WorldWideScience

Sample records for event-specific grading scale

  1. The effect of various grading scales on student grade point averages.

    Science.gov (United States)

    Barnes, Kelli D; Buring, Shauna M

    2012-04-10

    To investigate changes in and the impact of grading scales from 2005 to 2010 and explore pharmacy faculty and student perceptions of whole-letter and plus/minus grading scales on cumulative grade point averages (GPAs) in required courses. Grading scales used in 2010 at the University of Cincinnati College of Pharmacy were retrospectively identified and compared to those used in 2005. Mean GPA was calculated using a whole-letter grading scale and a plus/minus grading scale to determine the impact of scales on GPA. Faculty members and students were surveyed regarding their perceptions of plus/minus grading. Nine unique grading scales were used throughout the curriculum, including plus/minus (64%) and whole-letter (21%) grading scales. From 2005 to 2010 there was transition from use of predominantly whole-letter scales to plus/minus grading scales. The type of grading scale used did not affect the mean cumulative GPA. Students preferred use of a plus-only grading scale while faculty members preferred use of a plus/minus grading scale. The transition from whole-letter grading to plus/minus grading in courses from 2005 to 2010 reflects pharmacy faculty members' perception that plus/minus grading allows for better differentiation between students' performances.

  2. The Geological Grading Scale: Every million Points Counts!

    Science.gov (United States)

    Stegman, D. R.; Cooper, C. M.

    2006-12-01

    The concept of geological time, ranging from thousands to billions of years, is naturally quite difficult for students to grasp initially, as it is much longer than the timescales over which they experience everyday life. Moreover, universities operate on a few key timescales (hourly lectures, weekly assignments, mid-term examinations) to which students' maximum attention is focused, largely driven by graded assessment. The geological grading scale exploits the overwhelming interest students have in grades as an opportunity to instill familiarity with geological time. With the geological grading scale, the number of possible points/marks/grades available in the course is scaled to 4.5 billion points --- collapsing the entirety of Earth history into one semester. Alternatively, geological time can be compressed into each assignment, with scores for weekly homeworks not worth 100 points each, but 4.5 billion! Homeworks left incomplete with questions unanswered lose 100's of millions of points - equivalent to missing the Paleozoic era. The expected quality of presentation for problem sets can be established with great impact in the first week by docking assignments an insignificant amount points for handing in messy work; though likely more points than they've lost in their entire schooling history combined. Use this grading scale and your students will gradually begin to appreciate exactly how much time represents a geological blink of the eye.

  3. Interrater and intrarater reliability of the Knosp scale for pituitary adenoma grading.

    Science.gov (United States)

    Mooney, Michael A; Hardesty, Douglas A; Sheehy, John P; Bird, Robert; Chapple, Kristina; White, William L; Little, Andrew S

    2017-05-01

    OBJECTIVE The goal of this study was to determine the interrater and intrarater reliability of the Knosp grading scale for predicting pituitary adenoma cavernous sinus (CS) involvement. METHODS Six independent raters (3 neurosurgery residents, 2 pituitary surgeons, and 1 neuroradiologist) participated in the study. Each rater scored 50 unique pituitary MRI scans (with contrast) of biopsy-proven pituitary adenoma. Reliabilities for the full scale were determined 3 ways: 1) using all 50 scans, 2) using scans with midrange scores versus end scores, and 3) using a dichotomized scale that reflects common clinical practice. The performance of resident raters was compared with that of faculty raters to assess the influence of training level on reliability. RESULTS Overall, the interrater reliability of the Knosp scale was "strong" (0.73, 95% CI 0.56-0.84). However, the percent agreement for all 6 reviewers was only 10% (26% for faculty members, 30% for residents). The reliability of the middle scores (i.e., average rated Knosp Grades 1 and 2) was "very weak" (0.18, 95% CI -0.27 to 0.56) and the percent agreement for all reviewers was only 5%. When the scale was dichotomized into tumors unlikely to have intraoperative CS involvement (Grades 0, 1, and 2) and those likely to have CS involvement (Grades 3 and 4), the reliability was "strong" (0.60, 95% CI 0.39-0.75) and the percent agreement for all raters improved to 60%. There was no significant difference in reliability between residents and faculty (residents 0.72, 95% CI 0.55-0.83 vs faculty 0.73, 95% CI 0.56-0.84). Intrarater reliability was moderate to strong and increased with the level of experience. CONCLUSIONS Although these findings suggest that the Knosp grading scale has acceptable interrater reliability overall, it raises important questions about the "very weak" reliability of the scale's middle grades. By dichotomizing the scale into clinically useful groups, the authors were able to address the poor

  4. Grading Scale of Radiographic Findings in the Pubic Bone and Symphysis in Athletes

    International Nuclear Information System (INIS)

    Besjakov, J.; Scheele, C. von; Ekberg, O.; Gentz, C. F.; Westlin, N.E.

    2003-01-01

    Purpose: Radiographic abnormalities in the pubic bone and symphysis are often seen in athletes with groin pain. The aim was to create a grading scale of such radiologic changes. Material and Methods: Plain radiography of the pelvic ring including the pubic bone and the symphysis was performed in 20 male athletes, age 19-35, with long-standing uni- or bilateral groin pain. We used two control groups: Control group 1: 20 healthy age-matched men who had undergone radiologic examination of the pelvis due to trauma. Control group 2: 120 adults (66 men and 54 women) in 9 age groups between 15 and 90 years of age. These examinations were also evaluated for interobserver variance. Results and Conclusion: The grading scale was based on the type and the amount of the different changes, which were classified as follows: No bone changes (grade 0), slight bone changes (grade 1), intermediate changes (grade 2), and advanced changes (grade 3). The grading scale is easy to interpret and an otherwise troublesome communication between the radiologist and the physician was avoided. There was a high interobserver agreement with a high kappa value (0.8707). Male athletes with long-standing groin pain had abnormal bone changes in the symphysis significantly more frequently and more severely (p>0.001) than their age-matched references. In asymptomatic individuals such abnormalities increased in frequency with age both in men and women

  5. Fisher Grading Scale Associated with Language Disorders in Patients with Anterior Circulation Aneurysmal Subarachnoid Hemorrhage.

    Science.gov (United States)

    de Souza, Moysés Loiola Ponte; Vieira, Ana Cláudia C; Andrade, Gustavo; Quinino, Saul; de Fátima Leal Griz, Maria; Azevedo-Filho, Hildo R C

    2015-08-01

    To associate the presence of language deficits with varying scores of the Fisher grading scale in patients with subarachnoid hemorrhage in the period preceding the treatment of aneurysm in the anterior circulation, as well as to compare the scores of this scale, identifying the grades more associated with the decline of language. Database analysis of 185 preoperative evaluations of language, through the Montreal Toulouse Protocol Alpha version and verbal fluency through CERAD battery, of patients from "Hospital da Restauração" with aneurysmal subarachnoid hemorrhage, divided according to the Fisher grading scale (Fisher I, II, III, or IV) and compared with a control group of individuals considered normal. The various scores of the Fisher grading scale have different levels of language deficits, more pronounced as the amount of blood increases. Fisher III and IV scores are most associated with the decline of language. Our study made it possible to obtain information not yet available in the literature, by correlating the various scores of the Fisher grading scale with language yet in the period preceding treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. CT grading scales for splenic injury: why can't we agree?

    International Nuclear Information System (INIS)

    Clark, Rhys; Hird, Kathryn

    2011-01-01

    Full text: Computed tomography (CT) has been proven to be able to accurately diagnose splenic injury, Many have published CT splenic injury grading scales to quantify the extent of injury, However, these scales have failed at predicting clinical outcomes and therefore cannot be used to accu rately predict the need for intervention. We hypothesi sed that low interrater reliability is the reason why these scales have failed at predicting clinical outcomes. This is a retrospective study of patients who were admitted to the Royal Perth Hospital with blunt splenic injury as coded in the trauma registry, The abdominal CT images of these patients were reviewed by three consultant radiologists and were graded using the six different splenic injury grading scales. We assessed interrater reliability between each of the scales using generalised kappa and proportion of agreement calculations. Results: The images of 64 patients were reviewed. The interrater reliability yielded a generalised kappa score of 0.32-0,60 and proportion of agreement ranging from 34,4% to 65,5%, The six studied CT splenic injury grading scales did not have a high enough interrater reliability to be adequate for clinical use, The poor interrater reliability is likely to contribute to the failure of the scales at predicting clinical outcomes. Further research to improve the interrater reliability is recommended.

  7. Elementary School Student Burnout Scale for Grades 6-8: A Study of Validity and Reliability

    Science.gov (United States)

    Aypay, Ayse

    2011-01-01

    The purpose of this study is to develop an "Elementary School Student Burnout Scale for Grades 6-8". The study group included 691 students out of 10 schools in Eskisehir. Both Exploratory Factor Analysis and Confirmatory Factor Analysis were conducted on the data (Burnout stem from school activities, burnout stem from family, feeling of…

  8. Adaptation and validation of the Spanish version of the graded chronic pain scale.

    Science.gov (United States)

    Ferrer-Peña, Raúl; Gil-Martínez, Alfonso; Pardo-Montero, Joaquín; Jiménez-Penick, Virginia; Gallego-Izquierdo, Tomás; La Touche, Roy

    2016-01-01

    To adapt the Graded Chronic Pain Scale for use in Primary care patients in Spain, and to assess its psychometric properties. Clinical measures observational study investigating the severity of chronic pain. The methodology included a process of translation and back-translation following the international guidelines. Study participants were 75 patients who experienced lower back pain for more than six months and were sent to Primary Care physiotherapy units. Internal consistency, construct validity, test-retest reliability, floor and ceiling effects, and answering capacity were analysed. The Spanish version of the Graded Chronic Pain Scale had a high internal consistency, with a Cronbach's alpha of 0.87 and intraclass correlation coefficient of 0.81. Regarding construct validity, it was identified that two factors explained 72.37% of the variance. Convergent validity showed a moderate positive correlation with the Visual Analogue Scale, the activity avoidance subscale of the Tampa Scale of Kinesophobia, the Pain Catastrophizing Scale, the Roland-Morris Low Back Pain and Disability Questionnaire, and the FearAvoidance Beliefs Questionnaire. A moderate negative correlation was identified with the Chronic Pain Self-Efficacy Scale. The mean time of questionnaire administration was 2minutes and 28seconds. The Spanish version of the Graded Chronic Pain Scale appears to be a valid, reliable, and useful tool for measuring chronic pain at an early stage in Primary Care settings in Spain. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  9. Functionally graded hardmetals and cermets: preparation, performance and production scale up

    International Nuclear Information System (INIS)

    Dreyer, K.; Kassel, D.; Daub, H.-W.; Berg, H. van den; Lengauer, W.; Garcia, J.; Ucakar, V.

    2001-01-01

    Sintering experiments were carried out to establish graded microstructures in hardmetals and cermets. The formation of these microstructural features was investigated as a function of nitrogen pressure, sintering temperature, sintering period and sintering profile. The nitrogen pressure influences the formation of carbonitride layers at the surface. Decreasing sintering temperature yields similar results as increasing nitrogen pressure. Upon prolonged sintering time a small growth of the outer carbonitride layer can only be obtained if a substantial WC grain growth is accepted. Variation of the sintering profile after dense sintering does not principally change the type of the graded microstructure. The laboratory experiments were scaled up in an industrial sinter/HIP furnace and showing good correspondence with each other. First turning cutting tests with different alloys show excellent performance in comparison to ungraded materials. (author)

  10. Evaluation of novel scoring system named 5-5-5 exacerbation grading scale for allergic conjunctivitis disease.

    Science.gov (United States)

    Shoji, Jun; Inada, Noriko; Sawa, Mitsuru

    2009-12-01

    The objective of this study is to evaluate the practical usefulness of a scoring system using the 5-5-5 exacerbation grading scale for allergic conjunctivitis disease (ACD). Subjects were 103 patients with ACD including 40 patients with vernal keratoconjunctivitis (VKC), 20 patients with atopic keratoconjunctivitis (AKC), and 43 patients with allergic conjunctivitis (AC). The 5-5-5 exacerbation grading scale consists of the following 3 graded groups of clinical observations: the 100-point-grade group (100 points for each observation) includes active giant papillae, gelatinous infiltrates of the limbus, exfoliative epithelial keratopathy, shield ulcer and papillary proliferation at lower palpebral conjunctiva; the 10-point-grade group (10 points for each observation) includes blepharitis, papillary proliferation with velvety appearance, Horner-Trantas spots, edema of bulbal conjunctiva, and superficial punctate keratopathy; and the 1-point-grade group (1 point for each observation) includes papillae at upper palpebral conjunctiva, follicular lesion at lower palpebral conjunctiva, hyperemia of palpebral conjunctiva, hyperemia of bulbal conjunctiva, and lacrimal effusion. The total points in each grade group were determined as the severity score of the 5-5-5 exacerbation grading scale. The median severity scores of the 5-5-5 exacerbation grading scale in VKC, AKC and AC were 243 (range: 12-444), 32.5 (11-344), and 13 (2-33), respectively. The severity score of each ACD disease type was significantly different (P Kruskal-Wallis test). The severity of each type of ACD was classified as severe, moderate, or mild according to the severity score. The 5-5-5 exacerbation grading scale is a useful clinical tool for grading the severity of each type of ACD.

  11. Deep-UV patterning of commercial grade PMMA for low-cost, large-scale microfluidics

    International Nuclear Information System (INIS)

    Haiducu, M; Rahbar, M; Foulds, I G; Johnstone, R W; Sameoto, D; Parameswaran, M

    2008-01-01

    Although PMMA can be exposed using a variety of exposure sources, deep-UV at 254 nm is of interest because it is relatively inexpensive. Additionally, deep-UV sources can be readily scaled to large area exposures. Moreover, this paper will show that depths of over 100µm can be created in commercial grade PMMA using an uncollimated source. These depths are sufficient for creating microfluidic channels. This paper will provide measurements of the dissolution depth of commercial grade PMMA as a function of the exposure dose and etch time, using an IPA:H 2 O developer. Additionally, experiments were run to characterize the dependence of the dissolution rate on temperature and agitation. The patterned substrates were thermally bonded to blank PMMA pieces to enclose the channels and ports were drilled into the reservoirs. The resulting fluidic systems were then tested for leakage. The work herein presents the patterning, development and system behaviour of a complete microfluidics system based on commercial grade PMMA

  12. Validity and Reliability of Preschool, First and Second Grade Versions of Berkeley Parenting Self-Efficacy Scale

    Directory of Open Access Journals (Sweden)

    Shahrbanoo Tajeri

    2009-02-01

    Full Text Available "nObjective: The purpose of this study is to examine the factor structure, internal consistency, and construct validity of preschool, first and second grade versions of Berkeley Parenting self-efficacy scale. "nMethod:  The subjects were 317 mothers: (102 mothers of preschool children, 111 mothers of first grade children and 104 mothers of second grade children who were randomly selected from schools in Tehran. They completed Berkeley parenting self-efficacy and Rotter `s locus of control scales. Factor analysis using the principle component method was used to identify the factor structure of parenting self-efficacy scale. Cronbach`s alpha coefficient was used to identify the reliability of parenting self efficacy scale. "nResults: Results of this study indicated that the cronbach`s alpha coefficient was 0.84, 0.87, 0.64 for preschool, first grade and second grade versions respectively. Based on the scree test ,,factor analysis produced two factors of maternal strategy and child outcome, and it also produced the highest level of total variance explained by these 2 factors. The Parenting self-efficacy scale was negatively associated with measure of locus of control(r=-0.54 for the preschool version, -0.64 for the first grade version and -0.54 for the second grade version. "nConclusion: Due to relatively high reliability and validity of preschool, first and second grade versions of Berkeley Parenting Self-Efficacy scale, this scale could be used as a reliable and valid scale in other research areas

  13. A Novel Actinic Keratosis Field Assessment Scale for Grading Actinic Keratosis Disease Severity.

    Science.gov (United States)

    Dréno, Brigitte; Cerio, Rino; Dirschka, Thomas; Nart, Ignasi Figueras; Lear, John T; Peris, Ketty; de Casas, Andrés Ruiz; Kaleci, Shaniko; Pellacani, Giovanni

    2017-10-02

    Actinic keratosis (AK) lesions are surrounded by field cancerization (areas of subclinical, non-visible sun damage). Existing AK grading tools rely on AK counts, which are not reproducible. An Actinic Keratosis Field Assessment Scale (AK-FAS) for grading the severity of AK/field was developed. Standardized photographs of patients representing the full range of AK severity were collected. Six investigators independently rated each photograph according to 3 criteria: AK area (total skin area affected by AK lesions), hyperkeratosis and sun damage. Inter-rater reproducibility was good for all 3 criteria. Validation of the AK-FAS showed good reproducibility for AK area and hyperkeratosis, even for dermatologists untrained on use of the scale. In conclusion, the AK-FAS is objective, easy to use and implement, and reproducible. It incorporates assessment of the entire field affected by AK instead of relying on lesion counts. Use of the AK-FAS may standardize AK diagnosis, making it relevant to routine clinical practice.

  14. Manufacturing process scale-up of optical grade transparent spinel ceramic at ArmorLine Corporation

    Science.gov (United States)

    Spilman, Joseph; Voyles, John; Nick, Joseph; Shaffer, Lawrence

    2013-06-01

    While transparent Spinel ceramic's mechanical and optical characteristics are ideal for many Ultraviolet (UV), visible, Short-Wave Infrared (SWIR), Mid-Wave Infrared (MWIR), and multispectral sensor window applications, commercial adoption of the material has been hampered because the material has historically been available in relatively small sizes (one square foot per window or less), low volumes, unreliable supply, and with unreliable quality. Recent efforts, most notably by Technology Assessment and Transfer (TA and T), have scaled-up manufacturing processes and demonstrated the capability to produce larger windows on the order of two square feet, but with limited output not suitable for production type programs. ArmorLine Corporation licensed the hot-pressed Spinel manufacturing know-how of TA and T in 2009 with the goal of building the world's first dedicated full-scale Spinel production facility, enabling the supply of a reliable and sufficient volume of large Transparent Armor and Optical Grade Spinel plates. With over $20 million of private investment by J.F. Lehman and Company, ArmorLine has installed and commissioned the largest vacuum hot press in the world, the largest high-temperature/high-pressure hot isostatic press in the world, and supporting manufacturing processes within 75,000 square feet of manufacturing space. ArmorLine's equipment is capable of producing window blanks as large as 50" x 30" and the facility is capable of producing substantial volumes of material with its Lean configuration and 24/7 operation. Initial production capability was achieved in 2012. ArmorLine will discuss the challenges that were encountered during scale-up of the manufacturing processes, ArmorLine Optical Grade Spinel optical performance, and provide an overview of the facility and its capabilities.

  15. Comparison of gray-scale contrast-enhanced ultrasonography with contrast-enhanced computed tomography in different grading of blunt hepatic and splenic trauma: an animal experiment.

    Science.gov (United States)

    Tang, Jie; Li, Wenxiu; Lv, Faqin; Zhang, Huiqin; Zhang, Lihai; Wang, Yuexiang; Li, Junlai; Yang, Li

    2009-04-01

    To compare the diagnostic value of contrast-enhanced ultrasonography (CEUS) with contrast-enhanced computed tomography (CECT) for the detection of different grading of solid organ injuries in blunt abdominal trauma in animals. A self-made miniature tools were used as models to simulate a blunt hepatic or splenic trauma in 16 and 14 anesthetized dogs, respectively. Baseline ultrasound, CEUS and CECT were used to detect traumatic injuries of livers and spleens. The degree of injuries was determined by CEUS according to the American Association for the Surgery of Trauma (AAST) scale and the results compared with injury scale based on CECT evaluation. CEUS showed 22 hepatic injury sites in 16 animals and 17 splenic injury sites in other 14 animals. According to AAST scale, 2 grade I, 4 grade II, 3 grade III, 5 grade IV and 2 grade V hepatic lesions were present in 16 animals; 2 grade I, 4 grade II, 6 grade III and 2 grade IV splenic lesions in 14 animals. On CECT scan, 21 hepatic and 17 splenic injuries were demonstrated. According to Becker CT scaling for hepatic injury, 1 grade I, 2 grade II, 4 grade III, 5 grade IV and 2 grade V hepatic injuries were present. On the basis of Buntain spleen scaling, 2 grade I, 5 grade II, 5 grade III, 2 grade IV splenic injuries were showed. After Spearman rank correlation analysis, the agreement of CEUS with CECT on the degree of hepatic and splenic injury is 93.3% and 92.9%, respectively. CT is currently considered as the reference method for grading blunt abdominal trauma, according to experiment results, CEUS grading showed high levels of concordance with CECT. CEUS can accurately determine the degree of injury and will play an important role in clinical application.

  16. Modulation of Magnetic Properties at the Nanometer Scale in Continuously Graded Ferromagnets

    Directory of Open Access Journals (Sweden)

    Lorenzo Fallarino

    2018-02-01

    Full Text Available Ferromagnetic alloy materials with designed composition depth profiles provide an efficient route for the control of magnetism at the nanometer length scale. In this regard, cobalt-chromium and cobalt-ruthenium alloys constitute powerful model systems. They exhibit easy-to-tune magnetic properties such as saturation magnetization MS and Curie temperature TC while preserving their crystalline structure over a wide composition range. In order to demonstrate this materials design potential, we have grown a series of graded Co1−xCrx and Co1−wRuw (10 1 ¯ 0 epitaxial thin films, with x and w following predefined concentration profiles. Structural analysis measurements verify the epitaxial nature and crystallographic quality of our entire sample sets, which were designed to exhibit in-plane c-axis orientation and thus a magnetic in-plane easy axis to achieve suppression of magnetostatic domain generation. Temperature and field-dependent magnetic depth profiles have been measured by means of polarized neutron reflectometry. In both investigated structures, TC and MS are found to vary as a function of depth in accordance with the predefined compositional depth profiles. Our Co1−wRuw sample structures, which exhibit very steep material gradients, allow us to determine the localization limit for compositionally graded materials, which we find to be of the order of 1 nm. The Co1−xCrx systems show the expected U-shaped TC and MS depth profiles, for which these specific samples were designed. The corresponding temperature dependent magnetization profile is then utilized to control the coupling along the film depth, which even allows for a sharp onset of decoupling of top and bottom sample parts at elevated temperatures.

  17. Native American Students' Understanding of Geologic Time Scale: 4th-8th Grade Ojibwe Students' Understanding of Earth's Geologic History

    Science.gov (United States)

    Nam, Younkyeong; Karahan, Engin; Roehrig, Gillian

    2016-01-01

    Geologic time scale is a very important concept for understanding long-term earth system events such as climate change. This study examines forty-three 4th-8th grade Native American--particularly Ojibwe tribe--students' understanding of relative ordering and absolute time of Earth's significant geological and biological events. This study also…

  18. Correlation between Manchester Grading Scale and American Orthopaedic Foot and Ankle Society Score in Patients with Hallux Valgus

    Science.gov (United States)

    Iliou, Kalliopi; Paraskevas, George; Kanavaros, Panagiotis; Barbouti, Alexandra; Vrettakos, Aristidis; Gekas, Christos; Kitsoulis, Panagiotis

    2015-01-01

    Objective To evaluate the correlation between the Manchester Grading Scale and the American Orthopaedic Foot and Ankle Society (AOFAS) score in patients with a hallux valgus deformity. Subjects and Methods The study sample included 181 feet of 122 patients with hallux valgus and 424 feet of 212 individuals without hallux valgus deformity as the control group. The severity of hallux valgus, utilizing a relative nonmetric scale, the Manchester Grading Scale, and the metric AOFAS score, was determined for all individuals in the hallux valgus and control groups. SPSS version 18 (Chicago, Ill., USA) was used for data analysis. Results According to the Manchester Grading Scale, the 424 feet of the normal group were classified as ‘no deformity−. In the hallux valgus group, 85 feet were classified as ‘mild deformity−, 67 as ‘moderate deformity' and 29 as ‘severe deformity−. The AOFAS total score in the control group was 99.14. In the hallux valgus group, patients with mild or moderate deformity had total scores of 86.20 and 68.19, respectively. For those with severe hallux valgus, the total score was 44.69 and the differences were statistically significant (p = 0.000). Using the Pearson correlation, strong negative correlations were found between the AOFAS score and the hallux valgus angle (HVA; r = −0.899, p = 0.000). Strong negative correlations were demonstrated between the AOFAS score and the first intermetatarsal angle (IMA) as well (r = −0.748, p = 0.000). Conclusions The AOFAS score was negatively associated with the Manchester Grading Scale, HVA and first IMA. As the severity of hallux valgus increased, the AOFAS score seemed to decrease. PMID:26335050

  19. Validation of the new graded prognostic assessment scale for brain metastases: a multicenter prospective study

    International Nuclear Information System (INIS)

    Villà, Salvador; Verger, Eugènia; Balañà, Carme; Graus, Francesc; Weber, Damien C; Moretones, Cristina; Mañes, Anabel; Combescure, Christophe; Jové, Josep; Puyalto, Paloma; Cuadras, Patricia; Bruna, Jordi

    2011-01-01

    Prognostic indexes are useful to guide tailored treatment strategies for cancer patients with brain metastasis (BM). We evaluated the new Graded Prognostic Assessment (GPA) scale in a prospective validation study to compare it with two published prognostic indexes. A total of 285 newly diagnosed BM (n = 85 with synchronous BM) patients, accrued prospectively between 2000 and 2009, were included in this analysis. Mean age was 62 ± 12.0 years. The median KPS and number of BM was 70 (range, 20-100) and 3 (range, 1-50), respectively. The majority of primary tumours were lung (53%), or breast (17%) cancers. Treatment was administered to 255 (89.5%) patients. Only a minority of patients could be classified prospectively in a favourable prognostic class: GPA 3.5-4: 3.9%; recursive partitioning analysis (RPA) 1, 8.4% and Basic Score for BM (BSBM) 3, 9.1%. Mean follow-up (FU) time was 5.2 ± 4.7 months. During the period of FU, 225 (78.9%) patients died. The 6 months- and 1 year-OS was 36.9% and 17.6%, respectively. On multivariate analysis, performance status (P < 0.001), BSBM (P < 0.001), Center (P = 0.007), RPA (P = 0.02) and GPA (P = 0.03) were statistically significant for OS. The survival prediction performances' of all indexes were identical. Noteworthy, the significant OS difference observed within 3 months of diagnosis between the BSBM, RPA and GPA classes/groups was not observed after this cut-off time point. Harrell's concordance indexes C were 0.58, 0.61 and 0.58 for the GPA, BSBM and RPA, respectively. Our data suggest that the new GPA index is a valid prognostic index. In this prospective study, the prediction performance was as good as the BSBM or RPA systems. These published indexes may however have limited long term prognostication capability

  20. Colorimetric grading scale can promote the standardization of experiential and sensory evaluation in quality control of traditional Chinese medicines.

    Directory of Open Access Journals (Sweden)

    Jia-bo Wang

    Full Text Available Experiential and sensory evaluation is an ancient method that remains important in the current quality control system of Traditional Chinese Medicines (TCMs. The process is rapid and convenient when evaluating the quality of crude materials in TCM markets. However, sensory evaluation has been met with skepticism because it is mainly based on experience and lacks a scientific basis. In this study, rhubarb was selected to demonstrate how color-based sensory evaluation could differentiate the quality of herbal medicines objectively. The colors of the rhubarb samples, expressed as RGB values, were obtained from different parts and forms of the plant, including the plant's surface, fracture surface color, and a powdered form with or without treatment with a color-developing reagent. We first divided the rhubarb samples into three grades based on the total content of five hydroxyanthraquinone derivatives, the major pharmacological components in rhubarb. Then, a three-layer back-propagation artificial neural network (BP-ANN, calibrated with selected training samples, was used to correlate the quality of the rhubarb with its color. The color of the rhubarb powder after coloration attained the highest accuracy (92.3% in predicting the quality grade of the test samples with the established artificial neural networks. Finally, a standardized colorimetric grading scale was created based on the spatial distribution of the rhubarb samples in a two-dimensional chromaticity diagram according to the colors of the powdered rhubarb after color enhancement. By comparing the color between the scale and the tested samples, similar to performing a pH test with indicator paper, subjects without sensory evaluation experience could quickly determine the quality grade of rhubarb. This work illustrates the technical feasibility of the color-based grading of rhubarb quality and offers references for quantifying and standardizing the sensory evaluation of TCMs, foods and

  1. Low relative error in consumer-grade GPS units make them ideal for measuring small-scale animal movement patterns

    Directory of Open Access Journals (Sweden)

    Greg A. Breed

    2015-08-01

    Full Text Available Consumer-grade GPS units are a staple of modern field ecology, but the relatively large error radii reported by manufacturers (up to 10 m ostensibly precludes their utility in measuring fine-scale movement of small animals such as insects. Here we demonstrate that for data collected at fine spatio-temporal scales, these devices can produce exceptionally accurate data on step-length and movement patterns of small animals. With an understanding of the properties of GPS error and how it arises, it is possible, using a simple field protocol, to use consumer grade GPS units to collect step-length data for the movement of small animals that introduces a median error as small as 11 cm. These small error rates were measured in controlled observations of real butterfly movement. Similar conclusions were reached using a ground-truth test track prepared with a field tape and compass and subsequently measured 20 times using the same methodology as the butterfly tracking. Median error in the ground-truth track was slightly higher than the field data, mostly between 20 and 30 cm, but even for the smallest ground-truth step (70 cm, this is still a signal-to-noise ratio of 3:1, and for steps of 3 m or more, the ratio is greater than 10:1. Such small errors relative to the movements being measured make these inexpensive units useful for measuring insect and other small animal movements on small to intermediate scales with budgets orders of magnitude lower than survey-grade units used in past studies. As an additional advantage, these units are simpler to operate, and insect or other small animal trackways can be collected more quickly than either survey-grade units or more traditional ruler/gird approaches.

  2. Large-scale computations on histology images reveal grade-differentiating parameters for breast cancer

    Directory of Open Access Journals (Sweden)

    Katsinis Constantine

    2006-10-01

    Full Text Available Abstract Background Tumor classification is inexact and largely dependent on the qualitative pathological examination of the images of the tumor tissue slides. In this study, our aim was to develop an automated computational method to classify Hematoxylin and Eosin (H&E stained tissue sections based on cancer tissue texture features. Methods Image processing of histology slide images was used to detect and identify adipose tissue, extracellular matrix, morphologically distinct cell nuclei types, and the tubular architecture. The texture parameters derived from image analysis were then applied to classify images in a supervised classification scheme using histologic grade of a testing set as guidance. Results The histologic grade assigned by pathologists to invasive breast carcinoma images strongly correlated with both the presence and extent of cell nuclei with dispersed chromatin and the architecture, specifically the extent of presence of tubular cross sections. The two parameters that differentiated tumor grade found in this study were (1 the number density of cell nuclei with dispersed chromatin and (2 the number density of tubular cross sections identified through image processing as white blobs that were surrounded by a continuous string of cell nuclei. Classification based on subdivisions of a whole slide image containing a high concentration of cancer cell nuclei consistently agreed with the grade classification of the entire slide. Conclusion The automated image analysis and classification presented in this study demonstrate the feasibility of developing clinically relevant classification of histology images based on micro- texture. This method provides pathologists an invaluable quantitative tool for evaluation of the components of the Nottingham system for breast tumor grading and avoid intra-observer variability thus increasing the consistency of the decision-making process.

  3. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  4. On the path of a crack near a graded interface under large scale yielding

    DEFF Research Database (Denmark)

    Rashid, M. M.; Tvergaard, Viggo

    2003-01-01

    The trajectory of a crack lying parallel to a thin graded layer between two plastically dissimilar materials is studied using the exclusion region (ER) theory of fracture. The ER theory is a theoretical framework for surface separation within which a broad range of fracture phenomenologies can...... be represented. In the present study, the direction of crack advance is determined by maximizing the resolved normal-opening force on the near-tip region, whereas separation itself is governed by the intensity of plastic deformation near the tip. A computational study was undertaken using the ER theory....... The special-purpose finite element analysis platform accommodates arbitrary-and a priori unknown-crack trajectories. The model problem considered herein involves two plastically dissimilar, but elastically identical, materials joined by a thin, graded interface layer. The initial crack lies parallel...

  5. GRADING SCALE OF VISCERAL ADIPOSE TISSUE THICKNESS AND THEIR RELATION TO THE NONALCOHOLIC FATTY LIVER DISEASE

    Directory of Open Access Journals (Sweden)

    Luís Jesuino de Oliveira ANDRADE

    2014-04-01

    Full Text Available Context The mesenteric fat is drained by the portal system, being related to the metabolic syndrome which is an impor­tant risk factor for non-alcoholic fatty liver disease (NAFLD. Objectives Graduate of visceral fat thickness and correlate with the NAFLD degree through ultrasonography method. Methods We studied 352 subjects for age, gender, measures of subcutaneous fat thickness and visceral fat thickness as well as the presence and degree of liver fatty. Was analyzed the independent relationship between visceral fat thickness and NAFLD, and linear regression analysis was used in order to predict the visceral fat thickness from subcutaneous fat thickness. Results The mean age of 225 women (63.9% and 127 men (36.1% was 47.5 ± 14.0 (18-77 years, 255 subjects had normal examinations, 97 had NAFLD thus distributed, 37 grade 1, 32 grade 2, and 28 grade 3. The subcutaneous fat thickness ranged from 0.26 to 3.50 cm with a mean of 1.3 ± 0.6 cm and visceral fat thickness ranged from 0.83 to 8.86 cm with a mean of 3.6 ± 1.7 cm. Linear regression showed that for every increase of 1 cm in subcutaneous fat thickness the visceral fat thickness will increase 0.9 cm. Conclusions The visceral fat thickness measured by ultrasonography is a useful and seems to be able to help estimate the risk of NAFLD.

  6. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    Science.gov (United States)

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  7. Evaluation of gastric biopsies in chronic gastritis: Grading of inflammation by Visual Analogue Scale

    Directory of Open Access Journals (Sweden)

    Sonam Pruthi

    2014-01-01

    Full Text Available Introduction: Gastritis is a common condition with many etiologies and the classification of the same poses a great challenge to the pathologist. Aim: This study was undertaken to classify gastritis according to the Sydney system guidelines including graded and non-graded variables and simultaneously find association of Helicobacter pylori (H. pylori with each of these variables. Materials and Methods: A total of 100 biopsies of chronic superficial gastritis received over a period of two years were studied, prospectively. Histology was evaluated with Hematoxylin and eosin, and Giemsa stains, and Gomori′s staining method for demonstration of reticulin fibres. Rapid Urease test results obtained from gastroenterology department were compared with histopathology. Chi-square test was used to analyze the correlation between the various variables. Results: Gastritis cases showed a male preponderance and the most common presenting complaint was dyspepsia. H. pylori gastritis usually shows increased neutrophilic activity but can also present with increased mononuclear inflammatory infiltrate and lymphoid follicles in chronic gastritis. Intestinal metaplasia and atrophy indicates the chronicity of the disease. H. pylori were noted in the areas away from the metaplastic gastric epithelium. Conclusion: The study showed that histopathology is the most sensitive test for diagnosing H. pylori on endoscopic biopsies. Though, rapid urease test kit gives gastroenterologist a rapid diagnosis, its specificity is low, and hence should be combined with histopathology, which is the gold standard for diagnosis.

  8. Validity of the Braden Scale in grading pressure ulcers in trauma and burn patients.

    Science.gov (United States)

    Griswold, Lauren H; Griffin, Russell L; Swain, Thomas; Kerby, Jeffrey D

    2017-11-01

    Pressure ulcers are a costly hospital-acquired condition in terms of clinical outcome and expense. The Braden Scale was developed in 1987 as a risk scoring method for pressure ulcers and uses six different risk factors: sensory perception, moisture, activity, mobility, nutrition, and friction and shear. A score of ≤18 is considered high risk. To date, research on the utility of the Braden Scale has focused on general medicine and nontrauma/burn surgery patients. We hypothesize that the Braden Scale does not accurately discriminate who will get a pressure ulcer among trauma and burn patients. We collected data from medical records regarding documented Braden scores and presence of pressure ulcers regardless of staging. Patients with ulcers present on admission were excluded from analysis. For each patient, the lowest Braden score documented before the occurrence of the pressure ulcer was determined. A logistic regression was used to estimate odds ratios and associated 95% confidence intervals for the association between pressure ulcer likelihood and lowest Braden Scale measurement. To determine the discriminatory ability of the Braden Scale on pressure ulcer risk, four measures of performance (i.e., sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio) were calculated for four nonmutually exclusive groups: a Braden Scale measurement ≤18, ≤14, ≤12, and ≤9. From 2011 through 2014, a total of 2660 patients were admitted to the trauma/burn intensive care unit. Of these patients, 63 (2.3%) subsequently developed a pressure ulcer. A Braden Scale of ≤18 as the threshold for being at-risk of pressure ulcer had a sensitivity of 100% and specificity of 6%, whereas a Braden Scale of ≤9 had a sensitivity of 28.6% and a specificity of 90%. For all Braden Scale measurements, the positive likelihood ratio never reached the value of 10 that suggests high likelihood of an ulcer. The Braden scale has mediocre discriminatory ability among

  9. Enhancement of struvite pellets crystallization in a full-scale plant using an industrial grade magnesium product.

    Science.gov (United States)

    Crutchik, D; Morales, N; Vázquez-Padín, J R; Garrido, J M

    2017-02-01

    A full-scale struvite crystallization system was operated for the treatment of the centrate obtained from the sludge anaerobic digester in a municipal wastewater treatment plant. Additionally, the feasibility of an industrial grade Mg(OH) 2 as a cheap magnesium and alkali source was also investigated. The struvite crystallization plant was operated for two different periods: period I, in which an influent with low phosphate concentration (34.0 mg P·L -1 ) was fed to the crystallization plant; and period II, in which an influent with higher phosphate concentration (68.0 mg P·L -1 ) was used. A high efficiency of phosphorus recovery by struvite crystallization was obtained, even when the effluent treated had a high level of alkalinity. Phosphorus recovery percentage was around 77%, with a phosphate concentration in the effluent between 10.0 and 30.0 mg P·L -1 . The experiments gained struvite pellets of 0.5-5.0 mm size. Moreover, the consumption of Mg(OH) 2 was estimated at 1.5 mol Mg added·mol P recovered -1 . Thus, industrial grade Mg(OH) 2 can be an economical alternative as magnesium and alkali sources for struvite crystallization at industrial scale.

  10. Historical perspective on the use of visual grading scales in evaluating skin irritation and sensitization

    DEFF Research Database (Denmark)

    Farage, Miranda A; Maibach, Howard I; Andersen, Klaus Ejner

    2011-01-01

    quality in comparison with current testing methods that rely on visual assessment. In addition, such measuring techniques can add considerably to the complexity of testing protocols. When benefits and cost are weighed in the balance, the visual assessment scales popularized by Draize and others remain...

  11. Multidimensionality of Teachers' Graded Responses for Preschoolers' Stylistic Learning Behavior: The Learning-to-Learn Scales

    Science.gov (United States)

    McDermott, Paul A.; Fantuzzo, John W.; Warley, Heather P.; Waterman, Clare; Angelo, Lauren E.; Gadsden, Vivian L.; Sekino, Yumiko

    2011-01-01

    Assessment of preschool learning behavior has become very popular as a mechanism to inform cognitive development and promote successful interventions. The most widely used measures offer sound predictions but distinguish only a few types of stylistic learning and lack sensitive growth detection. The Learning-to-Learn Scales was designed to…

  12. Realizing Large-Scale, Electronic-Grade Two-Dimensional Semiconductors.

    Science.gov (United States)

    Lin, Yu-Chuan; Jariwala, Bhakti; Bersch, Brian M; Xu, Ke; Nie, Yifan; Wang, Baoming; Eichfeld, Sarah M; Zhang, Xiaotian; Choudhury, Tanushree H; Pan, Yi; Addou, Rafik; Smyth, Christopher M; Li, Jun; Zhang, Kehao; Haque, M Aman; Fölsch, Stefan; Feenstra, Randall M; Wallace, Robert M; Cho, Kyeongjae; Fullerton-Shirey, Susan K; Redwing, Joan M; Robinson, Joshua A

    2018-02-27

    Atomically thin transition metal dichalcogenides (TMDs) are of interest for next-generation electronics and optoelectronics. Here, we demonstrate device-ready synthetic tungsten diselenide (WSe 2 ) via metal-organic chemical vapor deposition and provide key insights into the phenomena that control the properties of large-area, epitaxial TMDs. When epitaxy is achieved, the sapphire surface reconstructs, leading to strong 2D/3D (i.e., TMD/substrate) interactions that impact carrier transport. Furthermore, we demonstrate that substrate step edges are a major source of carrier doping and scattering. Even with 2D/3D coupling, transistors utilizing transfer-free epitaxial WSe 2 /sapphire exhibit ambipolar behavior with excellent on/off ratios (∼10 7 ), high current density (1-10 μA·μm -1 ), and good field-effect transistor mobility (∼30 cm 2 ·V -1 ·s -1 ) at room temperature. This work establishes that realization of electronic-grade epitaxial TMDs must consider the impact of the TMD precursors, substrate, and the 2D/3D interface as leading factors in electronic performance.

  13. A novel iris transillumination grading scale allowing flexible assessment with quantitative image analysis and visual matching.

    Science.gov (United States)

    Wang, Chen; Brancusi, Flavia; Valivullah, Zaheer M; Anderson, Michael G; Cunningham, Denise; Hedberg-Buenz, Adam; Power, Bradley; Simeonov, Dimitre; Gahl, William A; Zein, Wadih M; Adams, David R; Brooks, Brian

    2018-01-01

    To develop a sensitive scale of iris transillumination suitable for clinical and research use, with the capability of either quantitative analysis or visual matching of images. Iris transillumination photographic images were used from 70 study subjects with ocular or oculocutaneous albinism. Subjects represented a broad range of ocular pigmentation. A subset of images was subjected to image analysis and ranking by both expert and nonexpert reviewers. Quantitative ordering of images was compared with ordering by visual inspection. Images were binned to establish an 8-point scale. Ranking consistency was evaluated using the Kendall rank correlation coefficient (Kendall's tau). Visual ranking results were assessed using Kendall's coefficient of concordance (Kendall's W) analysis. There was a high degree of correlation among the image analysis, expert-based and non-expert-based image rankings. Pairwise comparisons of the quantitative ranking with each reviewer generated an average Kendall's tau of 0.83 ± 0.04 (SD). Inter-rater correlation was also high with Kendall's W of 0.96, 0.95, and 0.95 for nonexpert, expert, and all reviewers, respectively. The current standard for assessing iris transillumination is expert assessment of clinical exam findings. We adapted an image-analysis technique to generate quantitative transillumination values. Quantitative ranking was shown to be highly similar to a ranking produced by both expert and nonexpert reviewers. This finding suggests that the image characteristics used to quantify iris transillumination do not require expert interpretation. Inter-rater rankings were also highly similar, suggesting that varied methods of transillumination ranking are robust in terms of producing reproducible results.

  14. Concordance between the chang and the International Society of Pediatric Oncology (SIOP) ototoxicity grading scales in patients treated with cisplatin for medulloblastoma.

    Science.gov (United States)

    Bass, Johnnie K; Huang, Jie; Onar-Thomas, Arzu; Chang, Kay W; Bhagat, Shaum P; Chintagumpala, Murali; Bartels, Ute; Gururangan, Sridharan; Hassall, Tim; Heath, John A; McCowage, Geoffrey; Cohn, Richard J; Fisher, Michael J; Robinson, Giles; Broniscer, Alberto; Gajjar, Amar; Gurney, James G

    2014-04-01

    Reporting ototoxicity is frequently complicated by use of various ototoxicity criteria. The International Society of Pediatric Oncology (SIOP) ototoxicity grading scale was recently proposed for standardized use in reporting hearing loss outcomes across institutions. The aim of this study was to evaluate the concordance between the Chang and SIOP ototoxicity grading scales. Differences between the two scales were identified and the implications these differences may have in the clinical setting were discussed. Audiological evaluations were reviewed for 379 patients with newly diagnosed medulloblastoma (ages 3-21 years). Each patient was enrolled on one of two St. Jude clinical protocols that included craniospinal radiation therapy and four courses of 75 mg/m(2) cisplatin chemotherapy. The latest audiogram conducted 5.5-24.5 months post-protocol treatment initiation was graded using the Chang and SIOP ototoxicity criteria. Clinically significant hearing loss was defined as Chang grade ≥2a and SIOP ≥2. Hearing loss was considered serious (requiring a hearing aid) at the level of Chang grade ≥2b and SIOP ≥3. A strong concordance was observed between the Chang and SIOP ototoxicity scales (Stuart's tau-c statistic = 0.89, 95% CI: 0.86, 0.91). Among those patients diagnosed with serious hearing loss, the two scales were in good agreement. However, the scales deviated from one another in classifying patients with less serious or no hearing loss. Although discrepancies between the Chang and SIOP ototoxicity scales exist primarily for patients with no or minimal hearing loss, the scales share a strong concordance overall. © 2013 Wiley Periodicals, Inc.

  15. easyCBM CCSS Math Item Scaling and Test Form Revision (2012-2013): Grades 6-8. Technical Report #1313

    Science.gov (United States)

    Anderson, Daniel; Alonzo, Julie; Tindal, Gerald

    2012-01-01

    The purpose of this technical report is to document the piloting and scaling of new easyCBM mathematics test items aligned with the Common Core State Standards (CCSS) and to describe the process used to revise and supplement the 2012 research version easyCBM CCSS math tests in Grades 6-8. For all operational 2012 research version test forms (10…

  16. Concurrently examining unrealistic absolute and comparative optimism: Temporal shifts, individual-difference and event-specific correlates, and behavioural outcomes.

    Science.gov (United States)

    Ruthig, Joelle C; Gamblin, Bradlee W; Jones, Kelly; Vanderzanden, Karen; Kehn, Andre

    2017-02-01

    Researchers have spent considerable effort examining unrealistic absolute optimism and unrealistic comparative optimism, yet there is a lack of research exploring them concurrently. This longitudinal study repeatedly assessed unrealistic absolute and comparative optimism within a performance context over several months to identify the degree to which they shift as a function of proximity to performance and performance feedback, their associations with global individual difference and event-specific factors, and their link to subsequent behavioural outcomes. Results showed similar shifts in unrealistic absolute and comparative optimism based on proximity to performance and performance feedback. Moreover, increases in both types of unrealistic optimism were associated with better subsequent performance beyond the effect of prior performance. However, several differences were found between the two forms of unrealistic optimism in their associations with global individual difference factors and event-specific factors, highlighting the distinctiveness of the two constructs. © 2016 The British Psychological Society.

  17. Comparative evaluation of H&H and WFNS grading scales with modified H&H (sans systemic disease): A study on 1000 patients with subarachnoid hemorrhage.

    Science.gov (United States)

    Aggarwal, Ashish; Dhandapani, Sivashanmugam; Praneeth, Kokkula; Sodhi, Harsimrat Bir Singh; Pal, Sudhir Singh; Gaudihalli, Sachin; Khandelwal, N; Mukherjee, Kanchan K; Tewari, M K; Gupta, Sunil Kumar; Mathuriya, S N

    2018-01-01

    The comparative studies on grading in subarachnoid hemorrhage (SAH) had several limitations such as the unclear grading of Glasgow Coma Scale 15 with neurological deficits in World Federation of Neurosurgical Societies (WFNS), and the inclusion of systemic disease in Hunt and Hess (H&H) scales. Their differential incremental impacts and optimum cut-off values for unfavourable outcome are unsettled. This is a prospective comparison of prognostic impacts of grading schemes to address these issues. SAH patients were assessed using WFNS, H&H (including systemic disease), modified H&H (sans systemic disease) and followed up with Glasgow Outcome Score (GOS) at 3 months. Their performance characteristics were analysed as incremental ordinal variables and different grading scale dichotomies using rank-order correlation, sensitivity, specificity, positive predictive value, negative predictive value, Youden's J and multivariate analyses. A total of 1016 patients were studied. As univariate incremental variable, H&H sans systemic disease had the best negative rank-order correlation coefficient (-0.453) with respect to lower GOS (p H&H sans systemic disease had the greatest adjusted incremental impact of 0.72 (95% confidence interval (CI) 0.54-0.91) against a lower GOS as compared to 0.6 (95% CI 0.45-0.74) and 0.55 (95% CI 0.42-0.68) for H&H and WFNS grades, respectively. In multivariate categorical analysis, H&H grades 4-5 sans systemic disease had the greatest impact on unfavourable GOS with an adjusted odds ratio of 6.06 (95% CI 3.94-9.32). To conclude, H&H grading sans systemic disease had the greatest impact on unfavourable GOS. Though systemic disease is an important prognostic factor, it should be considered distinctly from grading. Appropriate cut-off values suggesting unfavourable outcome for H&H and WFNS were 4-5 and 3-5, respectively, indicating the importance of neurological deficits in addition to level of consciousness.

  18. Predictors of extended length of stay, discharge to inpatient rehab, and hospital readmission following elective lumbar spine surgery: introduction of the Carolina-Semmes Grading Scale.

    Science.gov (United States)

    McGirt, Matthew J; Parker, Scott L; Chotai, Silky; Pfortmiller, Deborah; Sorenson, Jeffrey M; Foley, Kevin; Asher, Anthony L

    2017-10-01

    OBJECTIVE Extended hospital length of stay (LOS), unplanned hospital readmission, and need for inpatient rehabilitation after elective spine surgery contribute significantly to the variation in surgical health care costs. As novel payment models shift the risk of cost overruns from payers to providers, understanding patient-level risk of LOS, readmission, and inpatient rehabilitation is critical. The authors set out to develop a grading scale that effectively stratifies risk of these costly events after elective surgery for degenerative lumbar pathologies. METHODS The Quality and Outcomes Database (QOD) registry prospectively enrolls patients undergoing surgery for degenerative lumbar spine disease. This registry was queried for patients who had undergone elective 1- to 3-level lumbar surgery for degenerative spine pathology. The association between preoperative patient variables and extended postoperative hospital LOS (LOS ≥ 7 days), discharge status (inpatient facility vs home), and 90-day hospital readmission was assessed using stepwise multivariate logistic regression. The Carolina-Semmes grading scale was constructed using the independent predictors for LOS (0-12 points), discharge to inpatient facility (0-18 points), and 90-day readmission (0-6 points), and its performance was assessed using the QOD data set. The performance of the grading scale was then confirmed separately after using it in 2 separate neurosurgery practice sites (Carolina Neurosurgery & Spine Associates [CNSA] and Semmes Murphey Clinic). RESULTS A total of 6921 patients were analyzed. Overall, 290 (4.2%) patients required extended LOS, 654 (9.4%) required inpatient facility care/rehabilitation on hospital discharge, and 474 (6.8%) were readmitted to the hospital within 90 days postdischarge. Variables that remained as independently associated with these unplanned events in multivariate analysis included age ≥ 70 years, American Society of Anesthesiologists Physical Classification System

  19. Psychometric properties of scales used for grading the severity of bronchial obstruction in pediatrics: A systematic review and meta-analysis.

    Science.gov (United States)

    Luarte-Martínez, Soledad; Rodríguez-Núñez, Iván; Astudillo, Paula; Manterola, Carlos

    2017-06-01

    In pediatrics, identifying the severity of bronchial obstruction in an early manner is a decisive factor. To assess the psychometric properties of the scales for grading the severity of bronchial obstruction in pediatric patients. This was a systematic review of studies on the validity and reliability of scales for grading the severity of bronchial obstruction conducted in infants and children younger than 3 years old. The search was conducted in Medline, WoS, EMBASE, SciELO, and Google Scholar. The correlation coefficient corresponding to each article was included in a random effects model to establish the criterion validity and reliability using the weighted averages of coefficients as per the sample size. A total of 9 articles were included, which accounted for 2699 children; 3 articles had an adequate or excellent methodological quality. Four articles established the concurrent criterion validity considering oxygen saturation, with a weighted correlation coefficient of -0.627 (95% confidence interval [CI]: -0.767 to -0.431, p reliability, with a weighted correlation coefficient of0.500for kappa and 0.891 for the intraclass correlation coefficient. The assessment of psychometric properties to support the use of scales for grading the construct "severity of bronchial obstruction" showed a moderate to adequate criterion validity. The percentage of agreement among observers in terms of the studied measure (severity of bronchial obstruction) was adequate; however, weaknesses such as the article design should be taken into account since it may affect the internal validity of results.

  20. The Hijdra scale has significant prognostic value for the functional outcome of Fisher grade 3 patients with subarachnoid hemorrhage.

    Science.gov (United States)

    Bretz, Julia S; Von Dincklage, Falk; Woitzik, Johannes; Winkler, Maren K L; Major, Sebastian; Dreier, Jens P; Bohner, Georg; Scheel, Michael

    2017-09-01

    Despite its high prevalence among patients with aneurysmal subarachnoid hemorrhage (aSAH) and high risk of delayed cerebral ischemia (DCI), the Fisher grade 3 category remains a poorly studied subgroup. The aim of this cohort study has been to investigate the prognostic value of the Hijdra sum scoring system for the functional outcome in patients with Fisher grade 3 aSAH, in order to improve the risk stratification within this Fisher category. Initial CT scans of 72 prospectively enrolled patients with Fisher grade 3 aSAH were analyzed, and cisternal, ventricular, and total amount of blood were graded according to the Hijdra scale. Additionally, space-occupying subarachnoid blood clots were assessed. Outcome was evaluated after 6 months. Within the subgroup of Fisher grade 3, aSAH patients with an unfavorable outcome showed a significantly larger cisternal Hijdra sum score (HSS: 21.1 ± 5.2) than patients with a favorable outcome (HSS: 17.6 ± 5.9; p = 0.009). However, both the amount of ventricular blood (p = 0.165) and space-occupying blood clots (p = 0.206) appeared to have no prognostic relevance. After adjusting for the patient's age, gender, tobacco use, clinical status at admission, and presence of intracerebral hemorrhage, the cisternal and total HSS remained the only independent parameters included in multivariate logistic regression models to predict functional outcome (p Fisher 3 category. We suggest that the Hijdra scale is a practically useful prognostic instrument for the risk evaluation after aSAH and should be applied more often in the clinical setting.

  1. Attachment avoidance, alexithymia, and gender: Examining their associations with distress disclosure tendencies and event-specific disclosure.

    Science.gov (United States)

    O'Loughlin, Julia I; Cox, Daniel W; Kahn, Jeffrey H; Wu, Amery D

    2018-01-01

    Distress disclosure has been linked with reduced psychological distress, increased wellbeing, and successful psychotherapeutic outcome. Because of the importance of distress disclosure, researchers have worked to develop and improve theoretical models of disclosure to facilitate counseling practices that reduce impediments to disclosure. Presently, we conducted a 2-part study to investigate distress disclosure's associations with attachment avoidance, gender, and alexithymia-3 constructs frequently linked with disclosure. In Part 1, we examined the extent to which attachment avoidance, alexithymia, and gender predicted general disclosure tendencies. In Part 2, we examined the extent to which attachment avoidance, alexithymia, and gender predicted event-specific disclosure. Participants were recruited from a crowdsourcing website (N = 178 in Part 1; N = 108 in Part 2). In Part 1, alexithymia partially mediated the association between attachment avoidance and disclosure tendencies, and the link between attachment avoidance and alexithymia was stronger for men than women. In Part 2, the association between distress intensity and event-specific disclosure was weaker for people with high levels of alexithymia. Implications for counseling theory and practice are discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  2. Do pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out?

    DEFF Research Database (Denmark)

    Østergaard, Jeanette; Skov, Peter Rohde

    2014-01-01

    Introduction and Aims Young people drinking heavily before going out to bars and clubs is associated with alcohol-related harm and therefore of great public concern. This study examines whether pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out in England...... demographics, socioeconomic status, frequency of intoxication and alcohol unit intake before and during the young people's night out. Results A mixed linear model performed on the panel mobile survey shows that pre-drinkers in England and Denmark consume 9.185 (P ..., respectively, more than the non-pre-drinkers. However, in both countries pre-drinkers consume 3.430 (P alcohol on-premises than the non-pre-drinkers. Discussion and Conclusion Pre-drinking is a widespread phenomenon in England and Denmark, with more than half of young...

  3. Background Predictors and Event-Specific Characteristics of Sexual Aggression Incidents: The Roles of Alcohol and Other Factors.

    Science.gov (United States)

    Davis, Kelly Cue; Danube, Cinnamon L; Stappenbeck, Cynthia A; Norris, Jeanette; George, William H

    2015-08-01

    Sexual assault in the United States is an important public health concern. Using prospective longitudinal methods and responses from 217 community men, we examined whether background characteristics predicted subsequent sexual aggression (SA) perpetration during a 3-month follow-up period. We also examined event-specific characteristics of reported SA occurrences. Consistent with predictions, SA perpetration history, aggressive and impulsive personality traits, rape myth attitudes, and alcohol expectancies predicted SA (both non- and alcohol-involved) at follow-up. In addition, alcohol-involved assaults occurred more often with casual (vs. steady) partners but were more likely to involve condom use with casual (vs. steady) partners. Results suggest important avenues for future research and SA prevention efforts. © The Author(s) 2015.

  4. Scale-dependent effects on wave propagation in magnetically affected single/double-layered compositionally graded nanosize beams

    Science.gov (United States)

    Ebrahimi, Farzad; Barati, Mohammad Reza

    2018-04-01

    This article deals with the wave propagation analysis of single/double layered functionally graded (FG) size-dependent nanobeams in elastic medium and subjected to a longitudinal magnetic field employing nonlocal elasticity theory. Material properties of nanobeam change gradually according to the sigmoid function. Applying an analytical solution, the acoustical and optical dispersion relations are explored for various wave number, nonlocality parameter, material composition, elastic foundation constants, and magnetic field intensity. It is found that frequency and phase velocity of waves propagating in S-FGM nanobeam are significantly affected by these parameters. Also, presence of cut-off and escape frequencies in wave propagation analysis of embedded S-FGM nanobeams is investigated.

  5. Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

    Science.gov (United States)

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2017-07-01

    One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Development and validation of an event-specific quantitative PCR method for genetically modified maize MIR162.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2014-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.

  7. Quality of School Life Scale: Means, Variances, Reliabilities, and Factor Analysis for Grades 10, 11, and 12.

    Science.gov (United States)

    Nimmer, Donald N.

    1979-01-01

    The Quality of School Life Scale (QLS) is an instrument designed to measure students' perceptions of their school experiences. Such an instrument may aid educators in evaluating students' perceptions in the three areas identified by the QSL: satisfaction, commitment to classwork, and reactions to teachers. (Author)

  8. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    Science.gov (United States)

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  9. Low Interrater Reliability in Grading of Rectal Bleeding Using National Cancer Institute Common Toxicity Criteria and Radiation Therapy Oncology Group Toxicity Scales: A Survey of Radiation Oncologists

    International Nuclear Information System (INIS)

    Huynh-Le, Minh-Phuong; Zhang, Zhe; Tran, Phuoc T.; DeWeese, Theodore L.; Song, Daniel Y.

    2014-01-01

    Purpose: To measure concordance among genitourinary radiation oncologists in using the National Cancer Institute Common Toxicity Criteria (NCI CTC) and Radiation Therapy Oncology Group (RTOG) grading scales to grade rectal bleeding. Methods and Materials: From June 2013 to January 2014, a Web-based survey was sent to 250 American and Canadian academic radiation oncologists who treat prostate cancer. Participants were provided 4 case vignettes in which patients received radiation therapy and developed rectal bleeding and were asked for management plans and to rate the bleeding according to NCI CTC v.4 and RTOG late toxicity grading (scales provided). In 2 cases, participants were also asked whether they would send the patient for colonoscopy. A multilevel, random intercept modeling approach was used to assess sources of variation (case, respondent) in toxicity grading to calculate the intraclass correlation coefficient (ICC). Agreement on a dichotomous grading scale (low grades 1-2 vs high grades 3-4) was also assessed, using the κ statistic for multiple respondents. Results: Seventy-two radiation oncologists (28%) completed the survey. Forty-seven (65%) reported having either written or been principal investigator on a study using these scales. Agreement between respondents was moderate (ICC 0.52, 95% confidence interval [CI] 0.47-0.58) when using NCI CTC and fair using the RTOG scale (ICC 0.28, 95% CI 0.20-0.40). Respondents who chose an invasive management were more likely to select a higher toxicity grade (P<.0001). Using the dichotomous scale, we observed moderate agreement (κ = 0.42, 95% CI 0.40-0.44) with the NCI CTC scale, but only slight agreement with the RTOG scale (κ = 0.19, 95% CI 0.17-0.21). Conclusion: Low interrater reliability was observed among radiation oncologists grading rectal bleeding using 2 common scales. Clearer definitions of late rectal bleeding toxicity should be constructed to reduce this variability and avoid ambiguity in both

  10. Energy, Exergy and Economic Evaluation Comparison of Small-Scale Single and Dual Pressure Organic Rankine Cycles Integrated with Low-Grade Heat Sources

    Directory of Open Access Journals (Sweden)

    Armando Fontalvo

    2017-09-01

    Full Text Available Low-grade heat sources such as solar thermal, geothermal, exhaust gases and industrial waste heat are suitable alternatives for power generation which can be exploited by means of small-scale Organic Rankine Cycle (ORC. This paper combines thermodynamic optimization and economic analysis to assess the performance of single and dual pressure ORC operating with different organic fluids and targeting small-scale applications. Maximum power output is lower than 45 KW while the temperature of the heat source varies in the range 100–200 °C. The studied working fluids, namely R1234yf, R1234ze(E and R1234ze(Z, are selected based on environmental, safety and thermal performance criteria. Levelized Cost of Electricity (LCOE and Specific Investment Cost (SIC for two operation conditions are presented: maximum power output and maximum thermal efficiency. Results showed that R1234ze(Z achieves the highest net power output (up to 44 kW when net power output is optimized. Regenerative ORC achieves the highest performance when thermal efficiency is optimized (up to 18%. Simple ORC is the most cost-effective among the studied cycle configurations, requiring a selling price of energy of 0.3 USD/kWh to obtain a payback period of 8 years. According to SIC results, the working fluid R1234ze(Z exhibits great potential for simple ORC when compared to conventional R245fa.

  11. Scales

    Science.gov (United States)

    Scales are a visible peeling or flaking of outer skin layers. These layers are called the stratum ... Scales may be caused by dry skin, certain inflammatory skin conditions, or infections. Examples of disorders that ...

  12. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  13. The Prognostic Value of a Four-Dimensional CT Angiography-Based Collateral Grading Scale for Reperfusion Therapy in Acute Ischemic Stroke Patients.

    Science.gov (United States)

    Zhang, Sheng; Chen, Weili; Tang, Huan; Han, Quan; Yan, Shenqiang; Zhang, Xiaocheng; Chen, Qingmeng; Parsons, Mark; Wang, Shaoshi; Lou, Min

    2016-01-01

    Leptomeningeal collaterals, which affects tissue fate, are still challenging to assess. Four-dimensional CT angiography (4D CTA) originated from CT perfusion (CTP) provides the possibility of non-invasive and time-resolved assessment of leptomeningeal collateral flow. We sought to develop a comprehensive rating system to integrate the speed and extent of collateral flow on 4D CTA, and investigate its prognostic value for reperfusion therapy in acute ischemic stroke (AIS) patients. We retrospectively studied 80 patients with M1 ± internal carotid artery (ICA) occlusion who had baseline CTP before intravenous thrombolysis. The velocity and extent of collaterals were evaluated by regional leptomeningeal collateral score on peak phase (rLMC-P) and temporally fused intensity projections (tMIP) (rLMC-M) on 4D CTA, respectively. The cutoffs of rLMC-P and rLMC-M score for predicting good outcome (mRS score ≤ 2) were integrated to develop the collateral grading scale (CGS) (rating from 0-2). The CGS score was correlated with 3-months mRS score (non-recanalizers: ρ = -0.495, p = 0.01; recanalizers: ρ = -0.671, p < 0.001). Patients with intermediate or good collaterals (CGS score of 1 and 2) who recanalized were more likely to have good outcome than those without recanalization (p = 0.038, p = 0.018), while there was no significant difference in outcome in patients with poor collaterals (CGS score of 0) stratified by recanalization (p = 0.227). Identification of collaterals based on CGS may help to select good responders to reperfusion therapy in patients with large artery occlusion.

  14. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  15. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  16. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

    Science.gov (United States)

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

    2011-12-28

    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

  17. Grade 12 Students' Conceptual Understanding and Mental Models of Galvanic Cells before and after Learning by Using Small-Scale Experiments in Conjunction with a Model Kit

    Science.gov (United States)

    Supasorn, Saksri

    2015-01-01

    This study aimed to develop the small-scale experiments involving electrochemistry and the galvanic cell model kit featuring the sub-microscopic level. The small-scale experiments in conjunction with the model kit were implemented based on the 5E inquiry learning approach to enhance students' conceptual understanding of electrochemistry. The…

  18. Study and full-scale test of a high-velocity grade-crossing simulated accident of a locomotive and a nuclear-spent-fuel shipping cask

    International Nuclear Information System (INIS)

    Huerta, M.; Yoshimura, H.R.

    1983-02-01

    This report described structural analyses of a high-speed impact between a locomotive and a tractor-trailer system carrying a nuclear-spent-fuel shipping cask. The analyses included both mathematical and physical scale-modeling of the system. The report then describes the full-scale test conducted as part of the program. The system response is described in detail, and a comparison is made between the analyses and the actual hardware response as observed in the full-scale test. 34 figures

  19. Is 4/20 an Event-Specific Marijuana Holiday? A Daily Diary Investigation of Marijuana Use and Consequences Among College Students.

    Science.gov (United States)

    Bravo, Adrian J; Pearson, Matthew R; Conner, Bradley T; Parnes, Jamie E

    2017-01-01

    Given the popular association between April 20 ("4/20") and marijuana, the present study examined marijuana use and consequences on 4/20 compared with other days in order to test whether 4/20 is a high-risk, event-specific marijuana use holiday among college student marijuana users. Fifty-nine college student marijuana users from three different, large U.S. universities located in Virginia, New Mexico, and Colorado completed daily brief surveys (<10 minutes) over a 12-day (April 15-April 26) period assessing prior-day marijuana use (i.e., percentage of users who consumed marijuana, number of unique marijuana use sessions, subjective high/intoxication while under the influence of marijuana, and number of grams of marijuana consumed) and marijuana-related consequences. Using oneway repeated-measures analyses of variance, we found that (a) 50% of students reported using marijuana on 4/20, which was significantly more than weekdays (28%) and weekend days (37%); (b) students reported a significantly higher number of unique marijuana use sessions on 4/20 (M = 1.47) compared with weekdays (M = 0.91); and (c) students reported a significantly higher number of grams consumed on 4/20 (M = 0.79) compared with weekdays (M = 0.35) and weekend days (M = 0.47). Our study provides preliminary support that 4/20 is a day associated with increased marijuana use but provides little evidence for an association with more problematic use.

  20. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  1. Full-scale locomotive dynamic crash testing and correlations : locomotive consist colliding with steel coil truck at grade crossing (test 3).

    Science.gov (United States)

    2011-09-01

    This report presents the test results and finite element correlations of a full-scale dynamic collision between a locomotive and a highway truck loaded with two heavy steel coils. The locomotive consist was moving at 58 miles per hour before it struc...

  2. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    Science.gov (United States)

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  3. Drinking game play among first-year college student drinkers: an event-specific analysis of the risk for alcohol use and problems.

    Science.gov (United States)

    Ray, Anne E; Stapleton, Jerod L; Turrisi, Rob; Mun, Eun-Young

    2014-09-01

    College students who play drinking games (DGs) more frequently report higher levels of alcohol use and experience more alcohol-related harm. However, the extent to which they are at risk for increased consumption and harm as a result of DG play on a given event after accounting for their typical DG participation, and typical and event drinking, is unclear. We examined whether first-year students consumed more alcohol and were more likely to experience consequences on drinking occasions when they played DGs. Participants (n = 336) completed up to six web-based surveys following weekend drinking events in their first semester. Alcohol use, DG play, and consequences were reported for the Friday and Saturday prior to each survey. Typical DG tendencies were controlled in all models. Typical and event alcohol use were controlled in models predicting risk for consequences. Participants consumed more alcohol on DG versus non-DG events. All students were more likely to experience blackout drinking consequences when they played DGs. Women were more likely to experience social-interpersonal consequences when they played DGs. DG play is an event-specific risk factor for increased alcohol use among first-year students, regardless of individual DG play tendencies. Further, event DG play signals increased risk for blackout drinking consequences for all students, and social-interpersonal consequences for women, aside from the amount of alcohol consumed on those occasions as well as typical drinking behaviors. Prevention efforts to reduce high-risk drinking may be strengthened by highlighting both event- and person-specific risks of DG play.

  4. Standardized Total Average Toxicity Score: A Scale- and Grade-Independent Measure of Late Radiotherapy Toxicity to Facilitate Pooling of Data From Different Studies

    Energy Technology Data Exchange (ETDEWEB)

    Barnett, Gillian C., E-mail: gillbarnett@doctors.org.uk [University of Cambridge Department of Oncology, Oncology Centre, Cambridge (United Kingdom); Cancer Research-UK Centre for Genetic Epidemiology and Department of Oncology, Strangeways Research Laboratories, Cambridge (United Kingdom); West, Catharine M.L. [School of Cancer and Enabling Sciences, Manchester Academic Health Science Centre, University of Manchester, Christie Hospital, Manchester (United Kingdom); Coles, Charlotte E. [University of Cambridge Department of Oncology, Oncology Centre, Cambridge (United Kingdom); Pharoah, Paul D.P. [Cancer Research-UK Centre for Genetic Epidemiology and Department of Oncology, Strangeways Research Laboratories, Cambridge (United Kingdom); Talbot, Christopher J. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Elliott, Rebecca M. [School of Cancer and Enabling Sciences, Manchester Academic Health Science Centre, University of Manchester, Christie Hospital, Manchester (United Kingdom); Tanteles, George A. [Department of Clinical Genetics, University Hospitals of Leicester, Leicester (United Kingdom); Symonds, R. Paul [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester (United Kingdom); Wilkinson, Jennifer S. [University of Cambridge Department of Oncology, Oncology Centre, Cambridge (United Kingdom); Dunning, Alison M. [Cancer Research-UK Centre for Genetic Epidemiology and Department of Oncology, Strangeways Research Laboratories, Cambridge (United Kingdom); Burnet, Neil G. [University of Cambridge Department of Oncology, Oncology Centre, Cambridge (United Kingdom); Bentzen, Soren M. [University of Wisconsin, School of Medicine and Public Health, Department of Human Oncology, Madison, WI (United States)

    2012-03-01

    Purpose: The search for clinical and biologic biomarkers associated with late radiotherapy toxicity is hindered by the use of multiple and different endpoints from a variety of scoring systems, hampering comparisons across studies and pooling of data. We propose a novel metric, the Standardized Total Average Toxicity (STAT) score, to try to overcome these difficulties. Methods and Materials: STAT scores were derived for 1010 patients from the Cambridge breast intensity-modulated radiotherapy trial and 493 women from University Hospitals of Leicester. The sensitivity of the STAT score to detect differences between patient groups, stratified by factors known to influence late toxicity, was compared with that of individual endpoints. Analysis of residuals was used to quantify the effect of these covariates. Results: In the Cambridge cohort, STAT scores detected differences (p < 0.00005) between patients attributable to breast volume, surgical specimen weight, dosimetry, acute toxicity, radiation boost to tumor bed, postoperative infection, and smoking (p < 0.0002), with no loss of sensitivity over individual toxicity endpoints. Diabetes (p = 0.017), poor postoperative surgical cosmesis (p = 0.0036), use of chemotherapy (p = 0.0054), and increasing age (p = 0.041) were also associated with increased STAT score. When the Cambridge and Leicester datasets were combined, STAT was associated with smoking status (p < 0.00005), diabetes (p = 0.041), chemotherapy (p = 0.0008), and radiotherapy boost (p = 0.0001). STAT was independent of the toxicity scale used and was able to deal with missing data. There were correlations between residuals of the STAT score obtained using different toxicity scales (r > 0.86, p < 0.00005 for both datasets). Conclusions: The STAT score may be used to facilitate the analysis of overall late radiation toxicity, from multiple trials or centers, in studies of possible genetic and nongenetic determinants of radiotherapy toxicity.

  5. Teachers' Grading Decision Making

    Science.gov (United States)

    Isnawati, Ida; Saukah, Ali

    2017-01-01

    This study investigated teachers' grading decision making, focusing on their beliefs underlying their grading decision making, their grading practices and assessment types, and factors they considered in grading decision making. Two teachers from two junior high schools applying different curriculum policies in grade reporting in Indonesian…

  6. Student Attitudes Toward Grades and Grading Practices.

    Science.gov (United States)

    Stallings, William M.; Leslie, Elwood K.

    The result of a study designed to assess student attitudes toward grading practices are discussed. Questionnaire responses of 3439 students in three institutions were tabulated. Responses were generally negative toward conventional grading systems. (MS)

  7. Bulk Scale Formulation of Therapeutic Doses of Clinical Grade Ready-to-Use 177Lu-DOTA-TATE: The Intricate Radiochemistry Aspects.

    Science.gov (United States)

    Mathur, Anupam; Prashant, Vrinda; Sakhare, Navin; Chakraborty, Sudipta; Vimalnath, K V; Mohan, Repaka Krishna; Arjun, Chanda; Karkhanis, Barkha; Seshan, Ravi; Basu, Sandip; Korde, Aruna; Banerjee, Sharmila; Dash, Ashutosh; Sachdev, Satbir Singh

    2017-09-01

    177 Lu-DOTA-TATE is a clinically useful and promising therapeutic radiopharmaceutical for peptide receptor radionuclide therapy of neuroendocrine tumors (NETs) overexpressing somatostatin receptors. Currently, the radiopharmaceutical is prepared in-house at nuclear medicine centers, thereby restricting its use to limited centers only. In this article, the authors describe systematic studies toward bulk scale formulation of "ready-to-use" 177 Lu-DOTA-TATE using medium specific activity 177 Lu (740-1110 GBq/mg) at a centralized radiopharmacy facility. In an optimized protocol, 177 Lu-DOTA-TATE synthesis was carried out by direct heating of 177 LuCl 3 (Sp. act. 740-1110 GBq/mg) with DOTA-TATE peptide (1.5-3.0 equivalents) in ammonium acetate buffer (0.2 M) containing 2,5-dihydroxy benzoic acid (gentisic acid). Thereafter, the crude labeled product was purified using a Sep-Pak ® C18 column and diluted with acetate buffer-gentisic acid (1.5% w/v) solution to final radioactive concentration of 740 MBq/mL. This was further sterilized and dispensed as 7.4 GBq patient dose/vial with 2 days postformulation calibration. A peptide/metal ratio of 1.5-3.0 is essential for complexation wherein radiolabeling yields >90% are obtained minimizing free 177 Lu waste. For formulation of 7.4 GBq patient dose (2 days postproduction), even specific activity of about 555 GBq/mg was found to be adequate for the radiometal. The ready-to-use 740 MBq/mL 177 Lu-DOTA-TATE formulation with gentisic acid (1.5% w/v) is observed to be safe for human use for more than 1 week (radiochemical purity >98%) from the day of production when stored at -70°C. However, the target specificity may get affected beyond 2 days as the total peptide content for 7.4 GBq dose may exceed the critical peptide limit of 300 μg. Patient treatment carried with several batches of present formulation in diseased NET patients exhibited desired distribution at the tumor and its metastatic site. A ready

  8. On arbitrarily graded rings

    Indian Academy of Sciences (India)

    58

    paper is devoted to the study of arbitrary rings graded through arbitrary sets. .... which recover certain multiplicative relations among the homogeneous components ... instance the case in which the grading set A is an Abelian group, where the ...

  9. Graded manifolds and supermanifolds

    International Nuclear Information System (INIS)

    Batchelor, M.

    1984-01-01

    In this paper, a review is presented on graded manifolds and supermanifolds. Many theorems, propositions, corrollaries, etc. are given with proofs or sketch proofs. Graded manifolds, supereuclidian space, Lie supergroups, etc. are dealt with

  10. Perceptions of restaurateurs on quality grading

    Directory of Open Access Journals (Sweden)

    Joseph Roberson

    2014-01-01

    Full Text Available A restaurateur's strategic focus is to maximise wealth for the owner(s. To achieve wealth maximisation, a restaurateur could implement one or more of the following strategies: focus strategy, cost-leadership strategy and/or differentiation strategy. A management intervention a restaurateur could implement to achieve this is quality differentiation. Grading of an establishment will assist a restaurateur in becoming a market leader. Currently there no national restaurant grading system exists in South Africa. As support and participation of restaurateurs in any future quality grading system are essential, it is imperative to test their perceptions of the implementation of a quality grading scale. The aim of this paper is to gather the perceptions of restaurateurs of an envisaged scale that could be used to grade independent full-service restaurants. In this study the researcher tested the perceptions of restaurateurs using nine possible outcomes of implementing quality grading in the independent fullservice restaurant segment. The outcomes to be tested were presented to restaurateurs in a questionnaire uploaded on "survey monkey". This was emailed to 3 286 restaurateurs and 265 responses were received. Respondents who were positive regarding grading indicated that they were enthusiastic about the impact grading would have on international tourism, as well as the fact that it could contribute to an increase in the value of their establishments.

  11. GRADE Equity Guidelines 3

    DEFF Research Database (Denmark)

    Welch, Vivian A; Akl, Elie A; Pottie, Kevin

    2017-01-01

    OBJECTIVE: The aim of this paper is to describe a conceptual framework for how to consider health equity in the GRADE (Grading Recommendations Assessment and Development Evidence) guideline development process. STUDY DESIGN AND SETTING: Consensus-based guidance developed by the GRADE working grou...

  12. Graded gauge theory

    International Nuclear Information System (INIS)

    Kerner, R.

    1983-01-01

    The mathematical background for a graded extension of gauge theories is investigated. After discussing the general properties of graded Lie algebras and what may serve as a model for a graded Lie group, the graded fiber bundle is constructed. Its basis manifold is supposed to be the so-called superspace, i.e. the product of the Minkowskian space-time with the Grassmann algebra spanned by the anticommuting Lorentz spinors; the vertical subspaces tangent to the fibers are isomorphic with the graded extension of the SU(N) Lie algebra. The connection and curvature are defined then on this bundle; the two different gradings are either independent of each other, or may be unified in one common grading, which is equivalent to the choice of the spin-statistics dependence. The Yang-Mills lagrangian is investigated in the simplified case. The conformal symmetry breaking is discussed, as well as some other physical consequences of the model. (orig.)

  13. Foraminal syringomyelia: suggestion for a grading system.

    Science.gov (United States)

    Versari, P P; D'Aliberti, G; Talamonti, G; Collice, M

    1993-01-01

    The standard treatment of foraminal syringomyelia includes foramen magnum decompression and duraplasty. Improvement or stabilization of the disease are achieved in most of cases. However, at least one third of patients are reported to receive little or no benefit. In this paper we retrospectively reviewed a series of 40 consecutive foramen magnum decompressions in order to identify the possible pre-operative outcome predictors. Based on clinical evolution, neurological impairment and radiological features, a scale of severity was fixed and retrospectively tested. A pre-operative score was obtained for each patient and was correlated with the surgical results. Then a four level grading system was derived. All grade I and grade II patients achieved good results (improvement or stabilization), whereas grade III patients showed intermediate behaviour and grade IV invariably worsened. On this basis, surgical results of foramen magnum decompression might be further improved provided that a careful pre-operative selection is made.

  14. Grading Practices and Distributions Across Internal Medicine Clerkships.

    Science.gov (United States)

    Fazio, Sara B; Torre, Dario M; DeFer, Thomas M

    2016-01-01

    Clerkship evaluation and grading practices vary widely between U.S. medical schools. Grade inflation continues to exist, and grade distribution is likely to be different among U.S. medical schools. Increasing the number of available grades curtails "grade inflation." A national survey of all Clerkship Directors in Internal Medicine members was administered in 2011. The authors assessed key aspects of grading. Response rate was 76%. Among clerkship directors (CDs), 61% of respondents agreed that grade inflation existed in the internal medicine clerkship at their school, and 43% believed that it helped students obtain better residency positions. With respect to grading practices, 79% of CDs define specific behaviors needed to achieve each grade, and 36% specify an ideal grade distribution. In addition, 44% have a trained core faculty responsible for evaluating students, 35% describe formal grading meetings, and 39% use the Reporter-Interpreter-Manager-Educator (RIME) scheme. Grading scales were described as follows: 4% utilize a pass/fail system, 13% a 3-tier (e.g., Honors/Pass/Fail), 45% 4-tier, 35% 5-tier, and 4% 6+-tier system. There was a trend to higher grades with more tiers available. Grade inflation continues in the internal medicine clerkship. Almost half of CDs feel that this practice assists students to obtain better residency positions. A minority of programs have a trained core faculty who are responsible for evaluation. About one third have formal grading meetings and use the RIME system; both have been associated with more robust and balanced grading practices. In particular, there is a wide variation between schools in the percentage of students who are awarded the highest grade, which has implications for residency applications. Downstream users of clinical clerkship grades must be fully aware of these variations in grading in order to appropriately judge medical student performance.

  15. Graded tensor calculus

    International Nuclear Information System (INIS)

    Scheunert, M.

    1982-10-01

    We develop a graded tensor calculus corresponding to arbitrary Abelian groups of degrees and arbitrary commutation factors. The standard basic constructions and definitions like tensor products, spaces of multilinear mappings, contractions, symmetrization, symmetric algebra, as well as the transpose, adjoint, and trace of a linear mapping, are generalized to the graded case and a multitude of canonical isomorphisms is presented. Moreover, the graded versions of the classical Lie algebras are introduced and some of their basic properties are described. (orig.)

  16. Classroom: Efficient Grading

    Science.gov (United States)

    Shaw, David D.; Pease, Leonard F., III.

    2014-01-01

    Grading can be accelerated to make time for more effective instruction. This article presents specific time management strategies selected to decrease administrative time required of faculty and teaching assistants, including a multiple answer multiple choice interface for exams, a three-tier grading system for open ended problem solving, and a…

  17. Grain Grading and Handling.

    Science.gov (United States)

    Rendleman, Matt; Legacy, James

    This publication provides an introduction to grain grading and handling for adult students in vocational and technical education programs. Organized in five chapters, the booklet provides a brief overview of the jobs performed at a grain elevator and of the techniques used to grade grain. The first chapter introduces the grain industry and…

  18. Vascular grading of angiogenesis

    DEFF Research Database (Denmark)

    Hansen, S; Grabau, D A; Sørensen, Flemming Brandt

    2000-01-01

    The study aimed to evaluate the prognostic value of angiogenesis by vascular grading of primary breast tumours, and to evaluate the prognostic impact of adding the vascular grade to the Nottingham Prognostic Index (NPI). The investigation included 836 patients. The median follow-up time was 11...... years and 4 months. The microvessels were immunohistochemically stained by antibodies against CD34. Angiogenesis was graded semiquantitatively by subjective scoring into three groups according to the expected number of microvessels in the most vascular tumour area. The vascular grading between observers...... for 24% of the patients, who had a shift in prognostic group, as compared to NPI, and implied a better prognostic dissemination. We concluded that the angiogenesis determined by vascular grading has independent prognostic value of clinical relevance for patients with breast cancer....

  19. Vascular grading of angiogenesis

    DEFF Research Database (Denmark)

    Hansen, S; Grabau, D A; Sørensen, Flemming Brandt

    2000-01-01

    The study aimed to evaluate the prognostic value of angiogenesis by vascular grading of primary breast tumours, and to evaluate the prognostic impact of adding the vascular grade to the Nottingham Prognostic Index (NPI). The investigation included 836 patients. The median follow-up time was 11...... years and 4 months. The microvessels were immunohistochemically stained by antibodies against CD34. Angiogenesis was graded semiquantitatively by subjective scoring into three groups according to the expected number of microvessels in the most vascular tumour area. The vascular grading between observers...... impact for 24% of the patients, who had a shift in prognostic group, as compared to NPI, and implied a better prognostic dissemination. We concluded that the angiogenesis determined by vascular grading has independent prognostic value of clinical relevance for patients with breast cancer....

  20. Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

    Science.gov (United States)

    Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-02-18

    In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

  1. Comparison of cartilage thickness with radiologic grade of knee osteoarthritis

    International Nuclear Information System (INIS)

    Agnesi, Filippo; Amrami, Kimberly K.; Frigo, Carlo A.; Kaufman, Kenton R.

    2008-01-01

    To compare joint space width (JSW) measurements obtained from magnetic resonance imaging (MRI) with a semi-automated computer algorithm to the Kellgren and Lawrence grading of osteoarthritis (OA). Three hundred and six patients (234 female, 72 male) with a mean age of 56.7 years (range 31-81 years) underwent MRI of their knees with a fast oblique spiral spoiled gradient (SPGR) sequence. A board-certified musculoskeletal radiologist graded the OA of all the patients in accordance with the Kellgren and Lawrence OA scale. A previously validated computer algorithm was used to determine the minimum JSW for both the tibiofemoral joint and the patellofemoral joint. An analysis of variance (ANOVA) with the Student-Newman-Kuels post-hoc test was used to determine if there were differences in JSW as a function of OA grade. The radiologic grade of OA was inversely associated with the JSW. In the medial compartment the JSW did not change significantly between grade 1 and grade 2, but there was a significant decrease in JSW between grade 0 (normal) and grade 1 and for each OA grade above grade 2. In the lateral compartment no statistical differences were found till grade 2, while grade 3 was found to be statistically different from the previous one. The number of patients with a grade 4 patellofemoral OA was too low for the statistical significance to be assessed. In the patellofemoral joint the JSW did not change significantly until grade 2, while a statistically significant reduction was found for both grade 3 and grade 4. This study showed that an inverse non-linear relationship exists between radiologic grade and JSW. The relationship differs for the tibiofemoral and the patellofemoral joint. (orig.)

  2. Comparison of cartilage thickness with radiologic grade of knee osteoarthritis

    Energy Technology Data Exchange (ETDEWEB)

    Agnesi, Filippo [Mayo Clinic, Motion Analysis Laboratory, Division of Orthopedic Research, Rochester, MN (United States); Polytechnic of Milan, Department of Bioengineering, Milan (Italy); Amrami, Kimberly K. [Mayo Clinic, Department of Radiology, Rochester, MN (United States); Frigo, Carlo A. [Polytechnic of Milan, Department of Bioengineering, Milan (Italy); Kaufman, Kenton R. [Mayo Clinic, Motion Analysis Laboratory, Division of Orthopedic Research, Rochester, MN (United States); Mayo Clinic/Foundation, Motion Analysis Laboratory, Department of Orthopedic Surgery, Rochester, MN (United States)

    2008-07-15

    To compare joint space width (JSW) measurements obtained from magnetic resonance imaging (MRI) with a semi-automated computer algorithm to the Kellgren and Lawrence grading of osteoarthritis (OA). Three hundred and six patients (234 female, 72 male) with a mean age of 56.7 years (range 31-81 years) underwent MRI of their knees with a fast oblique spiral spoiled gradient (SPGR) sequence. A board-certified musculoskeletal radiologist graded the OA of all the patients in accordance with the Kellgren and Lawrence OA scale. A previously validated computer algorithm was used to determine the minimum JSW for both the tibiofemoral joint and the patellofemoral joint. An analysis of variance (ANOVA) with the Student-Newman-Kuels post-hoc test was used to determine if there were differences in JSW as a function of OA grade. The radiologic grade of OA was inversely associated with the JSW. In the medial compartment the JSW did not change significantly between grade 1 and grade 2, but there was a significant decrease in JSW between grade 0 (normal) and grade 1 and for each OA grade above grade 2. In the lateral compartment no statistical differences were found till grade 2, while grade 3 was found to be statistically different from the previous one. The number of patients with a grade 4 patellofemoral OA was too low for the statistical significance to be assessed. In the patellofemoral joint the JSW did not change significantly until grade 2, while a statistically significant reduction was found for both grade 3 and grade 4. This study showed that an inverse non-linear relationship exists between radiologic grade and JSW. The relationship differs for the tibiofemoral and the patellofemoral joint. (orig.)

  3. CRA Grade Inflation

    OpenAIRE

    Kenneth H. Thomas

    2000-01-01

    Community Reinvestment Act of 1977 (CRA) ratings and performance evaluations are the only bank and thrift exam findings disclosed by financial institution regulators. Inflation of CRA ratings has been alleged by community activists for two decades, but there has been no quantification or empirical investigation of grade inflation. Using a unique grade inflation methodology on actual ratings and evaluation data for 1,407 small banks and thrifts under the revised CRA regulations, this paper con...

  4. Functionally graded materials

    CERN Document Server

    Mahamood, Rasheedat Modupe

    2017-01-01

    This book presents the concept of functionally graded materials as well as their use and different fabrication processes. The authors describe the use of additive manufacturing technology for the production of very complex parts directly from the three dimension computer aided design of the part by adding material layer after layer. A case study is also presented in the book on the experimental analysis of functionally graded material using laser metal deposition process.

  5. The Changing Landscape of Grading Systems in US Higher Education

    Science.gov (United States)

    Kleinman, Steven B.; Leidman, Mary Beth; Longcore, Andrew J.

    2018-01-01

    The following study explores the landscape of grading systems utilised in higher education, focusing on the frequency of different types of assessment scales (including Straight Letter, Plus/Minus, and other alternative policies). Although numerous studies have explored the relationship between university grading system and student behaviour,…

  6. Identifying the professional knowledge base for multi-grade teaching ...

    African Journals Online (AJOL)

    This paper reports a small-scale qualitative study of teachers and teaching principals in multi-grade rural schools in Australia, focusing on identifying the professional knowledge base required for teachers in such contexts. Such a knowledge base is essential for improving the quality of multi-grade teaching. Interviews and ...

  7. Using 4+ to grade near-normal muscle strength does not improve agreement

    DEFF Research Database (Denmark)

    O'Neill, Søren; Jaszczak, Sofie Louise Thomsen; Steffensen, Anne Katrine Søndergaard

    2017-01-01

    of the six grades. It is not necessarily obvious how to convert a manual muscle test finding into an MRC grade. Several modifications which include intermediate grades have been suggested to improve the MRC scale and the current study examines whether agreement improves and variation in ratings decrease......Manual assessment of muscle strength is often graded using the ordinal Medical Research Council (MRC) scale. The scale has a number of inherent weaknesses, including poorly defined limits between grades `4' and `5' and very large differences in the span of muscle strength encompassed by each...

  8. Using 4+ to grade near-normal muscle strength does not improve agreement

    DEFF Research Database (Denmark)

    O'Neill, Søren; Jaszczak, Sofie Louise Thomsen; Steffensen, Anne Katrine Søndergaard

    2017-01-01

    Manual assessment of muscle strength is often graded using the ordinal Medical Research Council (MRC) scale. The scale has a number of inherent weaknesses, including poorly defined limits between grades `4' and `5' and very large differences in the span of muscle strength encompassed by each...... of the six grades. It is not necessarily obvious how to convert a manual muscle test finding into an MRC grade. Several modifications which include intermediate grades have been suggested to improve the MRC scale and the current study examines whether agreement improves and variation in ratings decrease...

  9. Contractions from grading

    Science.gov (United States)

    Krishnan, Chethan; Raju, Avinash

    2018-04-01

    We note that large classes of contractions of algebras that arise in physics can be understood purely algebraically via identifying appropriate Zm-gradings (and their generalizations) on the parent algebra. This includes various types of flat space/Carroll limits of finite and infinite dimensional (A)dS algebras, as well as Galilean and Galilean conformal algebras. Our observations can be regarded as providing a natural context for the Grassmann approach of Krishnan et al. [J. High Energy Phys. 2014(3), 36]. We also introduce a related notion, which we call partial grading, that arises naturally in this context.

  10. Endangered Animals. Second Grade.

    Science.gov (United States)

    Popp, Marcia

    This second grade teaching unit centers on endangered animal species around the world. Questions addressed are: What is an endangered species? Why do animals become extinct? How do I feel about the problem? and What can I do? Students study the definition of endangered species and investigate whether it is a natural process. They explore topics…

  11. Calculating Student Grades.

    Science.gov (United States)

    Allswang, John M.

    1986-01-01

    This article provides two short microcomputer gradebook programs. The programs, written in BASIC for the IBM-PC and Apple II, provide statistical information about class performance and calculate grades either on a normal distribution or based on teacher-defined break points. (JDH)

  12. Grades as Information

    Science.gov (United States)

    Grant, Darren

    2007-01-01

    We determine how much observed student performance in microeconomics principles can be attributed, inferentially, to three kinds of student academic "productivity," the instructor, demographics, and unmeasurables. The empirical approach utilizes an ordered probit model that relates student performance in micro to grades in prior…

  13. First Grade Baseline Evaluation

    Science.gov (United States)

    Center for Innovation in Assessment (NJ1), 2013

    2013-01-01

    The First Grade Baseline Evaluation is an optional tool that can be used at the beginning of the school year to help teachers get to know the reading and language skills of each student. The evaluation is composed of seven screenings. Teachers may use the entire evaluation or choose to use those individual screenings that they find most beneficial…

  14. The Fifth Grade Classroom.

    Science.gov (United States)

    Hartman, Michael; And Others

    An interdisciplinary design project report investigates the relationship of the fifth grade educational facility to the student and teacher needs in light of human and environmental factors. The classroom, activity and teaching spaces are analyzed with regard to the educational curriculum. Specifications and design criteria concerning equipment…

  15. Cutting Class Harms Grades

    Science.gov (United States)

    Taylor, Lewis A., III

    2012-01-01

    An accessible business school population of undergraduate students was investigated in three independent, but related studies to determine effects on grades due to cutting class and failing to take advantage of optional reviews and study quizzes. It was hypothesized that cutting classes harms exam scores, attending preexam reviews helps exam…

  16. Reliability of injury grading systems for patients with blunt splenic trauma

    NARCIS (Netherlands)

    Olthof, D. C.; van der Vlies, C. H.; Scheerder, M. J.; de Haan, R. J.; Beenen, L. F. M.; Goslings, J. C.; van Delden, O. M.

    2014-01-01

    The most widely used grading system for blunt splenic injury is the American Association for the Surgery of Trauma (AAST) organ injury scale. In 2007 a new grading system was developed. This 'Baltimore CT grading system' is superior to the AAST classification system in predicting the need for

  17. Inflated Grades, Enrollments & Budgets

    Directory of Open Access Journals (Sweden)

    J. E. Stone

    1995-06-01

    Full Text Available Reports of the past 13 years that call attention to deficient academic standards in American higher education are enumerated. Particular attention is given the Wingspread Group's recent An American Imperative: Higher Expectations for Higher Education. Low academic standards, grade inflation, and budgetary incentives for increased enrollment are analyzed and a call is made for research at the state level. Reported trends in achievement and GPAs are extrapolated to Tennessee and combined with local data to support the inference that 15% of the state's present day college graduates would not have earned a diploma by mid 1960s standards. A conspicuous lack of interest by public oversight bodies is noted despite a growing public awareness of low academic expectations and lenient grading and an implicit budgetary impact of over $100 million. Various academic policies and the dynamics of bureaucratic control are discussed in relationship to the maintenance of academic standards. The disincentives for challenging course requirements and responsible grading are examined, and the growing movement to address academic quality issues through better training and supervision of faculty are critiqued. Recommendations that would encourage renewed academic integrity and make learning outcomes visible to students, parents, employers, and the taxpaying public are offered and briefly discussed.

  18. TCGA_LowerGradeGliomas

    Science.gov (United States)

    TCGA researchers analyzed nearly 300 cases of diffuse low- and intermediate-grade gliomas, which together comprise lower-grade gliomas. LGGs occur mainly in adults and include astrocytomas, oligodendrogliomas and oligoastrocytomas.

  19. Let's End the Grading Game.

    Science.gov (United States)

    Edwards, Clifford H.; Edwards, Laurie

    1999-01-01

    Argues that grades have negative effects on learning and self-concept. States that while grading has a long tradition of sorting children for college entrance, there is limited evidence that grades serve a valid purpose. Argues that this practice should be abolished and an evaluation system established that provides a more valid estimate of…

  20. Four Steps in Grading Reform

    Science.gov (United States)

    Guskey, Thomas R.; Jung, Lee Ann

    2012-01-01

    The field of education is moving rapidly toward a standards-based approach to grading. School leaders have become increasingly aware of the tremendous variation that exists in grading practices, even among teachers of the same courses in the same department in the same school. Consequently, students' grades often have little relation to their…

  1. Establishment of Traceability of Reference Grade Hydrometers at National Physical Laboratory, India (npli)

    Science.gov (United States)

    Kumar, Anil; Kumar, Harish; Mandal, Goutam; Das, M. B.; Sharma, D. C.

    The present paper discusses the establishment of traceability of reference grade hydrometers at National Physical Laboratory, India (NPLI). The reference grade hydrometers are calibrated and traceable to the primary solid density standard. The calibration has been done according to standard procedure based on Cuckow's Method and the reference grade hydrometers calibrated covers a wide range. The uncertainty of the reference grade hydrometers has been computed and corrections are also calculated for the scale readings, at which observations are taken.

  2. Functionally Graded Materials Database

    Science.gov (United States)

    Kisara, Katsuto; Konno, Tomomi; Niino, Masayuki

    2008-02-01

    Functionally Graded Materials Database (hereinafter referred to as FGMs Database) was open to the society via Internet in October 2002, and since then it has been managed by the Japan Aerospace Exploration Agency (JAXA). As of October 2006, the database includes 1,703 research information entries with 2,429 researchers data, 509 institution data and so on. Reading materials such as "Applicability of FGMs Technology to Space Plane" and "FGMs Application to Space Solar Power System (SSPS)" were prepared in FY 2004 and 2005, respectively. The English version of "FGMs Application to Space Solar Power System (SSPS)" is now under preparation. This present paper explains the FGMs Database, describing the research information data, the sitemap and how to use it. From the access analysis, user access results and users' interests are discussed.

  3. Isolation of monocytes from leukapheretic products for large-scale GMP-grade generation of cytomegalovirus-specific T-cell lines by means of an automated elutriation device.

    Science.gov (United States)

    Perseghin, Paolo; D'Amico, Giovanna; Dander, Erica; Gaipa, Giuseppe; Dassi, Maria; Biagi, Ettore; Biondi, Andrea

    2008-08-01

    Dendritic cells (DC) act as antigen-presenting cells in immune response-mediated mechanisms against malignant cells and/or viral or fungal pathogens. CD14+ monocytes have been so far isolated by techniques of plastic adherence or by using immunomagnetic methods. Here the effectiveness of a commercially available cell separation system (Elutra, Gambro BCT) in the separation of monocytes and the large-scale production of cytomegalovirus (CMV)-specific T-cell lines were investigated. Six mononuclear cell (MNC) collections were processed with the Elutra system. Monocyte-enriched fraction was differentiated into DCs by addition of granulocyte-macrophage-colony-stimulating factor and interleukin (IL)-4. After 6 days of culture, DCs were matured in the presence of interferon (IFN)-gamma, IFN-alpha, IL-1beta, tumor necrosis factor-alpha, and poly(I:C) and pulsed with a pool of 48 MHC Class I and II-binding CMV peptides. Lymphocytes were then stimulated with mature autologous CMV peptide-pulsed DCs. After elutriation, the mean monocyte yield was 0.89 x 10(9) +/- 0.65 x 10(9), with a 51.0 +/- 31.6 percent recovery and a 51.1 +/- 35.4 percent purity. A significant correlation was observed when basal monocyte content was related to the postelutriation recovery (p < 0.0116). More than 60 percent of plated monocytes were differentiated into DCs, which after pulsing with CMV peptides, were able to stimulate a robust enrichment in CMV antigen-specific T cells in all tested samples (mean percentage of pentamer-positive CD8+ cells, 35% compared to the initial 2%). Our findings might be helpful for an appropriate MNC collection, to maximize the efficiency of the elutriation system and subsequently obtain an optimal monocyte-enriched yield for further DC generation and T-cell stimulation.

  4. The Implications of Grade Inflation

    DEFF Research Database (Denmark)

    Smith, David E.; Fleisher, Steven

    2011-01-01

    The authors review current and past practices of the grade inflation controversy and present ways to return to each institution’s established grading guidelines. Students are graded based on knowledge gathered. Certain faculty members use thorough evaluative methods, such as written and oral pres...... have been profiled in the news. The model is provided to ensure that degree candidates are academic experts in their field, having earned the credential through rigorous study....

  5. Practicing Good Habits, Grade 4.

    Science.gov (United States)

    Van Cong Lau; And Others

    This illustrated textbook was designed for teaching civics and values to fourth grade students in Vietnam. It is divided into six chapters: (1) At School (recapitulation of the grade three program, friendship, respect for the teacher, team work, discipline, honor); (2) In the Street: Traffic Regulations; (3) At Home (the extended family spirit,…

  6. Graded geometry and Poisson reduction

    OpenAIRE

    Cattaneo, A S; Zambon, M

    2009-01-01

    The main result of [2] extends the Marsden-Ratiu reduction theorem [4] in Poisson geometry, and is proven by means of graded geometry. In this note we provide the background material about graded geometry necessary for the proof in [2]. Further, we provide an alternative algebraic proof for the main result. ©2009 American Institute of Physics

  7. Compositionally Graded Multilayer Ceramic Capacitors.

    Science.gov (United States)

    Song, Hyun-Cheol; Zhou, Jie E; Maurya, Deepam; Yan, Yongke; Wang, Yu U; Priya, Shashank

    2017-09-27

    Multilayer ceramic capacitors (MLCC) are widely used in consumer electronics. Here, we provide a transformative method for achieving high dielectric response and tunability over a wide temperature range through design of compositionally graded multilayer (CGML) architecture. Compositionally graded MLCCs were found to exhibit enhanced dielectric tunability (70%) along with small dielectric losses (filters and power converters.

  8. Multi-Input Convolutional Neural Network for Flower Grading

    Directory of Open Access Journals (Sweden)

    Yu Sun

    2017-01-01

    Full Text Available Flower grading is a significant task because it is extremely convenient for managing the flowers in greenhouse and market. With the development of computer vision, flower grading has become an interdisciplinary focus in both botany and computer vision. A new dataset named BjfuGloxinia contains three quality grades; each grade consists of 107 samples and 321 images. A multi-input convolutional neural network is designed for large scale flower grading. Multi-input CNN achieves a satisfactory accuracy of 89.6% on the BjfuGloxinia after data augmentation. Compared with a single-input CNN, the accuracy of multi-input CNN is increased by 5% on average, demonstrating that multi-input convolutional neural network is a promising model for flower grading. Although data augmentation contributes to the model, the accuracy is still limited by lack of samples diversity. Majority of misclassification is derived from the medium class. The image processing based bud detection is useful for reducing the misclassification, increasing the accuracy of flower grading to approximately 93.9%.

  9. Coupled plasmon modes and their localization in graded plasmonic chains

    International Nuclear Information System (INIS)

    Xiao, J.J.; Yakubo, K.; Yu, K.W.

    2007-01-01

    Plasmonic waves occur in the subwavelength scale with transverse confinement below the diffraction limit. In this work, we report results of longitudinal localization-delocalization transitions of coupled plasmon modes in graded chains of metallic nanodots. Two graded models are studied: graded index of refraction in the host medium and incremental spacing between the nanoparticles. The coupled plasmon modes in these graded systems exhibit strong localization, showing a tunable passband in finite size systems. These localized modes survive in presence of weak loss in the nanodots. To understand the localization mechanism, we construct equivalent systems of one-dimensional coupled harmonic oscillators, whose coupling strength or masses are gradually varied from one end to the other, with additional on-site potentials. Confining and transmitting electromagnetic energy in these structures may pave new way for many fruitful applications in plasmonics

  10. Study of thermal conductivity and thermal rectification in exponential mass graded lattices

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Tejal N. [Bhavan' s Sheth R.A. College of Science, Khanpur, Ahmedabad 380 001, Gujarat (India); Gajjar, P.N., E-mail: pngajjar@rediffmail.com [Department of Physics, University School of Sciences, Gujarat University, Ahmedabad 380 009, Gujarat (India)

    2012-01-09

    Concept of exponential mass variation of oscillators along the chain length of N oscillators is proposed in the present Letter. The temperature profile and thermal conductivity of one-dimensional (1D) exponential mass graded harmonic and anharmonic lattices are studied on the basis of Fermi–Pasta–Ulam (FPU) β model. Present findings conclude that the exponential mass graded chain provide higher conductivity than that of linear mass graded chain. The exponential mass graded anharmonic chain generates the thermal rectification of 70–75% which is better than linear mass graded materials, so far. Thus instead of using linear mass graded material, the use of exponential mass graded material will be a better and genuine choice for controlling the heat flow at nano-scale. -- Highlights: ► In PRE 82 (2010) 040101, use of mass graded material as a thermal devices is explored. ► Concept of exponential mass graded material is proposed. ► The rectification obtained is about 70–75% which is better than linear mass graded materials. ► The exponential mass graded material will be a better choice for the thermal devices at nano-scale.

  11. Effect of Grade Retention in First Grade on Psychosocial Outcomes

    OpenAIRE

    Wu, Wei; West, Stephen G.; Hughes, Jan N.

    2010-01-01

    In a 4-year longitudinal study, the authors investigated effects of retention in first grade on children’s externalizing and internalizing behaviors; social acceptance; and behavioral, cognitive, and affective engagement. From a large multiethnic sample (n = 784) of children below the median on literacy at school entrance, 124 retained children were matched with 251 promoted children on the basis of propensity scores (probability of being retained in first grade estimated from 72 baseline var...

  12. Grade 12 Achievement Rating Scales in the New National Senior ...

    African Journals Online (AJOL)

    The raw score results showed a decline in proficiency in all topics, and significantly reduced skills development, with mastery of acids and bases showing the most serious decline. Rasch analysis of the data indicated that a 12 percentage point shift in preparedness occurred in 2009 compared with 2005. The contribution to ...

  13. Grade 12 Achievement Rating Scales in the New National Senior ...

    African Journals Online (AJOL)

    NICO

    were collected in 2009 for first-time entering students at the Universities of Pretoria (UP) (N= 828) ... secondary education was adjusted to satisfy a much wider range ..... CCT respondent would have a 50 % probability of answering ... Figure 1 Performance distributions for the combined UP and UCT mainstream chemistry ...

  14. Lab-scale preparations of Candida albicans and dual Candida albicans-Candida glabrata biofilms on the surface of medical-grade polyvinyl chloride (PVC) perfusion tube using a modified gravity-supported free-flow biofilm incubator (GS-FFBI).

    Science.gov (United States)

    Shao, Jing; Lu, KeQiao; Tian, Ge; Cui, YanYan; Yan, YuanYuan; Wang, TianMing; Zhang, XinLong; Wang, ChangZhong

    2015-02-01

    The assembly of a man-made gravity-supported free-flow biofilm incubator (GS-FFBI) was described, which was composed of a gas cushion injector and four incubators. The GS-FFBI had the characteristics of (i) a bottom-up flow direction, and (ii) lab-scale biofilm preparation without the use of a multichannel pump. Two opportunistic fungal strains, namely Candida albicans and Candida glabrata, were employed to incubate C. albicans and dual C. albicans-C. glabrata biofilms on the surface of medical-grade polyvinyl chloride perfusion tube. In terms of the results from {2, 3-bis (2-methoxy-4-nitro-5-sulfo-phenyl)-2H-tetrazolium-5-carboxanilide} (XTT) assay, dry weight measurement, colony-forming unit counting, susceptibility test, and scanning electron microscopy, it was demonstrated that GS-FFBI could form both stable single and dual Candida biofilms with no significant variations among the four incubators or the three daily incubations within 21h, and could operate for at least 96h smoothly with no contamination of stock medium. The results also indicated, for the first time, that C. albicans and C. glabrata might be co-existent competitively and symbiotically in the dual biofilms with flowing media. GS-FFBI would be a useful device to study in vitro morphological and physiological features of microbial biofilms in the medical settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. MR detection of retinal hemorrhages: correlation with graded ophthalmologic exam

    International Nuclear Information System (INIS)

    Beavers, Angela J.; Allbery, Sandra M.; Stagner, Anna M.; Hejkal, Thomas W.; Lyden, Elizabeth R.; Haney, Suzanne B.

    2015-01-01

    Dilated fundoscopic exam is considered the gold standard for detecting retinal hemorrhage, but expertise in obtaining this exam is not always immediately available. MRI can detect retinal hemorrhages, but correlation of the grade or severity of retinal hemorrhage on dilated fundoscopic exam with retinal hemorrhage visibility on MRI has not been described. To determine the value of standard brain protocol MRI in detecting retinal hemorrhage and to determine whether there is any correlation with MR detection of retinal hemorrhage and the dilated fundoscopic exam grade of hemorrhage. We conducted a retrospective chart review of 77 children <2 years old who were seen for head trauma from April 2007 to July 2013 and had both brain MRI and dilated fundoscopic exam or retinal camera images. A staff pediatric radiologist and radiology resident reviewed the MR images. Retinal hemorrhages were graded by a chief ophthalmology resident on a 12-point scale based on the retinal hemorrhage type, size, location and extent as seen on review of retinal camera images and detailed reports by ophthalmologists. Higher scores indicated increased severity of retinal hemorrhages. There was a statistically significant difference in the median grade of retinal hemorrhage examination between children who had retinal hemorrhage detected on MRI and children who did not have retinal hemorrhage detected on MRI (P = 0.02). When examination grade was categorized as low-grade (1-4), moderate-grade (5-8) or high-grade (>8) hemorrhage, there was a statistically significant association between exam grade and diagnosis based on MRI (P = 0.008). For example, only 14% of children with low-grade retinal hemorrhages were identified on MRI compared to 76% of children with high-grade hemorrhages. MR detection of retinal hemorrhage demonstrated a sensitivity of 61%, specificity of 100%, positive predictive value of 100% and negative predictive value of 63%. Retinal hemorrhage was best seen on the gradient

  16. Gender discrimination in exam grading?

    DEFF Research Database (Denmark)

    Rangvid, Beatrice Schindler

    2018-01-01

    Girls, on average, obtain higher test scores in school than boys, and recent research suggests that part of this difference may be due to discrimination against boys in grading. This bias is consequential if admission to subsequent education programs is based on exam scores. This study assesses t...... tendencies are in accordance with statistical discrimination as a mechanism for grading bias in essay writing and with gender-stereotyped beliefs of math being a male domain....... are scored twice (blind and non-blind). Both strategies use difference-in-differences methods. Although imprecisely estimated, the point estimates indicate a blind grading advantage for boys in essay writing of approximately 5-8% SD, corresponding to 9-15% of the gender gap in essay exam grades. The effect...

  17. Progressive problems higher grade physics

    CERN Document Server

    Kennedy, William

    2001-01-01

    This book fully covers all three Units studied in Scotland's Higher Grade Physics course, providing a systematic array of problems (from the simplest to the most difficult) to lead variously abled pupils to examination success.

  18. Grade 6 Science Curriculum Specifications.

    Science.gov (United States)

    Alberta Dept. of Education, Edmonton. Curriculum Branch.

    This material describes curriculum specifications for grade 6 science in Alberta. Emphases recommended are: (1) process skills (50%); (2) psychomotor skills (10%); (3) attitudes (10%); and (4) subject matter (30%). Priorities within each category are identified. (YP)

  19. Improving GRADE evidence tables part 2

    DEFF Research Database (Denmark)

    Langendam, Miranda; Carrasco-Labra, Alonso; Santesso, Nancy

    2016-01-01

    OBJECTIVES: The Grading of Recommendations Assessment, Development, and Evaluation (GRADE) working group has developed GRADE evidence profiles (EP) and summary of findings (SoF) tables to present evidence summaries in systematic reviews, clinical guidelines, and health technology assessments. Exp...

  20. The Post-Ureteroscopic Lesion Scale (PULS)

    DEFF Research Database (Denmark)

    Schoenthaler, Martin; Buchholz, Noor; Farin, Erik

    2014-01-01

    The Post-Ureteroscopic Lesion Scale (PULS) offers a simple grading system for the description of ureteral lesions after ureteroscopy. In this article, we present the results of a video-based multicenter evaluation of the inter-rater reliability of clinically important PULS grades 0-3....

  1. Cracks in functionally graded materials

    International Nuclear Information System (INIS)

    Bahr, H.-A.; Balke, H.; Fett, T.; Hofinger, I.; Kirchhoff, G.; Munz, D.; Neubrand, A.; Semenov, A.S.; Weiss, H.-J.; Yang, Y.Y.

    2003-01-01

    The weight function method is described to analyze the crack growth behavior in functionally graded materials and in particular materials with a rising crack growth resistance curve. Further, failure of graded thermal barrier coatings (TBCs) under cyclic surface heating by laser irradiation is modeled on the basis of fracture mechanics. The damage of both graded and non-graded TBCs is found to develop in several distinct stages: vertical cracking→delamination→blistering→spalling. This sequence can be understood as an effect of progressive shrinkage due to sintering and high-temperature creep during thermal cycling, which increases the energy-release rate for vertical cracks which subsequently turn into delamination cracks. The results of finite element modeling, taking into account the TBC damage mechanisms, are compatible with experimental data. An increase of interface fracture toughness due to grading and a decrease due to ageing have been measured in a four-point bending test modified by a stiffening layer. Correlation with the damage observed in cyclic heating is discussed. It is explained in which way grading is able to reduce the damage

  2. Graded/Gradient Porous Biomaterials

    Directory of Open Access Journals (Sweden)

    Xigeng Miao

    2009-12-01

    Full Text Available Biomaterials include bioceramics, biometals, biopolymers and biocomposites and they play important roles in the replacement and regeneration of human tissues. However, dense bioceramics and dense biometals pose the problem of stress shielding due to their high Young’s moduli compared to those of bones. On the other hand, porous biomaterials exhibit the potential of bone ingrowth, which will depend on porous parameters such as pore size, pore interconnectivity, and porosity. Unfortunately, a highly porous biomaterial results in poor mechanical properties. To optimise the mechanical and the biological properties, porous biomaterials with graded/gradient porosity, pores size, and/or composition have been developed. Graded/gradient porous biomaterials have many advantages over graded/gradient dense biomaterials and uniform or homogenous porous biomaterials. The internal pore surfaces of graded/gradient porous biomaterials can be modified with organic, inorganic, or biological coatings and the internal pores themselves can also be filled with biocompatible and biodegradable materials or living cells. However, graded/gradient porous biomaterials are generally more difficult to fabricate than uniform or homogenous porous biomaterials. With the development of cost-effective processing techniques, graded/gradient porous biomaterials can find wide applications in bone defect filling, implant fixation, bone replacement, drug delivery, and tissue engineering.

  3. Grade Inflation in Medical Student Radiation Oncology Clerkships: Missed Opportunities for Feedback?

    International Nuclear Information System (INIS)

    Grover, Surbhi; Swisher-McClure, Samuel; Sosnowicz, Stasha; Li, Jiaqi; Mitra, Nandita; Berman, Abigail T.; Baffic, Cordelia; Vapiwala, Neha; Freedman, Gary M.

    2015-01-01

    Purpose: To test the hypothesis that medical student radiation oncology elective rotation grades are inflated and cannot be used to distinguish residency applicants. Methods and Materials: The records of 196 applicants to a single radiation oncology residency program in 2011 and 2012 were retrospectively reviewed. The grades for each rotation in radiation oncology were collected and converted to a standardized 4-point grading scale (honors, high pass, pass, fail). Pass/fail grades were scored as not applicable. The primary study endpoint was to compare the distribution of applicants' grades in radiation oncology with their grades in medicine, surgery, pediatrics, and obstetrics/gynecology core clerkships. Results: The mean United States Medical Licensing Examination Step 1 score of the applicants was 237 (range, 188-269), 43% had additional Masters or PhD degrees, and 74% had at least 1 publication. Twenty-nine applicants were graded for radiation oncology rotations on a pass/fail basis and were excluded from the final analysis. Of the remaining applicants (n=167), 80% received the highest possible grade for their radiation oncology rotations. Grades in radiation oncology were significantly higher than each of the other 4 clerkships studied (P<.001). Of all applicants, 195 of 196 matched into a radiation oncology residency. Higher grades in radiation oncology were associated with significantly higher grades in the pediatrics core clerkship (P=.002). However, other medical school performance metrics were not significantly associated with higher grades in radiation oncology. Conclusions: Although our study group consists of a selected group of radiation oncology applicants, their grades in radiation oncology clerkships were highly skewed toward the highest grades when compared with grades in other core clerkships. Student grading in radiation oncology clerkships should be re-evaluated to incorporate more objective and detailed performance metrics to allow for

  4. Hardwood log grades and lumber grade yields for factory lumber logs

    Science.gov (United States)

    Leland F. Hanks; Glenn L. Gammon; Robert L. Brisbin; Everette D. Rast

    1980-01-01

    The USDA Forest Service Standard Grades for Hardwood Factory Lumber Logs are described, and lumber grade yields for 16 species and 2 species groups are presented by log grade and log diameter. The grades enable foresters, log buyers, and log sellers to select and grade those log suitable for conversion into standard factory grade lumber. By using the apropriate lumber...

  5. 7 CFR 810.2204 - Grades and grade requirements for wheat.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Grades and grade requirements for wheat. 810.2204... OFFICIAL UNITED STATES STANDARDS FOR GRAIN United States Standards for Wheat Principles Governing the Application of Standards § 810.2204 Grades and grade requirements for wheat. (a) Grades and grade requirements...

  6. A practical MRI grading system for osteoarthritis of the knee: Association with Kellgren–Lawrence radiographic scores

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hee-Jin, E-mail: parkhiji@gmail.com [Department of Radiology, Sungkyunkwan University School of Medicine, Kangbuk Samsung Hospital, #108 Pyung-dong, Jongno-gu, Seoul 110-746 (Korea, Republic of); Department of Radiology, Kangwon National University School of Medicine, Baengnyeong-ro 156, Chuncheon-Si, Gangwon-Do Kangwon National University Hospital 200-722 (Korea, Republic of); Kim, Sam Soo, E-mail: samskim@kangwon.ac.kr [Department of Radiology, Kangwon National University School of Medicine, Baengnyeong-ro 156, Chuncheon-Si, Gangwon-Do Kangwon National University Hospital 200-722 (Korea, Republic of); Lee, So-Yeon, E-mail: parkhiji@kwandong.ac.kr [Department of Radiology, Sungkyunkwan University School of Medicine, Kangbuk Samsung Hospital, #108 Pyung-dong, Jongno-gu, Seoul 110-746 (Korea, Republic of); Park, Noh-Hyuck, E-mail: nhpark904@kwandong.ac.kr [Department of Radiology, Myongji Hospital, Kwandong University, College of Medicine, 697-24 Hwajung-dong, Dukyang-ku, Koyang, Kyunggi 412-270 (Korea, Republic of); Park, Ji-Yeon, E-mail: zzzz3@hanmail.net [Department of Radiology, Myongji Hospital, Kwandong University, College of Medicine, 697-24 Hwajung-dong, Dukyang-ku, Koyang, Kyunggi 412-270 (Korea, Republic of); Choi, Yoon-Jung, E-mail: yoonchoi99@gmail.com [Department of Radiology, Sungkyunkwan University School of Medicine, Kangbuk Samsung Hospital, #108 Pyung-dong, Jongno-gu, Seoul 110-746 (Korea, Republic of); Jeon, Hyun-Jun, E-mail: ostrich-13@hanmail.net [Department of Occupational Medicine, Dongsan Medical Center, Keimyung University School of Medicine, 194 Dongsan-Dong, Jung-ku, Taegu (Korea, Republic of)

    2013-01-15

    Purpose: To propose a reproducible and constant MR grading system for osteoarthritis of the knee joint that provides high interobserver and intraoberver agreement and that does not require complicated calculation procedures. Materials and methods: This retrospective study sample included 44 men and 65 women who underwent both MRI and plain radiography of the knee at our institution. All patients were older than 50 years of age (mean 57.7) and had clinically suspected osteoarthritis of the knee. The standard of 4 grades on the MR grade scale was based mainly on cartilage injury and additional findings. Kellgren–Lawrence grades were assessed for the same patient group. The relationship between the results was determined. Statistical analyses were performed including kappa statistics, categorical regression analysis and nonparametric correlation analysis. Results: The interobserver and intraoberver agreements between the two readers in the grading of osteoarthritis were found to be almost perfect. Interobserver and intraobserver agreements were slightly lower for the MR grading system than for the Kellgren–Lawrence grading scale. The correlation between the MR grade and Kellgren–Lawrence grade was very high and did not differ with patient age. The MR grades were highly correlated with the Kellgren–Lawrence grades and showed excellent interobserver and intraobserver agreements. Conclusion: This new MR grading system for osteoarthritis of the knee joint is reproducible and may be helpful for the grading of osteoarthritis of the knee without requiring reference to plain radiography.

  7. A practical MRI grading system for osteoarthritis of the knee: Association with Kellgren–Lawrence radiographic scores

    International Nuclear Information System (INIS)

    Park, Hee-Jin; Kim, Sam Soo; Lee, So-Yeon; Park, Noh-Hyuck; Park, Ji-Yeon; Choi, Yoon-Jung; Jeon, Hyun-Jun

    2013-01-01

    Purpose: To propose a reproducible and constant MR grading system for osteoarthritis of the knee joint that provides high interobserver and intraoberver agreement and that does not require complicated calculation procedures. Materials and methods: This retrospective study sample included 44 men and 65 women who underwent both MRI and plain radiography of the knee at our institution. All patients were older than 50 years of age (mean 57.7) and had clinically suspected osteoarthritis of the knee. The standard of 4 grades on the MR grade scale was based mainly on cartilage injury and additional findings. Kellgren–Lawrence grades were assessed for the same patient group. The relationship between the results was determined. Statistical analyses were performed including kappa statistics, categorical regression analysis and nonparametric correlation analysis. Results: The interobserver and intraoberver agreements between the two readers in the grading of osteoarthritis were found to be almost perfect. Interobserver and intraobserver agreements were slightly lower for the MR grading system than for the Kellgren–Lawrence grading scale. The correlation between the MR grade and Kellgren–Lawrence grade was very high and did not differ with patient age. The MR grades were highly correlated with the Kellgren–Lawrence grades and showed excellent interobserver and intraobserver agreements. Conclusion: This new MR grading system for osteoarthritis of the knee joint is reproducible and may be helpful for the grading of osteoarthritis of the knee without requiring reference to plain radiography

  8. EXAMINATION OF ACHIEVEMENT RELATIONS AND MOTIVATION OF 7th GRADE STUDENTS FOR INVOLVEMENT IN PHYSICAL EDUCATION CLASSES

    OpenAIRE

    Dragoljub Višnjić; Dragan Martinović; Jelena Ilić; Živorad Marković

    2010-01-01

    The relations of students achievement and motivation for involvement in PE classes were examined in a sample of 247 seventh-grade elementary school students of both sexes. The independent variables in the study were: sex, general success of the previous grade, PE grade, students’ opinion on sufficiency of knowledge acquired through instruction process, students’ involvement in sport. The scale for measurement of motivation consisted of 29 items obtained by adaptation of the Scale for measurem...

  9. The Relationship between Home Literary Environments and Attitudes toward Reading in Ninth-Grade Students.

    Science.gov (United States)

    Kubis, Mary Ellen

    A study determined what variables in the home literary environments of ninth-grade students influenced their attitudes toward reading. Subjects, 316 students from 2 ninth-grade classes at 2 metropolitan high schools, were given the Estes Reading Attitude Scale and a researcher-developed, 30-question inventory of their home literary environment.…

  10. Measuring Listening Comprehension Skills of 5th Grade School Students with the Help of Web Based System

    Science.gov (United States)

    Acat, M. Bahaddin; Demiral, Hilmi; Kaya, Mehmet Fatih

    2016-01-01

    The main purpose of this study is to measure listening comprehension skills of 5th grade school students with the help of web based system. This study was conducted on 5th grade students studying at the primary schools of Eskisehir. The scale used in the process of the study is "Web Based Listening Scale". In the process of the study,…

  11. TSUNAMI analysis of the applicability of proposed experiments to reactor-grade and weapons-grade mixed-oxide systems

    International Nuclear Information System (INIS)

    Rearden, Bradley T.; Hopper, Calvin M.; Elam, Karla R.

    2005-01-01

    The applicability of proposed critical experiments for the criticality code validation of a series of prototypic reactor-grade and weapons-grade mixed-oxide systems has been assessed with the TSUNAMI methodology from SCALE 5. The application systems were proposed by the Nuclear Energy Agency (NEA) Organization for Economic Cooperation and Development (OECD) Working Party on Nuclear Criticality Safety MOX Experimental Needs Working Group. Forty-eight application systems were conceived to envelope the range of conditions in processing and fabrication of reactor-grade and weapons-grade MOX fuel. The applicability of 303 existing critical benchmarks to each of the 48 applications was assessed, and validation coverage was found to be lacking for certain applications. Two series of proposed critical experiments were also considered in this analysis. The TSUNAMI analysis has revealed that both series of proposed experiments are applicable to numerous configurations of the reactor-grade and weapons-grade systems. A detailed assessment of which experiments were revealed by TSUNAMI to be most applicable to specific prototypic fuel processing systems has been performed. (author)

  12. Assessment of health surveys: fitting a multidimensional graded response model.

    Science.gov (United States)

    Depaoli, Sarah; Tiemensma, Jitske; Felt, John M

    The multidimensional graded response model, an item response theory (IRT) model, can be used to improve the assessment of surveys, even when sample sizes are restricted. Typically, health-based survey development utilizes classical statistical techniques (e.g. reliability and factor analysis). In a review of four prominent journals within the field of Health Psychology, we found that IRT-based models were used in less than 10% of the studies examining scale development or assessment. However, implementing IRT-based methods can provide more details about individual survey items, which is useful when determining the final item content of surveys. An example using a quality of life survey for Cushing's syndrome (CushingQoL) highlights the main components for implementing the multidimensional graded response model. Patients with Cushing's syndrome (n = 397) completed the CushingQoL. Results from the multidimensional graded response model supported a 2-subscale scoring process for the survey. All items were deemed as worthy contributors to the survey. The graded response model can accommodate unidimensional or multidimensional scales, be used with relatively lower sample sizes, and is implemented in free software (example code provided in online Appendix). Use of this model can help to improve the quality of health-based scales being developed within the Health Sciences.

  13. Functionally Graded Mo sintered steels

    Directory of Open Access Journals (Sweden)

    Manuel Cisneros-Belmonte

    2016-12-01

    Full Text Available Functionally graded materials (FGM, the multi-materials, strive to satisfy the numerous requirements demanded of parts in a given combination of compositions and microstructures. The required material compatibility lead the manufacturing process and the achieving of an interface, not always diffuse. Powder metallurgy is one of the techniques used in manufacturing functionally graded materials, in particular the compaction matrix of the possible techniques for forming these materials. In this paper, a process of forming a functionally graded steel based on the use of a high molybdenum steel with cooper and other steel with copper, without molybdenum, is proposed with the aim of concentrating this element to the surface of the workpiece, increasing the mechanical strength. The study is completed with the evaluation of physical properties (density and porosity distribution, mechanical properties (hardness, tensile strength and elongation and microstructural analysis by optical and scanning electron microscopy.

  14. 7 CFR 51.304 - Combination grades.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946... Standards for Grades of Apples Grades § 51.304 Combination grades. (a) Combinations of the above grades may...

  15. On-Demand Grades: The Effect of Online Grade Book Access on Student Mastery and Performance Goal Orientations, Grade Orientation, Academic Self Efficacy, and Grades

    Science.gov (United States)

    Seldow, Adam Lowell

    2010-01-01

    With the widespread growth of broadband Internet access, teachers, and in many cases, schools and school districts are transitioning from traditional paper-based grade books to student accessible online (Web-based) grade books. Online grade books offer students 24/7, on demand access to grades and various other student data, and have the potential…

  16. Functionally Graded Material: An overview

    CSIR Research Space (South Africa)

    Mahamood, RM

    2012-07-01

    Full Text Available -3146. [50] X. Jin, L. Wu, L. Guo, H. Yu, and Y. Sun, ?Experimental investigation of the mixed-mode crack propagation in ZrO2/NiCr functionally graded materials,? Engineering Fracture Mechanics, vol. 76(12), (2009), pp. 1800-1810. [51] Z. Cheng, D. Gao... by stable crack growth,? Engineering Fracture Mechanics, vol.72(15), (2005), pp. 2359-2372. [47] Z.-H. Jin, and R.H. Dodds Jr, ?Crack growth resistance behavior of a functionally graded material: computational studies,? Engineering Fracture Mechanics...

  17. On the union of graded prime ideals

    Directory of Open Access Journals (Sweden)

    Uregen Rabia Nagehan

    2016-01-01

    Full Text Available In this paper we investigate graded compactly packed rings, which is defined as; if any graded ideal I of R is contained in the union of a family of graded prime ideals of R, then I is actually contained in one of the graded prime ideals of the family. We give some characterizations of graded compactly packed rings. Further, we examine this property on h – Spec(R. We also define a generalization of graded compactly packed rings, the graded coprimely packed rings. We show that R is a graded compactly packed ring if and only if R is a graded coprimely packed ring whenever R be a graded integral domain and h – dim R = 1.

  18. Growth of optical grade germanium crystals

    International Nuclear Information System (INIS)

    Waris, M.; Akhtar, M.J.; Mehmood, N.; Ashraf, M.; Siddique, M.

    2011-01-01

    A novel design of Czochralski( CZ ) growth station in a low frequency induction furnace is described and growth of optical grade Ge crystal as a test material is performed achieving a flat solid-liquid interface shape. Grown Ge crystals are annealed in air at 450 -500 deg. C for 4 hrs and then characterized by determination of crystallographic orientation by Laue (back-reflection of X-rays) method, dislocation density studies by etch-pits formation, measuring electrical resistivity by 4-probe technique, conductivity type determination by hot probe method, measurement of hardness on Moh's scale and optical transmission measurement in IR region. The results obtained are compared to those reported in the literature. The use of this growth station for other materials is suggested. (author)

  19. 7 CFR 810.404 - Grades and grade requirements for corn.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Grades and grade requirements for corn. 810.404... OFFICIAL UNITED STATES STANDARDS FOR GRAIN United States Standards for Corn Principles Governing the Application of Standards § 810.404 Grades and grade requirements for corn. Grade Minimum test weight per...

  20. 7 CFR 810.1804 - Grades and grade requirements for sunflower seed.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Grades and grade requirements for sunflower seed. 810... AGRICULTURE OFFICIAL UNITED STATES STANDARDS FOR GRAIN United States Standards for Sunflower Seed Principles Governing the Application of Standards § 810.1804 Grades and grade requirements for sunflower seed. Grade...

  1. A proposed grading system for standardizing tumor consistency of intracranial meningiomas.

    Science.gov (United States)

    Zada, Gabriel; Yashar, Parham; Robison, Aaron; Winer, Jesse; Khalessi, Alexander; Mack, William J; Giannotta, Steven L

    2013-12-01

    Tumor consistency plays an important and underrecognized role in the surgeon's ability to resect meningiomas, especially with evolving trends toward minimally invasive and keyhole surgical approaches. Aside from descriptors such as "hard" or "soft," no objective criteria exist for grading, studying, and conveying the consistency of meningiomas. The authors designed a practical 5-point scale for intraoperative grading of meningiomas based on the surgeon's ability to internally debulk the tumor and on the subsequent resistance to folding of the tumor capsule. Tumor consistency grades and features are as follows: 1) extremely soft tumor, internal debulking with suction only; 2) soft tumor, internal debulking mostly with suction, and remaining fibrous strands resected with easily folded capsule; 3) average consistency, tumor cannot be freely suctioned and requires mechanical debulking, and the capsule then folds with relative ease; 4) firm tumor, high degree of mechanical debulking required, and capsule remains difficult to fold; and 5) extremely firm, calcified tumor, approaches density of bone, and capsule does not fold. Additional grading categories included tumor heterogeneity (with minimum and maximum consistency scores) and a 3-point vascularity score. This grading system was prospectively assessed in 50 consecutive patients undergoing craniotomy for meningioma resection by 2 surgeons in an independent fashion. Grading scores were subjected to a linear weighted kappa analysis for interuser reliability. Fifty patients (100 scores) were included in the analysis. The mean maximal tumor diameter was 4.3 cm. The distribution of overall tumor consistency scores was as follows: Grade 1, 4%; Grade 2, 9%; Grade 3, 43%; Grade 4, 44%; and Grade 5, 0%. Regions of Grade 5 consistency were reported only focally in 14% of heterogeneous tumors. Tumors were designated as homogeneous in 68% and heterogeneous in 32% of grades. The kappa analysis score for overall tumor consistency

  2. Attendance Policies and Student Grades

    Science.gov (United States)

    Risen, D. Michael

    2007-01-01

    The details described in this case study examine the issues related to attendance policies and how such policies might be legally used to affect student grades. Concepts discussed should cause graduate students in educational administration to reflect on the issues presented from various points of view when the students complete an analysis of the…

  3. Grading Rubrics: Hoopla or Help?

    Science.gov (United States)

    Howell, Rebecca J.

    2014-01-01

    The purpose of the study was to offer some quantitative, multivariate evidence concerning the impact of grading rubric use on academic outcome among American higher education students. Using a pre-post, quasi-experimental research design, cross-sectional data were derived from undergraduates enrolled in an elective during spring and fall 2009 at…

  4. Transportation: Grade 8. Cluster IV.

    Science.gov (United States)

    Calhoun, Olivia H.

    A curriculum guide for grade 8, the document is devoted to the occupational cluster "Transportation." It is divided into five units: surface transportation, interstate transportation, air transportation, water transportation, and subterranean transportation (the Metro). Each unit is introduced by a statement of the topic, the unit's…

  5. Smartphone-based grading of apple quality

    Science.gov (United States)

    Li, Xianglin; Li, Ting

    2018-02-01

    Apple quality grading is a critical issue in apple industry which is one economical pillar of many countries. Artificial grading is inefficient and of poor accuracy. Here we proposed to develop a portable, convenient, real-time, and low cost method aimed at grading apple. Color images of the apples were collected with a smartphone and the grade of sampled apple was assessed by a customized smartphone app, which offered the functions translating RGB color values of the apple to color grade and translating the edge of apple image to weight grade. The algorithms are based on modeling with a large number of apple image at different grades. The apple grade data evaluated by the smartphone are in accordance with the actual data. This study demonstrated the potential of smart phone in apple quality grading/online monitoring at gathering and transportation stage for apple industry.

  6. Reliability of injury grading systems for patients with blunt splenic trauma.

    Science.gov (United States)

    Olthof, D C; van der Vlies, C H; Scheerder, M J; de Haan, R J; Beenen, L F M; Goslings, J C; van Delden, O M

    2014-01-01

    The most widely used grading system for blunt splenic injury is the American Association for the Surgery of Trauma (AAST) organ injury scale. In 2007 a new grading system was developed. This 'Baltimore CT grading system' is superior to the AAST classification system in predicting the need for angiography and embolization or surgery. The objective of this study was to assess inter- and intraobserver reliability between radiologists in classifying splenic injury according to both grading systems. CT scans of 83 patients with blunt splenic injury admitted between 1998 and 2008 to an academic Level 1 trauma centre were retrospectively reviewed. Inter and intrarater reliability were expressed in Cohen's or weighted Kappa values. Overall weighted interobserver Kappa coefficients for the AAST and 'Baltimore CT grading system' were respectively substantial (kappa=0.80) and almost perfect (kappa=0.85). Average weighted intraobserver Kappa's values were in the 'almost perfect' range (AAST: kappa=0.91, 'Baltimore CT grading system': kappa=0.81). The present study shows that overall the inter- and intraobserver reliability for grading splenic injury according to the AAST grading system and 'Baltimore CT grading system' are equally high. Because of the integration of vascular injury, the 'Baltimore CT grading system' supports clinical decision making. We therefore recommend use of this system in the classification of splenic injury. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. The effect of two grading systems on the performance of medical students during oral examinations

    DEFF Research Database (Denmark)

    Ba-Ali, Shakoor; Jemec, Gregor B E; Sander, Birgit

    2017-01-01

    group (p = 0.45). Moreover, the average mark was higher among the international students (mean = 10.3, on the seven-point grading scale) than in the Danish speaking classes (mean = 9.1). CONCLUSION: The seven-point grading scale seems to motivate students to yield a better performance; hence tiered......INTRODUCTION: Either a pass/fail approach or a seven-point grading scale are used to evaluate students at the Danish universities. The aim of this study was to explore any effect of the assessment methods on student performances during oral exams. METHODS: In a prospective study including 1......,037 examinations in three medical subjects, we investigated the difference in the test scores between the spring- and autumn semester. In the spring semester, the students could either pass or fail the subject (pass/fail) while in the following autumn semester, the students were assessed by tiered grading (seven...

  8. Anticipating and addressing event-specific alcohol consumption among adolescents

    Directory of Open Access Journals (Sweden)

    Simone Pettigrew

    2016-07-01

    Full Text Available Abstract Background Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students’ expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. Methods A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i aspects of Schoolies they were looking forward to most and least and (ii their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Results Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Conclusions Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  9. Anticipating and addressing event-specific alcohol consumption among adolescents.

    Science.gov (United States)

    Pettigrew, Simone; Biagioni, Nicole; Jongenelis, Michelle I

    2016-07-29

    Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students' expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i) aspects of Schoolies they were looking forward to most and least and (ii) their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  10. Anaplasia and grading in medulloblastomas.

    Science.gov (United States)

    Eberhart, Charles G; Burger, Peter C

    2003-07-01

    The variable clinical outcomes of medulloblastoma patients have prompted a search for markers with which to tailor therapies to individuals. In this review, we discuss clinical, histological and molecular features that can be used in such treatment customization, focusing on how histopathological grading can impact both patient care and research on the molecular basis of CNS embryonal tumors. Medulloblastomas span a histological spectrum ending in overtly malignant large cell/anaplastic lesions characterized by increased nuclear size, marked cytological anaplasia, and increased mitotic and apoptotic rates. These "high-grade" lesions make up approximately one quarter of medulloblastomas, and recur and metastasize more frequently than tumors lacking anaplasia. We believe anaplastic change represents a type of malignant progression common to many medulloblastoma subtypes and to other CNS embryonal lesions as well. Correlation of these histological changes with the accumulation of genetic events suggests a model for the histological and molecular progression of medulloblastoma.

  11. Gradings on simple Lie algebras

    CERN Document Server

    Elduque, Alberto

    2013-01-01

    Gradings are ubiquitous in the theory of Lie algebras, from the root space decomposition of a complex semisimple Lie algebra relative to a Cartan subalgebra to the beautiful Dempwolff decomposition of E_8 as a direct sum of thirty-one Cartan subalgebras. This monograph is a self-contained exposition of the classification of gradings by arbitrary groups on classical simple Lie algebras over algebraically closed fields of characteristic not equal to 2 as well as on some nonclassical simple Lie algebras in positive characteristic. Other important algebras also enter the stage: matrix algebras, the octonions, and the Albert algebra. Most of the presented results are recent and have not yet appeared in book form. This work can be used as a textbook for graduate students or as a reference for researchers in Lie theory and neighboring areas.

  12. Grading of quality assurance requirements

    International Nuclear Information System (INIS)

    1991-01-01

    The present Manual provides guidance and illustrative examples for applying a method by which graded quality assurance requirements may be determined and adapted to the items and services of a nuclear power plant in conformance with the requirements of the IAEA Nuclear Safety Standards (NUSS) Code and Safety Guides on quality assurance. The Manual replaces the previous publication IAEA-TECDOC-303 on the same subject. Various methods of grading quality assurance are available in a number of Member States. During the development of the present Manual it was not considered practical to attempt to resolve the differences between those methods and it was preferred to identify and benefit from the good practices available in all the methods. The method presented in this Manual deals with the aspects of management, documentation, control, verification and administration which affect quality. 1 fig., 4 tabs

  13. Grade Expectations: Rationality and Overconfidence

    Science.gov (United States)

    Magnus, Jan R.; Peresetsky, Anatoly A.

    2018-01-01

    Confidence and overconfidence are essential aspects of human nature, but measuring (over)confidence is not easy. Our approach is to consider students' forecasts of their exam grades. Part of a student's grade expectation is based on the student's previous academic achievements; what remains can be interpreted as (over)confidence. Our results are based on a sample of about 500 second-year undergraduate students enrolled in a statistics course in Moscow. The course contains three exams and each student produces a forecast for each of the three exams. Our models allow us to estimate overconfidence quantitatively. Using these models we find that students' expectations are not rational and that most students are overconfident, in agreement with the general literature. Less obvious is that overconfidence helps: given the same academic achievement students with larger confidence obtain higher exam grades. Female students are less overconfident than male students, their forecasts are more rational, and they are also faster learners in the sense that they adjust their expectations more rapidly. PMID:29375449

  14. Grade Expectations: Rationality and Overconfidence

    Directory of Open Access Journals (Sweden)

    Jan R. Magnus

    2018-01-01

    Full Text Available Confidence and overconfidence are essential aspects of human nature, but measuring (overconfidence is not easy. Our approach is to consider students' forecasts of their exam grades. Part of a student's grade expectation is based on the student's previous academic achievements; what remains can be interpreted as (overconfidence. Our results are based on a sample of about 500 second-year undergraduate students enrolled in a statistics course in Moscow. The course contains three exams and each student produces a forecast for each of the three exams. Our models allow us to estimate overconfidence quantitatively. Using these models we find that students' expectations are not rational and that most students are overconfident, in agreement with the general literature. Less obvious is that overconfidence helps: given the same academic achievement students with larger confidence obtain higher exam grades. Female students are less overconfident than male students, their forecasts are more rational, and they are also faster learners in the sense that they adjust their expectations more rapidly.

  15. Measure of uncertainty in regional grade variability

    NARCIS (Netherlands)

    Tutmez, B.; Kaymak, U.; Melin, P.; Castillo, O.; Gomez Ramirez, E.; Kacprzyk, J.; Pedrycz, W.

    2007-01-01

    Because the geological events are neither homogeneous nor isotropic, the geological investigations are characterized by particularly high uncertainties. This paper presents a hybrid methodology for measuring of uncertainty in regional grade variability. In order to evaluate the fuzziness in grade

  16. Relationship of the Van Herick Grading System with Peripheral Iris Configuration and Level of Iris Insertion.

    Science.gov (United States)

    Khan, Faisal Aziz; Niazi, Shafaq Pervez Khan; Khan, Assad Zaman

    2017-09-01

    To determine the relationship of the van Herick angle grading system with the level of iris insertion and peripheral iris configuration. Observational study. Eye department, Combined Military Hospital, Malir Cantt., Karachi, from May to October 2015. Sixty-five eyes of 65 patients were recruited. Anterior chamber depth at the temporal limbus was measured as a fraction of corneal section thickness using van Herick technique and graded on the standard 4-point scale of the van Herick grading system. Gonioscopy of the temporal quadrant was performed with a Posner 4 mirror goniolens and both the true level of iris insertion and peripheral iris configuration were recorded on a 4-point scale so as to equate with the van Herick 4-point grading system. Spearman's rho test was applied to determine the relationship of the van Herick grading system with level of iris root insertion and peripheral iris configuration. Amoderate positive correlation between van Herick grade and peripheral iris configuration was found which was statistically significant (rs=0.42, p < 0.001). Astatistically significant and moderate positive correlation was also detected between van Herick grade and the level of iris insertion (rs=0.45, p < 0.001). The van Herick grade has a moderately positive relationship with the peripheral iris configuration and true level of iris insertion.

  17. The grading management of the quality assurance

    International Nuclear Information System (INIS)

    Ma Xiaozheng; Han Shufang; Yu Bei; Tian Xuehang

    2009-01-01

    This paper introduces the quality assurance grading management of the items, services and technology process on nuclear power plants (nuclear island, conventional island, BOP), such as the requirements and aim in the related code, guide, technical document, the requirements for the related units, the grading principle and grading, the considering method for the differences of QA requirements of the each QA grand, as well as the status and propositions in the QA grading management in China. (authors)

  18. The pathologist's mean grade is constant and individualizes the prognostic value of bladder cancer grading.

    Science.gov (United States)

    van Rhijn, Bas W G; van Leenders, Geert J L H; Ooms, Bert C M; Kirkels, Wim J; Zlotta, Alexandre R; Boevé, Egbert R; Jöbsis, Adriaan C; van der Kwast, Theo H

    2010-06-01

    A new grading system for bladder cancer (BCa) was adopted in 2004 to reduce observer variability and provide better prognostic information. We compared the World Health Organization (WHO) 1973 and 2004 systems for observer variability and prognosis. Slides of 173 primary non-muscle-invasive BCa were reviewed two times by four pathologists. Intra- and interobserver variability were assessed using κ statistics. We determined the mean grade (eg, G1/low malignant potential is 1 grade point, G2/low grade is 2 grade points) of the pathologists per grading cycle. Kaplan-Meier analyses were applied for prediction of recurrence and progression. For WHO 2004 and 1973 grading, the agreement between the pathologists was 39-74% (κ: 0.14-0.58) and 39-64% (κ: 0.15-0.41), respectively. The intraobserver agreement varied from 71% to 88% (κ: 0.55-0.81). The mean grade of a pathologist was constant (difference below 0.1 grade point) irrespective of the grading system. Conversely, mean-grade differences among the pathologists were high, up to 0.7 grade point. The mean grades for the WHO 2004 system were 0.3-0.5 grade point higher than those of WHO 1973. Mean grade distinguished low and high graders among the pathologists and was strongly linked with risk of progression in each grade category. The variation in mean grade among individual pathologists exceeded the grade shift caused by WHO 2004 grading. Knowledge of the pathologist's mean grade allows a better assessment of the prognostic value of grading. Mean grade has the potential to become a tool for quality assurance in pathology. Copyright © 2009 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  19. Examining Text Complexity in the Early Grades

    Science.gov (United States)

    Fitzgerald, Jill; Elmore, Jeff; Hiebert, Elfrieda H.; Koons, Heather H.; Bowen, Kimberly; Sanford-Moore, Eleanor E.; Stenner, A. Jackson

    2016-01-01

    The Common Core raises the stature of texts to new heights, creating a hubbub. The fuss is especially messy at the early grades, where children are expected to read more complex texts than in the past. But early-grades teachers have been given little actionable guidance about text complexity. The authors recently examined early-grades texts to…

  20. Registration Patterns Under Two Different Grading Systems.

    Science.gov (United States)

    Remley, Audrey W.

    In the early 1960's, Westminster College adopted a new grading system, with the traditional grade levels of A, B, C, D, and F converted to DN (Distinction), HP (High Pass), P (Pass), and NC (No Credit). NC replaced both D and F of the old system, and grade point averages were abolished, in an effort to encourage students to register in more…

  1. Forecasting and recruitment in graded manpower systems

    NARCIS (Netherlands)

    van Nunen, J.A.E.E.; Wessels, J.

    1977-01-01

    In this paper a generalized Markov model is introduced to describe the dynamic behaviour of an individual employee in a graded Manpower system. Characteristics like the employee's grade, his educational level, his age and the time spent in his actual grade, can be incorporated in the Markov model.

  2. Demystify Learning Expectations to Address Grade Inflation

    Science.gov (United States)

    Hodges, Linda C.

    2014-01-01

    This article describes the subject of "grade inflation," a reference to educators giving higher grades to student work than their expectations for student achievement warrant. Of the many reasons why this practice happens, Hodges specifically discusses inflating grades as "a natural consequence" when the faculty really…

  3. Grade Inflation: An Issue for Higher Education?

    Science.gov (United States)

    Caruth, Donald L.; Caruth, Gail D.

    2013-01-01

    Grade inflation impacts university credibility, student courses of study, choices of institution, and other areas. There has been an upward shift in grades without a corresponding upward shift in knowledge gained. Some of the most frequently mentioned causes of grade inflation are: (1) student evaluations of professors; (2) student teacher…

  4. Does Education Corrupt? Theories of Grade Inflation

    Science.gov (United States)

    Oleinik, Anton

    2009-01-01

    Several theories of grade inflation are discussed in this review article. It is argued that grade inflation results from the substitution of criteria specific to the search for truth by criteria of quality control generated outside of academia. Particular mechanisms of the grade inflation that occurs when a university is transformed into a…

  5. Agreement between the Facial Nerve Grading System 2.0 and the House-Brackmann Grading System in Patients with Bell Palsy.

    Science.gov (United States)

    Lee, Ho Yun; Park, Moon Suh; Byun, Jae Yong; Chung, Ji Hyun; Na, Se Young; Yeo, Seung Geun

    2013-09-01

    We have analyzed the correlation between the House-Brackmann (HB) scale and Facial Nerve Grading System 2.0 (FNGS 2.0) in patients with Bell palsy, and evaluated the usefulness of the new grading system. Sixty patients diagnosed with Bell palsy from May 2009 to December 2010 were evaluated using the HB scale and FNGS 2.0 scale during their initial visit, and after 3 and 6 weeks and 3 months. The overall intraclass correlation coefficient (ICC) was 0.908 (P=0.000) and the Spearman correlation coefficient (SCC) was 0.912 (P<0.05). ICC and SCC displayed differences over time, being 0.604 and 0.626, respectively, at first visit; 0.834 and 0.843, respectively, after 3 weeks; 0.844 and 0.848, respectively, after 6 weeks; and 0.808 and 0.793, respectively, after 3 months. There was a significant difference in full recovery, depending on the scale used (HB, P=0.000; FNGS 2.0, P<0.05). The exact agreements between regional assessment and FNGS 2.0 for the mouth, eyes, and brow were 72%, 63%, and 52%, respectively. FNGS 2.0 shows moderate agreement with HB grading. Regional assessment, rather than HB grading, yields stricter evaluation, resulting in better prognosis and determination of grade.

  6. Correlation of quantitative sensorimotor tractography with clinical grade of cerebral palsy

    International Nuclear Information System (INIS)

    Trivedi, Richa; Gupta, Rakesh K.; Agarwal, Shruti; Rathore, Ram K.S.; Shah, Vipul; Goyel, Puneet; Paliwal, Vimal K.

    2010-01-01

    The purpose of this study was to determine whether tract-specific diffusion tensor imaging measures in somatosensory and motor pathways correlate with clinical grades as defined using the Gross Motor Function Classification System (GMFCS) in cerebral palsy (CP) children. Quantitative diffusion tensor tractography was performed on 39 patients with spastic quadriparesis (mean age = 8 years) and 14 age/sex-matched controls. All patients were graded on the basis of GMFCS scale into grade II (n = 12), grade IV (n = 22), and grade V (n = 5) CP and quantitative analysis reconstruction of somatosensory and motor tracts performed. Significant inverse correlation between clinical grade and fractional anisotropy (FA) was observed in both right and left motor and sensory tracts. A significant direct correlation of mean diffusivity values from both motor and sensory tracts was also observed with clinical grades. Successive decrease in FA values was observed in all tracts except for left motor tracts moving from age/sex-matched controls to grade V through grades II and IV. We conclude that white matter tracts from both the somatosensory and the motor cortex play an important role in the pathophysiology of motor disability in patients with CP. (orig.)

  7. Correlation of quantitative sensorimotor tractography with clinical grade of cerebral palsy

    Energy Technology Data Exchange (ETDEWEB)

    Trivedi, Richa; Gupta, Rakesh K. [Sanjay Gandhi Postgraduate Institute of Medical Sciences, Department of Radiodiagnosis, Lucknow (India); Agarwal, Shruti; Rathore, Ram K.S. [Indian Institute of Technology, Department of Mathematics and Statistics, Kanpur (India); Shah, Vipul [Bhargava Nursing Home, Pediatric Orthopedic Surgery unit, Lucknow (India); Goyel, Puneet [Sanjay Gandhi Postgraduate Institute of Medical Sciences, Department of Anesthesiology, Lucknow (India); Paliwal, Vimal K. [Sanjay Gandhi Postgraduate Institute of Medical Sciences, Department of Neurology, Lucknow (India)

    2010-08-15

    The purpose of this study was to determine whether tract-specific diffusion tensor imaging measures in somatosensory and motor pathways correlate with clinical grades as defined using the Gross Motor Function Classification System (GMFCS) in cerebral palsy (CP) children. Quantitative diffusion tensor tractography was performed on 39 patients with spastic quadriparesis (mean age = 8 years) and 14 age/sex-matched controls. All patients were graded on the basis of GMFCS scale into grade II (n = 12), grade IV (n = 22), and grade V (n = 5) CP and quantitative analysis reconstruction of somatosensory and motor tracts performed. Significant inverse correlation between clinical grade and fractional anisotropy (FA) was observed in both right and left motor and sensory tracts. A significant direct correlation of mean diffusivity values from both motor and sensory tracts was also observed with clinical grades. Successive decrease in FA values was observed in all tracts except for left motor tracts moving from age/sex-matched controls to grade V through grades II and IV. We conclude that white matter tracts from both the somatosensory and the motor cortex play an important role in the pathophysiology of motor disability in patients with CP. (orig.)

  8. Facial nerve grading instruments: systematic review of the literature and suggestion for uniformity

    NARCIS (Netherlands)

    Fattah, A.Y.; Gurusinghe, A.D.; Gavilan, J.; Hadlock, T.A.; Marcus, J.R.; Marres, H.A.; Nduka, C.C.; Slattery, W.H.; Snyder-Warwick, A.K.

    2015-01-01

    BACKGROUND: A variety of facial nerve grading scales have been developed over the years with the intended goals of objectively documenting facial nerve function,tracking recovery, and facilitating communication between practitioners. Numerous scales have been proposed; however, all are subject to

  9. Measuring Students' Writing Ability on a Computer-Analytic Developmental Scale: An Exploratory Validity Study

    Science.gov (United States)

    Burdick, Hal; Swartz, Carl W.; Stenner, A. Jackson; Fitzgerald, Jill; Burdick, Don; Hanlon, Sean T.

    2013-01-01

    The purpose of the study was to explore the validity of a novel computer-analytic developmental scale, the Writing Ability Developmental Scale. On the whole, collective results supported the validity of the scale. It was sensitive to writing ability differences across grades and sensitive to within-grade variability as compared to human-rated…

  10. The Relationship of Grade Span in 9th Grade to Math Achievement in High School

    Science.gov (United States)

    West, John; Miller, Mary Lou; Myers, Jim; Norton, Timothy

    2015-01-01

    Purpose, Scope, and Method of Study: The purpose of this study was to determine if a correlation exists between grade span for ninth grade and gains in math achievement test scores in 10th grade and 12th grade. A quantitative, longitudinal, correlational research design was employed to investigate the research questions. The population was high…

  11. High grade glioma: Imaging combined with pathological grade defines management and predicts prognosis

    International Nuclear Information System (INIS)

    Burnet, Neil G.; Lynch, Andrew G.; Jefferies, Sarah J.; Price, Stephen J.; Jones, Phil H.; Antoun, Nagui M.; Xuereb, John H.; Pohl, Ute

    2007-01-01

    Introduction: There is ambiguity in pathological grading of high grade gliomas within the WHO 2000 classification, especially those with predominant oligodendroglial differentiation. Patients and methods: All adult high grade gliomas treated radically, 1996-2005, were assessed. Cases in which pathology was grade III but radiology suggested glioblastoma (GBM) were classified as 'grade III/IV'; their pathology was reviewed. Results: Data from 245 patients (52 grade III, 18 grade III/IV, 175 GBM) were analysed using a Cox Proportional Hazards model. On pathology review, features suggestive of more aggressive behaviour were found in all 18 grade III/IV tumours. Oligodendroglial components with both necrosis and microvascular proliferation were present in 7. MIB-1 counts for the last 8 were all above 14%, mean 27%. Median survivals were: grade III 34 months, grade III/IV 10 months, GBM 11 months. Survival was not significantly different between grade III/IV and GBM. Patients with grade III/IV tumours had significantly worse outcome than grade III, with a hazard of death 3.7 times higher. Conclusions: The results highlight the current inconsistency in pathological grading of high grade tumours, especially those with oligodendroglial elements. Patients with histological grade III tumours but radiological appearances suggestive of GBM should be managed as glioblastoma

  12. Association of Grade Configuration with School Climate for 7th and 8th Grade Students

    Science.gov (United States)

    Malone, Marisa; Cornell, Dewey; Shukla, Kathan

    2017-01-01

    Educational authorities have questioned whether middle schools provide the best school climate for 7th and 8th grade students, and proposed that other grade configurations such as K-8th grade schools may provide a better learning environment. The purpose of this study was to compare 7th and 8th grade students' perceptions of 4 key features of…

  13. Comparing Dropout Predictors for Two State-Level Panels Using Grade 6 and Grade 8 Data

    Science.gov (United States)

    Franklin, Bobby J.; Trouard, Stephen B.

    2016-01-01

    The purpose of this study was to examine the effectiveness of dropout predictors across time. Two state-level high school graduation panels were selected to begin with the seventh and ninth grades but end at the same time. The first panel (seventh grade) contained 29,554 students and used sixth grade predictors. The second panel (ninth grade)…

  14. Grade Inflation Marches On: Grade Increases from the 1990s to 2000s

    Science.gov (United States)

    Kostal, Jack W.; Kuncel, Nathan R.; Sackett, Paul R.

    2016-01-01

    Grade inflation threatens the integrity of college grades as indicators of academic achievement. In this study, we contribute to the literature on grade inflation by providing the first estimate of the size of grade increases at the student level between the mid-1990s and mid-2000s. By controlling for student characteristics and course-taking…

  15. Grade control and the determination of ore reserves at a low-grade uranium mine

    International Nuclear Information System (INIS)

    Reid, J.A.F.; Robertson, B.

    1982-01-01

    In 1966 an intensive exploration programme was conducted by Rio Tinto South Africa Ltd, involving airborne and ground radiometric surveys, percussion and diamond drilling, and pilot-plant tests. This investigation established the presence of a large deposit of low-grade uranium that could be mined on a large scale by open-pitting. Soon after production started in June 1974, it was realized that the original presentation of the ore reserves did not give a true reflection of the orebody. A comparison between the estimates and the ore mined from reserve blocks over the period 1975 to 1977 showed that the reserve grades were over-optimistic. In 1977 Rio Tinto Zinc Consultants were commissioned to re-evaluate the ore reserves from exploration diamond-drill data with the help of The Centre de Geostatistique at Fontainebleau, France. A new global reserve using disjunctive kriging techniques was developed, and is now the long-term reserve used for planning purposes at the Roessing Mine. For short-term planning, ore-reserve data are replaced by information from an intermediate drilling programme and blast-hole assays if these are available. A computerized short-term planning system has been established that reconciles the ore mined against the reserve blocks, as well as a system by which composited blast-hole assays are analysed for grade-control purposes. Owing to the complexity of the orebody, additional monitoring is achieved by the scanning of each truckload of ore with a group of scintillation crystal heads that evaluate the material mined

  16. Scale Pretesting

    Science.gov (United States)

    Howard, Matt C.

    2018-01-01

    Scale pretests analyze the suitability of individual scale items for further analysis, whether through judging their face validity, wording concerns, and/or other aspects. The current article reviews scale pretests, separated by qualitative and quantitative methods, in order to identify the differences, similarities, and even existence of the…

  17. Additive and Multiplicative Effects of Working Memory and Test Anxiety on Mathematics Performance in Grade 3 Students

    Science.gov (United States)

    Korhonen, Johan; Nyroos, Mikaela; Jonsson, Bert; Eklöf, Hanna

    2018-01-01

    The aim of this study was to investigate the interplay between test anxiety and working memory (WM) on mathematics performance in younger children. A sample of 624 grade 3 students completed a test battery consisting of a test anxiety scale, WM tasks and the Swedish national examination in mathematics for grade 3. The main effects of test anxiety…

  18. Indiana Third Grade Reading ISTEP+ Scores Comparisons in a Public Elementary School to a Public Elementary Charter School

    Science.gov (United States)

    Gray, Cassandra D.

    2011-01-01

    The purpose of this study was to determine if there was a difference with student achievement at third grade in reading with a traditional public school as compared to a public charter school; both schools were a part of the Southwest Region School Corporation. This quasi-experimental study compared third grade ISTEP+ scale scores in…

  19. A Contemporary Prostate Cancer Grading System: A Validated Alternative to the Gleason Score

    Science.gov (United States)

    Epstein, Jonathan I.; Zelefsky, Michael J.; Sjoberg, Daniel D.; Nelson, Joel B.; Egevad, Lars; Magi-Galluzzi, Cristina; Vickers, Andrew J.; Parwani, Anil V.; Reuter, Victor E.; Fine, Samson W.; Eastham, James A.; Wiklund, Peter; Han, Misop; Reddy, Chandana A.; Ciezki, Jay P.; Nyberg, Tommy; Klein, Eric A.

    2016-01-01

    Background Despite revisions in 2005 and 2014, the Gleason prostate cancer (PCa) grading system still has major deficiencies. Combining of Gleason scores into a three-tiered grouping (6, 7, 8–10) is used most frequently for prognostic and therapeutic purposes. The lowest score, assigned 6, may be misunderstood as a cancer in the middle of the grading scale, and 3 + 4 = 7 and 4 + 3 = 7 are often considered the same prognostic group. Objective To verify that a new grading system accurately produces a smaller number of grades with the most significant prognostic differences, using multi-institutional and multimodal therapy data. Design, setting, and participants Between 2005 and 2014, 20 845 consecutive men were treated by radical prostatectomy at five academic institutions; 5501 men were treated with radiotherapy at two academic institutions. Outcome measurements and statistical analysis Outcome was based on biochemical recurrence (BCR). The log-rank test assessed univariable differences in BCR by Gleason score. Separate univariable and multivariable Cox proportional hazards used four possible categorizations of Gleason scores. Results and limitations In the surgery cohort, we found large differences in recurrence rates between both Gleason 3 + 4 versus 4 + 3 and Gleason 8 versus 9. The hazard ratios relative to Gleason score 6 were 1.9, 5.1, 8.0, and 11.7 for Gleason scores 3 + 4, 4 + 3, 8, and 9–10, respectively. These differences were attenuated in the radiotherapy cohort as a whole due to increased adjuvant or neoadjuvant hormones for patients with high-grade disease but were clearly seen in patients undergoing radiotherapy only. A five–grade group system had the highest prognostic discrimination for all cohorts on both univariable and multivariable analysis. The major limitation was the unavoidable use of prostate-specific antigen BCR as an end point as opposed to cancer-related death. Conclusions The new PCa grading system has these benefits: more

  20. Is the Sky Falling? Grade Inflation and the Signaling Power of Grades.

    Science.gov (United States)

    Pattison, Evangeleen; Grodsky, Eric; Muller, Chandra

    2013-06-01

    Grades are the fundamental currency of our educational system; they signal academic achievement and non-cognitive skills to parents, employers, postsecondary gatekeepers, and students themselves. Grade inflation compromises the signaling value of grades, undermining their capacity to achieve the functions for which they are intended. We challenge the 'increases in grade point average' definition of grade inflation and argue that grade inflation must be understood in terms of the signaling power of grades. Analyzing data from four nationally representative samples, we find that in the decades following 1972: (a) grades have risen at high schools and dropped at four-year colleges, in general, and selective four-year institutions, in particular; and (b) the signaling power of grades has attenuated little, if at all.

  1. Production of Food Grade Yeasts

    Directory of Open Access Journals (Sweden)

    Argyro Bekatorou

    2006-01-01

    Full Text Available Yeasts have been known to humans for thousands of years as they have been used in traditional fermentation processes like wine, beer and bread making. Today, yeasts are also used as alternative sources of high nutritional value proteins, enzymes and vitamins, and have numerous applications in the health food industry as food additives, conditioners and flavouring agents, for the production of microbiology media and extracts, as well as livestock feeds. Modern scientific advances allow the isolation, construction and industrial production of new yeast strains to satisfy the specific demands of the food industry. Types of commercial food grade yeasts, industrial production processes and raw materials are highlighted. Aspects of yeast metabolism, with respect to carbohydrate utilization, nutritional aspects and recent research advances are also discussed.

  2. Evaluating the impacts of grades on vehicular speeds on interstate highways.

    Directory of Open Access Journals (Sweden)

    Xinqiang Chen

    Full Text Available Grade variation on interstate highways affects the roadway geometric design, vehicle performance and driver behavior, thus possibly exerting an unexpected effect on vehicular speed. Hence, determining the internal relationship between grade and speed is important and useful for drivers, traffic regulators and other traffic participants. However, the problem with performing this research is the lack of large-scale gradient and speed data. Google Earth (GE provides an application programming interface for extracting elevation data worldwide. The elevation dataset from GE can be easily converted to grade data. In addition, our team has collected and stored speed series data for different freeways over several years. Based on the above obtainable grade and speed datasets, we conducted research on the effect of grades on free flow speeds from two perspectives. First, the influence of grades on speed was analyzed from both quantitative and qualitative aspects. The analysis of the distributions of four typical types of speeds demonstrated a decreasing tendency as the speed increased. Steeper grades generated a more intense speed fluctuation in terms of the four types of speeds. Second, a model based on the Student's t-test was developed to evaluate the level of significant difference among speed series under neighboring grades. The Student's t-test demonstrated that adjacent grades do not significantly influence the speeds. In summary, speeds under different grades showed obviously different tendencies. The findings of this study can help transport authorities set more reasonable speed limits and improve the geometric design of interstates with grade variation constraints.

  3. An Effort to Close Achievement Gaps at Scale through Self-Affirmation

    Science.gov (United States)

    Borman, Geoffrey D.; Grigg, Jeffrey; Hanselman, Paul

    2016-01-01

    In this districtwide scale-up, we randomly assigned seventh-grade students within 11 schools to receive a series of writing exercises designed to promote values affirmation. Impacts on cumulative seventh-grade grade point average (GPA) for the district's racial/ethnic minority students who may be subject to stereotype threat are consistent with…

  4. Processing of low-grade uranium ores

    International Nuclear Information System (INIS)

    Michel, P.

    1975-01-01

    Four types of low grade ores are studied. Low grade ores which must be extracted because they are enclosed in a normal grade deposit. Heap leaching is the processing method which is largely used. It allows to obtain solutions or preconcentrates which may be delivered at the nearest plant. Normal grade ores contained in a low amplitude deposit which can be processed using leaching as far as the operation does not need any large expensive equipment. Medium grade ores in medium amplitude deposits to which a simplified conventional process can be applied using fast heap leaching. Low grade ores in large deposits. The processing possibilities leading to use in place leaching are explained. The operating conditions of the method are studied (leaching agent, preparation of the ore deposit to obtain a good tightness with regard to the hydrological system and to have a good contact between ore and reagent) [fr

  5. Processing of low grade uranium ores

    International Nuclear Information System (INIS)

    Michel, P.

    1978-10-01

    Four types of low-grade ores are studied: (1) Low-grade ores that must be extracted because they are enclosed in a normal-grade deposit. Heap leaching is the processing method which is largely used. (2) Normal-grade ores contained in low-amplitude deposits. They can be processed using in-place leaching as far as the operation does not need any large and expensive equipment. (3) Medium-grade ores in medium-amplitude deposits. A simplified conventional process can be applied using fast heap leaching. (4) Low-grade ores in large deposits. The report explains processing possibilities leading in most cases to the use of in-place leaching. The operating conditions of this method are laid out, especially the selection of the leaching agents and the preparation of the ore deposit

  6. Compositional control of continuously graded anode functional layer

    Science.gov (United States)

    McCoppin, J.; Barney, I.; Mukhopadhyay, S.; Miller, R.; Reitz, T.; Young, D.

    2012-10-01

    In this work, solid oxide fuel cells (SOFC's) are fabricated with linear-compositionally graded anode functional layers (CGAFL) using a computer-controlled compound aerosol deposition (CCAD) system. Cells with different CGAFL thicknesses (30 um and 50 um) are prepared with a continuous compositionally graded interface deposited between the electrolyte and anode support current collecting regions. The compositional profile was characterized using energy dispersive X-ray spectroscopic mapping. An analytical model of the compound aerosol deposition was developed. The model predicted compositional profiles for both samples that closely matched the measured profiles, suggesting that aerosol-based deposition methods are capable of creating functional gradation on length scales suitable for solid oxide fuel cell structures. The electrochemical performances of the two cells are analyzed using electrochemical impedance spectroscopy (EIS).

  7. Maslowian Scale.

    Science.gov (United States)

    Falk, C.; And Others

    The development of the Maslowian Scale, a method of revealing a picture of one's needs and concerns based on Abraham Maslow's levels of self-actualization, is described. This paper also explains how the scale is supported by the theories of L. Kohlberg, C. Rogers, and T. Rusk. After a literature search, a list of statements was generated…

  8. MRI differentiation of low-grade from high-grade appendicular chondrosarcoma

    International Nuclear Information System (INIS)

    Douis, Hassan; Singh, Leanne; Saifuddin, Asif

    2014-01-01

    To identify magnetic resonance imaging (MRI) features which differentiate low-grade chondral lesions (atypical cartilaginous tumours/grade 1 chondrosarcoma) from high-grade chondrosarcomas (grade 2, grade 3 and dedifferentiated chondrosarcoma) of the major long bones. We identified all patients treated for central atypical cartilaginous tumours and central chondrosarcoma of major long bones (humerus, femur, tibia) over a 13-year period. The MRI studies were assessed for the following features: bone marrow oedema, soft tissue oedema, bone expansion, cortical thickening, cortical destruction, active periostitis, soft tissue mass and tumour length. The MRI-features were compared with the histopathological tumour grading using univariate, multivariate logistic regression and receiver operating characteristic curve (ROC) analyses. One hundred and seventy-nine tumours were included in this retrospective study. There were 28 atypical cartilaginous tumours, 79 grade 1 chondrosarcomas, 36 grade 2 chondrosarcomas, 13 grade 3 chondrosarcomas and 23 dedifferentiated chondrosarcomas. Multivariate analysis demonstrated that bone expansion (P = 0.001), active periostitis (P = 0.001), soft tissue mass (P < 0.001) and tumour length (P < 0.001) were statistically significant differentiating factors between low-grade and high-grade chondral lesions with an area under the ROC curve of 0.956. On MRI, bone expansion, active periostitis, soft tissue mass and tumour length can reliably differentiate high-grade chondrosarcomas from low-grade chondral lesions of the major long bones. (orig.)

  9. MRI differentiation of low-grade from high-grade appendicular chondrosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Douis, Hassan; Singh, Leanne; Saifuddin, Asif [The Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom)

    2014-01-15

    To identify magnetic resonance imaging (MRI) features which differentiate low-grade chondral lesions (atypical cartilaginous tumours/grade 1 chondrosarcoma) from high-grade chondrosarcomas (grade 2, grade 3 and dedifferentiated chondrosarcoma) of the major long bones. We identified all patients treated for central atypical cartilaginous tumours and central chondrosarcoma of major long bones (humerus, femur, tibia) over a 13-year period. The MRI studies were assessed for the following features: bone marrow oedema, soft tissue oedema, bone expansion, cortical thickening, cortical destruction, active periostitis, soft tissue mass and tumour length. The MRI-features were compared with the histopathological tumour grading using univariate, multivariate logistic regression and receiver operating characteristic curve (ROC) analyses. One hundred and seventy-nine tumours were included in this retrospective study. There were 28 atypical cartilaginous tumours, 79 grade 1 chondrosarcomas, 36 grade 2 chondrosarcomas, 13 grade 3 chondrosarcomas and 23 dedifferentiated chondrosarcomas. Multivariate analysis demonstrated that bone expansion (P = 0.001), active periostitis (P = 0.001), soft tissue mass (P < 0.001) and tumour length (P < 0.001) were statistically significant differentiating factors between low-grade and high-grade chondral lesions with an area under the ROC curve of 0.956. On MRI, bone expansion, active periostitis, soft tissue mass and tumour length can reliably differentiate high-grade chondrosarcomas from low-grade chondral lesions of the major long bones. (orig.)

  10. Sex, grade, and course differences in attitudes that are related to cognitive performance in secondary science

    Science.gov (United States)

    Levin, James; Seymour Fowler, H.

    The purpose of this study was to collect and analyze data on sexual differences in secondary school students' attitudes towards science. Attitudinal differences were also analyzed for the independent variables of science programs and grade levels. Data were collected from 988 students using a modified version of the Fennema-Sherman Mathematics Attitude Scales to represent attitudes toward science. Reliabilities of the modified science subscales were all high ( > 0.83). Multivariate analysis of variance (MANOVA) was used to analyze the data for the main and interaction effects of the independent variables of sex (male, female), grade level (10th, 11th, 12th), and science program (advanced placement, academic, general, terminal). Significant differences (p Scale, Science as a Male Domain Scale, and Teacher Scale. Although not significant, males evidenced more positive attitudes on all the remaining five subscales. Eleventh graders evidenced significantly more positive attitudes than tenth graders on all but the Effectance Motivation Scale. Students in 11th grade had more positive attitudes than 12th-grade students on all scales but Science as a Male Domain Scale; however, these differences were not significant. Tenth graders differed significantly from 12th graders on three subscales; Science Usefulness Scale, Confidence in Learning Science Scale, and Teacher Scale. Positive attitudes decreased from advanced placement to terminal programs. Academic students did not differ significantly from general students except on the Father Scale; however, they were significantly different (more positive) from the terminal students for all subscales. General students were also significantly different from terminal students except on the three subscales of Attitudes Toward Success in Science, Science as a Male Domain, and Effectance Motivation.

  11. Peer Victimization in Fifth Grade and Health in Tenth Grade

    Science.gov (United States)

    Elliott, Marc N.; Klein, David J.; Tortolero, Susan R.; Mrug, Sylvie; Peskin, Melissa F.; Davies, Susan L.; Schink, Elizabeth T.; Schuster, Mark A.

    2014-01-01

    BACKGROUND AND OBJECTIVES: Children who experience bullying, a type of peer victimization, show worse mental and physical health cross-sectionally. Few studies have assessed these relationships longitudinally. We examined longitudinal associations of bullying with mental and physical health from elementary to high school, comparing effects of different bullying histories. METHODS: We analyzed data from 4297 children surveyed at 3 time points (fifth, seventh, and tenth grades) in 3 cities. We used multivariable regressions to test longitudinal associations of bullying with mental and physical health by comparing youth who experienced bullying in both the past and present, experienced bullying in the present only, experienced bullying in the past only, or did not experience bullying. RESULTS: Bullying was associated with worse mental and physical health, greater depression symptoms, and lower self-worth over time. Health was significantly worse for children with both past and present bullying experiences, followed by children with present-only experiences, children with past-only experiences, and children with no experiences. For example, 44.6% of children bullied in both the past and present were at the lowest decile of psychosocial health, compared with 30.7% of those bullied in the present only (P = .005), 12.1% of those bullied in the past only (P bullied (P bullying are associated with substantially worse health. Clinicians who recognize bullying when it first starts could intervene to reverse the downward health trajectory experienced by youth who are repeated targets. PMID:24534401

  12. Toward a CFD-grade database addressing LWR containment phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Paladino, Domenico, E-mail: domenico.paladino@psi.ch [Laboratory for Thermal-Hydraulics, Nuclear Energy and Safety Department, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); Andreani, Michele; Zboray, Robert; Dreier, Joerg [Laboratory for Thermal-Hydraulics, Nuclear Energy and Safety Department, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland)

    2012-12-15

    Highlights: Black-Right-Pointing-Pointer The SETH-2 PANDA tests have supplied data with CFD-grade on plumes and jets at large-scale. Black-Right-Pointing-Pointer The PANDA tests have contributed to the understanding of phenomena with high safety relevance for LWRs. Black-Right-Pointing-Pointer The analytical activities related increased confidence in the use of various computational tools for safety analysis. - Abstract: The large-scale, multi-compartment PANDA facility (located at PSI in Switzerland) is one of the state-of-the-art facilities which is continuously upgraded to progressively match the requirements of CFD-grade experiments. Within the OECD/SETH projects, the PANDA facility has been used for the creation of an experimental database on basic containment phenomena e.g. gas mixing, transport, stratification, condensation. In the PANDA tests, these phenomena are driven by large scale plumes or jets. In the paper is presented a selection of the SETH PANDA experimental results. Examples of analytical activities performed at PSI using the GOTHIC, CFX-4 and CFX-5 codes will be used to illustrate how the spatial and temporal resolutions of the measurement grid in PANDA tests are adequate for CFD code (and advanced containment codes) assessment and validation purposes.

  13. Toward a CFD-grade database addressing LWR containment phenomena

    International Nuclear Information System (INIS)

    Paladino, Domenico; Andreani, Michele; Zboray, Robert; Dreier, Jörg

    2012-01-01

    Highlights: ► The SETH-2 PANDA tests have supplied data with CFD-grade on plumes and jets at large-scale. ► The PANDA tests have contributed to the understanding of phenomena with high safety relevance for LWRs. ► The analytical activities related increased confidence in the use of various computational tools for safety analysis. - Abstract: The large-scale, multi-compartment PANDA facility (located at PSI in Switzerland) is one of the state-of-the-art facilities which is continuously upgraded to progressively match the requirements of CFD-grade experiments. Within the OECD/SETH projects, the PANDA facility has been used for the creation of an experimental database on basic containment phenomena e.g. gas mixing, transport, stratification, condensation. In the PANDA tests, these phenomena are driven by large scale plumes or jets. In the paper is presented a selection of the SETH PANDA experimental results. Examples of analytical activities performed at PSI using the GOTHIC, CFX-4 and CFX-5 codes will be used to illustrate how the spatial and temporal resolutions of the measurement grid in PANDA tests are adequate for CFD code (and advanced containment codes) assessment and validation purposes.

  14. Framing scales and scaling frames

    NARCIS (Netherlands)

    van Lieshout, M.; Dewulf, A.; Aarts, N.; Termeer, K.

    2009-01-01

    Policy problems are not just out there. Actors highlight different aspects of a situation as problematic and situate the problem on different scales. In this study we will analyse the way actors apply scales in their talk (or texts) to frame the complex decision-making process of the establishment

  15. Management of subarachnoid hemorrhage classified grade V. Possibility of intravascular treatment

    Energy Technology Data Exchange (ETDEWEB)

    Uzura, Masahiko; Oshima, Kousuke; Morishima, Hiroyuki; Uchida, Kazuyoshi; Watanabe, Hiroyuki; Nakamura, Homare; Tanaka, Katsuyuki; Sekino, Hiroaki; Akashi, Katsuya [St. Marianna Univ., Kawasaki, Kanagawa (Japan). School of Medicine

    2001-10-01

    Management outcomes in poor-grade patients (World Federation of Neurological Surgeons Committee on a Universal Subarachnoid Hemorrhage Grading Scale Grade V) with ruptured cerebral aneurysms have historically been unsatisfactory. In the present study, we examined the possibility of intravascular treatment for ruptured aneurysm detected by 3-Dimensional CT angiography (3D-CTA) in poor-grade SAH patients. From April 1997 to July 2000, 3D-CTA was performed on 54 of 73 patients admitted with Grade V subarachnoid hemorrhage (SAH). Excluding 3 patients who underwent emergency surgery for ruptured aneurysms and intracerebral hematomas, CT findings from the remaining 51 patients were analyzed. The study included 23 men and 28 women, ranging in age from 28 to 91 with an average age of 63.6. The patients' initial scores on the Glasgow Coma Scale upon admission were 3 in 36 patients (including 19 patients who had undergone cardio-pulmonary arrest), 4 in 11 patients, 5 in 2 patients, and 6 in 2 patients. Ruptured aneurysms responsible for SAH were clearly delineated in 41 aneurysms from 39 patients, with 32 aneurysms in the anterior circulation and 9 in the posterior circulation. Patients with Glasgow Coma Scale of 4 or higher whose score did not progressively decrease for 12 hours after symptom onset were considered for intravascular treatment. In our study, 4 of 39 patients (10.3%) met these criteria. Glasgow Outcome Scale results were good recovery in 1 case, moderate disability in 1 case, severe disability in 1 case, and death in the remaining 48 cases. These results suggest that the management course for poor-grade (WFNS Grade V) SAH patients who retain brain stem reflexes contain the following: identification of aneurysms by 3D-CTA, maintenance of adequate sedation and external drainage to treat acute hydrocephalus, continued minimum 12-hour observation, monitoring levels of consciousness where possible, and consideration of aggressive therapy including

  16. What's in a Grade? Grading Policies and Practices in Principles of Economics

    Science.gov (United States)

    Walstad, William B.; Miller, Laurie A.

    2016-01-01

    Survey results from a national sample of economics instructors describe the grading policies and practices in principles of economics courses. The survey results provide insights about absolute and relative grading systems used by instructors, the course components and their weights that determine grades, and the type of assessment items used for…

  17. [Reproducibility of Fuhrman nuclear grade: advantages of a two-grade system].

    Science.gov (United States)

    Letourneux, Hervé; Lindner, Véronique; Lang, Hervé; Massfelder, Thierry; Meyer, Nicolas; Saussine, Christian; Jacqmin, Didier

    2006-06-01

    The Fuhrman nuclear grade is the reference histoprognostic grading system routinely used all over the world for renal cell carcinoma. Studies measuring the inter-observer and intra-observer concordance of Fuhrman grade show poor results in terms of reproducibility and repeatability. These variations are due to a certain degree of subjectivity of the pathologist in application of the definition of tumour grade, particularly nuclear grade. Elements able to account for this subjectivity in renal cell carcinoma are identified from a review of the literature. To improve the reliability of nuclear grade, the territory occupied by the highest grade must be specified and the grades should probably be combined. At the present time, regrouping of grade 1 and 2 tumours as low grade and grade 3 and 4 tumours as high grade would achieve better reproducibility, while preserving the prognostic: value for overall survival. The development of new treatment modalities and their use in adjuvant situations will imply the use of reliable histoprognostic factors to specify, indications.

  18. Teachers grading practices : an analysis of the reliability of teacher-assigned grade point average (GPA)

    NARCIS (Netherlands)

    van der Lans, R. M.; van de Grift, W. J. C. M.; van Veen, K.

    2015-01-01

    In previous research, teachers report that they use a hodgepodge of factors when grading students. This has led researchers to suspect that teacher-assigned grades are inflated by teacher-student interactions; the hodgepodge hypothesis. Teachers also are reported to differ in grading leniency; the

  19. The Impact of Early Exposure of Eighth Grade Math Standards on End of Grade Assessments

    Science.gov (United States)

    Robertson, Tonjai E.

    2016-01-01

    The purpose of this study was to examine the Cumberland County Schools district-wide issue surrounding the disproportional performance of eighth grade Math I students' proficiency scores on standardized end-of-grade and end-of-course assessments. The study focused on the impact of the school district incorporating eighth grade math standards in…

  20. Are Flunkers Social Outcasts? A Multilevel Study of Grade Retention Effects on Same-Grade Friendships

    Science.gov (United States)

    Demanet, Jannick; Van Houtte, Mieke

    2016-01-01

    We examine the association between grade retention and the number of same-grade friendships. Moreover, we investigate the effect of a school's proportion of retained students on these friendships and the moderating effect of this school characteristic on the relationship between retention and the number of same-grade friendships. Multilevel…

  1. Fifth Grade Elementary Students' Conceptions of Earthquakes

    Science.gov (United States)

    Savasci, Funda; Uluduz, Hatice

    2013-01-01

    This study intends to investigate the fifth grade students' conceptions of earthquakes. Twenty two grade 5 students (11-12 years old) from five different elementary schools in Istanbul voluntarily participated in the study. Data were collected from semi-structured interviews with each participant. Six interview questions were designed by…

  2. Matriculation Research Report: Incomplete Grades; Data & Analysis.

    Science.gov (United States)

    Gerda, Joe

    The policy on incomplete grades at California's College of the Canyons states that incompletes may only be given under circumstances beyond students' control and that students must make arrangements with faculty prior to the end of the semester to clear the incomplete. Failure to complete an incomplete may result in an "F" grade. While…

  3. The Leap into 4th Grade

    Science.gov (United States)

    Anderson, Mike

    2011-01-01

    Fourth grade is a pivotal year, in which students commonly face increased academic demands. According to Anderson, teachers can help students make a smooth transition to 4th grade by introducing these new challenges in ways that are in line with 4th graders' common developmental characteristics: incredible energy and emotion, industriousness and…

  4. Bruxism defined and graded: an international consensus

    NARCIS (Netherlands)

    Lobbezoo, F.; Ahlberg, J.; Glaros, A.G.; Kato, T.; Koyano, K.; Lavigne, G.J.; de Leeuw, R.; Manfredini, D.; Svensson, P.; Winocur, E.

    2013-01-01

    To date, there is no consensus about the definition and diagnostic grading of bruxism. A written consensus discussion was held among an international group of bruxism experts as to formulate a definition of bruxism and to suggest a grading system for its operationalisation. The expert group defined

  5. 7 CFR 51.2556 - Grades.

    Science.gov (United States)

    2010-01-01

    ... Standards for Grades of Shelled Pistachio Nuts § 51.2556 Grades. (a) “U.S. Fancy,” “U.S. Extra No. 1,” and “U.S. No. 1” consist of pistachio kernels which meet the following requirements: (1) Well dried, or...

  6. Contraction of graded su(2) algebra

    International Nuclear Information System (INIS)

    Patra, M.K.; Tripathy, K.C.

    1989-01-01

    The Inoenu-Wigner contraction scheme is extended to Lie superalgebras. The structure and representations of extended BRS algebra are obtained from contraction of the graded su(2) algebra. From cohomological consideration, we demonstrate that the graded su(2) algebra is the only superalgebra which, on contraction, yields the full BRS algebra. (orig.)

  7. What's ahead in automated lumber grading

    Science.gov (United States)

    D. Earl Kline; Richard Conners; Philip A. Araman

    1998-01-01

    This paper discusses how present scanning technologies are being applied to automatic lumber grading. The presentation focuses on 1) what sensing and scanning devices are needed to measure information for accurate grading feature detection, 2) the hardware and software needed to efficiently process this information, and 3) specific issues related to softwood lumber...

  8. Liberal Grading Improves Evaluations But Not Performance.

    Science.gov (United States)

    Vasta, Ross; Sarmiento, Robert F.

    Two grading distributions--a liberal and a more stringent curve--were compared between two sections of an undergraduate psychology course. The two classes were team taught and treated as similarly as possible. Four unit exams and an optional final were administered, with one section consistently receiving a more lenient grade distribution. No…

  9. Examining First Grade Teachers' Handwriting Instruction

    Science.gov (United States)

    Arslan, Derya

    2012-01-01

    The purpose of this study is to examine the first grade teachers' practices of handwriting instructions in terms of teaching, evaluation and handwriting difficulties. From qualitative research patterns, phenomenology was used. The study was applied to the 54 First grade teachers who work at central Burdur and Burdur county centre primary education…

  10. Extrauterine Low-Grade Endometrial Stromal Sarcoma

    Directory of Open Access Journals (Sweden)

    Yu-Ju Chen

    2005-12-01

    Conclusions: Low-grade endometrial stromal sarcoma typically has an indolent clinical course and favorable prognosis. Surgical resection is the primary therapeutic approach, and adjuvant therapy with radiotherapy, chemotherapy, or progesterone therapy should be considered for the management of residual or recurrent low-grade endometrial stromal sarcomas.

  11. Grade Repetition in Queensland State Prep Classes

    Science.gov (United States)

    Anderson, Robyn

    2012-01-01

    The current study considers grade repetition rates in the early years of schooling in Queensland state schools with specific focus on the pre-schooling year, Prep. In particular, it provides empirical evidence of grade repetition in Queensland state schools along with groups of students who are more often repeated. At the same time, much of the…

  12. Consumer Preference for Graded Maple Syrup

    Science.gov (United States)

    Paul E. Sendak

    1978-01-01

    The three grades of maple syrup and a commercial table syrup containing artificial flavor and 3 percent pure maple syrup were evaluated by 1,018 women in four cities. The results indicate that differences in preference for flavor are related to how close the respondents are to a maple syrup-production region. Differences in preference among grades of pure maple syrup...

  13. Determinants of College Grade Point Averages

    Science.gov (United States)

    Bailey, Paul Dean

    2012-01-01

    Chapter 2: The Role of Class Difficulty in College Grade Point Averages. Grade Point Averages (GPAs) are widely used as a measure of college students' ability. Low GPAs can remove a students from eligibility for scholarships, and even continued enrollment at a university. However, GPAs are determined not only by student ability but also by the…

  14. Grading sugar pine saw logs in trees.

    Science.gov (United States)

    John W. Henley

    1972-01-01

    Small limbs and small overgrown limbs cause problems when grading saw logs in sugar pine trees. Surface characteristics and lumber recovery information for 426 logs from 64 sugar pine trees were examined. Resulting modifications in the grading specification that allow a grader to ignore small limbs and small limb indicators do not appear to decrease the performance of...

  15. Prospective validation of a surgical complications grading system in a cohort of 2114 patients.

    Science.gov (United States)

    Mazeh, Haggi; Cohen, Oded; Mizrahi, Ido; Hamburger, Tamar; Stojadinovic, Alexander; Abu-Wasel, Bassam; Alaiyan, Bilal; Freund, Herbert R; Eid, Ahmed; Nissan, Aviram

    2014-05-01

    We recently reported a grading system for surgical complications. This system proved to have a high sensitivity for recording minor but meaningful complications prolonging hospital stay in patients after colorectal surgery. We aimed to prospectively validate the complication grading system in a general surgery department over 1 year. All surgical procedures and related complications were prospectively recorded between January 1st and December 31st, 2009. Surgical complications were graded on a severity scale of 1-5. The system classifies short-term outcome by grade emphasizing intensity of therapy required for treatment of the defined complication. During the study period, 2114 patients underwent surgery. Elective and oncological surgeries were performed in 1606 (76%) and 465 (22%) patients, respectively. There were 422 surgical complications in 304 (14%) patients (Grade 1/2: 203 [67%]; Grade 3/4: 90 [29%]; Grade 5: 11 [4%]). Median length of stay correlated significantly with complication severity: 2.3 d for no complication, 6.2 and 11.8 d for Grades 1/2 and 3/4, respectively (P 2 (OR 2.07, P Grade (OR 1.85, P = 0.001), oncological (OR 2.82, P 120 min (OR 2.08, P grading surgical complications permits standardized reporting of surgical morbidity according to the severity of impact. Prospective validation of this system supports its use in a general surgery setting as a tool for surgical outcome assessment and quality assurance. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Graded activity: legacy of the sanatorium.

    Science.gov (United States)

    Creighton, C

    1993-08-01

    Occupational therapists in all areas of practice grade therapeutic activities to help patients progress toward their goals. It is proposed in this paper that the concept of graded activity originated in German tuberculosis sanatoria in the late 1800s, when patients were required to walk on graded (sloped) land for exercise. British physician Marcus Paterson included work, as well as walking, in his graduated exercise program for tuberculosis patients and was honored for this innovation at the founding meeting of the National Society for the Promotion of Occupational Therapy (NSPOT). George Barton, Susan Tracy, and Herbert Hall were among the NSPOT members who contributed to the development of graded activity as a principle in occupational therapy intervention. The military rehabilitation programs established during World War I provided additional impetus, and by the mid-1920s, graded activity was recognized as central to the profession.

  17. Functionally Graded Adhesives for Composite Joints

    Science.gov (United States)

    Stapleton, Scott E.; Waas, Anthony M.; Arnold, Steven M.

    2012-01-01

    Adhesives with functionally graded material properties are being considered for use in adhesively bonded joints to reduce the peel stress concentrations located near adherend discontinuities. Several practical concerns impede the actual use of such adhesives. These include increased manufacturing complications, alterations to the grading due to adhesive flow during manufacturing, and whether changing the loading conditions significantly impact the effectiveness of the grading. An analytical study is conducted to address these three concerns. An enhanced joint finite element, which uses an analytical formulation to obtain exact shape functions, is used to model the joint. Furthermore, proof of concept testing is conducted to show the potential advantages of functionally graded adhesives. In this study, grading is achieved by strategically placing glass beads within the adhesive layer at different densities along the joint.

  18. Grading Dysphagia as a Toxicity of Head and Neck Cancer: Differences in Severity Classification Based on MBS DIGEST and Clinical CTCAE Grades.

    Science.gov (United States)

    Goepfert, Ryan P; Lewin, Jan S; Barrow, Martha P; Warneke, Carla L; Fuller, Clifton D; Lai, Stephen Y; Weber, Randal S; Hutcheson, Katherine A

    2018-04-01

    Clinician-reported toxicity grading through common terminology criteria for adverse events (CTCAE) stages dysphagia based on symptoms, diet, and tube dependence. The new dynamic imaging grade of swallowing toxicity (DIGEST) tool offers a similarly scaled five-point ordinal summary grade of pharyngeal swallowing as determined through results of a modified barium swallow (MBS) study. This study aims to inform clinicians on the similarities and differences between dysphagia severity according to clinical CTCAE and MBS-derived DIGEST grading. A cross-sectional sample of 95 MBS studies was randomly selected from a prospectively-acquired MBS database among patients treated with organ preservation strategies for head and neck cancer. MBS DIGEST and clinical CTCAE dysphagia grades were compared. DIGEST and CTCAE dysphagia grades had "fair" agreement per weighted κ of 0.358 (95% CI .231-.485). Using a threshold of DIGEST ≥ 3 as reference, CTCAE had an overall sensitivity of 0.50, specificity of 0.84, and area under the curve (AUC) of 0.67 to identify severe MBS-detected dysphagia. At less than 6 months, sensitivity was 0.72, specificity was 0.76, and AUC was 0.75 while at greater than 6 months, sensitivity was 0.22, specificity was 0.90, and AUC was 0.56 for CTCAE to detect dysphagia as determined by DIGEST. Classification of pharyngeal dysphagia on MBS using DIGEST augments our understanding of dysphagia severity according to the clinically-derived CTCAE while maintaining the simplicity of an ordinal scale. DIGEST likely complements CTCAE toxicity grading through improved specificity for physiologic dysphagia in the acute phase and improved sensitivity for dysphagia in the late-phase.

  19. Automated tone grading of granite

    International Nuclear Information System (INIS)

    Catalina Hernández, J.C.; Fernández Ramón, G.

    2017-01-01

    The production of a natural stone processing plant is subject to the intrinsic variability of the stone blocks that constitute its raw material, which may cause problems of lack of uniformity in the visual appearance of the produced material that often triggers complaints from customers. The best way to tackle this problem is to classify the product according to its visual features, which is traditionally done by hand: an operator observes each and every piece that comes out of the production line and assigns it to the closest match among a number of predefined classes, taking into account visual features of the material such as colour, texture, grain, veins, etc. However, this manual procedure presents significant consistency problems, due to the inherent subjectivity of the classification performed by each operator, and the errors caused by their progressive fatigue. Attempts to employ automated sorting systems like the ones used in the ceramic tile industry have not been successful, as natural stone presents much higher variability than ceramic tiles. Therefore, it has been necessary to develop classification systems specifically designed for the treatment of the visual parameters that distinguish the different types of natural stone. This paper describes the details of a computer vision system developed by AITEMIN for the automatic classification of granite pieces according to their tone, which provides an integral solution to tone grading problems in the granite processing and marketing industry. The system has been designed to be easily trained by the end user, through the learning of the samples established as tone patterns by the user. [es

  20. Low grade uranium ores as potential sources of raw material

    International Nuclear Information System (INIS)

    Venzlaff, H.

    1976-01-01

    Reports on the uranium requirement and the uranium reserves show that, even if the demand were to be stretched out slightly, the rate of new discoveries of uranium would have to be doubled or even tripled within a few years in order to ensure supply. Despite some spectacular discoveries of large scale deposits in Australia it must be said that only very few truly new uranium provinces have been discovered over the past twenty years. In this situation more attention is now being devoted to low grade uranium depositis, to findings whose concentration does not exceed 1,000 ppm. These deposits contain quantities of uranium many times larger than the deposits that can now be mined at prices up to 30/lb of U 3 O 8 . Even now low grade uranium ore is being mined as a byproduct, with the actual valuable mineral producing most of the income from mining activities. However, if one strikes a balance in this situation, one finds that only part of the requirement can be met in this way. Hence, all possibilities must be exhausted to mine uranium as a byproduct, new techniques of uranium production from low grade ores must be developed, and also conventional prospection must be intensified, if the continuity of supply of the nuclear power stations in the eighties and nineties is to be guaranteed. (orig.) [de

  1. Non-operative management versus operative management in high-grade blunt hepatic injury.

    Science.gov (United States)

    Cirocchi, Roberto; Trastulli, Stefano; Pressi, Eleonora; Farinella, Eriberto; Avenia, Stefano; Morales Uribe, Carlos Hernando; Botero, Ana Maria; Barrera, Luis M

    2015-08-24

    Surgery used to be the treatment of choice in cases of blunt hepatic injury, but this approach gradually changed over the last two decades as increasing non-operative management (NOM) of splenic injury led to its use for hepatic injury. The improvement in critical care monitoring and computed tomographic scanning, as well as the more frequent use of interventional radiology techniques, has helped to bring about this change to non-operative management. Liver trauma ranges from a small capsular tear, without parenchymal laceration, to massive parenchymal injury with major hepatic vein/retrohepatic vena cava lesions. In 1994, the Organ Injury Scaling Committee of the American Association for the Surgery of Trauma (AAST) revised the Hepatic Injury Scale to have a range from grade I to VI. Minor injuries (grade I or II) are the most frequent liver injuries (80% to 90% of all cases); severe injuries are grade III-V lesions; grade VI lesions are frequently incompatible with survival. In the medical literature, the majority of patients who have undergone NOM have low-grade liver injuries. The safety of NOM in high-grade liver lesions, AAST grade IV and V, remains a subject of debate as a high incidence of liver and collateral extra-abdominal complications are still described. To assess the effects of non-operative management compared to operative management in high-grade (grade III-V) blunt hepatic injury. The search for studies was run on 14 April 2014. We searched the Cochrane Injuries Group's Specialised Register, The Cochrane Library, Ovid MEDLINE(R), Ovid MEDLINE(R) In-Process & Other Non-Indexed Citations, Ovid MEDLINE(R) Daily and Ovid OLDMEDLINE(R), Embase Classic+Embase (Ovid), PubMed, ISI WOS (SCI-EXPANDED, SSCI, CPCI-S & CPSI-SSH), clinical trials registries, conference proceedings, and we screened reference lists. All randomised trials that compare non-operative management versus operative management in high-grade blunt hepatic injury. Two authors independently

  2. Scaling down

    Directory of Open Access Journals (Sweden)

    Ronald L Breiger

    2015-11-01

    Full Text Available While “scaling up” is a lively topic in network science and Big Data analysis today, my purpose in this essay is to articulate an alternative problem, that of “scaling down,” which I believe will also require increased attention in coming years. “Scaling down” is the problem of how macro-level features of Big Data affect, shape, and evoke lower-level features and processes. I identify four aspects of this problem: the extent to which findings from studies of Facebook and other Big-Data platforms apply to human behavior at the scale of church suppers and department politics where we spend much of our lives; the extent to which the mathematics of scaling might be consistent with behavioral principles, moving beyond a “universal” theory of networks to the study of variation within and between networks; and how a large social field, including its history and culture, shapes the typical representations, interactions, and strategies at local levels in a text or social network.

  3. GRADE INFLATION: An Issue for Higher Education?

    Directory of Open Access Journals (Sweden)

    Donald L. CARUTH,

    2013-01-01

    Full Text Available Grade inflation impacts university credibility, student courses of study, choices of institution, and other areas. There has been an upward shift in grades without a corresponding upward shift in knowledge gained. Some of the most frequently mentioned causes of grade inflation are: Ø student evaluations of professors, Ø student teacher dynamics, Ø merit-based financial aid, and Ø student expectations. Ø Among the reasons for higher student grades on the part of professors are: Ø fear of student evaluations, Ø avoidance of bad relations with students, Ø below average teaching skills,Ø lack of experience, Ø a lack of clearly stated objectives, and Ø job security. While grades are not a perfect answer to assessing student performance in a course they are still the best answer we have for evaluating students. In order to evaluate students more accurately, universities must identify the problems in grading and grading practices. Once this is accomplished new practices can be designed and policies implemented.

  4. Power calculation of grading device in desintegrator

    Science.gov (United States)

    Bogdanov, V. S.; Semikopenko, I. A.; Vavilov, D. V.

    2018-03-01

    This article describes the analytical method of measuring the secondary power consumption, necessitated by the installation of a grading device in the peripheral part of the grinding chamber in the desintegrator. There is a calculation model for defining the power input of the disintegrator increased by the extra power demand, required to rotate the grading device and to grind the material in the area between the external row of hammers and the grading device. The work has determined the inertia moments of a cylindrical section of the grading device with armour plates. The processing capacity of the grading device is adjusted to the conveying capacity of the auger feeder. The grading device enables one to increase the concentration of particles in the peripheral part of the grinding chamber and the amount of interaction between particles and armour plates as well as the number of colliding particles. The perforated sections provide the output of the ground material with the proper size granules, which together with the effects of armour plates, improves the efficiency of grinding. The power demand to rotate the grading device does not exceed the admissible value.

  5. Alternative Grading Systems. The Practitioner, Vol. III, No. 3.

    Science.gov (United States)

    De Leonibus, Nancy; Thomson, Scott

    After examining some of the pros and cons of traditional grading, the demands colleges make on grading practices, and the responses of people interested in grading, a number of examples of operating alternative systems are given. The alternatives include a dual (pass/withdraw grading in some courses, traditional grading in others) system, a…

  6. 7 CFR 51.1578 - Off-Grade potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Off-Grade potatoes. 51.1578 Section 51.1578... STANDARDS) United States Consumer Standards for Potatoes Off-Grade § 51.1578 Off-Grade potatoes. Potatoes which fail to meet the requirements of any of the foregoing grades shall be Off-Grade potatoes...

  7. Chinese handwriting performance in preterm children in grade 2

    Science.gov (United States)

    Chang, Shao-Hsia; Hong, Rong-Bin

    2018-01-01

    Background First graders born prematurely perform poorly on handwriting speed and legibility. However, whether there are specific legibility factors in which preterm children demonstrate difficulty remains unknown. In addition, handwriting performance beyond the first grade and the influence of sex on handwriting performance in preterm children are still unclear. We aimed to investigate the influence of prematurity and sex on multiple dimensions of handwriting in grade two and to identify the contributors to performance. Methods Sixty-three preterm (34 boys and 29 girls) and 67 full-term (27 boys and 40 girls) peers in grade two were included. Class teachers were asked to complete the Chinese Handwriting Evaluation Form. A subgroup of 39 preterm children received assessments on intelligence, visual perception, tactile and kinesthetic sensation, and fine motor skills. Their inattention behavior was rated using a maternal self-report with a behavioral scale. Results Boys born prematurely exhibited poorer performance in the speed dimension than full-term boys (p = 0.008), whereas there was comparable performance in the two groups of girls (p = 0.221). In the dimensions related to legibility, preterm boys (32.4%) had a higher percentage of children with difficulty in the construction dimension than the other groups (preterm girls: 6.9%, full-term boys: 7.4%, full-term girls: 5.0%). However, no group difference was found in the dimensions of accuracy and directionality. Of the sensory-perceptual-motor factors, attention was the most significant predictor of accuracy in performance (p = 0.046) and speed dimensions (p = 0.001) in preterm children. Conclusions Boys appear to be vulnerable to the adverse impacts of preterm birth in terms of performance in the dimensions of speed and construction in grade two. Based on the significant contribution of attention to handwriting performance in preterm children, assessment and intervention in the area of attention is strongly

  8. KNO scaling

    International Nuclear Information System (INIS)

    Golokhvastov, A.I.; )

    2001-01-01

    A correct version of the KNO scaling of multiplicity distributions is discussed in detail. Some assertions on KNO-scaling violation based on the misinterpretation of experimental data behavior are analyzed. An accurate comparison with experiment is presented for the distributions of negative particles in e + e - annihilation at √S = 3 - 161 GeV, in inelastic pp interactions at √S = 2.4 - 62 GeV and in nucleus-nucleus interactions at p lab = 4.5 - 520 GeV/c per nucleon. The p-bar p data at √S 546 GeV are considered [ru

  9. Asymmetric acoustic transmission in graded beam

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Li, E-mail: lj94172350@hotmail.com [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Wu, Jiu Hui, E-mail: ejhwu@mail.xjtu.edu.cn [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Guan, Dong; Lu, Kuan [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Gao, Nansha [School of Marine Science and Technology, Northwestern Polytechnical University, Xi’an, Shaanxi 710072 (China); Songhua, Cao [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China)

    2016-12-01

    We demonstrate the dynamic effective material parameters and vibration performance of a graded beam. The structure of the beam was composed of several unit cells with different fill factors. The dispersion relations and energy band structures of each unit cell were calculated using the finite element method (FEM). The dynamic effective material parameters in each unit cell of the graded beam were determined by the dispersion relations and energy band structures. Longitudinal wave propagation was investigated using a numerical method and FEM. The results show that the graded beam allows asymmetric acoustic transmission over a wide range of frequencies.

  10. Graded Alternating-Time Temporal Logic

    Science.gov (United States)

    Faella, Marco; Napoli, Margherita; Parente, Mimmo

    Graded modalities enrich the universal and existential quantifiers with the capability to express the concept of at least k or all but k, for a non-negative integer k. Recently, temporal logics such as μ-calculus and Computational Tree Logic, Ctl, augmented with graded modalities have received attention from the scientific community, both from a theoretical side and from an applicative perspective. Both μ-calculus and Ctl naturally apply as specification languages for closed systems: in this paper, we add graded modalities to the Alternating-time Temporal Logic (Atl) introduced by Alur et al., to study how these modalities may affect specification languages for open systems.

  11. Fracture of functionally graded materials: application to hydrided zircaloy

    International Nuclear Information System (INIS)

    Perales, F.

    2005-12-01

    This thesis is devoted to the dynamic fracture of functionally graded materials. More particularly, it deals with the toughness of nuclear cladding at high burnup submitted to transient loading. The fracture is studied at local scale using cohesive zone model in a multi body approach. Cohesive zone models include frictional contact to take into account mixed mode fracture. Non smooth dynamics problems are treated within the Non-Smooth Contact Dynamics framework. A multi scale study is necessary because of the dimension of the clad. At microscopic scale, the effective properties of surface law, between each body, are obtained by periodic numerical homogenization. A two fields Finite Element formulation is so written. An extended formulation of the NSCD framework is obtained. The associated software allows to simulate, in finite deformation, from the crack initiation to post-fracture behavior in heterogeneous materials. At microscopic scale, random RVE calculations are made to determine effective properties. At macroscopic scale, calculations of part of clad are made to determine the role of the mean hydrogen concentration and gradient of hydrogen parameters in the toughness of the clad under dynamic loading. (author)

  12. Academic performance in human anatomy and physiology classes: a 2-yr study of academic motivation and grade expectation.

    Science.gov (United States)

    Sturges, Diana; Maurer, Trent W; Allen, Deborah; Gatch, Delena Bell; Shankar, Padmini

    2016-03-01

    This project used a nonexperimental design with a convenience sample and studied the relationship between academic motivation, grade expectation, and academic performance in 1,210 students enrolled in undergraduate human anatomy and physiology (HAP) classes over a 2-yr period. A 42-item survey that included 28 items of the adapted academic motivation scale for HAP based on self-determination theory was administered in class during the first 3 wk of each semester. Students with higher grade point averages, who studied for longer hours and reported to be more motivated to succeed, did better academically in these classes. There was a significant relationship between students' scores on the adapted academic motivation scale and performance. Students were more extrinsically motivated to succeed in HAP courses than intrinsically motivated to succeed, and the analyses revealed that the most significant predictor of final grade was within the extrinsic scale (introjected and external types). Students' motivations remained stable throughout the course sequence. The data showed a significant relationship between HAP students' expected grade and their final grade in class. Finally, 65.5% of students overestimated their final grade, with 29% of students overestimating by two to four letter grades. Copyright © 2016 The American Physiological Society.

  13. Scaling satan.

    Science.gov (United States)

    Wilson, K M; Huff, J L

    2001-05-01

    The influence on social behavior of beliefs in Satan and the nature of evil has received little empirical study. Elaine Pagels (1995) in her book, The Origin of Satan, argued that Christians' intolerance toward others is due to their belief in an active Satan. In this study, more than 200 college undergraduates completed the Manitoba Prejudice Scale and the Attitudes Toward Homosexuals Scale (B. Altemeyer, 1988), as well as the Belief in an Active Satan Scale, developed by the authors. The Belief in an Active Satan Scale demonstrated good internal consistency and temporal stability. Correlational analyses revealed that for the female participants, belief in an active Satan was directly related to intolerance toward lesbians and gay men and intolerance toward ethnic minorities. For the male participants, belief in an active Satan was directly related to intolerance toward lesbians and gay men but was not significantly related to intolerance toward ethnic minorities. Results of this research showed that it is possible to meaningfully measure belief in an active Satan and that such beliefs may encourage intolerance toward others.

  14. Sonographic features of invasive ductal breast carcinomas predictive of malignancy grade

    Directory of Open Access Journals (Sweden)

    Kanika Gupta

    2018-01-01

    Full Text Available Context: Assessment of individual sonographic features provides vital clues about the biological behavior of breast masses and can assist in determining histological grade of malignancy and thereby prognosis. Aims: Assessment of individual sonographic features of biopsy proven invasive ductal breast carcinomas as predictors of malignancy grade. Settings and Design: A retrospective analysis of sonographic findings of 103 biopsy proven invasive ductal breast carcinomas. Materials and Methods: Tumor characteristics on gray-scale ultrasound and color flow were assessed using American College of Radiology (ACR Breast Imaging Reporting and Data System (BI-RADS Atlas Fifth Edition. The sonographic findings of masses were individually correlated with their histopathologic grades. Statistical Analysis Used: Chi square test, ordinal regression, and Goodman and Kruskal tau test. Results: Breast mass showing reversal/lack of diastolic flow has a high probability of belonging to histological high grade tumor ( β 1.566, P 0.0001. The masses with abrupt interface boundary are more likely grade 3 ( β 1.524, P 0.001 in comparison to masses with echogenic halos. The suspicious calcifications present in and outside the mass is a finding associated with histologically high grade tumors. The invasive ductal carcinomas (IDCs with complex solid and cystic echotexture are more likely to be of high histological grade ( β 1.146, P 0.04 as compared to masses with hypoechoic echotexture. Conclusions: Certain ultrasound features are associated with tumor grade on histopathology. If the radiologist is cognizant of these sonographic features, ultrasound can be a potent modality for predicting histopathological grade of IDCs of the breast, especially in settings where advanced tests such as receptor and molecular analyses are limited.

  15. Sonographic features of invasive ductal breast carcinomas predictive of malignancy grade.

    Science.gov (United States)

    Gupta, Kanika; Kumaresan, Meenakshisundaram; Venkatesan, Bhuvaneswari; Chandra, Tushar; Patil, Aruna; Menon, Maya

    2018-01-01

    Assessment of individual sonographic features provides vital clues about the biological behavior of breast masses and can assist in determining histological grade of malignancy and thereby prognosis. Assessment of individual sonographic features of biopsy proven invasive ductal breast carcinomas as predictors of malignancy grade. A retrospective analysis of sonographic findings of 103 biopsy proven invasive ductal breast carcinomas. Tumor characteristics on gray-scale ultrasound and color flow were assessed using American College of Radiology (ACR) Breast Imaging Reporting and Data System (BI-RADS) Atlas Fifth Edition. The sonographic findings of masses were individually correlated with their histopathologic grades. Chi square test, ordinal regression, and Goodman and Kruskal tau test. Breast mass showing reversal/lack of diastolic flow has a high probability of belonging to histological high grade tumor ( β 1.566, P 0.0001 ). The masses with abrupt interface boundary are more likely grade 3 ( β 1.524, P 0.001 ) in comparison to masses with echogenic halos. The suspicious calcifications present in and outside the mass is a finding associated with histologically high grade tumors. The invasive ductal carcinomas (IDCs) with complex solid and cystic echotexture are more likely to be of high histological grade ( β 1.146, P 0.04 ) as compared to masses with hypoechoic echotexture. Certain ultrasound features are associated with tumor grade on histopathology. If the radiologist is cognizant of these sonographic features, ultrasound can be a potent modality for predicting histopathological grade of IDCs of the breast, especially in settings where advanced tests such as receptor and molecular analyses are limited.

  16. Development of processes for the production of solar grade silicon from halides and alkali metals

    Science.gov (United States)

    Dickson, C. R.; Gould, R. K.

    1980-01-01

    High temperature reactions of silicon halides with alkali metals for the production of solar grade silicon in volume at low cost were studied. Experiments were performed to evaluate product separation and collection processes, measure heat release parameters for scaling purposes, determine the effects of reactants and/or products on materials of reactor construction, and make preliminary engineering and economic analyses of a scaled-up process.

  17. ENERGY STAR Laboratory Grade Refrigerators and Freezers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Laboratory Grade Refrigerators and Freezers that...

  18. High Performance Graded Index Polymer Optical Fibers

    National Research Council Canada - National Science Library

    Garito, Anthony

    1998-01-01

    ...) plastic optical fibers (POF) and graded index (GI) POFs are reported. A set of criteria and analyses of physical parameters are developed in context to the major issues of POF applications in short-distance communication systems...

  19. Bruxism defined and graded: an international consensus.

    Science.gov (United States)

    Lobbezoo, F; Ahlberg, J; Glaros, A G; Kato, T; Koyano, K; Lavigne, G J; de Leeuw, R; Manfredini, D; Svensson, P; Winocur, E

    2013-01-01

    To date, there is no consensus about the definition and diagnostic grading of bruxism. A written consensus discussion was held among an international group of bruxism experts as to formulate a definition of bruxism and to suggest a grading system for its operationalisation. The expert group defined bruxism as a repetitive jaw-muscle activity characterised by clenching or grinding of the teeth and/or by bracing or thrusting of the mandible. Bruxism has two distinct circadian manifestations: it can occur during sleep (indicated as sleep bruxism) or during wakefulness (indicated as awake bruxism). For the operationalisation of this definition, the expert group proposes a diagnostic grading system of 'possible', 'probable' and 'definite' sleep or awake bruxism. The proposed definition and grading system are suggested for clinical and research purposes in all relevant dental and medical domains. © 2012 Blackwell Publishing Ltd.

  20. Kindergarten Predictors of Third Grade Writing

    Science.gov (United States)

    Kim, Young-Suk; Al Otaiba, Stephanie; Wanzek, Jeanne

    2015-01-01

    The primary goal of the present study was to examine the relations of kindergarten transcription, oral language, word reading, and attention skills to writing skills in third grade. Children (N = 157) were assessed on their letter writing automaticity, spelling, oral language, word reading, and attention in kindergarten. Then, they were assessed on writing in third grade using three writing tasks – one narrative and two expository prompts. Children’s written compositions were evaluated in terms of writing quality (the extent to which ideas were developed and presented in an organized manner). Structural equation modeling showed that kindergarten oral language and lexical literacy skills (i.e., word reading and spelling) were independently predicted third grade narrative writing quality, and kindergarten literacy skill uniquely predicted third grade expository writing quality. In contrast, attention and letter writing automaticity were not directly related to writing quality in either narrative or expository genre. These results are discussed in light of theoretical and practical implications. PMID:25642118

  1. Statistical Content in Middle Grades Mathematics Textbooks

    Science.gov (United States)

    Pickle, Maria Consuelo Capiral

    2012-01-01

    This study analyzed the treatment and scope of statistical concepts in four, widely-used, contemporary, middle grades mathematics textbook series: "Glencoe Math Connects," "Prentice Hall Mathematics," "Connected Mathematics Project," and "University of Chicago School Mathematics Project." There were three…

  2. Doubly graded sigma model with torsion

    International Nuclear Information System (INIS)

    Kowalski-Glikman, J.

    1986-08-01

    Using the Hull-Witten construction we show how to introduce torsion to the doubly graded sigma model. This construction enables us to find a link between this model and the ten-dimensional supergravity theory in superspace. (Auth.)

  3. Graded contractions of Jordan algebras and of their representations

    International Nuclear Information System (INIS)

    Kashuba, Iryna; Patera, JirI

    2003-01-01

    Contractions of Jordan algebras and Jordan superalgebras which preserve a chosen grading are defined and studied. Simultaneous grading of Jordan algebras and their representation spaces is used to develop a theory of grading, preserving contractions of representations of Jordan algebras

  4. The Interaction Effects of Gender and Grade Level on Secondary School Students' Attitude towards Learning Chemistry

    Science.gov (United States)

    Heng, Chua Kah; Karpudewan, Mageswary

    2015-01-01

    This quantitative study reports the effects of gender and grade level on secondary students' attitude towards chemistry lessons. For this purpose, the Attitude towards Chemistry Lessons Scale (ATCLS) was administered to 446 secondary school students between 16-19 years old. The ATCLS consists of four different subscales: liking for chemistry…

  5. Perceived Severity of Cyberbullying Behaviour: Differences between Genders, Grades and Participant Roles

    Science.gov (United States)

    Chen, Li-Ming; Cheng, Ying-Yao

    2017-01-01

    This study aimed to develop a new scale to examine primary and secondary school students' perceptions of the severity of cyberbullying behaviours, and to explore further whether differences exist in the means of gender, grade and participant role. A total of 707 primary and secondary school students (M = 14.7) in Taiwan participated in this study.…

  6. An Investigation of Mathematics Anxiety among Sixth through Eighth Grade Students in Turkey

    Science.gov (United States)

    Birgin, Osman; Baloglu, Mustafa; Catlioglu, Hakan; Gurbuz, Ramazan

    2010-01-01

    The purpose of the present study is to investigate mathematics anxiety among 220 sixth through eighth grade Turkish students in terms of mathematics achievement levels, perceived enjoyment of the mathematics teaching method, perceived enjoyment of mathematics, and perceived help with mathematics from parents. The Mathematics Anxiety Scale for…

  7. Goal: A Grading System That Demands Excellence on the Playing Field

    Science.gov (United States)

    Cady, Jennifer R.

    2011-01-01

    Despite the vast array of educational practices that are present in today's society, grading is one practice that has established a historical foundation and one that will continue to be an important aspect to the profession of education. This small scale study determined that both undergraduate and graduate learners, in one college instructor's…

  8. Younger Children's Changing Self-Concepts: Boys and Girls from Preschool through Second Grade

    Science.gov (United States)

    Mantzicopoulos, Panayota

    2006-01-01

    The author investigated age- and gender-related changes in self-evaluative judgments of 87 children followed from preschool through 2nd grade. Focusing on cognitive, physical, and peer competence assessed by the Pictorial Scale of Perceived Competence and Social Acceptance (PSPCSA; S. Harter & R. Pike, 1984), the author tested PSPCSA subscale…

  9. Testing the Theory of Successful Intelligence in Teaching Grade 4 Language Arts, Mathematics, and Science

    Science.gov (United States)

    Sternberg, Robert J.; Jarvin, Linda; Birney, Damian P.; Naples, Adam; Stemler, Steven E.; Newman, Tina; Otterbach, Renate; Parish, Carolyn; Randi, Judy; Grigorenko, Elena L.

    2014-01-01

    This study addressed whether prior successes with educational interventions grounded in the theory of successful intelligence could be replicated on a larger scale as the primary basis for instruction in language arts, mathematics, and science. A total of 7,702 4th-grade students in the United States, drawn from 223 elementary school classrooms in…

  10. The effect of two grading systems on the performance of medical students during oral examinations

    DEFF Research Database (Denmark)

    Ba-Ali, Shakoor; Jemec, Gregor B E; Sander, Birgit

    2017-01-01

    INTRODUCTION: Either a pass/fail approach or a seven-point grading scale are used to evaluate students at the Danish universities. The aim of this study was to explore any effect of the assessment methods on student performances during oral exams. METHODS: In a prospective study including 1,037 e...

  11. The Effect on the 8th Grade Students' Attitude towards Statistics of Project Based Learning

    Science.gov (United States)

    Koparan, Timur; Güven, Bülent

    2014-01-01

    This study investigates the effect of the project based learning approach on 8th grade students' attitude towards statistics. With this aim, an attitude scale towards statistics was developed. Quasi-experimental research model was used in this study. Following this model in the control group the traditional method was applied to teach statistics…

  12. Relationships among Perceived Stress, Coping, and Grade Point Average in University Students

    Science.gov (United States)

    Kewallal, Rajendra David

    2013-01-01

    This study explored the relationships among perceived stress, coping style, and academic performance in 210 students from a mid-sized public university and a small private college. Study participants were asked to complete the Perceived Stress Scale, the Brief COPE Questionnaire, and a demographic survey asking about their age, gender, grade point…

  13. An evaluation of the lamb and mutton carcase grading system in the ...

    African Journals Online (AJOL)

    %), Prima B (57%), Top C .... using a 15- and 18-point scale respectively. ... The average 'car- case thickness' (kg/cm) increased when carcase mass in- creased. This was most evident for carcases in the overfat grades, i.e. Lamb 2, B2 and C2.

  14. Pollination biology of basal angiosperms (ANITA Grade)

    Science.gov (United States)

    Leonard B. Thien; Peter Bernhardt; Margaret S. Devall; Zhi-Duan Chen; Yi-bo Luo; Jian-Hua Fan; Liang-Chen Yuan; Joseph H. Williams

    2009-01-01

    The fi rst three branches of the angiosperm phylogenetic tree consist of eight families with ~201 species of plants (the ANITA grade). The oldest fl ower fossil for the group is dated to the Early Cretaceous (115 – 125 Mya) and identifi ed to the Nymphaeales. The fl owers of extant plants in the ANITA grade are small, and pollen is the edible reward (rarely nectar or...

  15. Meat standards and grading: a world view.

    Science.gov (United States)

    Polkinghorne, R J; Thompson, J M

    2010-09-01

    This paper addresses the principles relating to meat standards and grading of beef and advances the concept that potential exists to achieve significant desirable change from adopting more consumer focused systems within accurate value-based payment frameworks. The paper uses the definitions that classification is a set of descriptive terms describing features of the carcass that are useful to those involved in the trading of carcasses, whereas grading is the placing of different values on carcasses for pricing purposes, depending on the market and requirements of traders. A third definition is consumer grading, which refers to grading systems that seek to define or predict consumer satisfaction with a cooked meal. The development of carcass classification and grading schemes evolved from a necessity to describe the carcass using standard terms to facilitate trading. The growth in world trade of meat and meat products and the transition from trading carcasses to marketing individual meal portions raises the need for an international language that can service contemporary needs. This has in part been addressed by the United Nations promoting standard languages on carcasses, cuts, trim levels and cutting lines. Currently no standards exist for describing consumer satisfaction. Recent Meat Standards Australia (MSA) research in Australia, Korea, Ireland, USA, Japan and South Africa showed that consumers across diverse cultures and nationalities have a remarkably similar view of beef eating quality, which could be used to underpin an international language on palatability. Consumer research on the willingness to pay for eating quality shows that consumers will pay higher prices for better eating quality grades and generally this was not affected by demographic or meat preference traits of the consumer. In Australia the MSA eating quality grading system has generated substantial premiums to retailers, wholesalers and to the producer. Future grading schemes which measure

  16. Direct behavior rating as a school-based behavior screener for elementary and middle grades.

    Science.gov (United States)

    Chafouleas, Sandra M; Kilgus, Stephen P; Jaffery, Rose; Riley-Tillman, T Chris; Welsh, Megan; Christ, Theodore J

    2013-06-01

    The purpose of this study was to investigate how Direct Behavior Rating Single Item Scales (DBR-SIS) involving targets of academically engaged, disruptive, and respectful behaviors function in school-based screening assessment. Participants included 831 students in kindergarten through eighth grades who attended schools in the northeastern United States. Teachers provided behavior ratings for a sample of students in their classrooms on the DBR-SIS, the Behavioral and Emotional Screening System (Kamphaus & Reynolds, 2007), and the Student Risk Screening Scale (Drummond, 1994). Given variations in rating procedures to accommodate scheduling differences across grades, analysis was conducted separately for elementary school and middle school grade levels. Results suggested that the recommended cut scores, the combination of behavior targets, and the resulting conditional probability indices varied depending on grade level grouping (lower elementary, upper elementary, middle). For example, for the lower elementary grade level grouping, a combination of disruptive behavior (cut score=2) and academically engaged behavior (cut score=8) was considered to offer the best balance among indices of diagnostic accuracy, whereas a cut score of 1 for disruptive behavior and 8 for academically engaged behavior were recommended for the upper elementary school grade level grouping and cut scores of 1 and 9, respectively, were suggested for middle school grade level grouping. Generally, DBR-SIS cut scores considered optimal for screening using single or combined targets including academically engaged behavior and disruptive behavior by offering a reasonable balance of indices for sensitivity (.51-.90), specificity (.47-.83), negative predictive power (.94-.98), and positive predictive power (.14-.41). The single target of respectful behavior performed poorly across all grade level groups, and performance of DBR-SIS targets was relatively better in the elementary school than middle

  17. Fatigue Characterization of Functionally Graded Metallic Alloys

    International Nuclear Information System (INIS)

    Silva, F. S.

    2008-01-01

    Functionally graded components exhibit spatial variations of mechanical properties in contrast with, and as an alternative to, purely homogeneous components. A large class of graded materials, however, are in fact mostly homogeneous materials with property variations (chemical or mechanical) restricted to a specific area or layer produced by applying for example a coating or by introducing sub-surface residual stresses. However, it is also possible to obtain graded materials with a smooth transition of mechanical properties along the entire component, for example in a 40 mm component. This is possible, for example, by using centrifugal casting technique or incremental melting and solidification technique. In this paper we will study fully metallic functionally graded components with a smooth gradient, focusing on fatigue crack propagation. Fatigue propagation will be assessed in the direction parallel to the gradation (in different homogeneous layers of the functionally graded component) to assess what would be fatigue crack propagation on the direction perpendicular to the gradation. Fatigue crack growth rate (standard mode I fatigue crack growth) will be correlated to the mode I stress intensity factor range. Other mechanical properties of different layers of the component (Young's modulus) will also be considered in this analysis. The effect of residual stresses along the component gradation on crack propagation will also be taken into account. A qualitative analysis of the effects of some important features, present in functionally graded materials, will be made based on the obtained results

  18. Nuclear scales

    International Nuclear Information System (INIS)

    Friar, J.L.

    1998-01-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the π-γ force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted

  19. Nuclear scales

    Energy Technology Data Exchange (ETDEWEB)

    Friar, J.L.

    1998-12-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the {pi}-{gamma} force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted.

  20. [Development of an activity of daily living scale for patients with COPD: the Activity of Daily Living Dyspnea scale].

    Science.gov (United States)

    Yoza, Yoshiyasu; Ariyoshi, Koya; Honda, Sumihisa; Taniguchi, Hiroyuki; Senjyu, Hideaki

    2009-10-01

    Patients with COPD often experience restriction in their activities of daily living (ADL) due to dyspnea. This type of restriction is unique to patients with COPD and cannot be adequately evaluated by the generic ADL scales. This study developed an ADL scale (the Activity of Daily Living Dyspnea scale [ADL-D scale]) for patients with COPD and investigated its validity and internal consistency. Patients with stable COPD were recruited and completed a pilot 26-item questionnaire. Patients also performed the Incremental Shuttle Walk Test (ISWT), and completed the St George's Respiratory Questionnaire (SGRQ), and Medical Research Council (MRC) dyspnea grade. There were 83 male participants who completed the pilot questionnaire. Following the pilot, 8 items that were not undertaken by the majority of subjects, and 3 items judged to be of low clinical importance by physical therapists were removed from the pilot questionnaire. The final ADL-D scale contained 15 items. Scores obtained with the ADL-D scale were significantly correlated with the MRC dyspnea grades, distance walked on the ISWT and SGRQ scores. The ADL-D scores were significantly different across the five grades of the MRC dyspnea grade. The ADL-D scale showed high consistency (Chronbach's alpha coefficient of 0.96). The ADL-D scale is a useful scale for assessing impairments in ADL in Japanese male patients with COPD.

  1. 大型資料庫國小四年級自然科學習成就評量標準設定結果之效度評估 Validation of the Standard Setting Procedure for a Large Scale 4th Grade Science

    Directory of Open Access Journals (Sweden)

    謝進昌 Jin-Chang Hsieh

    2011-03-01

    Full Text Available 學習成就評量資料庫建置目的之一,在於描述學生於各學科的學習成就表現概況;而學習成就表現的描述,即牽涉到標準設定議題。隨著臺灣學生學習成就評量資料庫對於國小四年級自然科之評量架構調整,致使沿用的表現標準已多不符合實務運用,而興起重新修訂之舉。本研究主要目的在於評估2009 年自然科學習成就評量國小四年級標準設定結果之效度,以Kane(1994, 2001)的效度評估證據為依據,藉由效度的過程證據、內部證據以及外部證據,作為標準設定結果之效度證據來源。結果發現,從各項效度證據來看,國小四年級自然科標準設定可由標準設定成員的組成及其回應、設定結果的一致性,以及外推論於數學成就的效度外部證據得到支持。本研究最後提出數項建議,供未來標準設定研究者參考。 One of the main purposes for constructing an academic achievement database is to understand the students’ academic performance for each content area. Standard setting is the main issue in the academic achievement. Due to the adjustment of the test blueprint for Taiwan Assessment of Student Achievement 4th grade science, the previous performance level description is outmoded for practice. Therefore, modifying the standards is necessary. The purpose of this study is to validate a science standard setting procedure designed for 2009 4th grade science students. Based on Kane’s (1994, 2001 framework for validation, this study collected procedural evidence, internal evidence, as well as external evidence using mathematics academic performance. Several suggestions are provided in the conclusion for further studies.

  2. Voxel-based clustered imaging by multiparameter diffusion tensor images for glioma grading.

    Science.gov (United States)

    Inano, Rika; Oishi, Naoya; Kunieda, Takeharu; Arakawa, Yoshiki; Yamao, Yukihiro; Shibata, Sumiya; Kikuchi, Takayuki; Fukuyama, Hidenao; Miyamoto, Susumu

    2014-01-01

    Gliomas are the most common intra-axial primary brain tumour; therefore, predicting glioma grade would influence therapeutic strategies. Although several methods based on single or multiple parameters from diagnostic images exist, a definitive method for pre-operatively determining glioma grade remains unknown. We aimed to develop an unsupervised method using multiple parameters from pre-operative diffusion tensor images for obtaining a clustered image that could enable visual grading of gliomas. Fourteen patients with low-grade gliomas and 19 with high-grade gliomas underwent diffusion tensor imaging and three-dimensional T1-weighted magnetic resonance imaging before tumour resection. Seven features including diffusion-weighted imaging, fractional anisotropy, first eigenvalue, second eigenvalue, third eigenvalue, mean diffusivity and raw T2 signal with no diffusion weighting, were extracted as multiple parameters from diffusion tensor imaging. We developed a two-level clustering approach for a self-organizing map followed by the K-means algorithm to enable unsupervised clustering of a large number of input vectors with the seven features for the whole brain. The vectors were grouped by the self-organizing map as protoclusters, which were classified into the smaller number of clusters by K-means to make a voxel-based diffusion tensor-based clustered image. Furthermore, we also determined if the diffusion tensor-based clustered image was really helpful for predicting pre-operative glioma grade in a supervised manner. The ratio of each class in the diffusion tensor-based clustered images was calculated from the regions of interest manually traced on the diffusion tensor imaging space, and the common logarithmic ratio scales were calculated. We then applied support vector machine as a classifier for distinguishing between low- and high-grade gliomas. Consequently, the sensitivity, specificity, accuracy and area under the curve of receiver operating characteristic

  3. Training readers to improve their accuracy in grading Crohn's disease activity on MRI

    International Nuclear Information System (INIS)

    Tielbeek, Jeroen A.W.; Bipat, Shandra; Boellaard, Thierry N.; Nio, C.Y.; Stoker, Jaap

    2014-01-01

    To prospectively evaluate if training with direct feedback improves grading accuracy of inexperienced readers for Crohn's disease activity on magnetic resonance imaging (MRI). Thirty-one inexperienced readers assessed 25 cases as a baseline set. Subsequently, all readers received training and assessed 100 cases with direct feedback per case, randomly assigned to four sets of 25 cases. The cases in set 4 were identical to the baseline set. Grading accuracy, understaging, overstaging, mean reading times and confidence scores (scale 0-10) were compared between baseline and set 4, and between the four consecutive sets with feedback. Proportions of grading accuracy, understaging and overstaging per set were compared using logistic regression analyses. Mean reading times and confidence scores were compared by t-tests. Grading accuracy increased from 66 % (95 % CI, 56-74 %) at baseline to 75 % (95 % CI, 66-81 %) in set 4 (P = 0.003). Understaging decreased from 15 % (95 % CI, 9-23 %) to 7 % (95 % CI, 3-14 %) (P < 0.001). Overstaging did not change significantly (20 % vs 19 %). Mean reading time decreased from 6 min 37 s to 4 min 35 s (P < 0.001). Mean confidence increased from 6.90 to 7.65 (P < 0.001). During training, overall grading accuracy, understaging, mean reading times and confidence scores improved gradually. Inexperienced readers need training with at least 100 cases to achieve the literature reported grading accuracy of 75 %. (orig.)

  4. Age-Related Grade Inflation Expectancies in a University Environment

    Directory of Open Access Journals (Sweden)

    Donald A. Loffredo

    2012-01-01

    Full Text Available Grade inflation is a recognized problem in higher education in the United States. Age, gender, and ethnic differences in discrepancies between student reports of their expected grade in each course and their expectations for general university grading practices were explored in a survey of 166 (mostly female participants at a small upper-division university. Results revealed that while a small minority of students agreed that grading systems in college should only include A or B grades, a large majority of students expected A or B grades. Thus, student discrepancies between their expectations for grading systems and their expected class grades were in line with expectations that they should receive inflated grades. Results also revealed statistically significant age differences in grade expectation with students older than the age of 55 expecting lower grades relative to their younger counterparts.

  5. An Investigation of the Relationships among 11th Grade Students' Attitudes toward Chemistry, Metacognition and Chemistry Achievement

    OpenAIRE

    KINGIR, Sevgi; AYDEMİR, Nurdane

    2012-01-01

    The purpose of this study was to investigate the relationships among 11th grade students' metacognition, chemistry achievement and attitudes toward chemistry. A total of 81 high school students at 11th grade participated in this study. Data were collected using Metacognitive Awareness Inventory and Attitude Scale toward Chemistry at the end of the second half of the academic year 2010â€"2011. Students' report card mean scores in chemistry course for that academic year were used as an ind...

  6. An Investigation of the Relationships among 11th Grade Students' Attitudes toward Chemistry, Metacognition and Chemistry Achievement

    OpenAIRE

    KINGIR, Sevgi; AYDEMİR, Nurdane

    2014-01-01

    The purpose of this study was to investigate the relationships among 11th grade students' metacognition, chemistry achievement and attitudes toward chemistry. A total of 81 high school students at 11th grade participated in this study. Data were collected using Metacognitive Awareness Inventory and Attitude Scale toward Chemistry at the end of the second half of the academic year 2010â€"2011. Students' report card mean scores in chemistry course for that academic year were ...

  7. Burning weapons-grade plutonium in reactors

    International Nuclear Information System (INIS)

    Newman, D.F.

    1993-06-01

    As a result of massive reductions in deployed nuclear warheads, and their subsequent dismantlement, large quantities of surplus weapons- grade plutonium will be stored until its ultimate disposition is achieved in both the US and Russia. Ultimate disposition has the following minimum requirements: (1) preclude return of plutonium to the US and Russian stockpiles, (2) prevent environmental damage by precluding release of plutonium contamination, and (3) prevent proliferation by precluding plutonium diversion to sub-national groups or nonweapons states. The most efficient and effective way to dispose of surplus weapons-grade plutonium is to fabricate it into fuel and use it for generation of electrical energy in commercial nuclear power plants. Weapons-grade plutonium can be used as fuel in existing commercial nuclear power plants, such as those in the US and Russia. This recovers energy and economic value from weapons-grade plutonium, which otherwise represents a large cost liability to maintain in safeguarded and secure storage. The plutonium remaining in spent MOX fuel is reactor-grade, essentially the same as that being discharged in spent UO 2 fuels. MOX fuels are well developed and are currently used in a number of LWRs in Europe. Plutonium-bearing fuels without uranium (non-fertile fuels) would require some development. However, such non-fertile fuels are attractive from a nonproliferation perspective because they avoid the insitu production of additional plutonium and enhance the annihilation of the plutonium inventory on a once-through fuel cycle

  8. Multiparametric Magnetic Resonance Imaging for Discriminating Low-Grade From High-Grade Prostate Cancer

    NARCIS (Netherlands)

    Vos, E.K.; Kobus, T.; Litjens, G.J.S.; Hambrock, T.; Hulsbergen-van de Kaa, C.A.; Barentsz, J.O.; Maas, M.C.; Scheenen, T.W.J.

    2015-01-01

    The aim of this study was to determine and validate the optimal combination of parameters derived from 3-T diffusion-weighted imaging, dynamic contrast-enhanced imaging, and magnetic resonance (MR) spectroscopic imaging for discriminating low-grade from high-grade prostate cancer (PCa).The study was

  9. 7 CFR 810.804 - Grades and grade requirements for mixed grain.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Grades and grade requirements for mixed grain. 810.804 Section 810.804 Agriculture Regulations of the Department of Agriculture (Continued) GRAIN INSPECTION, PACKERS AND STOCKYARD ADMINISTRATION (FEDERAL GRAIN INSPECTION SERVICE), DEPARTMENT OF AGRICULTURE...

  10. Does Grade Inflation Affect the Credibility of Grades? Evidence from US Law School Admissions

    Science.gov (United States)

    Wongsurawat, Winai

    2009-01-01

    While the nature and causes of university grade inflation have been extensively studied, little empirical research on the consequence of this phenomenon is currently available. The present study uses data for 48 US law schools to analyze admission decisions in 1995, 2000, and 2007, a period during which university grade inflation appears to have…

  11. Colorado Student Assessment Program: 2001 Released Passages, Items, and Prompts. Grade 4 Reading and Writing, Grade 4 Lectura y Escritura, Grade 5 Mathematics and Reading, Grade 6 Reading, Grade 7 Reading and Writing, Grade 8 Mathematics, Reading and Science, Grade 9 Reading, and Grade 10 Mathematics and Reading and Writing.

    Science.gov (United States)

    Colorado State Dept. of Education, Denver.

    This document contains released reading comprehension passages, test items, and writing prompts from the Colorado Student Assessment Program for 2001. The sample questions and prompts are included without answers or examples of student responses. Test materials are included for: (1) Grade 4 Reading and Writing; (2) Grade 4 Lectura y Escritura…

  12. Grades and Incentives: Assessing Competing Grade Point Average Measures and Postgraduate Outcomes

    Science.gov (United States)

    Bailey, Michael A.; Rosenthal, Jeffrey S.; Yoon, Albert H.

    2016-01-01

    In many educational settings, students may have an incentive to take courses where high grades are easier to achieve, potentially corroding student learning, evaluation of student achievement, and the fairness and efficiency of post-graduation labor outcomes. A grading system that takes into account heterogeneity of teacher standards and student…

  13. Comparing 2 Whiplash Grading Systems to Predict Clinical Outcomes.

    Science.gov (United States)

    Croft, Arthur C; Bagherian, Alireza; Mickelsen, Patrick K; Wagner, Stephen

    2016-06-01

    Two whiplash severity grading systems have been developed: Quebec Task Force on Whiplash-Associated Disorders (QTF-WAD) and the Croft grading system. The majority of clinical studies to date have used the modified grading system published by the QTF-WAD in 1995 and have demonstrated some ability to predict outcome. But most studies include only injuries of lower severity (grades 1 and 2), preventing a broader interpretation. The purpose of this study was assess the ability of these grading systems to predict clinical outcome within the context of a broader injury spectrum. This study evaluated both grading systems for their ability to predict the bivalent outcome, recovery, within a sample of 118 whiplash patients who were part of a previous case-control designed study. Of these, 36% (controls) had recovered, and 64% (cases) had not recovered. The discrete bivariate distribution between recovery status and whiplash grade was analyzed using the 2-tailed cross-tabulation statistics. Applying the criteria of the original 1993 Croft grading system, the subset comprised 1 grade 1 injury, 32 grade 2 injuries, 53 grade 3 injuries, and 32 grade 4 injuries. Applying the criteria of the modified (QTF-WAD) grading system, there were 1 grade 1 injury, 89 grade 2 injuries, and 28 grade 3 injuries. Both whiplash grading systems correlated negatively with recovery; that is, higher severity grades predicted a lower probability of recovery, and statistically significant correlations were observed in both, but the Croft grading system substantially outperformed the QTF-WAD system on this measure. The Croft grading system for whiplash injury severity showed a better predictive measure for recovery status from whiplash injuries as compared with the QTF-WAD grading system.

  14. Grading as a Sadomasochistic Activity or an Erotic Benevolent Activity?

    Science.gov (United States)

    Tjarks, Larry D.

    Numerous research studies have been conducted concerning the negative aspects of grading: the low correlations between academic success (high grades) and later vocational or professional success, possible sadomasochistic motives of teachers in awarding grades, and grade assignment resulting from the teacher's sense of duty or responsibility to…

  15. A Machine Vision System for Automatically Grading Hardwood Lumber - (Proceedings)

    Science.gov (United States)

    Richard W. Conners; Tai-Hoon Cho; Chong T. Ng; Thomas H. Drayer; Joe G. Tront; Philip A. Araman; Robert L. Brisbon

    1990-01-01

    Any automatic system for grading hardwood lumber can conceptually be divided into two components. One of these is a machine vision system for locating and identifying grading defects. The other is an automatic grading program that accepts as input the output of the machine vision system and, based on these data, determines the grade of a board. The progress that has...

  16. Effects of Instructions on Theme Grading: Grammatical vs. Holistic

    Science.gov (United States)

    Follman, John; And Others

    1971-01-01

    Twelve college seniors in an English methods course were assigned to three treatment groups, Grammatical, Holistic, and Both. Each group received different instructions but graded the same 10 themes. Themes graded for grammatical errors received lower grades than the same themes graded holistically. (NH)

  17. What Is Wrong with Grade Inflation (If Anything)?

    Science.gov (United States)

    Finefter-Rosenbluh, Ilana; Levinson, Meira

    2015-01-01

    Grade inflation is a global phenomenon that has garnered widespread condemnation among educators, researchers, and the public. Yet, few have deliberated over the ethics of grading, let alone the ethics of grade inflation. The purpose of this paper is to map out and examine the ethics of grade inflation. By way of beginning, we clarify why grade…

  18. 7 CFR 70.105 - Procedures for appeal gradings.

    Science.gov (United States)

    2010-01-01

    ... conducting the appeal grading. Whether defrosting poultry or rabbit carcasses for other types of appeals will... 7 Agriculture 3 2010-01-01 2010-01-01 false Procedures for appeal gradings. 70.105 Section 70.105... PRODUCTS AND RABBIT PRODUCTS Grading of Poultry Products and Rabbit Products Appeal of A Grading Or...

  19. Advantages and Disadvantages of Weighted Grading. Research Brief

    Science.gov (United States)

    Walker, Karen

    2004-01-01

    What are the advantages and disadvantages of weighted grading? The primary purpose of weighted grading has been to encourage high school students to take more rigorous courses. This effort is then acknowledged by more weight being given to the grade for a specified class. There are numerous systems of weighted grading cited in the literature from…

  20. 77 FR 6772 - United States Standards for Grades of Cauliflower

    Science.gov (United States)

    2012-02-09

    ... Service [Doc. AMS-FV-10-0047] United States Standards for Grades of Cauliflower AGENCY: Agricultural... Standards for Grades of Cauliflower. AMS is reviewing all fresh fruit and vegetable grade standards for... provisions for grading purple, orange or green cauliflower. The proposed revision will amend the color...

  1. Does the grading of chondromalacia patellae influence anterior knee pain following total knee arthroplasty without patellar resurfacing?

    Science.gov (United States)

    Zha, Guo-Chun; Feng, Shuo; Chen, Xiang-Yang; Guo, Kai-Jin

    2018-03-01

    The influence of chondromalacia patellae (CMP) on post-operative anterior knee pain (AKP) following total knee arthroplasty (TKA) remains controversial, and few studies have focused on the relationship between them. The purpose of this study was to determine whether different CMP grades affect the incidence of AKP after TKA without patellar resurfacing. We performed a retrospective analysis of prospectively collected data on 290 TKAs with the use of the low contact stress mobile-bearing prosthesis, without patellar resurfacing in 290 patients from February 2009 to January 2013. Patients were assessed by the Outerbridge classification for CMP, visual analog scale for AKP, the Knee Society clinical scoring system of knee score (KS), function score (FS), the patellar score (PS) for clinical function, and patients' satisfaction. The intra-operative grading of CMP: grade I in 30 patients, grade II in 68 patients, grade III in 97 patients, and grade IV in 95 patients. The incidence of AKP at 36-month follow-up was 10.3% (30/290). No statistical difference was detected among the different CMP grades in terms of the incidence of AKP (p = 0.995), patients' satisfaction (p = 0.832), KS (p = 0.228), FS (p = 0.713), and PS (p = 0.119) at 36-month follow-up. The findings may suggest no relevant influence of CMP grading on the incidence of AKP after TKA without patellar resurfacing.

  2. Parenting styles and overweight status in first grade.

    Science.gov (United States)

    Rhee, Kyung E; Lumeng, Julie C; Appugliese, Danielle P; Kaciroti, Niko; Bradley, Robert H

    2006-06-01

    The goal was to determine the relationship between the 4 parenting styles (authoritative, authoritarian, permissive, and neglectful) and overweight status in first grade. Data from the National Institute of Child Health and Human Development Study of Early Child Care and Youth Development were analyzed. Children with complete data for parenting parameters at 54 months and measured weight and height in first grade were included in the analysis. Overweight was defined as BMI of > or =95th percentile. The 4 parenting styles were constructed with 2 scales, namely, maternal sensitivity and maternal expectations for child self-control. Multivariate logistic regression analysis was used to evaluate the relationship between parenting style and overweight in first grade, controlling for gender, race, maternal education, income/needs ratio, marital status, and child behavior problems. A total of 872 children, 11.1% overweight and 82.8% white, were included in the analysis. Children of authoritarian mothers (n = 298) had an increased risk of being overweight, compared with children of authoritative mothers (n = 179). Children of permissive (n = 132) and neglectful (n = 263) mothers were twice as likely to be overweight, compared with children of authoritative mothers. Of the covariates, only income/needs ratio was significant and did not alter the relationship between parenting style and overweight risk. Among the 4 parenting styles, authoritarian parenting was associated with the highest risk of overweight among young children. Understanding the mechanisms through which parenting styles are associated with overweight risk may lead to the development of more-comprehensive and better-targeted interventions.

  3. Properties of textile grade ceramic fibers

    International Nuclear Information System (INIS)

    Pudnos, E.

    1992-01-01

    The availability of textile grade ceramic fibers has sparked great interest for applications in composite reinforcement and high temperature insulation. This paper summarizes the properties of various small diameter textile grade ceramic fibers currently available. Room temperature mechanical and electrical properties of the fibers are discussed for three cases: ambient conditions, after heat aging in argon, and after heat aging in wet air. Dow Corning (R) HPZ Ceramic Fiber, a silicon nitride type fiber, is shown to have improved retention of mechanical and electrical properties above 1200 C

  4. Graded thermal insulation layer systems; Gradierte Waermedaemmschichtsysteme

    Energy Technology Data Exchange (ETDEWEB)

    Leushake, U.; Krell, T. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Koeln (Germany). Inst. fuer Werkstoff-Forschung

    1996-12-31

    Graded thermal insulation systems reduce local stresses between two layers. Grading usually involves a concentration variation in a second phase but may also involve variations of the microstructure or chemical composition. The contribution discusses the application of this technique for thermal protection of turbine blades in aircraft propulsion systems. [Deutsch] Mit Hilfe gradierter Waermeschichtsysteme ist es moeglich die lokalen Spannungen zwischen zwei Schichten zu verringern. Die Gradierung umfasst meistens eine Variation des Gehaltes einer zweiten Phase, kann aber auch die Variation der Mikrostruktur oder der chemischen Zusammensetzung beinhalten. In diesem Beitrag wird auf die Anwendung als thermischer Schutz von Turbinenschaufeln fuer Flugtriebwerke eingegangen.

  5. Studies on high grade cerebral gliomas

    International Nuclear Information System (INIS)

    Bleehen, N.M.

    1990-01-01

    A brief review of attempts in the United Kingdom to improve the results of treatment of high grade (grade 3, 4) supra-tentorial astrocytomas is presented. The radiosensitizer misonidazole failed to improve the results of post-surgical radiotherapy, however, multivariate analysis of data from these patients has provided a prognostic index of use in defining good and poor prognosis patients. An overview study of adjuvant nitrosourea therapy trials has shown a small significant advantage for the chemotherapy. A study of chemosensitization by benznidazole of CCNU treatment of patients in relapse failed to demonstrate any effect. 13 references

  6. Graded photonic crystals by optical interference holography

    International Nuclear Information System (INIS)

    Han, Chunrui; Tam, Wing Yim

    2012-01-01

    We report on the fabrication of graded photonic crystals in dye doped dichromate gelatin emulsions using an optical interference holographic technique. The gradedness is achieved by imposing a gradient form factor in the interference intensity resulting from the absorption of the dye in the dichromate gelatin. Wider and deeper photonic bandgaps are observed for the dyed samples as compared to the un-dyed samples. Our method could open up a new direction in fabricating graded photonic crystals which cannot be achieved easily using other techniques. (paper)

  7. Graded associative conformal algebras of finite type

    OpenAIRE

    Kolesnikov, Pavel

    2011-01-01

    In this paper, we consider graded associative conformal algebras. The class of these objects includes pseudo-algebras over non-cocommutative Hopf algebras of regular functions on some linear algebraic groups. In particular, an associative conformal algebra which is graded by a finite group $\\Gamma $ is a pseudo-algebra over the coordinate Hopf algebra of a linear algebraic group $G$ such that the identity component $G^0$ is the affine line and $G/G^0\\simeq \\Gamma $. A classification of simple...

  8. Effects of multisensory resources on the achievement and science attitudes of seventh-grade suburban students taught science concepts on and above grade level

    Science.gov (United States)

    Roberts, Patrice Helen

    This research was designed to determine the relationships among students' achievement scores on grade-level science content, on science content that was three years above-grade level, on attitudes toward instructional approaches, and learning-styles perceptual preferences when instructional approaches were multisensory versus traditional. The dependent variables for this investigation were scores on achievement posttests and scores on the attitude survey. The independent variables were the instructional strategy and students' perceptual preferences. The sample consisted of 74 educationally oriented seventh-grade students. The Learning Styles Inventory (LSI) (Dunn, Dunn, & Price, 1990) was administered to determine perceptual preferences. The control group was taught seventh-grade and tenth-grade science units using a traditional approach and the experimental group was instructed on the same units using multisensory instructional resources. The Semantic Differential Scale (SDS) (Pizzo, 1981) was administered to reveal attitudinal differences. The traditional unit included oral reading from the textbook, completing outlines, labeling diagrams, and correcting the outlines and diagrams as a class. The multisensory unit included five instructional stations established in different sections of the classroom to allow students to learn by: (a) manipulating Flip Chutes, (b) using Electroboards, (c) assembling Task Cards, (d) playing a kinesthetic Floor Game, and (e) reading an individual Programmed Learning Sequence. Audio tapes and scripts were provided at each location. Students circulated in groups of four from station to station. The data subjected to statistical analyses supported the use of a multisensory, rather than a traditional approach, for teaching science content that is above-grade level. T-tests revealed a positive and significant impact on achievement scores (p < 0.0007). No significance was detected on grade-level achievement nor on the perceptual

  9. Hall–Petch and dislocation strengthening in graded nanostructured steel

    DEFF Research Database (Denmark)

    Zhang, Xiaodan; Hansen, Niels; Gao, Yukui

    2012-01-01

    The structure and strength of low carbon steel samples have been analyzed after plastic deformation by shot-peening and cold-rolling. The fine scale surface microstructure caused by shot-peening extends to ∼50 μm below the surface. The structure is graded and subdivided by dislocation boundaries...... and high angle boundaries showing a clear resemblance to the lamellar structure, which evolves during conventional rolling of bulk metallic materials from medium to high strain. As the surface is approached, the boundary spacing decreases to ∼50 nm at the surface. In parallel, the misorientation angle...... is the average spacing between the low and high angle boundaries which subdivide the microstructure, σ0 is the friction stress and k2 is a number which is expressed in terms of structural parameters which have been determined by electron backscattered diffraction. It is found that calculated k2 values...

  10. Fibrocartilaginous mesenchymoma with low-grade malignancy

    International Nuclear Information System (INIS)

    Dahlin, D.C.; Bertoni, F.; Beabout, J.W.; Campanacci, M.

    1984-01-01

    In a review of cases of fibrous cartilaginous dysplasia of bone, five of fibrocartilaginous lesions were found to be different in clinical behavior and radiographic and morphologic features from the others. We have named these previously undescribed tumors ''fibrocartilaginous mesenchymomas with low-grade malignancy in the fibrous elements.'' (orig.)

  11. Do Class Size Effects Differ across Grades?

    Science.gov (United States)

    Nandrup, Anne Brink

    2016-01-01

    This paper contributes to the class size literature by analysing whether short-run class size effects are constant across grade levels in compulsory school. Results are based on administrative data on all pupils enrolled in Danish public schools. Identification is based on a government-imposed class size cap that creates exogenous variation in…

  12. Compressive properties of sandwiches with functionally graded

    Indian Academy of Sciences (India)

    The compressive behaviour of a new class of sandwich composite made up of jute fiber reinforced epoxy skins and piece-wise linear fly ash reinforced functionally graded (FG) rubber core is investigated in flat-wise mode. FG samples are prepared using conventional casting technique. Presence of gradation is quantified ...

  13. Does Social Background Influence Political Science Grades?

    Science.gov (United States)

    Tiruneh, Gizachew

    2013-01-01

    This paper tests a hypothesized linear relationship between social background and final grades in several political science courses that I taught at the University of Central Arkansas. I employ a cross-sectional research design and ordinary least square (OLS) estimators to test the foregoing hypothesis. Relying on a sample of up to 204…

  14. Teacher Grading Decisions: Influences, Rationale, and Practices

    Science.gov (United States)

    Kunnath, Joshua P.

    2017-01-01

    This mixed-methods study applied a decision-making theoretical framework to an investigation of teacher grading in a large urban school district in California. A sample of 251 high school teachers of core subjects were surveyed, and 15 teachers participated in four focus group interviews in order provide data on the influences, rationale, and…

  15. Mechanical Drawing: Grades 7-12.

    Science.gov (United States)

    Instructional Objectives Exchange, Los Angeles, CA.

    Eighty-five behavioral objectives and related evaluation items for mechanical drawing in grades 7 through 12 are presented. Each sample contains the objective, test items, and means for judging the adequacy of the response. The following categories are included: (1) basic drafting skills; (2) beginning lettering; (3) drawing; (4) orthographic…

  16. High grade magnesium from waste bittern

    International Nuclear Information System (INIS)

    El-Yamani, I.S.; Farah, M.Y.; Isaac, S.L.

    1979-01-01

    The production of high grade magnesia for nuclear purposes from sea water by use of both aqueous and gaseous ammonia has been described. The effect of precipitating conditions on the settling rate and magnesium recovery, was thoroughly examined. Ammonia gas approach was recommended and justified

  17. Lumber stress grades and design properties

    Science.gov (United States)

    David E. Kretschmann; David W. Green

    1999-01-01

    Lumber sawn from a log, regardless of species and size, is quite variable in mechanical properties. Pieces may differ in strength by several hundred percent. For simplicity and economy in use, pieces of lumber of similar mechanical properties are placed in categories called stress grades, which are characterized by (a) one or more sorting criteria, (b) a set of...

  18. Better utilization of low-grade woods

    Science.gov (United States)

    Peter Koch

    1957-01-01

    The objective of this paper is threefold: to outline briefly some of the avenues of approach so far employed in utilizing low-grade wood, to comment on the economic aspects of the problem, and finally, to speculate about what developments the future might bring to the field of utilization.

  19. Does Relative Grading help Male Students?

    DEFF Research Database (Denmark)

    Czibor, Eszter; Onderstal, Sander; Sloof, Randolph

    The provision of non-pecuniary incentives in education is a topic that has received much scholarly attention lately. Our paper contributes to this discussion by investigating the effectiveness of grade incentives in increasing student performance. We perform a direct comparison of the two most co...

  20. Ia diastolic dysfunction: an echocardiographic grade.

    Science.gov (United States)

    Pandit, Anil; Mookadam, Farouk; Hakim, Fayaz A; Mulroy, Eoin; Saadiq, Rayya; Doherty, Mairead; Cha, Stephen; Seward, James; Wilansky, Susan

    2015-01-01

    To demonstrate that a distinct group of patients with Grade Ia diastolic dysfunction who do not conform to present ASE/ESE diastolic grading exists. Echocardiographic and demographic data of the Grade Ia diastolic dysfunction were extracted and compared with that of Grades I and II in 515 patients. The mean of age of the cohort was 75 ± 9 years and body mass index did not differ significantly between the 3 groups (P = 0.45). Measurements of left atrial volume index (28.58 ± 7 mL/m(2) in I, 33 ± 10 mL/m(2) in Ia, and 39 ± 12 mL/m(2) in II P Ia, and 79 ± 15 msec in II P Ia, and 217 ± 57 msec in II P Ia, and 22 ± 8 in II), and lateral E/e' (8 ± 3 in I, 15 ± 6 in Ia, and 18 ± 9 in II P Ia compared with I and II. These findings remained significant even after adjusting for age, gender, diabetes, and smoking. Patients with echocardiographic characteristics of relaxation abnormality (E/A ratio of Ia group. © 2014, Wiley Periodicals, Inc.

  1. Quantitative grading of store separation trajectories

    CSIR Research Space (South Africa)

    Jamison, Kevin A

    2017-09-01

    Full Text Available . This paper describes the development of an automated analysis process and software that can run a multitude of separation scenarios. A key enabler for this software is the development of a quantitative grading algorithm that scores the outcome of each release...

  2. Geometry task sheets : grades 3-5

    CERN Document Server

    Rosenberg, Mary

    2009-01-01

    For grades 3-5, our Common Core State Standards-based resource meets the geometry concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.

  3. Algebra task sheets : grades pk-2

    CERN Document Server

    Reed, Nat

    2009-01-01

    For grades PK-2, our Common Core State Standards-based resource meets the algebraic concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.

  4. Geometry task sheets : grades pk-2

    CERN Document Server

    Rosenberg, Mary

    2009-01-01

    For grades PK-2, our Common Core State Standards-based resource meets the geometry concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.

  5. Ferrite grade iron oxides from ore rejects

    Indian Academy of Sciences (India)

    Iron oxyhydroxides and hydroxides were synthesized from chemically beneficiated high SiO2/Al2O3 low-grade iron ore (57.49% Fe2O3) rejects and heated to get iron oxides of 96–99.73% purity. The infrared band positions, isothermal weight loss and thermogravimetric and chemical analysis established the chemical ...

  6. Elementary construction of graded lie groups

    International Nuclear Information System (INIS)

    Scheunert, M.; Rittenberg, V.

    1977-06-01

    We show how the definitions of the classical Lie groups have to be modified in the case where Grassmann variables are present. In particular, we construct the general linear, the special linear and the orthosymplectic graded Lie groups. Special attention is paid to the question of how to formulate an adequate 'unitarity condition'. (orig.) [de

  7. Developing Middle Grades Students' MP3

    Science.gov (United States)

    Tassell, Janet; Stobaugh, Rebecca; Sheffield, Linda

    2011-01-01

    Middle grades are a critical time for capturing the interest and imagination and developing the potential of mathematically promising students. This is a time for students to make sense of mathematics, build a solid foundation and enthusiasm, and set the course for the highest levels of mathematics in the future. This is a time to explore their…

  8. Osteoporosis Risk Factors in Eighth Grade Students.

    Science.gov (United States)

    Lysen, Victoria C.; Walker, Robert

    1997-01-01

    Presents findings from food frequency questionnaires and surveys of 138 Midwestern eighth-grade student-parent pairs. The study examined the incidence of modifiable and nonmodifiable osteoporosis risk factors and compared gender differences. Data analysis indicated that many adolescents possessed several modifiable and nonmodifiable risk factors…

  9. Whale Preservation. Grades Five to Nine.

    Science.gov (United States)

    Racicot, Darlene

    Dedicated to the conservation and preservation of whales, dolphins, and porpoises through public education, this instructional unit for grades 5-9 provides current (1993) facts, lesson plans, activities, and conservation and preservation techniques. Interdisciplinary activities involve students in debates, critical thinking, research, and…

  10. What Can Readers Read after Graded Readers?

    Science.gov (United States)

    McQuillan, Jeff

    2016-01-01

    Nation (2014) concluded that most of the vocabulary one needs to read challenging texts in English can be acquired incidentally through voluminous reading. This study examines possible texts that second language (L2) readers can use to move from controlled-vocabulary materials such as graded readers, which go up through approximately the…

  11. Comparison between two differential graded algebras in ...

    Indian Academy of Sciences (India)

    76

    A differential calculus on a “space” means the specification of a differential graded algebra (dga), often interpreted as space of forms. In classical geometry the “space” is a manifold and we have the de-Rham dga, whereas in noncommutative geometry a “space” is described by a triple called spectral triple. A spectral triple is ...

  12. Helping Your Kid Make the Grade.

    Science.gov (United States)

    Dornbusch, Sandy

    Research indicates that students' activities and relationships with their parents predict grades more surely than parental education, family income, ethnicity, sex, and family structure. Children with extremely permissive parents do not do well and children with extremely authoritarian parents do worse. Inconsistent parenting is even more strongly…

  13. Influence of Hydroxypropyl Methylcellulose Molecular Weight Grade ...

    African Journals Online (AJOL)

    Erah

    weight grades (K4M and K15M) on drug release from diclofenac sodium matrix tablets. Methods: Tablets containing diclofenac ... Keywords: Matrix, Diclofenac sodium, HPMC, Erosion, Water uptake. Received: 12 January 2011 .... incorporating the structure and geometric characteristics of the release device and n is.

  14. Graded-Lie-algebra cohomology and supergravity

    International Nuclear Information System (INIS)

    D'Auria, R.; Fre, P.; Regge, T.

    1980-01-01

    Detailed explanations of the cohomology invoked in the group-manifold approach to supergravity is given. The Chevalley cohomology theory of Lie algebras is extended to graded Lie algebras. The scheme of geometrical theories is enlarged so to include cosmological terms and higher powers of the curvature. (author)

  15. The Returns on Investment Grade Diamonds

    NARCIS (Netherlands)

    Renneboog, L.D.R.

    2013-01-01

    Abstract: This paper examines the risk-return characteristics of investment grade gems (white diamonds, colored diamonds and other types of gems including sapphires, rubies, and emeralds). The transactions are coming from gem auctions and span the period 1999-2012. Over our time frame, the annual

  16. 7 CFR 29.6018 - Grade.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Grade. 29.6018 Section 29.6018 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... to other characteristics when they are of sufficient importance to be treated separately. ...

  17. Examining Teacher Grades Using Rasch Measurement Theory

    Science.gov (United States)

    Randall, Jennifer; Engelhard, George, Jr.

    2009-01-01

    In this study, we present an approach to questionnaire design within educational research based on Guttman's mapping sentences and Many-Facet Rasch Measurement Theory. We designed a 54-item questionnaire using Guttman's mapping sentences to examine the grading practices of teachers. Each item in the questionnaire represented a unique student…

  18. Construction Industry Related Mathematics: Seventh Grade.

    Science.gov (United States)

    Mundell, Scott

    The field tested construction industry-related mathematics unit is intended to familiarize seventh grade students with various facets of the construction industry, including the various occupations available and the mathematical abilities and other skills and training necessary to pursue an occupation in the industry. The final set of activities…

  19. Communications and Media: Grade 7. Cluster II.

    Science.gov (United States)

    Calhoun, Olivia H.

    A curriculum guide for grade 7, the document is devoted to the occupational cluster "Communications and Media." It is divided into six units: advertising, film and photography, radio and television, journalism and publishing, library and periodicals, and transocean communications. Each unit is introduced by a statement of the topic, the…

  20. Environmental Education. Teacher's Handbook, Grade 5.

    Science.gov (United States)

    Nashville - Davidson County Metropolitan Public Schools, TN.

    Prepared for use in the 5th grade, this teacher's handbook consists of 19 science units dealing with environmental education. Topics are ecology, language arts, rocks and fossils, soil, noise pollution, Nashville pioneers and American Indians, conservation, waste and litter, water pollution, compass and mapping, plants and trees, use of the…

  1. Reliability Estimates for Undergraduate Grade Point Average

    Science.gov (United States)

    Westrick, Paul A.

    2017-01-01

    Undergraduate grade point average (GPA) is a commonly employed measure in educational research, serving as a criterion or as a predictor depending on the research question. Over the decades, researchers have used a variety of reliability coefficients to estimate the reliability of undergraduate GPA, which suggests that there has been no consensus…

  2. Molecular scale

    Directory of Open Access Journals (Sweden)

    Christopher H. Childers

    2016-03-01

    Full Text Available This manuscript demonstrates the molecular scale cure rate dependence of di-functional epoxide based thermoset polymers cured with amines. A series of cure heating ramp rates were used to determine the influence of ramp rate on the glass transition temperature (Tg and sub-Tg transitions and the average free volume hole size in these systems. The networks were comprised of 3,3′-diaminodiphenyl sulfone (33DDS and diglycidyl ether of bisphenol F (DGEBF and were cured at ramp rates ranging from 0.5 to 20 °C/min. Differential scanning calorimetry (DSC and NIR spectroscopy were used to explore the cure ramp rate dependence of the polymer network growth, whereas broadband dielectric spectroscopy (BDS and free volume hole size measurements were used to interrogate networks’ molecular level structural variations upon curing at variable heating ramp rates. It was found that although the Tg of the polymer matrices was similar, the NIR and DSC measurements revealed a strong correlation for how these networks grow in relation to the cure heating ramp rate. The free volume analysis and BDS results for the cured samples suggest differences in the molecular architecture of the matrix polymers due to cure heating rate dependence.

  3. Acne severity grading: determining essential clinical components and features using a Delphi consensus.

    Science.gov (United States)

    Tan, Jerry; Wolfe, Barat; Weiss, Jonathan; Stein-Gold, Linda; Bikowski, Joseph; Del Rosso, James; Webster, Guy F; Lucky, Anne; Thiboutot, Diane; Wilkin, Jonathan; Leyden, James; Chren, Mary-Margaret

    2012-08-01

    There are multiple global scales for acne severity grading but no singular standard. Our objective was to determine the essential clinical components (content items) and features (property-related items) for an acne global grading scale for use in research and clinical practice using an iterative method, the Delphi process. Ten acne experts were invited to participate in a Web-based Delphi survey comprising 3 iterative rounds of questions. In round 1, the experts identified the following clinical components (primary acne lesions, number of lesions, extent, regional involvement, secondary lesions, and patient experiences) and features (clinimetric properties, ease of use, categorization of severity based on photographs or text, and acceptance by all stakeholders). In round 2, consensus for inclusion in the scale was established for primary lesions, number, sites, and extent; as well as clinimetric properties and ease of use. In round 3, consensus for inclusion was further established for categorization and acceptance. Patient experiences were excluded and no consensus was achieved for secondary lesions. The Delphi panel consisted solely of the United States (U.S.)-based acne experts. Using an established method for achieving consensus, experts in acne vulgaris concluded that an ideal acne global grading scale would comprise the essential clinical components of primary acne lesions, their quantity, extent, and facial and extrafacial sites of involvement; with features of clinimetric properties, categorization, efficiency, and acceptance. Copyright © 2011 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  4. Histopathologic grading of anaplasia in retinoblastoma.

    Science.gov (United States)

    Mendoza, Pia R; Specht, Charles S; Hubbard, G Baker; Wells, Jill R; Lynn, Michael J; Zhang, Qing; Kong, Jun; Grossniklaus, Hans E

    2015-04-01

    To determine whether the degree of tumor anaplasia has prognostic value by evaluating its correlation with high-risk histopathologic features and clinical outcomes in a series of retinoblastoma patients. Retrospective clinicopathologic study. The clinical and pathologic findings in 266 patients who underwent primary enucleation for retinoblastoma were reviewed. The histologic degree of anaplasia was graded as retinocytoma, mild, moderate, or severe as defined by increasing cellular pleomorphism, number of mitoses, nuclear size, and nuclear hyperchromatism. Nuclear morphometric characteristics were measured. The clinical and pathologic data of 125 patients were compared using Kaplan-Meier estimates of survival. Fisher exact test and multivariate regression were used to analyze the association between anaplasia grade and high-risk histologic features. Increasing grade of anaplasia was associated with decreased overall survival (P = .003) and increased risk of metastasis (P = .0007). Histopathologic features that were associated with anaplasia included optic nerve invasion (P anaplasia grading as predictors of distant metastasis and death showed that high-risk histopathology was statistically significant as an independent predictor (P = .01 for metastasis, P = .03 for death) but anaplasia was not (P = .63 for metastasis, P = .30 for death). In the absence of high-risk features, however, severe anaplasia identified an additional risk for metastasis (P = .0004) and death (P = .01). Grading of anaplasia may be a useful adjunct to standard histopathologic criteria in identifying retinoblastoma patients who do not have high-risk histologic features but still have an increased risk of metastasis and may need adjuvant therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Pass-fail grading: laying the foundation for self-regulated learning.

    Science.gov (United States)

    White, Casey B; Fantone, Joseph C

    2010-10-01

    Traditionally, medical schools have tended to make assumptions that students will "automatically" engage in self-education effectively after graduation and subsequent training in residency and fellowships. In reality, the majority of medical graduates out in practice feel unprepared for learning on their own. Many medical schools are now adopting strategies and pedagogies to help students become self-regulating learners. Along with these changes in practices and pedagogy, many schools are eliminating a cornerstone of extrinsic motivation: discriminating grades. To study the effects of the switch from discriminating to pass-fail grading in the second year of medical school, we compared internal and external assessments and evaluations for a second-year class with a discriminating grading scale (Honors, High Pass, Pass, Fail) and for a second-year class with a pass-fail grading scale. Of the measures we compared (MCATs, GPAs, means on second-year examinations, USMLE Step 1 scores, residency placement, in which there were no statistically significant changes), the only statistically significant decreases (lower performance with pass fail) were found in two of the second-year courses. Performance in one other course also improved significantly. Pass-fail grading can meet several important intended outcomes, including "leveling the playing field" for incoming students with different academic backgrounds, reducing competition and fostering collaboration among members of a class, more time for extracurricular interests and personal activities. Pass-fail grading also reduces competition and supports collaboration, and fosters intrinsic motivation, which is key to self-regulated, lifelong learning.

  6. The Nine-Step Minnesota Grading System for Eyebank Eyes With Age Related Macular Degeneration: A Systematic Approach to Study Disease Stages.

    Science.gov (United States)

    Olsen, Timothy W; Liao, Albert; Robinson, Hershonna S; Palejwala, Neal V; Sprehe, Nicholas

    2017-10-01

    To refine the Minnesota Grading System (MGS) using definitions from the Age-Related Eye Disease Studies (AREDS) into a nine-step grading scale (MGS-9). A nine-step grading scale descriptive analysis using three key phenotypic features (total drusen area, increased, and decreased pigmentation) of human eyebank eyes that were graded according to definitions from the AREDS criteria in order to harmonize studies of disease progression for research involving human tissue. From 2005 through February 2017, we have analyzed 1159 human eyes, procured from two eyebanks. Each macula was imaged using high-resolution, stereoscopic color fundus photography with both direct- and transillumination. Fundus images were digitally overlaid with a grading template and triangulated for foveal centration. We documented and stratified risk for each globe by applying the AREDS nine-step grading scale to the key clinical features from the MGS-9. We found a good distribution within the MGS categories (1-9) with few level eight globes. Eyes were processed within 12.1 ± 6.3, hours from the time of death through imaging, dissection, and freezing or fixation. Applying the MGS-9 to 331 pairs (662 eyes were simultaneously graded), 84% were within one-grading step and 93% within two steps of the fellow eye. We also document reticular pseudodrusen, basal laminar drusen, and pattern dystrophy. The MGS nine-step grading scale enables researchers using human tissue to refine the risk assessment of donor tissue. This analysis will harmonize results among researchers when grading human tissue using MGS criteria. Most importantly, the MGS-9 links directly to the known risk for progression from the AREDS.

  7. Processing hot-dip galvanized AHSS grades: a challenging task

    Energy Technology Data Exchange (ETDEWEB)

    Pichler, A.; Hebesberger, T.; Tragl, E.; Traint, S.; Faderl, J.; Angeli, G.; Koesters, K. [voestalpine Stahl GmbH, Linz (Austria)

    2005-07-01

    High-strength thin sheet steel grades have gained a considerable market share. At present a very strong demand has been observed for DP (dual-phase), CP (complex phase) and TRIP grades, which are often summarized as advanced high-strength steel grades (AHSS). The potential benefits of applying AHSS grades were impressively demonstrated in the ULSAC-AVC project, in which a remarkable reduction in mass and an increase in stiffness and crash safety were achieved by using a very high share of AHSS steel grades. The present contribution concentrates on hot-dip galvanized AHSS thin sheet grades. The hot-dip galvanizeability of such grades is critically discussed after an overview is provided of the metallurgy of AHSS grades, including microstructure, mechanical properties, phase transformations and required alloy design. Based on these fundamentals, the processing of AHSS grades in the hot-dip galvanizing line is discussed and the resulting properties presented. (orig.)

  8. [Questions of terminology, systematization and grading of complications of contact ureteral lithotripsy].

    Science.gov (United States)

    Dutov, V V; Bazaev, V V; Mamedov, E A; Urenkov, S B; Podoinitsyn, A A

    2017-07-01

    To investigate the advantages and disadvantages of the current variants of systematization and grading of complications of contact ureteral lithotripsy (CULT) and develop a working classification of CULT complications. The study analyzed results of 545 fluoroscopy-guided endoscopic procedures performed at the MRRCI Clinic of Urology from 2008 to 2015 in 506 patients with ureterolithiasis. The proposed and implemented classification and terminology of CULT complications unifies the diagnostic and management algorithm. This tool is more systematic and structured than the classical classification and universal methods of systematization and grading of CULT complications (classifying CULT complications in "major" and "minor", PULS scale, Satava and Clavien-Dindo grading systems). Given the lack of clear grading of ureteral rupture, it was divided into amputation (two-level rupture) and avulsion (one-level rupture). Using such term as extravasation of the contrast media and/or migration of the stone outside of the ureter is groundless because these complications occur only after the perforation of the ureteral wall. Therefore, these conditions are complications not of CULT, but of the ureteral wall perforation. The ureteral perforation was classified into macro- and micro-perforation. The existing terminology, classification and grading of the CULT complications should undergo a more detailed analysis. None of the existing classifications of CULT complications afford them to be fully staged and systematized. The working classification of complications of CULT developed at the M.F. Vladimirsky MRRCI Clinic of Urology warrants a multi-center prospective study to validate it and investigate its effectiveness.

  9. Grade Retention at Primary School: What the Teachers in Zimbabwe Say

    Directory of Open Access Journals (Sweden)

    Muchemwa Stella

    2017-03-01

    Full Text Available Primary education is the base of all advanced education levels, developments and innovations; it should therefore be meticulously done so as not to disadvantage the learners. In a bid to do it well, those involved in primary education have tried and are still trying strategies that can give the learners maximum advantage, for instance, grade retention and grade promotion. This research aimed at assessing the Zimbabwean primary school teachers’ stance on grade retention. The researcher took the advantage of Block-Release students at Solusi University in April 2016 (these are teachers from all over Zimbabwe and other countries in Africa who come for their degree studies at Solusi University during the holidays to collect data through interviews from a purposive sample of these teachers. Collected data was coded and analyzed descriptively. Findings showed that: 56% of the respondents indicated that retention is taking place at the primary schools where they are teaching but usually on a minimal scale since it is usually done upon parents’ request; 67% of the respondents said that retention is necessary and helpful; retention can be most suitably done at infant grades (1-3; however, the effect of retention on pupils’ performance is not clear due to other factors that affect performance. Findings also showed that the Zimbabwean Government is neither for retention nor grade promotion but for ERI (Early Reading Initiative and PLAP (Performance Lag Address Programme which have been recently introduced.

  10. Feasibility studies on electrochemical separation and recovery of uranium by using domestic low grade uranium resources

    International Nuclear Information System (INIS)

    Oh, Won Zin; Jung, Chong Hun; Lee, Kune Woo; Won, Hui Jun; Choi, Wang Kyu; Kim, Gye Nam; Lee, Yu Ri; Lee, Joong Moung

    2005-12-01

    The up-to-date electrochemical uranium separation technology has been developed for uranium sludge waste treatment funded by a long term national nuclear technology development program. The objective of the studies is to examine applicability of the uranium separation technology to making use of the low grade uranium resources in the country. State of the arts of uranium separation and recovery from the low grade national uranium resources. - The amount of the high grade uranium resources(0.1 % U 3 O 8 contents) in the world is 1,750,000MTU and that of the low grade uranium resources(0.04 % U 3 O 8 contents) in the country is 340,000MTU. - The world uranium price will be increase to more than 30$/l0b in 10 years, so that the low grade uranium in the country become worth while to recover. - The conventional uranium recovery technologies are based on both acidic - The ACF electrochemical uranium separation technology is the state of the art technology in the world and the adsorption capability of 690 mgU/g is several ten times higher than that of a conventional zeolite and the uranium stripping efficiency by desorption is more than 99%. So, this technology is expected to replace the existing solvent extraction technology. Feasibility of the ACF electrochemical uranium separation technology as an uranium recovery method. Lab scale demonstration of uranium separation and recovery technologies have been carried out by using an ACF electrochemical method

  11. The effect of grades on the preference effect : Grading reduces consideration of disconfirming evidence

    NARCIS (Netherlands)

    Hayek, A.S.; Toma, C.; Oberlé, D.; Butera, F.

    2014-01-01

    The tendency to look for evidence that supports, rather than questions, one's viewpoint (preference effect) is a pervasive phenomenon. Although one important goal of education is developing critical thinking, the widespread practice of grading might discourage students in appreciating disconfirming

  12. A Comparison of Air Force Field Grade and Company Grade Officer Leadership

    National Research Council Canada - National Science Library

    Enrequez, Arnel

    1998-01-01

    ...), indicating that empirical development of a similar model for the USAF should be feasible. The purpose of this study was to determine differences in importance of leadership behaviors between AF company grade officers (CGOs), majors (O-4s...

  13. Will bottle-grade PET demand lure fiber-grade capacity?

    International Nuclear Information System (INIS)

    Coeyman, M.

    1993-01-01

    As demand for bottle-grade polyethylene terephthalate (PET) continues strong and new capacity hastens to meet it, some industry observers wonder if conversions to bottle-grade from fiber-grade capacity will become an industry trend. Taiwan's Nan Ya Plastics was recently said to be considering such a switch, but company sources say it has no such plans. Peter Driscoll, senior partner at PCI Fibres ampersand Raw Materials (Crawley, UK), says that while it is true that demand for the bottle-grade material remains unsatisfied, he doubts that many conversions will take place. You must remember, says Driscoll, that it is not always possible to switch, and that even where it is possible there are limitations

  14. Consumer assessment of beef tenderloin steaks from various USDA quality grades at 3 degrees of doneness.

    Science.gov (United States)

    O'Quinn, Travis G; Brooks, J Chance; Miller, Markus F

    2015-02-01

    A consumer study was conducted to determine palatability ratings of beef tenderloin steaks from USDA Choice, USDA Select, and USDA Select with marbling scores from Slight 50 to 100 (USDA High Select) cooked to various degrees of doneness. Steaks were randomly assigned to 1 of 3 degree of doneness categories: very-rare, medium-rare, or well-done. Consumers (N = 315) were screened for preference of degree of doneness and fed 4 samples of their preferred doneness (a warm-up and one from each USDA quality grade treatment in a random order). Consumers evaluated steaks on an 8-point verbally anchored hedonic scale for tenderness, juiciness, flavor, and overall like as well as rated steaks as acceptable or unacceptable for all palatability traits. Quality grade had no effect (P > 0.05) on consumer ratings for tenderness, juiciness, flavor, and overall like scores, with all traits averaging above a 7 ("like very much") on the 8-point scale. In addition, no differences (P > 0.05) were found in the percentage of samples rated as acceptable for all palatability traits, with more than 94% of samples rated acceptable for each trait in all quality grades evaluated. Steaks cooked to well-done had lower (P Choice and Select quality grades. © 2015 Institute of Food Technologists®

  15. High-grade and low-grade gliomas: differentiation by using perfusion MR imaging

    International Nuclear Information System (INIS)

    Hakyemez, B.; Erdogan, C.; Ercan, I.; Ergin, N.; Uysal, S.; Atahan, S.

    2005-01-01

    AIM: Relative cerebral blood volume (rCBV) is a commonly used perfusion magnetic resonance imaging (MRI) technique for the evaluation of tumour grade. Relative cerebral blood flow (rCBF) has been less studied. The goal of our study was to determine the usefulness of these parameters in evaluating the histopathological grade of the cerebral gliomas. METHODS: This study involved 33 patients (22 high-grade and 11 low-grade glioma cases). MRI was performed for all tumours by using a first-passage gadopentetate dimeglumine T2*-weighted gradient-echo single-shot echo-planar sequence followed by conventional MRI. The rCBV and rCBF were calculated by deconvolution of an arterial input function. The rCBV and rCBF ratios of the lesions were obtained by dividing the values obtained from the normal white matter of the contralateral hemisphere. For statistical analysis Mann-Whitney testing was carried out. A p value of less than 0.05 indicated a statistically significant difference. Receiver operating characteristic curve (ROC) analysis was performed to assess the relationship between the rCBV and rCBF ratios and grade of gliomas. Their cut-off value permitting discrimination was calculated. The correlation between rCBV and CBF ratios and glioma grade was assessed using Pearson correlation analysis. RESULTS: In high-grade gliomas, rCBV and rCBF ratios were measured as 6.50±4.29 and 3.32±1.87 (mean±SD), respectively. In low-grade gliomas, rCBV and rCBF ratios were 1.69±0.51 and 1.16±0.38, respectively. The rCBV and rCBF ratios for high-grade gliomas were statistically different from those of low-grade gliomas (p 0.05). The cut-off value was taken as 1.98 in the rCBV ratio and 1.25 in the rCBF ratio. There was a strong correlation between the rCBV and CBF ratios (Pearson correlation = 0.830, p<0.05). CONCLUSION: Perfusion MRI is useful in the preoperative assessment of the histopathologicalal grade of gliomas; the rCBF ratio in addition to the rCBV ratio can be incorporated

  16. Development of Solar Grade (SoG) Silicon

    Energy Technology Data Exchange (ETDEWEB)

    Joyce, David B; Schmid, Frederick

    2008-01-18

    The rapid growth of the photovoltaics (PV) industry is threatened by the ongoing shortage of suitable solar grade (SoG) silicon. Until 2004, the PV industry relied on the off spec polysilicon from the electronics industry for feedstock. The rapid growth of PV meant that the demand for SoG silicon predictably surpassed this supply. The long-term prospects for PV are very bright as costs have come down, and efficiencies and economies of scale make PV generated electricity ever more competitive with grid electricity. However, the scalability of the current process for producing poly silicon again threatens the future. A less costly, higher volume production technique is needed to supply the long-term growth of the PV industry, and to reduce costs of PV even further. This long-term need was the motivation behind this SBIR proposal. Upgrading metallurgical grade (MG) silicon would fulfill the need for a low-cost, large-scale production. Past attempts to upgrade MG silicon have foundered/failed/had trouble reducing the low segregation coefficient elements, B, P, and Al. Most other elements in MG silicon can be purified very efficiently by directional solidification. Thus, in the Phase I program, Crystal Systems proposed a variety of techniques to reduce B, P, and Al in MG silicon to produce a low cost commercial technique for upgrading MG silicon. Of the variety of techniques tried, vacuum refining and some slagging and additions turned out to be the most promising. These were pursued in the Phase II study. By vacuum refining, the P was reduced from 14 to 0.22 ppmw and the Al was reduced from 370 ppmw to 0.065 ppmw. This process was scaled to 40 kg scale charges, and the results were expressed in terms of half-life, or time to reduce the impurity concentration in half. Best half-lives were 2 hours, typical were 4 hours. Scaling factors were developed to allow prediction of these results to larger scale melts. The vacuum refining required the development of new crucibles

  17. Concomitant glenohumeral pathologies associated with acute and chronic grade III and grade V acromioclavicular joint injuries.

    Science.gov (United States)

    Jensen, Gunnar; Millett, Peter J; Tahal, Dimitri S; Al Ibadi, Mireille; Lill, Helmut; Katthagen, Jan Christoph

    2017-08-01

    The purpose of this study was to identify the risk of concomitant glenohumeral pathologies with acromioclavicular joint injuries grade III and V. Patients who underwent arthroscopically-assisted stabilization of acromioclavicular joint injuries grade III or grade V between 01/2007 and 12/2015 were identified in the patient databases of two surgical centres. Gender, age at index surgery, grade of acromioclavicular joint injury (Rockwood III or Rockwood V), and duration between injury and index surgery (classified as acute or chronic) were of interest. Concomitant glenohumeral pathologies were noted and their treatment was classified as debridement or reconstructive procedure. A total of 376 patients (336 male, 40 female) were included. Mean age at time of arthroscopic acromioclavicular joint reconstruction surgery was 42.1 ± 14.0 years. Overall, 201 patients (53%) had one or more concomitant glenohumeral pathologies. Lesions of the biceps tendon complex and rotator cuff were the most common. Forty-five patients (12.0%) had concomitant glenohumeral pathologies that required an additional repair. The remaining 156 patients (41.5%) received a debridement of their concomitant pathologies. Rockwood grade V compared to Rockwood grade III (p = 0.013; odds ratio 1.7), and chronic compared to acute injury were significantly associated with having a concomitant glenohumeral pathology (p = 0.019; odds ratio 1.7). The probability of having a concomitant glenohumeral pathology was also significantly associated with increasing age (p acromioclavicular joint injury of either grade III or V. Twenty-two percent of these patients with concomitant glenohumeral pathologies received an additional dedicated repair procedure. Although a significant difference in occurrence of concomitant glenohumeral pathologies was seen between Rockwood grades III and V, and between acute and chronic lesions, increasing age was identified as the most dominant predictor. Level IV, case series.

  18. Beneficiation studies on low-grade complex polymetallic lead-zinc ore of duddar (lasbela) Balochistan, Pakistan

    International Nuclear Information System (INIS)

    Bhatti, M.R.; Kazim, K.R.; Mehmood, R.; Akram, A.

    2016-01-01

    A bench-scale beneficiation study was performed on low-grade complex lead-zinc ore of Duddar area, District Lasbela, Balochistan Province, Pakistan. The polymetallic ore under investigation contains galena and sphalerite as valuable minerals of lead and zinc. The low-grade ore was upgraded by selective sequential froth flotation technology to recover both minerals. An effort was made to investigate the effect of important variables on grade and recovery of concentrates and to design the process flow sheet. Different parameters of flotation process such as particle size of the feed, pH and % solids of the pulp, speed of impeller, type of reagents (collectors, frothers, regulators and modifiers) and their quantities, conditioning time and flotation time were optimized to attain maximum grade and recovery of respective concentrates. The rougher concentrates obtained were subjected to one regrinding and two cleaning operations to achieve higher-grade concentrates of both metals. Bench-scale flotation tests show that it is possible to obtain a lead concentrate assaying 65.24% Pb with recovery rate of 81.32% and a zinc concentrate containing 55.63% Zn content with recovery rate of 80.28%. Both the concentrates meet the specifications required for metallurgical and chemical grades. (author)

  19. EXAMINATION OF ACHIEVEMENT RELATIONS AND MOTIVATION OF 7th GRADE STUDENTS FOR INVOLVEMENT IN PHYSICAL EDUCATION CLASSES

    Directory of Open Access Journals (Sweden)

    Dragoljub Višnjić

    2010-09-01

    Full Text Available The relations of students achievement and motivation for involvement in PE classes were examined in a sample of 247 seventh-grade elementary school students of both sexes. The independent variables in the study were: sex, general success of the previous grade, PE grade, students’ opinion on sufficiency of knowledge acquired through instruction process, students’ involvement in sport. The scale for measurement of motivation consisted of 29 items obtained by adaptation of the Scale for measurement of motives of sports’ achievement. Correlation analysis, multiple regression analysis and chi square test were preformed. It was established that male students manifested higher motivation that the females. The assumptions: that females will have better PE grades that the male students; that students’ success was negatively related to involvement in sport; that PE grade was connected to involvement in sport; that general success was negatively related to students’ involvement in PE and that PE grade is positively related to students’ motivation for involvement in instruction, were not confirmed.

  20. Improving reading in the primary grades.

    Science.gov (United States)

    Duke, Nell K; Block, Meghan K

    2012-01-01

    Almost fifteen years have passed since the publication of the National Research Council's seminal report Preventing Reading Difficulties in Young Children, which provided research-based recommendations on what could be done to better position students in prekindergarten through third grade for success in grade four and above. This article by Nell Duke and Meghan Block first examines whether specific key recommendations from the report have been implemented in U.S. classrooms. They find that recommendations regarding increased access to kindergarten and greater attention to and improvement of students' word-reading skills have been widely adopted. Others have not. Vocabulary and comprehension, long neglected in the primary grades, still appear to be neglected. Contrary to the report's recommendations, attention to building conceptual and content knowledge in science and social studies has actually decreased in the past fifteen years. In other words, the easier-to-master skills are being attended to, but the broader domains of accomplishment that constitute preparation for comprehension and learning in the later grades--vocabulary knowledge, comprehension strategy use, and conceptual and content knowledge--are being neglected. Near stagnation in fourth-grade students' comprehension achievement is thus unsurprising. The authors then turn to research and reviews of research on improving primary-grade reading published since 1998, when Preventing Reading Difficulties was issued. They discuss several instructional approaches identified as effective in improving word-reading skill, vocabulary and conceptual knowledge, comprehension strategies, and reading outside of school; they discuss advances in interventions for struggling readers, and in whole-school literacy reform. Duke and Block then identify three key obstacles that have prevented widespread adoption of these best practices in teaching reading. The first obstacle is a short-term orientation toward instruction and

  1. INAA of polyacrylic hydrogels of pharmaceutical grade

    International Nuclear Information System (INIS)

    Ponta, C.; Salagean, M.; Pantelica, A.; Georgescu, I.I.

    1998-01-01

    Polyacrylic acid (PA) and its salts are promising biomaterials used in the pharmaceutical industry. They could be used as pharmaceutical additives, as a burn dressing and also in the slow released implants or trans-derma patch formulations. Polyacrylic acid of pharmaceutical grade can be obtained by gamma irradiation polymerization. The influence of the raw materials and of the technological procedure on the final product purity has been investigated by Instrumental Neutron Activation Analysis (INAA) method. The following materials have been analyzed by INAA: 1) acrylic acid of technical grade; 2) acrylic acid purified by double crystallisation; 3) NaOH of analytical grade; 4) CaCl-2·6H 2 O of pharmaceutical grade; 5) CaCl 2 ·2H 2 O of analytical grade; 6) granulated PANa; 7) ungranulated PANa; 8) ungranulated PANaCa; 9) PANaCa granulated by milling in IFIN-HH using the mill nr. 1; 10) PANaCa granulated by milling in Institute of Chemical and Pharmaceutical Research (ICPR); 11) PANaCa granulated by milling in IFIN-HH using the mill nr. 2. The first five samples, marked from 1 to 5, are raw materials and the other six samples, marked from 6 to 11, are the final polyacrylic structures processed by various technological procedures. The samples together with the appropriate reference materials have been irradiated at WWR-S reactor in a neutron flux of 2.5·10 12 cm -2 s -1 and the induced radioactivity was registered by a HPGe detector (EG/G ORTEC) of 30% efficiency and 2.1 keV resolution. The concentrations of As, Br, Ce, Co, Cr, Fe, La, Sb, Sc, Zn have been determined. For the final polyacrylic structures, except for granulated PANa (sample 6), only the elements Co, Cr, Fe, Sc, Zn were found at the following concentration levels: tens of ppm (Co), ppm (Zn), hundreds of ppb (Cr), tens of ppb (Co), ppb (Co, Sc), 10 -1 ppb (Sc). In the granulated PANa, in comparison with the other analyzed final products, similar concentration values were found for Fe, Sc and Zn

  2. Comparison of non-electrophoresis grade with electrophoresis grade BIS in NIPAM polymer gel preparation

    Science.gov (United States)

    Khodadadi, Roghayeh; Khajeali, Azim; Farajollahi, Ali Reza; Hajalioghli, Parisa; Raeisi, Noorallah

    2015-01-01

    Introduction:The main objective of this study was to investigate the possibility of replacing electrophoresis cross-linker with non-electrophoresis N, N′-methylenebisacrylamide (BIS) in N-isopropyl acrylamide (NIPAM) polymer gel and its possible effect on dose response. Methods: NIPAM polymer gel was prepared from non-electrophoresis grade BIS and the relaxation rate (R2) was measured by MR imaging after exposing the gel to gamma radiation from Co-60 source. To compare the response of this gel with the one that contains electrophoresis grade BIS, two sets of NIPAM gel were prepared using electrophoresis and non-electrophoresis BIS and irradiated to different gamma doses. Results: It was found that the dose–response of NIPAM gel made from the non-electrophoresis grade BIS is coincident with that of electrophoresis grade BIS. Conclusion:Taken all, it can be concluded that the non-electrophoresis grade BIS not only is a suitable alternative for the electrophoresis grade BIS but also reduces the cost of gel due to its lower price. PMID:26457250

  3. Is Needle Biopsy Clinically Useful in Preoperative Grading of Central Chondrosarcoma of the Pelvis and Long Bones?

    Science.gov (United States)

    Roitman, Pablo D; Farfalli, Germán L; Ayerza, Miguel A; Múscolo, D Luis; Milano, Federico E; Aponte-Tinao, Luis A

    2017-03-01

    Central chondrosarcoma of bone is graded on a scale of 1 to 3 according to histological criteria. Clinically, these tumors can be divided into low-grade (Grade 1) and high-grade (Grade 2, Grade 3, and dedifferentiated) chondrosarcomas. Although en bloc resection has been the most widely used treatment, it has become generally accepted that in selected patients with low-grade chondrosarcomas of long bones, curettage is safe and effective. This approach requires an accurate preoperative estimation of grade to avoid under- or overtreatment, but prior reports have indicated that both imaging and biopsy do not always give an accurate prediction of grade. (1) What is the concordance of image-guided needle preoperative biopsy and postoperative grading in central (intramedullary) chondrosarcomas of long bones, and how does this compare with the concordance of image-guided needle preoperative biopsy and postoperative grading in central pelvic chondrosarcomas? (2) What is the concordance of preoperative image-guided needle biopsy and postoperative findings in differentiating low-grade from high-grade central chondrosarcomas of long bones, and how does this compare with the concordance in central pelvic chondrosarcomas? Between 1997 and 2014, in our institution, we treated 126 patients for central chondrosarcomas located in long bones and the pelvis. Of these 126 cases, 41 were located in the pelvis and the remaining 85 cases were located in long bones. This study considers 39 (95%) and 40 (47%) of them, respectively. We included all cases in which histological information was complete regarding preoperative and postoperative tumor grading. We excluded all cases with incomplete data sets or nondiagnostic preoperative biopsies. To evaluate the needle biopsy accuracy, we compared the histological tumor grade, obtained from the preoperative biopsy, with the final histological grade obtained from the postoperative surgical specimen. The weighted and nonweighted kappa statistics

  4. Relationship of pass/fail grading and curriculum structure with well-being among preclinical medical students: a multi-institutional study.

    Science.gov (United States)

    Reed, Darcy A; Shanafelt, Tait D; Satele, Daniel W; Power, David V; Eacker, Anne; Harper, William; Moutier, Christine; Durning, Steven; Massie, F Stanford; Thomas, Matthew R; Sloan, Jeff A; Dyrbye, Liselotte N

    2011-11-01

    Psychological distress is common among medical students. Curriculum structure and grading scales are modifiable learning environment factors that may influence student well-being. The authors sought to examine relationships among curriculum structures, grading scales, and student well-being. The authors surveyed 2,056 first- and second-year medical students at seven U.S. medical schools in 2007. They used the Perceived Stress Scale, Maslach Burnout Inventory, and Medical Outcomes Study Short Form (SF-8) to measure stress, burnout, and quality of life, respectively. They measured curriculum structure using hours spent in didactic, clinical, and testing experiences. Grading scales were categorized as two categories (pass/fail) versus three or more categories (e.g., honors/pass/fail). Of the 2,056 students, 1,192 (58%) responded. In multivariate analyses, students in schools using grading scales with three or more categories had higher levels of stress (beta 2.65; 95% CI 1.54-3.76, Pstudents in schools using pass/fail grading. There were no relationships between time spent in didactic and clinical experiences and well-being. How students are evaluated has a greater impact than other aspects of curriculum structure on their well-being. Curricular reform intended to enhance student well-being should incorporate pass/fail grading.

  5. Development of a Scale for Domain General Perceived Control Scale Primary School ChildrensAND#8217;

    Directory of Open Access Journals (Sweden)

    Esra Dereli

    2012-06-01

    Full Text Available SUMMARY AIM: This study aimed to develop a scale to measure domain general perceived control scale for elementary age children. METHOD: Participants were a total of 341 primary school children, 4th and f4th grade for 152 students, 6th, 7th and 8th grade for 162 students aged between 10-14.Skinner (1996, perceived control based on the theory is created 12-item scale of perceived control of the general form of the trial for primary education children and this form, within the scope of the research subjects, are given in order to make the validity and reliability studies. In order to test the validity of the scale developed, Satisfaction with Life was used. This scale was developed by Diener et al. (1985 and adapted into Turkish by Yetim (1993. RESULTS:Exploratory and confirmatory factor analysises and certain reliability analyses were used in the study. As a result of the analysis, four Likert-type five items scale were obtained. The findings revealed one -dimensional scale, 46.35% of whose variance was explained. Cronbach’s coefficient alpha provided evidence for the internal consistency of the exploratory the Scale. The reliability of the scale was 0.70 and indicated that the 5 item scale had good internal consistency for the sample. CONCLUSION: The scale that resulted was given the title “Scale for Primary School Children’ Time Orientation during Classroom Disengagement”. This instrument may be used in various studies in the future, thus contributing to the development of the field. [TAF Prev Med Bull 2012; 11(3.000: 331-338

  6. The Need for Large-Scale, Longitudinal Empirical Studies in Middle Level Education Research

    Science.gov (United States)

    Mertens, Steven B.; Caskey, Micki M.; Flowers, Nancy

    2016-01-01

    This essay describes and discusses the ongoing need for large-scale, longitudinal, empirical research studies focused on middle grades education. After a statement of the problem and concerns, the essay describes and critiques several prior middle grades efforts and research studies. Recommendations for future research efforts to inform policy…

  7. Effects of Engineering Design-Based Science on Elementary School Science Students' Engineering Identity Development across Gender and Grade

    Science.gov (United States)

    Capobianco, Brenda M.; Yu, Ji H.; French, Brian F.

    2015-04-01

    The integration of engineering concepts and practices into elementary science education has become an emerging concern for science educators and practitioners, alike. Moreover, how children, specifically preadolescents (grades 1-5), engage in engineering design-based learning activities may help science educators and researchers learn more about children's earliest identification with engineering. The purpose of this study was to examine the extent to which engineering identity differed among preadolescents across gender and grade, when exposing students to engineering design-based science learning activities. Five hundred fifty preadolescent participants completed the Engineering Identity Development Scale (EIDS), a recently developed measure with validity evidence that characterizes children's conceptions of engineering and potential career aspirations. Data analyses of variance among four factors (i.e., gender, grade, and group) indicated that elementary school students who engaged in the engineering design-based science learning activities demonstrated greater improvements on the EIDS subscales compared to those in the comparison group. Specifically, students in the lower grade levels showed substantial increases, while students in the higher grade levels showed decreases. Girls, regardless of grade level and participation in the engineering learning activities, showed higher scores in the academic subscale compared to boys. These findings suggest that the integration of engineering practices in the science classroom as early as grade one shows potential in fostering and sustaining student interest, participation, and self-concept in engineering and science.

  8. Heap bioleaching of uranium from low-grade granite-type ore by mixed acidophilic microbes

    International Nuclear Information System (INIS)

    Xuegang Wang; Zhongkui Zhou

    2017-01-01

    We evaluated uranium bioleaching from low-grade, granite-type uranium ore using mixed acidophilic microbes from uranium mine leachate. A 4854-ton plant-scale heap bioleaching process achieved sustained leaching with a uranium leaching efficiency of 88.3% using a pH of 1.0-2.0 and an Fe"3"+ dosage of 3.0-5.5 g/L. Acid consumption amounted to 25.8 g H_2SO_4 kg"-"1 ore. Uranium bioleaching follows a diffusion-controlled kinetic model with a correlation coefficient of 0.9136. Almost all uranium was dissolved in aqueous solution, except those encapsulated in quartz particles. Therefore, heap bioleaching by mixed acidophilic microbes enables efficient, economical, large-scale recovery of uranium from low-grade ores. (author)

  9. Analysis of the Relationship Between the Epidural Spinal Cord Compression (ESCC) Scale and Paralysis Caused by Metastatic Spine Tumors.

    Science.gov (United States)

    Uei, Hiroshi; Tokuhashi, Yasuaki; Maseda, Masafumi

    2018-04-15

    A retrospective, single-institute, and radiographic study. To evaluate the relationship between the epidural spinal cord compression (ESCC) scale and the severity of metastatic spine tumor-induced paralysis. The ESCC scale is used to evaluate the grade of spinal cord compression on T2-weighted magnetic resonance imaging (MRI). However, few studies have investigated the relationship between such MRI findings and paralysis. The subjects were 467 patients with metastatic spine tumors and grade 1b or worse spinal cord compression according to the ESCC scale. Evaluations using this scale were performed by three spine surgeons, and results that were obtained by two or more surgeons were adopted. We also examined patients whose spinal cord compression deteriorated by one grade or more to American Spinal Injury Association (ASIA) grade C or worse within the first 3 weeks after MRI. The kappa coefficients for inter- and intraexaminer variability were 0.90 and 0.95, respectively. ASIA grade D or worse paralysis developed in at least 50% of the patients with ESCC grade 1b or worse spinal cord compression at the C1-T2 and at least 50% of those with ESCC grade 1c or worse spinal cord compression at the T3-L5. The frequency of ASIA grade C or worse paralysis was high among the patients with ESCC grade 2 or worse spinal cord compression at the C7-L1. Nineteen patients experienced rapid deterioration of one grade or more to ASIA grade C or worse paralysis within the first 3 weeks after MRI. Of these, paralysis occurred in at least 30% of the patients with anterolateral or circumferential cord compression combined with ESCC grade 2 or 3 compression at the C7-L1. The severity of paralysis was not correlated with the ESCC scale. Patients with anterolateral or circumferential ESCC grade 2 or 3 cord compression at the C7-L1 are at high risk of rapidly progressive paralysis. 4.

  10. Production of nuclear grade zirconium: A review

    Energy Technology Data Exchange (ETDEWEB)

    Xu, L., E-mail: L.Xu-2@tudelft.nl [School of Materials Science and Metallurgy, Northeastern University, Shenyang 110004 (China); Department of Materials Science and Engineering, Delft University of Technology, Delft 2628 CD (Netherlands); Xiao, Y. [Department of Metallurgical Engineering, Anhui University of Technology, Ma' anshan 243002 (China); Zr-Hf-Ti Metallurgie B.V., Den Haag 2582 SB (Netherlands); Sandwijk, A. van [Zr-Hf-Ti Metallurgie B.V., Den Haag 2582 SB (Netherlands); Xu, Q. [School of Materials Science and Metallurgy, Northeastern University, Shenyang 110004 (China); Yang, Y. [Department of Materials Science and Engineering, Delft University of Technology, Delft 2628 CD (Netherlands)

    2015-11-15

    Zirconium is an ideal material for nuclear reactors due to its low absorption cross-section for thermal neutrons, whereas the typically contained hafnium with strong neutron-absorption is very harmful for zirconium as a fuel cladding material. This paper provides an overview of the processes for nuclear grade zirconium production with emphasis on the methods of Zr–Hf separation. The separation processes are roughly classified into hydro- and pyrometallurgical routes. The known pyrometallurgical Zr–Hf separation methods are discussed based on the following reaction features: redox characteristics, volatility, electrochemical properties and molten salt–metal equilibrium. In the present paper, the available Zr–Hf separation technologies are compared. The advantages and disadvantages as well as future directions of research and development for nuclear grade zirconium production are discussed.

  11. A low-grade extraskeletal osteosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Okada, Kyoji; Ito, Hiroki; Miyakoshi, Naohisa; Itoi, Eiji [Department of Orthopedic Surgery, Akita University School of Medicine, 1-1-1 Hondo, Akita 010-8543 (Japan); Sageshima, Masato [Department of Clinical Pathology, Akita University Hospital, 1-1-1 Hondo, Akita 010-8543 (Japan); Nishida, Jun [Department of Orthopedic Surgery, Iwate Medical School, 19-1 Uchimaru, Morioka 020-8505 (Japan)

    2003-03-01

    The case of a 35-year-old woman with low-grade extraskeletal osteosarcoma of the left leg is presented. Radiographs showed peripheral ossification of the lesion, suggesting myositis ossificans. Most of the tumor was composed of cartilage, and the cellularity and cell atypia of the proliferating chondrocytes were mild to moderate. In the periphery, bone formation with a relatively clear margin and proliferation of spindle cells with minimal nuclear atypia were observed. The average percentage of cells positive for MIB-1 was 9.0%. A diagnosis of low-grade extraskeletal osteosarcoma was made on the basis of these histologic findings. The clinical course 47 months after a wide excision was uneventful. (orig.)

  12. Probabilistic Modeling of Graded Timber Material Properties

    DEFF Research Database (Denmark)

    Faber, M. H.; Köhler, J.; Sørensen, John Dalsgaard

    2004-01-01

    The probabilistic modeling of timber material characteristics is considered with special emphasis to the modeling of the effect of different quality control and selection procedures used as means for quality grading in the production line. It is shown how statistical models may be established...... on the basis of the same type of information which is normally collected as a part of the quality control procedures and furthermore, how the efficiency of different control procedures may be quantified and compared. The tail behavior of the probability distributions of timber material characteristics plays...... such that they may readily be applied in structural reliability analysis and their format appears to be appropriate for codification purposes of quality control and selection for grading procedures....

  13. Grading of vesicoureteral reflux by radionuclide cystography

    International Nuclear Information System (INIS)

    Fretzayas, A.; Karpathios, T.; Dimitriou, P.; Nicolaidou, P.; Matsaniotis, N.

    1984-01-01

    Thirty-six children with urinary tract infection aged 6 months to 14 years (mean age 4 1/2 years) were studied sequentially using direct radionuclide (RNC) and conventional voiding cystourethrography (VCU). Vesicoureteral reflux (VUR) was detected equally well by both methods. Twenty-seven refluxing ureters were found by RNC, 23 by VCU and 22 by both methods. Radiologic grade of reflux may be determined approximately with the isotope technique from the volume of regurgitating urine und duration of reflux, at a much decreased radiation exposure. Residual urine was also measured by RNC and found to be higher in children with VUR. RNC is a reliable method for detecting and grading VUR and should effectively replace VCU as the follow-up examination of choice. (orig.)

  14. Buckling Response of Thick Functionally Graded Plates

    Directory of Open Access Journals (Sweden)

    BOUAZZA MOKHTAR

    2014-11-01

    Full Text Available In this paper, the buckling of a functionally graded plate is studied by using first order shear deformation theory (FSDT. The material properties of the plate are assumed to be graded continuously in the direction of thickness. The variation of the material properties follows a simple power-law distribution in terms of the volume fractions of constituents. The von Karman strains are used to construct the equilibrium equations of the plates subjected to two types of thermal loading, linear temperature rise and gradient through the thickness are considered. The governing equations are reduced to linear differential equation with boundary conditions yielding a simple solution procedure. In addition, the effects of temperature field, volume fraction distributions, and system geometric parameters are investigated. The results are compared with the results of the no shear deformation theory (classic plate theory, CPT.

  15. Cognition Effects of Low-Grade Hypoxia

    Science.gov (United States)

    2016-07-01

    human short-term memory . Br J Anaesth. 1971; 43(6):548–552. 3. Crow TJ, Kelman GR. Psychological effects of mild acute hypoxia. Br J Anaesth. 1973; 45...Journal Article 3. DATES COVERED (From – To) Jan 2003 – Sep 2005 4. TITLE AND SUBTITLE Cognition Effects of Low-Grade Hypoxia 5a. CONTRACT NUMBER... cognitive function are reported in this paper. The study compared cognitive function during short exposures at four different altitudes. Ninety-one

  16. Fracture Analysis of Functionally Graded Materials

    International Nuclear Information System (INIS)

    Zhang, Ch.; Gao, X. W.; Sladek, J.; Sladek, V.

    2010-01-01

    This paper reports our recent research works on crack analysis in continuously non-homogeneous and linear elastic functionally graded materials. A meshless boundary element method is developed for this purpose. Numerical examples are presented and discussed to demonstrate the efficiency and the accuracy of the present numerical method, and to show the effects of the material gradation on the crack-opening-displacements and the stress intensity factors.

  17. Different grades MEMS accelerometers error characteristics

    Science.gov (United States)

    Pachwicewicz, M.; Weremczuk, J.

    2017-08-01

    The paper presents calibration effects of two different MEMS accelerometers of different price and quality grades and discusses different accelerometers errors types. The calibration for error determining is provided by reference centrifugal measurements. The design and measurement errors of the centrifuge are discussed as well. It is shown that error characteristics of the sensors are very different and it is not possible to use simple calibration methods presented in the literature in both cases.

  18. New examples of continuum graded Lie algebras

    International Nuclear Information System (INIS)

    Savel'ev, M.V.

    1989-01-01

    Several new examples of continuum graded Lie algebras which provide an additional elucidation of these algebras are given. Here, in particular, the Kac-Moody algebras, the algebra S 0 Diff T 2 of infinitesimal area-preserving diffeomorphisms of the torus T 2 , the Fairlie, Fletcher and Zachos sine-algebras, etc., are described as special cases of the cross product Lie algebras. 8 refs

  19. Vibration of Elastic Functionally Graded Thick Rings

    Directory of Open Access Journals (Sweden)

    Guang-Hui Xu

    2017-01-01

    Full Text Available The free vibration behaviors of functionally graded rings were investigated theoretically. The material graded in the thickness direction according to the power law rule and the rings were assumed to be in plane stress and plane strain states. Based on the first-order shear deformation theory and the kinetic relation of von Kárman type, the frequency equation for free vibration of functionally graded ring was derived. The derived results were verified by those in literatures which reveals that the present theory can be appropriate to predict the free vibration characteristics for quite thick rings with the radius-to-thickness ratio from 60 down to 2.09. Comparison between the plane stress case and the plane strain case indicates a slight difference. Meanwhile, the effects of the structural dimensional parameters and the material inhomogeneous parameter are examined. It is interesting that the value of the logarithmic form of vibration frequency is inversely proportional to the logarithmic form of the radius-to-thickness ratio or the mean radius.

  20. Uranium production from low grade Swedish shale

    International Nuclear Information System (INIS)

    Carlsson, O.

    1977-01-01

    In view of the present nuclear programmes a steep increase in uranium demand is foreseen which will pose serious problems for the uranium industry. The annual additions to uranium ore reserves must almost triple within the next 15 years in order to support the required production rates. Although there are good prospects for the discovery of further conventional deposits of uranium there is a growing interest in low grade uranium deposits. Large quantities of uranium exist in black shales, phosphates, granites, sea water and other unconventional sources. There are however factors which limit the utilization of these low grade materials. These factors include the extraction costs, the environmental constrains on mining and milling of huge amounts of ore, the development of technologies for the beneficiation of uranium and, in the case of very low grade materials, the energy balance. The availability of by-product uranium is limited by the production rate of the main product. The limitations differ very much according to types of ores, mining and milling methods and the surroundings. As an illustration a description is given of the Swedish Ranstad uranium shale project, its potential, constraints and technical solutions

  1. Automated Essay Grading using Machine Learning Algorithm

    Science.gov (United States)

    Ramalingam, V. V.; Pandian, A.; Chetry, Prateek; Nigam, Himanshu

    2018-04-01

    Essays are paramount for of assessing the academic excellence along with linking the different ideas with the ability to recall but are notably time consuming when they are assessed manually. Manual grading takes significant amount of evaluator’s time and hence it is an expensive process. Automated grading if proven effective will not only reduce the time for assessment but comparing it with human scores will also make the score realistic. The project aims to develop an automated essay assessment system by use of machine learning techniques by classifying a corpus of textual entities into small number of discrete categories, corresponding to possible grades. Linear regression technique will be utilized for training the model along with making the use of various other classifications and clustering techniques. We intend to train classifiers on the training set, make it go through the downloaded dataset, and then measure performance our dataset by comparing the obtained values with the dataset values. We have implemented our model using java.

  2. A vision of graded hemispheric specialization.

    Science.gov (United States)

    Behrmann, Marlene; Plaut, David C

    2015-11-01

    Understanding the process by which the cerebral hemispheres reach their mature functional organization remains challenging. We propose a theoretical account in which, in the domain of vision, faces and words come to be represented adjacent to retinotopic cortex by virtue of the need to discriminate among homogeneous exemplars. Orthographic representations are further constrained to be proximal to typically left-lateralized language-related information to minimize connectivity length between visual and language areas. As reading is acquired, orthography comes to rely more heavily (albeit not exclusively) on the left fusiform region to bridge vision and language. Consequently, due to competition from emerging word representations, face representations that were initially bilateral become lateralized to the right fusiform region (albeit, again, not exclusively). We review recent research that describes constraints that give rise to this graded hemispheric arrangement. We then summarize empirical evidence from a variety of studies (behavioral, evoked response potential, functional imaging) across different populations (children, adolescents, and adults; left handers and individuals with developmental dyslexia) that supports the claims that hemispheric lateralization is graded rather than binary and that this graded organization emerges dynamically over the course of development. Perturbations of this system either during development or in adulthood provide further insights into the principles governing hemispheric organization. © 2015 New York Academy of Sciences.

  3. Preparing Attitude Scale to Define Students' Attitudes about Environment, Recycling, Plastic and Plastic Waste

    Science.gov (United States)

    Avan, Cagri; Aydinli, Bahattin; Bakar, Fatma; Alboga, Yunus

    2011-01-01

    The aim of this study is to introduce an attitude scale in order to define students? attitudes about environment, recycling, plastics, plastic waste. In this study, 80 attitude sentences according to 5-point Likert-type scale were prepared and applied to 492 students of 6th grade in the Kastamonu city center of Turkey. The scale consists of…

  4. Análisis Psicométrico de la escala de autoeficacia en conductas académicas en universitarios de primer ingreso / First grade university student’s psychometric analysis of an self-efficacy scale in academic behavior

    Directory of Open Access Journals (Sweden)

    Humberto Blanco Vega

    2011-12-01

    Full Text Available ResumenEl presente artículo tiene como propósito el diseño de la Escala Autoeficacia en Conductas Académicas (EACA y el estudio de sus propiedades psicométricas desde la perspectiva del enfoque clásico de la teoría de los test y el de los modelos de ecuaciones estructurales, lo cual permitió realizar estudios paralelos para corroborar y verificar los resultados obtenidos. La muestra total fue de 2089 sujetos; 902 mujeres y 1187 hombres, estudiantes de primer ingreso a las licenciaturas que se ofrecen en la Universidad Autónoma de Chihuahua, con una edad media de 18.23 años (DE= 0.74. El análisis de las propiedades psicométricas, ha mostrado que una estructura trifactorial es viable y adecuada de acuerdo con los requisitos psicométricos establecidos cuando los informantes son los propios alumnos. Estos resultados nos llevaron a eliminar 14 de los 27 ítems analizados. La estructura de tres factores (Comunicación, Atención y Excelencia, atendiendo a criterios estadísticos y sustantivos, ha mostrado adecuados indicadores de ajuste, de fiabilidad y de validez. Además, los resultados de los análisis factoriales llevados a cabo con las submuestras 1 y 2, indican la existencia de fuertes evidencias de la estabilidad de la estructura factorial, hasta que no se demuestre lo contrario. Futuras investigaciones deberían replicar estos hallazgos en muestras más amplias.AbstractThis article focuses on the design of the Self-Efficacy Scale in Academic Behaviors (EACA and on its psychometric properties from the classical test theory as well as the structural equation models; which allowed the development of parallel studies to verify the obtained results. The total sample comprised 2089 participants; 902 women and 1187 men, all of them freshman at Universidad Autónoma de Chihuahua, with a mean age of 18.23 years (DS= 0.74. Psychometric analysis showed that a three-factorial structure was viable and adequate according to the established

  5. Medical and pharmacy students' perceptions of the grading and assessment practices

    OpenAIRE

    Kasanda, C. D.; Mitonga, K. H.; Veii, K.; Zimba, R. F.

    2013-01-01

    Many students at the University of Namibia have frequently complained about ineffective assessment practices used at the institution. On many occasions, these complaints have not been substantiated with evidence of any kind. The purpose of this study was to obtain some empirical evidence that would ascertain undergraduate students' perceptions of the University of Namibia's grading and assessment practices. Using a structured scaled questionnaire, data were obtained from a representative samp...

  6. Volume Equalization Method for Land Grading Design: Uniform ...

    African Journals Online (AJOL)

    muğla üniversitesi

    2011-05-23

    May 23, 2011 ... *Corresponding author. E-mail: ... Land grading has been in practice for a long time, but land-grading ... method was based on least-squares theory and he showed its ... Srinisava (1996) developed a nonlinear optimization.

  7. Comparative evaluation of six cytological grading systems in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Kaushik Saha

    2013-01-01

    Conclusions: Robinson′s grading system is simple, more objective and reproducible, and demonstrated the best concordance with histological grading. So, Robinson′s system should be used routinely for breast carcinoma aspirates.

  8. Relation between grade and abundance of manganese nodules

    Digital Repository Service at National Institute of Oceanography (India)

    Sudhakar, M.

    Data from more than 1000 locations in the Central Indian Ocean Basin (CIOB) where both bulk nodule chemistry and abundance were determined and utilized to study the relationship between grade and abundance of manganese nodule deposits. Grade...

  9. Laser-beam apodization with a graded random phase window

    Energy Technology Data Exchange (ETDEWEB)

    Haas, R.A.; Summers, M.A.; Linford, G.J.

    1986-10-01

    Experiments and analysis indicate that graded random phase modulation can be usesd to apodize a laser beam. In the case of an obscuration or a hard edge it can prevent the formation of Fresnel-diffraction ripples. For example, here the interaction of a 1-..mu..m-wavelength laser beam with a central obscuration of half-width a -- 100 ..mu..m is studied theoretically. It is found that if the exit surface of a window, placed immediately downstream of the obstacle, is randomly modulated with a Gaussian amplitude transverse correlation length l -- 50..mu..m and a mean-square amplitude that decreases exponentially from a peak height of --1..mu..m/sup 2/ away from the center of the obscuration with transverse scale length L -- 500 ..mu..m, then the Fresenel-diffraction ripples normally produced by the obscuration are elimated. The scaling of these results is also discussed. The calculations are in general agreement with experimental results.

  10. Laser-beam apodization with a graded random phase window

    International Nuclear Information System (INIS)

    Haas, R.A.; Summers, M.A.; Linford, G.J.

    1986-01-01

    Experiments and analysis indicate that graded random phase modulation can be usesd to apodize a laser beam. In the case of an obscuration or a hard edge it can prevent the formation of Fresnel-diffraction ripples. For example, here the interaction of a 1-μm-wavelength laser beam with a central obscuration of half-width a -- 100 μm is studied theoretically. It is found that if the exit surface of a window, placed immediately downstream of the obstacle, is randomly modulated with a Gaussian amplitude transverse correlation length l -- 50μm and a mean-square amplitude that decreases exponentially from a peak height of --1μm 2 away from the center of the obscuration with transverse scale length L -- 500 μm, then the Fresenel-diffraction ripples normally produced by the obscuration are elimated. The scaling of these results is also discussed. The calculations are in general agreement with experimental results

  11. Fast propagation of electromagnetic fields through graded-index media.

    Science.gov (United States)

    Zhong, Huiying; Zhang, Site; Shi, Rui; Hellmann, Christian; Wyrowski, Frank

    2018-04-01

    Graded-index (GRIN) media are widely used for modeling different situations: some components are designed considering GRIN modulation, e.g., multi-mode fibers, optical lenses, or acousto-optical modulators; on the other hand, there are other components where the refractive-index variation is undesired due to, e.g., stress or heating; and finally, some effects in nature are characterized by a GRIN variation, like turbulence in air or biological tissues. Modeling electromagnetic fields propagating in GRIN media is then of high importance for optical simulation and design. Though ray tracing can be used to evaluate some basic effects in GRIN media, the field properties are not considered and evaluated. The general physical optics techniques, like finite element method or finite difference time domain, can be used to calculate fields in GRIN media, but they need great numerical effort or may even be impractical for large-scale components. Therefore, there still exists a demand for a fast physical optics model of field propagation through GRIN media on a large scale, which will be explored in this paper.

  12. A Quantitative Study on the Correlation between Grade Span Configuration of Sixth Grade Students in Private Florida Schools and Academic Achievement on Standardized Achievement Scores

    Science.gov (United States)

    Rantin, Deborah

    2017-01-01

    The applied dissertation was designed to investigate the three models of grade span configurations of sixth grade and the effects grade span configuration has on results of the standardized achievement scores of sixth grade students in private, Florida schools. Studies that have been conducted on sixth grade students and grade span configuration…

  13. Tumor grade-related thallium-201 uptake in chondrosarcomas

    International Nuclear Information System (INIS)

    Kaya, G.C.; Demir, Y.; Ozkal, S.

    2010-01-01

    Diagnosis of low-grade chondrosarcoma, especially discrimination between enchondroma and low-grade chondrosarcoma, may be difficult pathologically. The aim of this study was to evaluate the value of thallium-201 (Tl-201) scintigraphy in the diagnosis of chondrosarcoma and to investigate whether there was a correlation between Tl-201 uptake and tumor grade. We retrospectively evaluated 121 patients with pathologically proven bone and soft tissue tumors diagnosed between the years 1999 and 2007. All patients were followed by the Bone and Soft Tissue Tumor Working Group in our hospital. Twenty-three patients, mean age 44±15 (range 17-72) years, with a diagnosis of cartilaginous tumors were included. Increased Tl-201 uptake at the lesion sites greater than background was evaluated as malignant tumor. For the pathologic classification, a grading system (grade 1-3) based on the histopathologic findings was used. Pearson correlation coefficient was used to determine whether there was any correlation between Tl-201 uptake and tumor grade in chondrosarcoma. There were 7 enchondromas and 16 chondrosarcomas. Four of 16 patients with chondrosarcoma had lesions pathologically classified as grade 3, 5 as grade 2, and 7 had grade 1 chondrosarcoma. Increased Tl-201 uptake was observed in all patients with grade 3 chondrosarcoma and 2 patients with grade 2 chondrosarcoma. Of 10 patients with chondrosarcoma, 3 grade 2 chondrosarcomas and 7 grade 1 chondrosarcomas, there was no Tl-201 uptake in the tumor region. A significant correlation was found between Tl-201 uptake and tumor grade in chondrosarcoma (p=0.002, r=0.71). Only a few reports in literature have demonstrated false negative results in low-grade chondrosarcoma. Tl-201 uptake was related to tumor grade in chondrosarcoma. If there is a possibility of chondrosarcoma, Tl-201 scintigraphy should be reported with caution. (author)

  14. Determination of sieve grading curves using an optical device

    OpenAIRE

    PHAM, AM; DESCANTES, Yannick; DE LARRARD, François

    2011-01-01

    The grading curve of an aggregate is a fundamental characteristic for mix design that can easily be modified to adjust several mix properties. While sieve analysis remains the reference method to determine this curve, optical devices are developing, allowing easier and faster assessment of aggregate grading. Unfortunately, optical grading results significantly differ from sieve grading curves. As a consequence, getting full acceptance of these new methods requires building bridges between the...

  15. Construct validity of selected measures of physical activity beliefs and motives in fifth and sixth grade boys and girls.

    Science.gov (United States)

    Dishman, Rod K; Saunders, Ruth P; McIver, Kerry L; Dowda, Marsha; Pate, Russell R

    2013-06-01

    Scales used to measure selected social-cognitive beliefs and motives for physical activity were tested among boys and girls. Covariance modeling was applied to responses obtained from large multi-ethnic samples of students in the fifth and sixth grades. Theoretically and statistically sound models were developed, supporting the factorial validity of the scales in all groups. Multi-group longitudinal invariance was confirmed between boys and girls, overweight and normal weight students, and non-Hispanic black and white children. The construct validity of the scales was supported by hypothesized convergent and discriminant relationships within a measurement model that included correlations with physical activity (MET • min/day) measured by an accelerometer. Scores from the scales provide valid assessments of selected beliefs and motives that are putative mediators of change in physical activity among boys and girls, as they begin the understudied transition from the fifth grade into middle school, when physical activity naturally declines.

  16. Grading options for western hemlock "pulpwood" logs from southeastern Alaska.

    Science.gov (United States)

    David W. Green; Kent A. McDonald; John Dramm; Kenneth Kilborn

    Properties and grade yield are estimated for structural lumber produced from No. 3, No. 4, and low-end No. 2 grade western hemlock logs of the type previously used primarily for the production of pulp chips. Estimates are given for production in the Structural Framing, Machine Stress Rating, and Laminating Stock grading systems. The information shows that significant...

  17. Preliminary work in developing sawbolt grading systems for white oak

    Science.gov (United States)

    Everette D. Rast; Everette D. Rast

    1971-01-01

    This paper is principally a description of one technique used in the development of white oak (Quercus alba L.) sawbolt grades--not a final sawbolt grading system for the species over its range. This technique can be used by anyone in developing other bolt-grade specifications or in refining the system presented in this paper.

  18. Extensive Graded Reading in the Liberal Arts and Sciences

    Science.gov (United States)

    Poulshock, Joseph

    2010-01-01

    For this research, learners did extensive graded reading (EGR) with traditional graded readers, and they also interacted with short graded stories in the liberal arts and sciences (LAS). This study describes the purpose and format of the LAS stories used by hundreds of university students and adult learners in Japan. It summarizes the results of…

  19. The Relationship between Attendance Policies and Student Grades

    Science.gov (United States)

    Aaron, Michael D.

    2012-01-01

    The relationship between attendance policies and student grades in college courses was investigated. Specifically, a calculated grade point average was determined for all academic classes taught at Shelton State Community College between 2000 and 2008. These grade point averages were compared descriptively and statistically in an effort to…

  20. 49 CFR 80.11 - Investment-grade ratings.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Investment-grade ratings. 80.11 Section 80.11... § 80.11 Investment-grade ratings. (a) At the time a project sponsor submits an application, the DOT... investment-grade rating. (b) The full funding of a secured (direct) loan, loan guarantee, or line of credit...

  1. Collegiate Grading Practices and the Gender Pay Gap

    Directory of Open Access Journals (Sweden)

    Alicia C. Dowd

    2000-01-01

    Full Text Available Extending research findings by R. Sabot and J. Wakeman-Linn (1991, this article presents a theoretical analysis showing that relatively low grading quantitative fields and high grading verbal fields create a disincentive for college women to invest in quantitative study. Pressures on grading practices are modeled using higher education production functions.

  2. Collegiate Grading Practices and the Gender Pay Gap.

    Science.gov (United States)

    Dowd, Alicia C.

    2000-01-01

    Presents a theoretical analysis showing that relatively low grading quantitative fields and high grading verbal fields create a disincentive for college women to invest in quantitative study. Extends research by R. Sabot and J. Wakeman-Linn. Models pressures on grading practices using higher education production functions. (Author/SLD)

  3. 7 CFR 52.1855 - Grades of Sultana raisins.

    Science.gov (United States)

    2010-01-01

    ... § 52.1855 Grades of Sultana raisins. (a) “U.S. Grade A” is the quality of Sultana Raisins that have... in Table IV of this subpart. (b) “U.S. Grade B” is the quality of Sultana Raisins that have similar... than materially affected. Grit, sand, or silt None of any consequence may be present that affects the...

  4. Choosing the Adequate Level of Graded Readers--Preliminary Study

    Science.gov (United States)

    Prtljaga, Jelena; Palinkaševic, Radmila; Brkic, Jovana

    2015-01-01

    Graded readers have been used as second language teaching material since the end of the Second World War. They are an important source of simplified material which provides comprehensible input on all levels. It is of crucial importance for a successful usage of graded readers in the classroom and in studies which focus on graded readers, that an…

  5. The Effects of Framing Grades on Student Learning and Preferences

    Science.gov (United States)

    Bies-Hernandez, Nicole J.

    2012-01-01

    Two experiments examined whether framing effects, in terms of losses and gains, can be extended to student learning and grading preferences. In Experiment 1, participants rated psychology course syllabi to investigate preferences for differently framed grading systems: a loss versus gain grading system. The results showed a clear framing effect…

  6. Machine grading of lumber : practical concerns for lumber producers

    Science.gov (United States)

    William L. Galligan; Kent A. McDonald

    2000-01-01

    Machine lumber grading has been applied in commercial operations in North America since 1963, and research has shown that machine grading can improve the efficient use of wood. However, industry has been reluctant to apply research findings without clear evidence that the change from visual to machine grading will be a profitable one. For instance, mill managers need...

  7. The Causal Effects of Grade Retention on Behavioral Outcomes

    Science.gov (United States)

    Martorell, Paco; Mariano, Louis T.

    2018-01-01

    This study examines the impact of grade retention on behavioral outcomes under a comprehensive assessment-based student promotion policy in New York City. To isolate the causal effect of grade retention, we implement a fuzzy regression discontinuity (RD) design that exploits the fact that grade retention is largely determined by whether a student…

  8. Illusions of a Good Grade: Effort or Luck?

    Science.gov (United States)

    Buckelew, Susan P.; Byrd, Nikki; Key, Colin W.; Thornton, Jessica; Merwin, Michelle M.

    2013-01-01

    This study assessed the relationships among the accuracy of grade predictions, actual grades, self-enhancement bias, and attributions about academic performance. As a group, students anticipated higher grades than were earned. Individual differences in self-enhancement bias were measured using the discrepancy between anticipated and attained…

  9. Influence of "Halo" and "Demon" Effects in Subjective Grading.

    Science.gov (United States)

    Gibb, Gerald D.

    1983-01-01

    The phenomenon of "halo" effects in subjective grading was investigated. Two groups of three raters evaluated 20 term papers in introductory psychology. Term paper grades correlated significantly with course grades when information about previous academic performance was made available. When this information was not available, the…

  10. Grading Homework to Emphasize Problem-Solving Process Skills

    Science.gov (United States)

    Harper, Kathleen A.

    2012-01-01

    This article describes a grading approach that encourages students to employ particular problem-solving skills. Some strengths of this method, called "process-based grading," are that it is easy to implement, requires minimal time to grade, and can be used in conjunction with either an online homework delivery system or paper-based homework.

  11. Elementary Social Studies: Activities for Intermediate Grades.

    Science.gov (United States)

    Cheek, Helen N.

    1986-01-01

    Presents fifteen activities designed to lead children from the enactive, iconic, and symbolic levels of understanding map symbols, perspective, direction, distance, location, scale, relief and elevation. (JDH)

  12. Grading sacroiliitis with emphasis on MRI imaging; Grading der Sakroiliitis mit Betonung der MRT-Bildgebung

    Energy Technology Data Exchange (ETDEWEB)

    Jurik, A.G.; Egund, N. [The Department of Radiology R, Aarhus Kommunehospital (Denmark)

    2004-03-01

    Cross-sectional imaging techniques play a decisive role in identification, localization, and characterization of alterations in the sacroiliac joint during the early stage of seronegative spondylarthropathy (SpA). Although several studies showed that the diagnostic capabilities of MRI and CT are superior to those of conventional radiography, they have not yet become established and accepted as methods for evaluating the grade of ankylosing spondylitis (AS) in contrast to conventional radiography. The lack of acceptance for MRI and/or CT methods for evaluating and grading changes in the sacroiliac joint makes it difficult to include the results of these procedures in classifying the grade of SpA. Moreover, grading the changes in the sacroiliac joint in SpA with a method more sensitive than conventional radiography will be of prime importance in assessing treatment, e.g., the efficacy of new biological therapeutic agents directed against the tumor necrosis factor-alpha (TNF-{alpha}). An overview of the available grading methods is provided and MRI and CT techniques are presented. (orig.) [German] Schnittbildverfahren spielen bei der Identifizierung, Lokalisation und Charakterisierung von Veraenderungen des Sakroiliakalgelenks (SIG) im Fruehstadium der seronegativen Spondylarthropathie (SpA) eine entscheidende Rolle. Obwohl mehrere Studien zeigten, dass der diagnostische Wert der MRT und CT jenem der konventionellen Radiographie ueberlegen ist, hat sich das Schnittbildverfahren als Mittel zur Evaluierung des Grades der ankylosierenden Spondylitis (AS) im Gegensatz zur konventionellen Radiographie noch nicht etabliert und durchgesetzt. Dieses Fehlen eines akzeptierten MRT- und/oder CT-Verfahrens zur Evaluierung und zum Grading der Veraenderungen am SIG macht es schwierig, die Ergebnisse dieser Verfahren bei der Einstufung des Grades der AS-Veraenderungen und Erarbeitung von Diagnosekriterien fuer andere Formen der SpA einzubeziehen. Ausserdem wird das Grading der SIG

  13. Cognitive impairments in patients with low grade gliomas and high grade gliomas

    Directory of Open Access Journals (Sweden)

    Eliane C. Miotto

    2011-08-01

    Full Text Available OBJECTIVE: The relationship between brain tumors and cognitive deficits is well established in the literature. However, studies investigating the cognitive status in low and high-grade gliomas patients are scarce, particularly in patients with average or lower educational level. This study aimed at investigating the cognitive functioning in a sample of patients with low and high-grade gliomas before surgical intervention. METHOD: The low-grade (G1, n=19 and high-grade glioma (G2, n=8 patients underwent a detailed neuropsychological assessment of memory, executive functions, visuo-perceptive and visuo-spatial abilities, intellectual level and language. RESULTS: There was a significant impairment on verbal and visual episodic memory, executive functions including mental flexibility, nominal and categorical verbal fluency and speed of information processing in G2. G1 showed only specific deficits on verbal and visual memory recall, mental flexibility and processing speed. CONCLUSION: These findings demonstrated different levels of impairments in the executive and memory domains in patients with low and high grade gliomas.

  14. Children's Perceived Competence Scale: Reference values in Japan.

    Science.gov (United States)

    Nagai, Yukiyo; Nomura, Kayo; Nagata, Masako; Ohgi, Shohei; Iwasa, Mitsuji

    2015-12-01

    To support children with chronic diseases, reference values to measure developmental changes in self-perception and self-esteem are considered a useful yardstick. To develop reference values to measure self-perceived competence and self-esteem in Japanese children, the Children's Perceived Competence Scale (CPCS) was administered to 768 children of elementary school grade 1 (6 years) to grade 6 (11 years) at four public schools in Japan, from November to December 2012. After excluding 74 with chronic diseases and/or incomplete responses, 694 children were included. CPCS measures children's self-perceived competence in cognitive, social, physical domains, and general self-worth, namely self-esteem. There was a tendency for scores of cognitive and general self-worth to decrease with increasing grade. Scores among grade 5 respondents were significantly lower than those among grade 4 respondents for both social and physical domains. Scores among boys and girls differed significantly, with boys scoring higher for physical domain in grades 3 and 6 and for general self-worth domain in grade 6. The CPCS reference values to measure self-perceived competence and self-esteem in Japanese children were developed in this study. These reference values are useful to inform practitioners supporting children with psychological or psychiatric problems or those with chronic diseases. © The Author(s) 2014.

  15. Postural control deficit in acute QTF grade II whiplash injuries.

    Science.gov (United States)

    Dehner, Christoph; Heym, Birgit; Maier, Dirk; Sander, Silvia; Arand, Markus; Elbel, Martin; Hartwig, Erich; Kramer, Michael

    2008-07-01

    Experimental in vivo study. The objective was to investigate the balance control in patients with acute QTF grade II whiplash injuries of the cervical spine. Tetra-ataxiametric posturography in chronic pain patients after whiplash injuries of the cervical spine has revealed an impaired regulation of balance. However, so far it is unclear if this is caused by the accident or other factors that are associated with the pain chronification process. 40 patients with acute QTF grade II whiplash injuries and 40 healthy matched controls were examined on a posturography platform. The stability index ST(Sigma) and the Fourier analysis FA(Sigma) (0.10-1.00Hz) were established for eight standing positions and sum scores were calculated. The pain index was established using a visual analog scale ranging from 0 to 100. A follow-up examination was conducted for the patients after 2 months. The patients with acute whiplash injuries of the cervical spine achieved significantly poorer results for both ST(Sigma) and FA(Sigma) than the healthy controls. There were no differences between the eight standing positions for both ST(Sigma) and FA(Sigma). After 2 months, 17 patients had no change in the pain development, 21 patients showed an improvement in pain intensity and 2 patients had deteriorated. The subgroup of patients with improvement in pain intensity showed a significant improvement in balance control concerning the FA(Sigma) compared to patients with unchanged pain intensity. Patients with acute whiplash injuries have a reduced balance control as compared to matched controls. This study gives an indication that post-traumatic neck pain is associated with impairments of postural control.

  16. Alkali control of high-grade metamorphism and granitization

    Directory of Open Access Journals (Sweden)

    Oleg G. Safonov

    2014-09-01

    Full Text Available We review petrologic observations of reaction textures from high-grade rocks that suggest the passage of fluids with variable alkali activities. Development of these reaction textures is accompanied by regular compositional variations in plagioclase, pyroxenes, biotite, amphibole and garnet. The textures are interpreted in terms of exchange and net-transfer reactions controlled by the K and Na activities in the fluids. On the regional scale, these reactions operate in granitized, charnockitized, syenitized etc. shear zones within high-grade complexes. Thermodynamic calculations in simple chemical systems show that changes in mineral assemblages, including the transition from the hydrous to the anhydrous ones, may occur at constant pressure and temperature due only to variations in the H2O and the alkali activities. A simple procedure for estimating the activity of the two major alkali oxides, K2O and Na2O, is implemented in the TWQ software. Examples of calculations are presented for well-documented dehydration zones from South Africa, southern India, and Sri Lanka. The calculations have revealed two end-member regimes of alkalis during specific metamorphic processes: rock buffered, which is characteristic for the precursor rocks containing two feldspars, and fluid-buffered for the precursor rocks without K-feldspar. The observed reaction textures and the results of thermodynamic modeling are compared with the results of available experimental studies on the interaction of the alkali chloride and carbonate-bearing fluids with metamorphic rocks at mid-crustal conditions. The experiments show the complex effect of alkali activities in the fluid phase on the mineral assemblages. Both thermodynamic calculations and experiments closely reproduce paragenetic relations theoretically predicted by D.S. Korzhinskii in the 1940s.

  17. Operative management and outcomes in 103 AAST-OIS grades IV and V complex hepatic injuries: trauma surgeons still need to operate, but angioembolization helps.

    Science.gov (United States)

    Asensio, Juan A; Roldán, Gustavo; Petrone, Patrizio; Rojo, Esther; Tillou, Areti; Kuncir, Eric; Demetriades, Demetrios; Velmahos, George; Murray, James; Shoemaker, William C; Berne, Thomas V; Chan, Linda

    2003-04-01

    American Association for the Surgery of Trauma (AAST) Organ Injury Scale (OIS) grades IV and V complex hepatic injuries are highly lethal. Our objectives were to review experience and identify predictors of outcome and to evaluate the role of angioembolization in decreasing mortality. This was a retrospective 8-year study of all patients sustaining AAST-OIS grades IV and V hepatic injuries managed operatively. Statistical analysis was performed using univariate and multivariate logistic regression. The main outcome measure was survival. The study included 103 patients, with a mean Revised Trauma Score of 5.61 +/- 2.55 and a mean Injury Severity Score of 33 +/- 9.5. Mechanism of injury was penetrating in 80 (79%) and blunt in 23 (21%). Emergency department thoracotomy was performed in 21 (25%). AAST grade IV injuries occurred in 51 (47%) and grade V injuries occurred in 52 (53%). Mean estimated blood loss was 9,414 mL. Overall survival was 43%. Adjusted overall survival rate after emergency department thoracotomy patients were excluded was 58%. Results stratified to AAST-OIS injury grade were as follows: grade IV, 32 of 51 (63%); grade V, 12 of 52 (23%); grade IV versus grade V (p Trauma Score (adjusted p hepatic veins (adjusted p hepatic injuries.

  18. Medical-grade footwear: the impact of fit and comfort.

    Science.gov (United States)

    Hurst, Bessie; Branthwaite, Helen; Greenhalgh, Andrew; Chockalingam, Nachiappan

    2017-01-01

    Pressure-related skin lesions on the digits are a significant cause of discomfort. Most foot pain related to ill-fitting shoes occurs in the forefoot and digital areas. Pain has been associated with poor shoe fit, reduced toe box volume, as well as contour and shape of the shoe Off-the-shelf medical-grade footwear is designed as an intervention for chronic lesions on the digits. These shoes are designed with a flexible neoprene fabric upper that is thought to reduce pressure on the forefoot and reduce discomfort associated with ill-fitting shoes. The aim of this study was to investigate the effect of an off-the-shelf, medical-grade shoe on dorsal digital pressure and perceived comfort when compared to participant's own preferred shoe. Thirty participants (18 females, 12 males) scored their perceived comfort whilst wearing each footwear style using a visual analog comfort scale. Dorsal digital and interdigital pressures were measured in using the WalkinSense® in-shoe pressure system. Sensors were placed on predetermined anatomical landmarks on the digits. Participants were randomly assigned the test shoe and their own shoe. Once wearing the shoe, the participants walked across a 6 m walkway and pressure data from each sensor was collected and processed to obtain peak pressure, time to peak pressure and contact time. Participants scored the test shoe with higher comfort points than their own footwear. Overall peak pressure, pressure time integral and contact time decreased, whilst the time taken to reach peak pressure increased across all anatomical landmarks whilst wearing the test shoe. Statistically significant changes were observed for all of the measured variables relating to pressure on the medial border of the first metatarsophalangeal joint. The test shoe provided greater comfort and reduced the amount of pressure on the forefoot. The medical-grade footwear therefore, is a viable alternative to custom made prescription footwear and is more suitable than a

  19. Working memory and individual differences in mathematics achievement: A longitudinal study from first grade to second grade

    OpenAIRE

    De Smedt, Bert; Janssen, Rianne; Bouwens, Kelly; Verschaffel, Lieven; Boets, Bart; Ghesquière, Pol

    2009-01-01

    This longitudinal study examined the relationship between working memory and individual differences in mathematics. Working memory measures, comprising the phonological loop, the visuospatial sketchpad, and the central executive, were administered at the start of first grade. Mathematics achievement was assessed 4 months later (at the middle of first grade) and 1 year later (at the start of second grade). Working memory was significantly related to mathematics achievement in both grades, show...

  20. Desalination using low grade heat sources

    Science.gov (United States)

    Gude, Veera Gnaneswar

    A new, low temperature, energy-efficient and sustainable desalination system has been developed in this research. This system operates under near-vacuum conditions created by exploiting natural means of gravity and barometric pressure head. The system can be driven by low grade heat sources such as solar energy or waste heat streams. Both theoretical and experimental studies were conducted under this research to evaluate and demonstrate the feasibility of the proposed process. Theoretical studies included thermodynamic analysis and process modeling to evaluate the performance of the process using the following alternate energy sources for driving the process: solar thermal energy, solar photovoltaic/thermal energy, geothermal energy, and process waste heat emissions. Experimental studies included prototype scale demonstration of the process using grid power as well as solar photovoltaic/thermal sources. Finally, the feasibility of the process in reclaiming potable-quality water from the effluent of the city wastewater treatment plant was studied. The following results have been obtained from theoretical analysis and modeling: (1) The proposed process can produce up to 8 L/d of freshwater for 1 m2 area of solar collector and evaporation chamber respectively with a specific energy requirement of 3122 kJ for 1 kg of freshwater production. (2) Photovoltaic/thermal (PV/T) energy can produce up to 200 L/d of freshwater with a 25 m2 PV/T module which meets the electricity needs of 21 kWh/d of a typical household as well. This configuration requires a specific energy of 3122 kJ for 1 kg of freshwater production. (3) 100 kg/hr of geothermal water at 60°C as heat source can produce up to 60 L/d of freshwater with a specific energy requirement of 3078 kJ for 1 kg of freshwater production. (4) Waste heat released from an air conditioning system rated at 3.25 kW cooling, can produce up to 125 L/d of freshwater. This configuration requires an additional energy of 208 kJ/kg of

  1. Girls' Spatial Skills and Arithmetic Strategies in First Grade as Predictors of Fifth-Grade Analytical Math Reasoning

    Science.gov (United States)

    Casey, Beth M.; Lombardi, Caitlin McPherran; Pollock, Amanda; Fineman, Bonnie; Pezaris, Elizabeth

    2017-01-01

    This study investigated longitudinal pathways leading from early spatial skills in first-grade girls to their fifth-grade analytical math reasoning abilities (N = 138). First-grade assessments included spatial skills, verbal skills, addition/subtraction skills, and frequency of choice of a decomposition or retrieval strategy on the…

  2. HYPERGLYCEMIA IN GRADE III AND GRADE IV MALNUTRITION WITH DEHYDRATING GASTROENTERITIS

    Directory of Open Access Journals (Sweden)

    Mallesh

    2015-07-01

    Full Text Available OBJECTIVE OF THE STUDY: To study the incidence of hyperglycemia in grade III AND IV malnutrition with no signs and some signs of dehydration. SETTING: Tertiary care center located in north Karnataka. DESIGN: Prospective observational study involving 21 children. METHODS: All the children with grade III and grade IV malnutrition presenting with diarrhea of less than 14 days duration, having no signs to some signs of dehydration. RESULTS: Hyperglycemia was observed in three of 21 children hypoglycemia was observed in six children. CONCLUSION: Although hypoglycemia is common finding in moderate and severely malnourished children with dehydrating gastroenteritis, hyperglycemia should also be suspected and treated. Long term follow up of these children is needed involving larger number of people in multicenter studies.

  3. 7 CFR 51.2335 - Grades.

    Science.gov (United States)

    2010-01-01

    ...) Discoloration; (iv) Hail; (v) Growth cracks; (vi) Scab; (vii) Scars; (viii) Heat, sprayburn, or sunburn; (ix... cracks; (vi) Scab; (vii) Scars; (viii) Heat, sprayburn, or sunburn; (ix) Scale; (x) Insects; (xi) Other...; (vii) Scars; (viii) Heat, sprayburn, or sunburn; (ix) Scale; (x) Insects; (xi) Other diseases; and...

  4. Clinical management of grade III oligodendroglioma

    Directory of Open Access Journals (Sweden)

    Simonetti G

    2015-07-01

    Full Text Available G Simonetti, P Gaviani, A Botturi, A Innocenti, E Lamperti, A Silvani Neurooncology Unit, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy Abstract: Oligodendrogliomas represent the third most common type of glioma, comprising 4%–15% of all gliomas and can be classified by degree of malignancy into grade II and grade III, according to WHO classification. Only 30% of oligodendroglial tumors have anaplastic characteristics. Anaplastic oligodendroglioma (AO is often localized as a single lesion in the white matter and in the cortex, rarely in brainstem or spinal cord. The management of AO is deeply changed in the recent years. Maximal safe surgical resection followed by radiotherapy (RT was considered as the standard of care since paramount findings regarding molecular aspects, in particular co-deletion of the short arm of chromosome 1 and the long arm of chromosome 19, revealed that these subsets of AO, benefit in terms of overall survival (OS and progression-free survival (PFS, from the addition of chemotherapy to RT. Allelic losses of chromosomes 1p and 19q occur in 50%–70% of both low-grade and anaplastic tumors, representing a strong prognostic factor and a powerful predictor of prolonged survival. Several other molecular markers have potential clinical significance as IDH1 mutations, confirming the strong prognostic role for OS. Malignant brain tumors negatively impacts on patients' quality of life. Seizures, visual impairment, headache, and cognitive disorders can be present. Moreover, chemotherapy and RT have important side effects. For these reasons, “health-related quality of life” is becoming a topic of growing interest, investigating on physical, mental, emotional, and social well-being. Understanding the impact of medical treatment on health-related quality of life will probably have a growing effect both on health care strategies and on patients. Keywords: anaplastic oligodendroglioma, radiotherapy, chemotherapy

  5. Low grade gastric MALT lymphoma: Radiographic findings

    International Nuclear Information System (INIS)

    Brown, J.A.; Carson, B.W.; Gascoyne, R.D.; Cooperberg, P.L.; Connors, J.M.; Mason, A.C.

    2000-01-01

    AIMS: Gastric MALT (mucosa-associated lymphoid tissue) lymphoma is now recognized as a distinct entity within extranodal non-Hodgkin's lymphoma. The purpose of this study was to describe the radiographic findings in low grade gastric MALT lymphoma. MATERIALS AND METHODS: We retrospectively reviewed the radiographic findings in 22 cases of low-grade gastric MALT lymphoma. The study group consisted of 15 men and seven women (median age 68 years, range 41-91 years). Lesions were designated as infiltrative or polypoid by consensus of two radiologists. Polypoid lesions were categorized by number and size. Anatomical site within the stomach and presence of transpyloric or oesophagogastric extension was determined for each case. The presence of abdominal lymphadenopathy was categorized as regional or distant. The presence of Helicobacter pylori was determined from endoscopic and surgical biopsies. RESULTS: Computed tomography (CT) revealed abnormalities of the stomach in 19 cases of the 21 in which it was performed. There were 14 infiltrative lesions and five polypoid lesions. Of the 14 infiltrative lesions, the mean gastric wall thickness was 2.2 cm (range 0.8-6.0 cm). There were three single and two multiple polypoid lesions (mean size 2.2 cm, range 1.5-2.7 cm). Transpyloric extension was observed in two cases and oesophagogastric extension in one. Abdominal lymphadenopathy was observed in 10 of 21 patients. Helicobacter pylori was found in 19 of 22 cases (86%). CONCLUSION: Low grade B cell gastric MALT lymphomas present with an infiltrative form on CT in about three-quarters of cases and a polypoid pattern in the remainder. Abdominal lymphadenopathy is seen in approximately one-half of cases. There is a high association with Helicobacter pylori. Brown, J.A. 2000. Clinical Radiology 55, 384-389

  6. Clinical management of grade III oligodendroglioma

    International Nuclear Information System (INIS)

    Simonetti, G; Gaviani, P; Botturi, A; Innocenti, A; Lamperti, E; Silvani, A

    2015-01-01

    Oligodendrogliomas represent the third most common type of glioma, comprising 4%–15% of all gliomas and can be classified by degree of malignancy into grade II and grade III, according to WHO classification. Only 30% of oligodendroglial tumors have anaplastic characteristics. Anaplastic oligodendroglioma (AO) is often localized as a single lesion in the white matter and in the cortex, rarely in brainstem or spinal cord. The management of AO is deeply changed in the recent years. Maximal safe surgical resection followed by radiotherapy (RT) was considered as the standard of care since paramount findings regarding molecular aspects, in particular co-deletion of the short arm of chromosome 1 and the long arm of chromosome 19, revealed that these subsets of AO, benefit in terms of overall survival (OS) and progression-free survival (PFS), from the addition of chemotherapy to RT. Allelic losses of chromosomes 1p and 19q occur in 50%–70% of both low-grade and anaplastic tumors, representing a strong prognostic factor and a powerful predictor of prolonged survival. Several other molecular markers have potential clinical significance as IDH1 mutations, confirming the strong prognostic role for OS. Malignant brain tumors negatively impacts on patients’ quality of life. Seizures, visual impairment, headache, and cognitive disorders can be present. Moreover, chemotherapy and RT have important side effects. For these reasons, “health-related quality of life” is becoming a topic of growing interest, investigating on physical, mental, emotional, and social well-being. Understanding the impact of medical treatment on health-related quality of life will probably have a growing effect both on health care strategies and on patients

  7. EDF specifications on nuclear grade resins

    International Nuclear Information System (INIS)

    Mascarenhas, Darren; Gressier, Frederic; Taunier, Stephane; Le-Calvar, Marc; Ranchoux, Gilles; Marteau, Herve; Labed, Veronique

    2012-09-01

    Ion exchange resins are widely used across EDF, especially within the nuclear division for the purification of water. Important applications include primary circuit, secondary circuit and effluent treatment, which require high quality nuclear grade resins to retain the dissolved species, some of which may be radioactive. There is a need for more and more efficient purification in order to decrease worker dose during maintenance but also to decrease volumes of radioactive resin waste. Resin performance is subject to several forms of degradation, including physical, chemical, thermal and radioactive, therefore appropriate resin properties have to be selected to reduce such effects. Work has been done with research institutes, manufacturers and on EDF sites to select these properties, create specifications and to continuously improve on these specifications. An interesting example of research regarding resin performance is the resin degradation under irradiation. Resins used in the CVCS circuit of EDF nuclear power plants are subject to irradiation over their lifetime. A study was carried out on the effects of total integrated doses of 0.1, 1 and 10 MGy on typically used EDF mixed bed resins in a 'mini-CVCS' apparatus to simultaneously test actual primary circuit fluid. The tests confirmed that the resins still perform efficiently after a typical CVCS radiation dose. Certain resins also need additional specifications in order to maintain the integrity of the particular circuits they are used in. Recently, EDF has updated its requirements on these high purity nuclear grade resins, produced generic doctrines for all products and materials used on site which include resins of all grades, and as a result have also updated a guide on recommended resin usage for the French fleet of reactors. An overview of the evolutions will be presented. (authors)

  8. Low-grade salivary duct carcinoma or low-grade intraductal carcinoma? Review of the literature.

    Science.gov (United States)

    Kuo, Ying-Ju; Weinreb, Ilan; Perez-Ordonez, Bayardo

    2013-07-01

    Low-grade salivary duct carcinoma (LG-SDC) is a rare neoplasm characterized by predominant intraductal growth, luminal ductal phenotype, bland microscopic features, and favorable clinical behavior with an appearance reminiscent of florid to atypical ductal hyperplasia to low grade intraductal breast carcinoma. LG-SDC is composed of multiple cysts, cribriform architecture with "Roman Bridges", "pseudocribriform" proliferations with floppy fenestrations or irregular slits, micropapillae with epithelial tufts, fibrovascular cores, and solid areas. Most of the tumor cells are small to medium sized with pale eosinophilic cytoplasm, and round to oval nuclei, which may contain finely dispersed or dark condensed chromatin. Foci of intermediate to high grade atypia, and invasive carcinoma or micro-invasion have been reported in up to 23 % of cases. The neoplastic cells have a ductal phenotype with coexpression of keratins and S100 protein and are surrounded by a layer of myoepithelial cells in non-invasive cases. The main differential diagnosis of LG-SDC includes cystadenoma, cystadenocarcinoma, sclerosing polycystic adenosis, salivary duct carcinoma in situ/high-grade intraductal carcinoma, and papillary-cystic variant of acinic cell carcinoma. There is no published data supporting the continuous classification of LG-SDC as a variant of cystadenocarcinoma. Given that most LG-SDC are non-invasive neoplasms; the terms "cribriform cystadenocarcinoma" and LG-SDC should be replaced by "low-grade intraductal carcinoma" (LG-IDC) of salivary gland or "low-grade intraductal carcinoma with areas of invasive carcinoma" in those cases with evidence of invasive carcinoma.

  9. Do class size effects differ across grades?

    DEFF Research Database (Denmark)

    Nandrup, Anne Brink

    size cap that creates exogenous variation in class sizes. Significant (albeit modest) negative effects of class size increases are found for children on primary school levels. The effects on math abilities are statistically different across primary and secondary school. Larger classes do not affect......This paper contributes to the class size literature by analyzing whether short-run class size effects are constant across grade levels in compulsory school. Results are based on administrative data on all pupils enroled in Danish public schools. Identification is based on a government-imposed class...

  10. Contemporary management of high-grade gliomas.

    Science.gov (United States)

    Sim, Hao-Wen; Morgan, Erin R; Mason, Warren P

    2018-01-01

    High-grade gliomas, including glioblastoma, are the most common malignant brain tumors in adults. Despite intensive efforts to develop new therapies for these diseases, treatment options remain limited and prognosis is poor. Recently, there have been important advances in our understanding of the molecular basis of glioma, leading to refinements in our diagnostic and management approach. There is new evidence to guide the treatment of elderly patients. A multitude of new agents have been investigated, including targeted therapies, immunotherapeutics and tumor-treating fields. This review summarizes the key findings from this research, and presents a perspective on future opportunities to advance the field.

  11. The Fracture Toughness of Nuclear Graphites Grades

    Energy Technology Data Exchange (ETDEWEB)

    Burchell, Timothy D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Erdman, III, Donald L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lowden, Rick R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hunter, James A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hannel, Cara C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-04-01

    New measurements of graphite mode I critical stress intensity factor, KIc (commonly referred to as the fracture toughness) and the mode II critical shear stress intensity, KIIc, are reported and compared with prior data for KIc and KIIc. The new data are for graphite grades PCEA, IG-110 and 2114. Variations of KIc and acoustic emission (AE) data with graphite texture are reported and discussed. The Codes and Standards applications of fracture toughness, KIc, data are also discussed. A specified minimum value for nuclear graphite KIc is recommended.

  12. [The WHO/ISUP grading system for renal carcinoma].

    Science.gov (United States)

    Moch, H

    2016-07-01

    Histological tumor grading is an accepted prognostic parameter of renal cell carcinoma (RCC). In 2012, the International Society of Urologic Pathologists (ISUP) proposed a novel grading system for RCC, mainly based on the evaluation of nucleoli: grade 1 tumors have nucleoli that are inconspicuous and basophilic at ×400 magnification; grade 2 tumors have nucleoli that are clearly visible at ×400 magnification and eosinophilic; grade 3 tumors have clearly visible nucleoli at ×100 magnification; and grade 4 tumors have extreme pleomorphism or rhabdoid and/or sarcomatoid morphology. This grading system was validated for clear cell renal cell carcinoma and papillary renal cell carcinoma. At the same time, the ISUP proposed not grading chromophobe renal cell carcinomas according to this system. At a consensus conference in Zurich the World Health Organization (WHO) recommended the ISUP grading system; thus, the WHO/ISUP grading system is now going to be implemented internationally. The ISUP/WHO grading system has not been validated as a prognostic parameter for other tumor subtypes, but can be used for descriptive purposes.

  13. Development of an automatic visual grading system for grafting seedlings

    Directory of Open Access Journals (Sweden)

    Subo Tian

    2017-01-01

    Full Text Available In this study, a visual grading system of vegetable grafting machine was developed. The study described key technology of visual grading system of vegetable grafting machine. First, the contrasting experiment was conducted between acquired images under blue background light and natural light conditions, with the blue background light chosen as lighting source. The Visual C++ platform with open-source computer vision library (Open CV was used for the image processing. Subsequently, maximum frequency of total number of 0-valued pixels was predicted and used to extract the measurements of scion and rootstock stem diameters. Finally, the developed integrated visual grading system was experimented with 100 scions and rootstock seedlings. The results showed that success rate of grading reached up to 98%. This shows that selection and grading of scion and rootstock could be fully automated with this developed visual grading system. Hence, this technology would be greatly helpful for improving the grading accuracy and efficiency.

  14. Aeroelastic Tailoring of a Plate Wing with Functionally Graded Materials

    Science.gov (United States)

    Dunning, Peter D.; Stanford, Bret K.; Kim, H. Alicia; Jutte, Christine V.

    2014-01-01

    This work explores the use of functionally graded materials for the aeroelastic tailoring of a metallic cantilevered plate-like wing. Pareto trade-off curves between dynamic stability (flutter) and static aeroelastic stresses are obtained for a variety of grading strategies. A key comparison is between the effectiveness of material grading, geometric grading (i.e., plate thickness variations), and using both simultaneously. The introduction of material grading does, in some cases, improve the aeroelastic performance. This improvement, and the physical mechanism upon which it is based, depends on numerous factors: the two sets of metallic material parameters used for grading, the sweep of the plate, the aspect ratio of the plate, and whether the material is graded continuously or discretely.

  15. [Patients with subarachnoid haemorrhage in poor grade neurological status: Study of prognostic factors].

    Science.gov (United States)

    Sosa-Pérez, Coralia; Morera-Molina, Jesús; Espino-Postigo, Carlos; Jiménez-O'Shanahan, Aruma

    2015-01-01

    To evaluate and predict factors influencing prognosis and/or clinical outcome at 6 months in patients with spontaneous subarachnoid haemorrhage, World Federation of Neurosurgical Societies (WFNS) grades iv and v. This was a retrospective study of a consecutive series of 394 patients admitted to our hospital with clinical and radiological diagnosis of spontaneous subarachnoid haemorrhage, from 1 January 1999 to 30 June 2009. We selected 121 patients who met the criteria of being in WFNS grades iv or v before treatment; 3 patients were excluded due to loss of tracking. The outcome variable was assessed 6 months after the event using the Glasgow Outcome Scale. A P value<.05 was considered statistically significant. One hundred and twenty-one patients were included in the statistical analysis. The average age of the patients in the series was 54 years (14-92). Patients who had a mean Glasgow Coma Scale lower than 7 points (P<.0001), those who were grade v (P<.0001) in the pre-treatment WFNS scale and those with pupillary disorder (P=.002) had a worse clinical outcome. Likewise, those with associated intraparenchymal hematoma (P=.020) and those not receiving any treatment (P=.020) were also associated with a poor clinical outcome. These results were statistically significant. Patients admitted with a WFNS grade v and/or presenting pupil disorder and/or intraparenchymal hematoma were associated with worse clinical outcomes. Copyright © 2014 Sociedad Española de Neurocirugía. Published by Elsevier España. All rights reserved.

  16. Interpreting the Third International Mathematics and Science Study (TIMSS) achievement scales using scale anchoring

    Science.gov (United States)

    Kelly, Dana L.

    1999-11-01

    The scale anchoring method was used to analyze and describe the TIMSS primary and middle school (Populations 1 and 2) mathematics and science achievement scales. Scale anchoring is a way of attaching meaning to a scale by describing what students know and can do at specific points on the scale. Student achievement was scrutinized at four points on the TIMSS primary and middle school achievement scales---the 25th, 50th, 75th, and 90th international percentiles for fourth and eighth grades. The scale anchoring method was adapted for the TIMSS data and items that students scoring at each of the four scale points were likely to answer correctly (with a 65 percent probability) were identified. The items were assembled in binders organized by anchor level and content area. Two ten-member panels of subject-matter specialists were convened to scrutinize the items, draft descriptions of student proficiency at the four scale points, and identify example TIMSS items to illustrate performance at each level. Following the panel meetings, the descriptions were refined through an iterative review process. The result is a content-referenced interpretation of the TIMSS scales through which TIMSS achievement results can be better communicated and understood.

  17. Exploring scientific creativity of eleventh-grade students in Taiwan

    Science.gov (United States)

    Liang, Jia-Chi

    2002-04-01

    Although most researchers focus on scientists' creativity, students' scientific creativity should be considered, especially for high school and college students. It is generally assumed that most professional creators in science emerge from amateur creators. Therefore, the purpose of this study is to investigate the relationship between students' scientific creativity and selected variables including creativity, problem finding, formulating hypotheses, science achievement, the nature of science, and attitudes toward science for finding significant predictors of eleventh grade students' scientific creativity. A total of 130 male eleventh-grade students in three biology classes participated in this study. The main instruments included the Test of Divergent Thinking (TDT) for creativity measurement, the Creativity Rating Scale (CRS) and the Creative Activities and Accomplishments Check Lists (CAACL ) for measurement of scientific creativity, the Nature of Scientific Knowledge Scale (NSKS) for measurement of the nature of science, and the Science Attitude Inventory II (SAI II) for measurement of attitudes toward science. In addition, two instruments on measuring students' abilities of problem finding and abilities of formulating hypotheses were developed by the researcher in this study. Data analysis involved descriptive statistics, Pearson product-moment correlations, and stepwise multiple regressions. The major findings suggested the following: (1) students' scientific creativity significantly correlated with some of selected variables such as attitudes toward science, problem finding, formulating hypotheses, the nature of science, resistance to closure, originality, and elaboration; (2) four significant predictors including attitudes toward science, problem finding, resistance to closure, and originality accounted for 48% of the variance of students' scientific creativity; (3) there were big differences between students with a higher and a lower degree of scientific

  18. Automated grading system for evaluation of ocular redness associated with dry eye

    Directory of Open Access Journals (Sweden)

    Rodriguez JD

    2013-06-01

    Full Text Available John D Rodriguez,1 Patrick R Johnston,1 George W Ousler III,1 Lisa M Smith,1 Mark B Abelson1,21Ora, Inc, Andover, MA, USA; 2Department of Ophthalmology, Harvard Medical School, Boston, MA, USABackground: We have observed that dry eye redness is characterized by a prominence of fine horizontal conjunctival vessels in the exposed ocular surface of the interpalpebral fissure, and have incorporated this feature into the grading of redness in clinical studies of dry eye.Aim: To develop an automated method of grading dry eye-associated ocular redness in order to expand on the clinical grading system currently used.Methods: Ninety nine images from 26 dry eye subjects were evaluated by five graders using a 0–4 (in 0.5 increments dry eye redness (Ora CalibraTM Dry Eye Redness Scale [OCDER] scale. For the automated method, the Opencv computer vision library was used to develop software for calculating redness and horizontal conjunctival vessels (noted as "horizontality". From original photograph, the region of interest (ROI was selected manually using the open source ImageJ software. Total average redness intensity (Com-Red was calculated as a single channel 8-bit image as R − 0.83G − 0.17B, where R, G and B were the respective intensities of the red, green and blue channels. The location of vessels was detected by normalizing the blue channel and selecting pixels with an intensity of less than 97% of the mean. The horizontal component (Com-Hor was calculated by the first order Sobel derivative in the vertical direction and the score was calculated as the average blue channel image intensity of this vertical derivative. Pearson correlation coefficients, accuracy and concordance correlation coefficients (CCC were calculated after regression and standardized regression of the dataset.Results: The agreement (both Pearson's and CCC among investigators using the OCDER scale was 0.67, while the agreement of investigator to computer was 0.76. A multiple

  19. Automated grading system for evaluation of ocular redness associated with dry eye.

    Science.gov (United States)

    Rodriguez, John D; Johnston, Patrick R; Ousler, George W; Smith, Lisa M; Abelson, Mark B

    2013-01-01

    We have observed that dry eye redness is characterized by a prominence of fine horizontal conjunctival vessels in the exposed ocular surface of the interpalpebral fissure, and have incorporated this feature into the grading of redness in clinical studies of dry eye. To develop an automated method of grading dry eye-associated ocular redness in order to expand on the clinical grading system currently used. Ninety nine images from 26 dry eye subjects were evaluated by five graders using a 0-4 (in 0.5 increments) dry eye redness (Ora Calibra™ Dry Eye Redness Scale [OCDER]) scale. For the automated method, the Opencv computer vision library was used to develop software for calculating redness and horizontal conjunctival vessels (noted as "horizontality"). From original photograph, the region of interest (ROI) was selected manually using the open source ImageJ software. Total average redness intensity (Com-Red) was calculated as a single channel 8-bit image as R - 0.83G - 0.17B, where R, G and B were the respective intensities of the red, green and blue channels. The location of vessels was detected by normalizing the blue channel and selecting pixels with an intensity of less than 97% of the mean. The horizontal component (Com-Hor) was calculated by the first order Sobel derivative in the vertical direction and the score was calculated as the average blue channel image intensity of this vertical derivative. Pearson correlation coefficients, accuracy and concordance correlation coefficients (CCC) were calculated after regression and standardized regression of the dataset. The agreement (both Pearson's and CCC) among investigators using the OCDER scale was 0.67, while the agreement of investigator to computer was 0.76. A multiple regression using both redness and horizontality improved the agreement CCC from 0.66 and 0.69 to 0.76, demonstrating the contribution of vessel geometry to the overall grade. Computer analysis of a given image has 100% repeatability and zero

  20. Comparison of the reliability of two hydronephrosis grading systems: The Society for Foetal Urology grading system vs. the Onen grading system

    International Nuclear Information System (INIS)

    Kim, S.-Y.; Kim, M.-J.; Yoon, C.S.; Lee, M.S.; Han, K.H.; Lee, M.-J.

    2013-01-01

    Aim: To compare the reliability of the conventional ultrasonography grading system for hydronephrosis as suggested by the Society for Fetal Urology (SFU) in 1993 and that developed by Onen in 2007. Materials and methods: One hundred and eighty kidneys in 90 paediatric patients were assessed by four radiologists using each of the two grading systems twice. The SFU system was graded 0–4 (0 = no hydronephrosis; 1 = visualized only renal pelvis; 2 = plus a few caliceal dilatation; 3 = all calyceal dilatation; 4 = plus parenchymal thinning). The Onen system was graded 0–4 (0 = no hydronephrosis; 1 = only renal pelvic dilatation; 2 = plus caliceal dilatation; 3 = plus 50% renal parenchymal loss). Cohen's kappa statistic was used to estimate intra- and interobserver agreement. The weighted least-squares approach was used to compare the intra-observer agreement, and bootstrapping was used to compare the interobserver agreement between the two systems. Results: Intra-observer agreement was substantial to almost perfect in both the SFU (κ 0.79–0.95) and the Onen (κ 0.66–0.97) grading system without difference. The overall interobserver agreement was substantial in both the SFU (κ 0.61–0.68) and the Onen (κ 0.66–0.76) grading system. However, interobserver agreement was fair to moderate for SFU grades 1 and 2 and Onen grades 2 and 3. Conclusion: Both the SFU and Onen grading system are reliable with good intra- and interobserver agreement. However, decreased interobserver agreement was demonstrated for SFU grades 1 and 2 and Onen grades 2 and 3

  1. Current treatment of low grade astrocytoma

    DEFF Research Database (Denmark)

    Pedersen, Christina Louise; Romner, Bertil

    2013-01-01

    Through a comprehensive review of the current literature, the present article investigates several aspects of low grade astrocytomas (LGA), including prognostic factors, treatment strategies and follow-up regimes. LGA are in general relatively slow-growing primary brain tumours, but they have a v...... effective in discriminating between tumour progression and radiation necrosis. The research into biomarkers is currently limited with regards to their applications in LGA diagnostics, and therefore further studies including larger patient populations are needed.......Through a comprehensive review of the current literature, the present article investigates several aspects of low grade astrocytomas (LGA), including prognostic factors, treatment strategies and follow-up regimes. LGA are in general relatively slow-growing primary brain tumours, but they have...... as the course of disease. The current literature seems to support the idea that treatment with radical tumour resection, where possible, yields better long term outcome for patients with LGA. However, adjuvant therapy is often necessary. Administering early postoperative radiotherapy to patients with partially...

  2. Graded Recombination Layers for Multijunction Photovoltaics

    KAUST Repository

    Koleilat, Ghada I.

    2012-06-13

    Multijunction devices consist of a stack of semiconductor junctions having bandgaps tuned across a broad spectrum. In solar cells this concept is used to increase the efficiency of photovoltaic harvesting, while light emitters and detectors use it to achieve multicolor and spectrally tunable behavior. In series-connected current-matched multijunction devices, the recombination layers must allow the hole current from one cell to recombine, with high efficiency and low voltage loss, with the electron current from the next cell. We recently reported a tandem solar cell in which the recombination layer was implemented using a progression of n-type oxides whose doping densities and work functions serve to connect, with negligible resistive loss at solar current densities, the constituent cells. Here we present the generalized conditions for design of efficient graded recombination layer solar devices. We report the number of interlayers and the requirements on work function and doping of each interlayer, to bridge an work function difference as high as 1.6 eV. We also find solutions that minimize the doping required of the interlayers in order to minimize optical absorption due to free carriers in the graded recombination layer (GRL). We demonstrate a family of new GRL designs experimentally and highlight the benefits of the progression of dopings and work functions in the interlayers. © 2012 American Chemical Society.

  3. Microbial Production of Food Grade Pigments

    Directory of Open Access Journals (Sweden)

    Laurent Dufossé

    2006-01-01

    Full Text Available The controversial topic of synthetic dyes in food has been discussed for many years. The scrutiny and negative assessment of synthetic food dyes by the modern consumer have raised a strong interest in natural colouring alternatives. Nature is rich in colours (minerals, plants, microalgae, etc., and pigment-producing microorganisms (fungi, yeasts, bacteria are quite common. Among the molecules produced by microorganisms are carotenoids, melanins, flavins, quinones, and more specifically monascins, violacein or indigo. The success of any pigment produced by fermentation depends upon its acceptability on the market, regulatory approval, and the size of the capital investment required to bring the product to market. A few years ago, some expressed doubts about the successful commercialization of fermentation-derived food grade pigments because of the high capital investment requirements for fermentation facilities and the extensive and lengthy toxicity studies required by regulatory agencies. Public perception of biotechnology-derived products also had to be taken into account. Nowadays some fermentative food grade pigments are on the market: Monascus pigments, astaxanthin from Xanthophyllomyces dendrorhous, Arpink Red from Penicillium oxalicum, riboflavin from Ashbya gossypii, b-carotene from Blakeslea trispora. The successful marketing of pigments derived from algae or extracted from plants, both as a food colour and a nutritional supplement, reflects the presence and importance of niche markets in which consumers are willing to pay a premium for »all natural ingredients«.

  4. Controlling Thermal Conduction by Graded Materials

    Science.gov (United States)

    Ji, Qin; Huang, Ji-Ping

    2018-04-01

    Manipulating thermal conductivities are fundamentally important for controlling the conduction of heat at will. Thermal cloaks and concentrators, which have been extensively studied recently, are actually graded materials designed according to coordinate transformation approaches, and their effective thermal conductivity is equal to that of the host medium outside the cloak or concentrator. Here we attempt to investigate a more general problem: what is the effective thermal conductivity of graded materials? In particular, we perform a first-principles approach to the analytic exact results of effective thermal conductivities of materials possessing either power-law or linear gradation profiles. On the other hand, by solving Laplace’s equation, we derive a differential equation for calculating the effective thermal conductivity of a material whose thermal conductivity varies along the radius with arbitrary gradation profiles. The two methods agree with each other for both external and internal heat sources, as confirmed by simulation and experiment. This work provides different methods for designing new thermal metamaterials (including thermal cloaks and concentrators), in order to control or manipulate the transfer of heat. Support by the National Natural Science Foundation of China under Grant No. 11725521, by the Science and Technology Commission of Shanghai Municipality under Grant No. 16ZR1445100

  5. Diabetic Retinopathy Grading by Digital Curvelet Transform

    Directory of Open Access Journals (Sweden)

    Shirin Hajeb Mohammad Alipour

    2012-01-01

    Full Text Available One of the major complications of diabetes is diabetic retinopathy. As manual analysis and diagnosis of large amount of images are time consuming, automatic detection and grading of diabetic retinopathy are desired. In this paper, we use fundus fluorescein angiography and color fundus images simultaneously, extract 6 features employing curvelet transform, and feed them to support vector machine in order to determine diabetic retinopathy severity stages. These features are area of blood vessels, area, regularity of foveal avascular zone, and the number of micro-aneurisms therein, total number of micro-aneurisms, and area of exudates. In order to extract exudates and vessels, we respectively modify curvelet coefficients of color fundus images and angiograms. The end points of extracted vessels in predefined region of interest based on optic disk are connected together to segment foveal avascular zone region. To extract micro-aneurisms from angiogram, first extracted vessels are subtracted from original image, and after removing detected background by morphological operators and enhancing bright small pixels, micro-aneurisms are detected. 70 patients were involved in this study to classify diabetic retinopathy into 3 groups, that is, (1 no diabetic retinopathy, (2 mild/moderate nonproliferative diabetic retinopathy, (3 severe nonproliferative/proliferative diabetic retinopathy, and our simulations show that the proposed system has sensitivity and specificity of 100% for grading.

  6. Recovery of uranium from low-grade sandstone ores and phosphate rock

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, R H [United States Atomic Energy Commission, Washington, D. C. (United States)

    1967-06-15

    This paper is concerned principally with commercial-scale experience in the United States in the recovery of uranium from low-grade sources. Most of these operations have been conducted by the operators of uranium mills as an alternative to processing normal-grade ores. The operations have been generally limited, therefore, to the treatment of low-grade materials generated in the course of mining normal-grade ores. In some circumstances such materials can be treated by simplified procedures as an attractive source of additional production. The experience gained in uranium recovery from phosphate rock will be treated in some detail. The land pebble phosphate rock of central Florida generally contains about 0.01 to 0.02% U{sub 3}O{sub 8}. While no uranium is being recovered from this source at the present time, it does represent a significant potential source of by-product uranium production because of the large tonnages being mined. (author)

  7. Bulk solar grade silicon: how chemistry and physics play to get a benevolent microstructured material

    Energy Technology Data Exchange (ETDEWEB)

    Pizzini, S. [University of Milano-Bicocca, Department of Materials Science, Milan (Italy); Nedsilicon SpA, Osimo, Ancona (Italy)

    2009-07-15

    The availability of low-cost alternatives to electronic grade silicon has been and still is the condition for the extensive use of photovoltaics as an efficient sun harvesting system. The first step towards this objective was positively carried out in the 1980s and resulted in the reduction in cost and energy of the growth process using as feedstock electronic grade scraps and a variety of solidification procedures, all of which deliver a multi-crystalline material of high photovoltaic quality. The second step was an intense R and D activity aiming at defining and developing at lab scale a new variety of silicon, called ''solar grade'' silicon, which should fulfil the requirement of both cost effectiveness and high conversion efficiency. The third step involved and still involves the development of cost-effective technologies for the manufacture of solar grade silicon, in alternative to the classical Siemens route, which relays, as is well-known, to the pyrolitic decomposition of high-purity trichlorosilane and which is, also in its more advanced versions, extremely energy intensive. Aim of this paper is to give the author's viewpoint about some open questions concerning bulk solar silicon for PV applications and about challenges and chances of novel feedstocks of direct metallurgical origin. (orig.)

  8. Joint multiple fully connected convolutional neural network with extreme learning machine for hepatocellular carcinoma nuclei grading.

    Science.gov (United States)

    Li, Siqi; Jiang, Huiyan; Pang, Wenbo

    2017-05-01

    Accurate cell grading of cancerous tissue pathological image is of great importance in medical diagnosis and treatment. This paper proposes a joint multiple fully connected convolutional neural network with extreme learning machine (MFC-CNN-ELM) architecture for hepatocellular carcinoma (HCC) nuclei grading. First, in preprocessing stage, each grayscale image patch with the fixed size is obtained using center-proliferation segmentation (CPS) method and the corresponding labels are marked under the guidance of three pathologists. Next, a multiple fully connected convolutional neural network (MFC-CNN) is designed to extract the multi-form feature vectors of each input image automatically, which considers multi-scale contextual information of deep layer maps sufficiently. After that, a convolutional neural network extreme learning machine (CNN-ELM) model is proposed to grade HCC nuclei. Finally, a back propagation (BP) algorithm, which contains a new up-sample method, is utilized to train MFC-CNN-ELM architecture. The experiment comparison results demonstrate that our proposed MFC-CNN-ELM has superior performance compared with related works for HCC nuclei grading. Meanwhile, external validation using ICPR 2014 HEp-2 cell dataset shows the good generalization of our MFC-CNN-ELM architecture. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Longitudinal Change in the Relationship between Fundamental Motor Skills and Perceived Competence: Kindergarten to Grade 2

    Directory of Open Access Journals (Sweden)

    Jeff R. Crane

    2017-08-01

    Full Text Available As children transition from early to middle childhood, the relationship between motor skill proficiency and perceptions of physical competence should strengthen as skills improve and inflated early childhood perceptions decrease. This study examined change in motor skills and perceptions of physical competence and the relationship between those variables from kindergarten to grade 2. Participants were 250 boys and girls (Mean age = 5 years 8 months in kindergarten. Motor skills were assessed using the Test of Gross Motor Development-2 and perceptions were assessed using a pictorial scale of perceived competence. Mixed-design analyses of variance revealed there was a significant increase in object-control skills and perceptions from kindergarten to grade 2, but no change in locomotor skills. In kindergarten, linear regression showed that locomotor skills and object-control skills explained 10% and 9% of the variance, respectively, in perceived competence for girls, and 7% and 11%, respectively, for boys. In grade 2, locomotor skills predicted 11% and object-control skills predicted 19% of the variance in perceptions of physical competence, but only among the boys. Furthermore, the relationship between motor skills and perceptions of physical competence strengthened for boys only from early to middle childhood. However, it seems that forces other than motor skill proficiency influenced girls’ perceptions of their abilities in grade 2.

  10. Crater ejecta scaling laws: fundamental forms based on dimensional analysis

    International Nuclear Information System (INIS)

    Housen, K.R.; Schmidt, R.M.; Holsapple, K.A.

    1983-01-01

    A model of crater ejecta is constructed using dimensional analysis and a recently developed theory of energy and momentum coupling in cratering events. General relations are derived that provide a rationale for scaling laboratory measurements of ejecta to larger events. Specific expressions are presented for ejection velocities and ejecta blanket profiles in two limiting regimes of crater formation: the so-called gravity and strength regimes. In the gravity regime, ejectra velocities at geometrically similar launch points within craters vary as the square root of the product of crater radius and gravity. This relation implies geometric similarity of ejecta blankets. That is, the thickness of an ejecta blanket as a function of distance from the crater center is the same for all sizes of craters if the thickness and range are expressed in terms of crater radii. In the strength regime, ejecta velocities are independent of crater size. Consequently, ejecta blankets are not geometrically similar in this regime. For points away from the crater rim the expressions for ejecta velocities and thickness take the form of power laws. The exponents in these power laws are functions of an exponent, α, that appears in crater radius scaling relations. Thus experimental studies of the dependence of crater radius on impact conditions determine scaling relations for ejecta. Predicted ejection velocities and ejecta-blanket profiles, based on measured values of α, are compared to existing measurements of velocities and debris profiles

  11. Ultrasonography versus magnetic resonance imaging in detecting and grading common extensor tendon tear in chronic lateral epicondylitis.

    Directory of Open Access Journals (Sweden)

    Artur Bachta

    Full Text Available To investigate the diagnostic performance and reliability of ultrasonography (US in detecting and grading common extensor tendon (CET tear in patients with chronic lateral epicondylitis (LE, using magnetic resonance imaging (MRI as the reference standard.The study comprised fifty-eight chronic LE patients. Each patient underwent US and MRI. CET status was classified as: high-grade tear (≥50% thickness, low-grade tear (<50% thickness, suspected tear (possible but not evident tear, no tear. Additionally, the following dichotomous scale was used: confirmed or unconfirmed CET tear. Relative US parameters (versus MRI for detecting CET tear included: sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and accuracy. The agreement between US and MRI findings was measured using the weighted Cohen kappa coefficient (κ.US showed moderate agreement with MRI in detecting and grading CET tear (κ = 0.49. Sensitivity, specificity, and accuracy in CET tear detecting by US were 64.52%, 85.19%, and 72.73%, respectively. PPV and NPV of US were 83.33% and 67.65%, respectively. No patient with unconfirmed CET tear on US had high-grade CET tear on MRI.Ultrasonography is a valuable imaging modality that can be used as a screening tool to exclude high-grade CET tear in chronic LE patients. Once a tear is evident on US, MRI should be considered to assess precisely the extent of tendon injury.

  12. Comparison of thermal comfort and sensation scales : a case study

    NARCIS (Netherlands)

    Vesely, Michal; Zeiler, Wim; Li, Rongling; Loomans, M.G.L.C.; te Kulve, M.

    2015-01-01

    Thermal sensation is a conscious feeling that grades the thermal environment, while thermal comfort expresses satisfaction with this feeling. Multiple scales to quantify thermal sensation and comfort have been developed throughout the history of research on thermal comfort. In this paper, the most

  13. Construct validity of the career myths scale among South African ...

    African Journals Online (AJOL)

    Career beliefs can limit individuals' abilities to make effective career decisions and hence it is important to identify such beliefs during counselling. Two hundred and sixty grade 8 to 11 high school learners completed the Career Myths Scale, which is a measure of dysfunctional beliefs. The data were subjected to a ...

  14. Validation of the Self-Regulation Scale in Chinese Children

    Science.gov (United States)

    Zhou, Ying; Bullock, Amanda; Liu, Junsheng; Fu, Rui; Coplan, Robert J.; Cheah, Charissa S. L.

    2016-01-01

    Psychometric properties of the Chinese version of the Self-Regulation Scale (C-SRS) were examined in a sample of 1,458 third- to eighth-grade students in China. Children completed self-reports of self-regulation, loneliness, depression, and self-esteem, and teachers rated children's school adjustment. Results showed a stable three-factor model…

  15. Automated discrimination of lower and higher grade gliomas based on histopathological image analysis

    Directory of Open Access Journals (Sweden)

    Hojjat Seyed Mousavi

    2015-01-01

    Full Text Available Introduction: Histopathological images have rich structural information, are multi-channel in nature and contain meaningful pathological information at various scales. Sophisticated image analysis tools that can automatically extract discriminative information from the histopathology image slides for diagnosis remain an area of significant research activity. In this work, we focus on automated brain cancer grading, specifically glioma grading. Grading of a glioma is a highly important problem in pathology and is largely done manually by medical experts based on an examination of pathology slides (images. To complement the efforts of clinicians engaged in brain cancer diagnosis, we develop novel image processing algorithms and systems to automatically grade glioma tumor into two categories: Low-grade glioma (LGG and high-grade glioma (HGG which represent a more advanced stage of the disease. Results: We propose novel image processing algorithms based on spatial domain analysis for glioma tumor grading that will complement the clinical interpretation of the tissue. The image processing techniques are developed in close collaboration with medical experts to mimic the visual cues that a clinician looks for in judging of the grade of the disease. Specifically, two algorithmic techniques are developed: (1 A cell segmentation and cell-count profile creation for identification of Pseudopalisading Necrosis, and (2 a customized operation of spatial and morphological filters to accurately identify microvascular proliferation (MVP. In both techniques, a hierarchical decision is made via a decision tree mechanism. If either Pseudopalisading Necrosis or MVP is found present in any part of the histopathology slide, the whole slide is identified as HGG, which is consistent with World Health Organization guidelines. Experimental results on the Cancer Genome Atlas database are presented in the form of: (1 Successful detection rates of pseudopalisading necrosis

  16. Effect of Retention in Elementary Grades on Grade 9 Motivation for Educational Attainment

    Science.gov (United States)

    Cham, Heining; Hughes, Jan N.; West, Stephen G.; Im, Myung Hee

    2014-01-01

    This study investigated the effect of grade retention in elementary school on students’ motivation for educational attainment in grade 9. We equated retained and promoted students on 67 covariates assessed in grade 1 through propensity score weighting. Retained students (31.55%, nretained = 177) and continuously promoted students (68.45%, npromoted = 384) were compared on the bifactor model of motivation for educational attainment (Cham, Hughes, West, & Im, 2014). This model consists of a General factor (student’s overall motivation for educational attainment), and three specific factors: student perceived Teacher Educational Expectations, Peer Educational Aspirations, and Value of Education. Measurement invariance between retained and promoted groups was established. Retained students scored significantly higher than promoted students on each specific factor but not on the General factor. Results showed that the retained and promoted students did not significantly differ on the General factor. The retained students had significantly higher scores on each specific factor than the promoted students. The results suggested that grade retention may not have the negative effects so widely assumed in the published literature; it is an expensive intervention with minimal evidence of benefits to the retained student. PMID:25636258

  17. Grade determination of crumb rubber-modified performance graded asphalt binder.

    Science.gov (United States)

    2013-08-01

    Due to particulates common in crumb rubber-modified asphalt binders, conventional PG grading using the Dynamic : Shear Rheometer (DSR) with a gap height of 1.0 mm may not be valid and in accordance with current specifications. : Asphalt binder testin...

  18. Navigating middle grades: role of social contexts in middle grade school climate.

    Science.gov (United States)

    Kim, Ha Yeon; Schwartz, Kate; Cappella, Elise; Seidman, Edward

    2014-09-01

    During early adolescence, most public school students undergo school transitions, and many students experience declines in academic performance and social-emotional well-being. Theories and empirical research have highlighted the importance of supportive school environments in promoting positive youth development during this period of transition. Despite this, little is known about the proximal social and developmental contexts of the range of middle grade public schools US students attend. Using a cross-sectional dataset from the eighth grade wave of the Early Childhood Longitudinal Study-Kindergarten Cohort 1998-1999, the current study examines the middle grade school social context from the perspectives of administrators and teachers in public schools with typical grade configurations (k-8 schools, middle schools, and junior high schools) and how it relates to students' perceptions of school climate. We find that administrators and teachers in k-8 schools perceive a more positive school social context, controlling for school structural and demographic characteristics. This school social context, in turn, is associated with students' perceptions of their schools' social and academic climate. Implications for educational policy and practice are discussed.

  19. Effect of retention in elementary grades on grade 9 motivation for educational attainment.

    Science.gov (United States)

    Cham, Heining; Hughes, Jan N; West, Stephen G; Im, Myung Hee

    2015-02-01

    This study investigated the effect of grade retention in elementary school on students' motivation for educational attainment in grade 9. We equated retained and promoted students on 67 covariates assessed in grade 1 through propensity score weighting. Retained students (31.55%, nretained=177) and continuously promoted students (68.45%, npromoted=384) were compared on the bifactor model of motivation for educational attainment (Cham, Hughes, West & Im, 2014). This model consists of a General factor (student's overall motivation for educational attainment), and three specific factors: student perceived Teacher Educational Expectations, Peer Educational Aspirations, and Value of Education. Measurement invariance between retained and promoted groups was established. Retained students scored significantly higher than promoted students on each specific factor but not on the General factor. Results showed that the retained and promoted students did not significantly differ on the General factor. The retained students had significantly higher scores on each specific factor than those of the promoted students. The results suggested that grade retention may not have the negative effects so widely assumed in the published literature; it is an expensive intervention with minimal evidence of benefits to the retained student. Copyright © 2014 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  20. Sample Grade Level Benchmarks, Grades 5-8, Based on the 1998 Arkansas State Mathematics Framework.

    Science.gov (United States)

    Arkansas State Dept. of Education, Little Rock.

    This document presents the application and use of mathematics learning proposed by the Arkansas curriculum frameworks for grades 5-8. The standards are presented in chart form and organized into five strands: (1) number sense, properties, and operations; (2) geometry and spatial sense; (3) measurement; (4) data analysis, statistics, and…

  1. Characterization of food-grade titanium dioxide: the presence of nanosized particles.

    Science.gov (United States)

    Yang, Yu; Doudrick, Kyle; Bi, Xiangyu; Hristovski, Kiril; Herckes, Pierre; Westerhoff, Paul; Kaegi, Ralf

    2014-06-03

    Titanium dioxide (TiO2) is widely used in food products, which will eventually enter wastewater treatment plants and terrestrial or aquatic environments, yet little is known about the fraction of this TiO2 that is nanoscale, or the physical and chemical properties of TiO2 that influence its human and environmental fate or toxicity. Instead of analyzing TiO2 properties in complex food or environmental samples, we procured samples of food-grade TiO2 obtained from global food suppliers and then, using spectroscopic and other analytical techniques, quantified several parameters (elemental composition, crystal structure, size, and surface composition) that are reported to influence environmental fate and toxicity. Another sample of nano-TiO2 that is generally sold for catalytic applications (P25) and widely used in toxicity studies, was analyzed for comparison. Food-grade and P25 TiO2 are engineered products, frequently synthesized from purified titanium precursors, and not milled from bulk scale minerals. Nanosized materials were present in all of the food-grade TiO2 samples, and transmission electron microscopy showed that samples 1-5 contained 35, 23, 21, 17, and 19% of nanosized primary particles (average hydrodynamic diameter of >100 nm. Food-grade samples contained phosphorus (P), with concentrations ranging from 0.5 to 1.8 mg of P/g of TiO2. The phosphorus content of P25 was below inductively coupled plasma mass spectrometry detection limits. Presumably because of a P-based coating detected by X-ray photoelectron spectroscopy, the ζ potential of the food-grade TiO2 suspension in deionized water ranged from -10 to -45 mV around pH 7, and the iso-electric point for food-grade TiO2 (grade materials, and although the presence of amorphous TiO2 could not be ruled out, it is unlikely on the basis of Raman analysis. The food-grade TiO2 was solar photoactive. Cationic dyes adsorbed more readily to food-grade TiO2 than P25, indicating very different potentials for

  2. The Influence of Scale on School Performance

    Directory of Open Access Journals (Sweden)

    Robert Bickel

    2000-05-01

    Full Text Available In this study, we investigate the joint influence of school and district size on school performance among schools with eighth grades (n=367 and schools with eleventh grades in Georgia (n=298. Schools are the unit of analysis in this study because schools are increasingly the unit on which states fix the responsibility to be accountable. The methodology further develops investigations along the line of evidence suggesting that the influence of size is contingent on socioeconomic status (SES. All previous studies have used a single-level regression model (i.e., schools or districts. This study confronts the issue of cross-level interaction of SES and size (i.e., schools and districts with a single-equation-relative-effects model to interpret the joint influence of school and district size on school performance (i.e., the dependent variable is a school-level variable. It also tests the equity of school-level outcomes jointly by school and district size. Georgia was chosen for study because previous single-level analysis there had revealed no influence of district size on performance (measured at the district level. Findings from this study show substantial cross-level influences of school and district size at the 8th grade, and weaker influences at the 11th grade. The equity effects, however, are strong at both grade levels and show a distinctive pattern of size interactions. Results are interpreted to draw implications for a "structuralist" view of school and district restructuring, with particular concern for schooling to serve impoverished communities. The authors argue the importance of a notion of "scaling" in the system of schooling, advocating the particular need to create smaller districts as well as smaller schools as a route to both school excellence and equity of school outcomes.

  3. Interference studies with two hospital-grade and two home-grade glucose meters.

    Science.gov (United States)

    Lyon, Martha E; Baskin, Leland B; Braakman, Sandy; Presti, Steven; Dubois, Jeffrey; Shirey, Terry

    2009-10-01

    Interference studies of four glucose meters (Nova Biomedical [Waltham, MA] StatStrip [hospital grade], Roche Diagnostics [Indianapolis, IN] Accu-Chek Aviva [home grade], Abbott Diabetes Care [Alameda, CA] Precision FreeStyle Freedom [home grade], and LifeScan [Milpitas, CA] SureStep Flexx [hospital grade]) were evaluated and compared to the clinical laboratory plasma hexokinase reference method (Roche Hitachi 912 chemistry analyzer). These meters were chosen to reflect the continuum of care from hospital to home grade meters commonly seen in North America. Within-run precision was determined using a freshly prepared whole blood sample spiked with concentrated glucose to give three glucose concentrations. Day-to-day precision was evaluated using aqueous control materials supplied by each vendor. Common interferences, including hematocrit, maltose, and ascorbate, were tested alone and in combination with one another on each of the four glucose testing devices at three blood glucose concentrations. Within-run precision for all glucose meters was glucose meters. Ascorbate caused differences (percentage change from a sample without added interfering substances) of >5% with pyrroloquinolinequinone (PQQ)-glucose dehydrogenase-based technologies (Aviva and Freestyle) and the glucose oxidase-based Flexx meter. Maltose strongly affected the PQQ-glucose dehydrogenase-based meter systems. When combinations of interferences (ascorbate, maltose, and hematocrit mixtures) were tested, the extent of the interference was up to 193% (Aviva), 179% (FreeStyle), 25.1% (Flexx), and 5.9% (StatStrip). The interference was most pronounced at low glucose (3.9-4.4 mmol/L). All evaluated glucose meter systems demonstrated varying degrees of interference by hematocrit, ascorbate, and maltose mixtures. PQQ-glucose dehydrogenase-based technologies showed greater susceptibility than glucose oxidase-based systems. However, the modified glucose oxidase-based amperometric method (Nova StatStrip) was

  4. Peer Grading in Astronomy Massive Open Online Course

    Science.gov (United States)

    Formanek, Martin; Wenger, Matthew; Impey, Christopher; Buxner, Sanlyn

    In this work we thoroughly investigate the peer grading process as it happened in the University of Arizona session based MOOC ``Astronomy: Exploring Time and Space'' offered during Spring 2015 through Coursera. Overall, 25400 learners from over 100 countries registered for this course. Of those, 14900 accessed at least one part of the course and 1332 users engaged in the peer grading. First of all we provide description of the peer graded assignments and we identify trends in behavior of people who participated in these exercises. E.g. time they spent on grading, number of assignments graded and patterns arising from comparing all three assignments. Furthermore, for the second assignment, we graded random sample of 300 essays by a group of trained undergraduate students and a group consisting of one of the course instructors together with graduate TAs and we compared results with grades from the peer grading. Specifically we look on Intraclass Correlation Coefficients for all three groups of graders to determine reliability of each group and correlations between final grades. Finally we assess factors influencing reliability of the peer graders participating in the MOOC based on the difference from our grades. This research was supported by Howard Hughes Medical Institute Grant No. 415580.

  5. Developing a Scale for Teacher Integration of Information and Communication Technology in Grades 1-9

    Science.gov (United States)

    Hsu, S.

    2010-01-01

    There is no unified view about how teachers' integration of information and communication technology (ICT) should be measured. While many instruments have focused on the technological aspects, recent studies have suggested teachers' pedagogical considerations, professional development, and emerging ethical and safety issues should be included when…

  6. EFFECTIVENESS OF ADJUVANT USE OF POSTERIOR MANUAL COMPRESSION WITH GRADED COMPRESSION IN THE SONOGRAPHIC DIAGNOSIS OF ACUTE APPENDICITIS

    Directory of Open Access Journals (Sweden)

    Senthilnathan V

    2018-01-01

    Full Text Available BACKGROUND Diagnosing appendicitis by Graded Compression Ultrasonogram is a difficult task because of limiting factors such as operator– dependent technique, retrocaecal location of the appendix and patient obesity. Posterior manual compression technique visualizes the appendix better in the Grey-scale Ultrasonogram. The Aim of this study is to determine the accuracy of ultrasound in detecting or excluding acute appendicitis and to evaluate the usefulness of the adjuvant use of posterior manual compression technique in visualization of the appendix and in the diagnosis of acute appendicitis MATERIALS AND METHODS This prospective study involved a total of 240 patients in all age groups and both sexes. All these patients underwent USG for suspected appendicitis. Ultrasonography was performed with transverse and longitudinal graded compression sonography. If the appendix is not visualized on graded compression sonography, posterior manual compression technique was used to further improve the detection of appendix. RESULTS The vermiform appendix was visualized in 185 patients (77.1% out of 240 patients with graded compression alone. 55 out of 240 patients whose appendix could not be visualized by graded compression alone were subjected to both graded followed by posterior manual compression technique among that Appendix was visualized in 43 patients on posterior manual compression technique amounting to 78.2% of cases, Appendix could not be visualized in the remaining 12 patients (21.8% out of 55. CONCLUSION Combined method of graded compression with posterior manual compression technique is better than the graded compression technique alone in diagnostic accuracy and detection rate of the vermiform appendix.

  7. Role of cytologic grading in prognostication of invasive breast carcinoma

    Directory of Open Access Journals (Sweden)

    Khan Nazoora

    2009-01-01

    Full Text Available Background: Evaluation of cytologic features is indispensable in the preoperative diagnosis and grading of infiltrating ductal breast carcinoma (CA in fine-needle aspiration cytology (FNAC material and this method can also provide additional information regarding intrinsic features of the tumor as well as its prognosis. Aim: This study has been done to evaluate comparatively the cytologic and histomorphologic grading of infiltrating ductal carcinoma of breast with specific reference to lymph node metastasis and its role in prognostication. Materials and Methods: Forty three patients who underwent FNAC and mastectomy for infiltrating ductal carcinoma were cytologically and histologically graded (employing Robinson′s cytologic grading system and Elston′s modification of Bloom-Richardson system, respectively. Statistical analysis was done employing ′z′ test and c2 test to compare the two grading system and to examine the degree of correlation between the cytologic and histologic grades. Multiple regression analysis was done to assess the significance of every cytologic and histologic parameter. All 43 cases, graded cyto-histologically were also evaluated for presence or absence of metastasis to the regional lymph nodes employing c2 test. Results: With histologic grade taken as the standard, cytology was found to be fairly comparable, for grading breast carcinoma (overall sensitivity 89.1%, specificity 100%. Further comparison of the two grading systems by Z-test showed that difference between the cytologic and histologic grading was insignificant in all the three grade (p > 0.05. Of the six parameters studied, cell dissociation, nucleoli and chromatin pattern were the most influential features (p < 0.001. The statistically significant difference (p < 0.001 was found in incidences of axillary lymph node metastatic rate in three cytologic grades (15.4% in grade I vs. 83.3% in grade III as well. Conclusions: Apart from being simple and

  8. On graded algebras of global dimension 3

    International Nuclear Information System (INIS)

    Piontkovskii, D I

    2001-01-01

    Assume that a graded associative algebra A over a field k is minimally presented as the quotient algebra of a free algebra F by the ideal I generated by a set f of homogeneous elements. We study the following two extensions of A: the algebra F-bar=F/I oplus I/I 2 oplus ... associated with F with respect to the I-adic filtration, and the homology algebra H of the Shafarevich complex Sh(f,F) (which is a non-commutative version of the Koszul complex). We obtain several characterizations of algebras of global dimension 3. In particular, the A-algebra H in this case is free, and the algebra F-bar is isomorphic to the quotient algebra of a free A-algebra by the ideal generated by a so-called strongly free (or inert) set

  9. Is Kindergarten the New First Grade?

    Directory of Open Access Journals (Sweden)

    Daphna Bassok

    2016-01-01

    Full Text Available Recent accounts suggest that accountability pressures have trickled down into the early elementary grades and that kindergarten today is characterized by a heightened focus on academic skills and a reduction in opportunities for play. This paper compares public school kindergarten classrooms between 1998 and 2010 using two large, nationally representative data sets. We show substantial changes in each of the five dimensions considered: kindergarten teachers’ beliefs about school readiness, time spent on academic and nonacademic content, classroom organization, pedagogical approach, and use of standardized assessments. Kindergarten teachers in the later period held far higher academic expectations for children both prior to kindergarten entry and during the kindergarten year. They devoted more time to advanced literacy and math content, teacher-directed instruction, and assessment and substantially less time to art, music, science, and child-selected activities.

  10. Microbial leaching of low grade copper ores

    International Nuclear Information System (INIS)

    Rauf, A.; Ashfaq, M.

    1991-01-01

    Biotechnology is regarded as one of the most promising and revolutionary solution to various problems which are generally faced in the extraction of metals from their ores such as high energy, capital costs and environmental pollution. The paper deals with the study of low grade copper ores for their beneficiation and extraction of copper. The ores used were chalcopyrite and oxidized copper ores. Microorganisms play a vital role in the solubilization of valuable contents from ores such as copper and other metals. Studies have been conducted on the indigenous copper ores by using thiobacillus ferro oxidans and thiobacillus thio oxidans. For comparison purpose some experiments have also been conducted by chemical leaching. The results of bacterial leaching are encouraging. (author)

  11. Metal recovery from high-grade WEEE

    DEFF Research Database (Denmark)

    Bigum, Marianne; Brogaard, Line Kai-Sørensen; Christensen, Thomas Højlund

    2012-01-01

    . The modeled metallurgical treatment facility included a Kaldo plant, a converter aisle, an anode refinery and a precious metal refinery. The metallurgic treatment showed significant environmental savings when credited the environmental load from avoided production of the same amount of metals by mining...... and refining of ore. The resource recovery per tonne of high-grade WEEE ranged from 2 g of palladium to 386 kg of iron. Quantified in terms of person-equivalents the recovery of palladium, gold, silver, nickel and copper constituted the major environmental benefit of the recovery of metals from WEEE....... These benefits are most likely underestimated in the model, since we did not find adequate data to include all the burdens from mining and refining of ore; burdens that are avoided when metals are recovered from WEEE. The processes connected to the pre-treatment of WEEE were found to have little environmental...

  12. High-grade primary pulmonary leiomyosarcoma

    Directory of Open Access Journals (Sweden)

    Rodrigo Afonso da Silva Sardenberg

    2011-12-01

    Full Text Available Primary sarcomas of the lung are rare and account for 0.5% of all primary lung tumors. There were approximately 300 cases described in the literature as of 2006. All histologic types of sarcoma were described, and the most common intrathoracic types reported were angiosarcoma, leiomyosarcoma, fibrosarcoma, hemangiopericytoma, and rhabdomyosarcoma. The biological behavior of these tumors is not well-known due to their low frequency. Leiomyosarcomas represent one of the most common subtypes encountered in the lungs, and usually occur during the sixth decade, with male predominance. Although the frequency of metastatic disease is not related to tumor size, prognosis was reported to be poorer in high-grade tumors. In comparison with other sarcomas, survival after complete resection of pulmonary leiomyosarcoma was reported as longer. We report on a patient with primary leiomyosarcoma originating from the bronchus with complete resection and long-term follow-up.

  13. Synthesis of battery grade reduced silver powder

    International Nuclear Information System (INIS)

    Qadeer, R.; Hameed, M.; Ikram, S.; Munir, A.

    2002-01-01

    Process for production of battery grade reduced silver powder, an active positive material for zinc-silver oxide batteries, having specific characteristics has been optimized and the synthesized reduced silver powder was characterized. Results reveal that the values of bulk density (1.25 0.1 g/cm3) and activity (73.27 %) of synthesized reduced silver powder lies within the recommended range for use as battery material. It has purity ≥ 98% and contains Fe and Cu as traces in the concentration range of 30 5 ppm and 15 7 ppm respectively. Others determined values of surface and pores parameters are: surface area 2.6 .4 m2/g: pore volume 3.10 cm3/g: pore diameter 0.043 mu m and porosity 20%. XRD studies reveal that reduced silver powder has a cubic structure. (author)

  14. Micromechanical models for graded composite materials

    DEFF Research Database (Denmark)

    Reiter, T; Dvorak, G.J.; Tvergaard, Viggo

    1997-01-01

    of piecewise homogeneous layers with equivalent elastic properties estimated by Mori-Tanaka and self-consistent methods are also analysed under similar boundary conditions. Comparisons of the overall and local fields predicted by the discrete and homogenized models are made using a C/SiC composite system...... fields are predicted by Mori-Tanaka estimates. On the other hand, the response of graded materials with a skeletal microstructure in a wide transition zone between clearly defined matrix phases is better approximated by the self-consistent estimates. Certain exceptions are noted for loading by overall...... transverse shear stress; The results suggest that the averaging methods originally developed for statistically homogeneous aggregates may be selectively applied, with a reasonable degree of confidence, to aggregates dth composition gradients, subjected to both uniform and nonuniform overall loads. (C) 1997...

  15. The modified couple stress functionally graded Timoshenko beam formulation

    International Nuclear Information System (INIS)

    Asghari, M.; Rahaeifard, M.; Kahrobaiyan, M.H.; Ahmadian, M.T.

    2011-01-01

    In this paper, a size-dependent formulation is presented for Timoshenko beams made of a functionally graded material (FGM). The formulation is developed on the basis of the modified couple stress theory. The modified couple stress theory is a non-classic continuum theory capable to capture the small-scale size effects in the mechanical behavior of structures. The beam properties are assumed to vary through the thickness of the beam. The governing differential equations of motion are derived for the proposed modified couple-stress FG Timoshenko beam. The generally valid closed-form analytic expressions are obtained for the static response parameters. As case studies, the static and free vibration of the new model are respectively investigated for FG cantilever and FG simply supported beams in which properties are varying according to a power law. The results indicate that modeling beams on the basis of the couple stress theory causes more stiffness than modeling based on the classical continuum theory, such that for beams with small thickness, a significant difference between the results of these two theories is observed.

  16. Personality traits predicting children's social behaviour in the first grade

    Directory of Open Access Journals (Sweden)

    Martina Horvat

    2011-01-01

    Full Text Available The paper presents concurrent predictive relations of personality traits with social behaviour of children at the transition from early to middle childhood. Personality ratings of firstgraders (N = 316 were collected using the Inventory of Child and Adolescent Individual Differences (Zupančič & Kavčič, 2009 and the Social Competence and Behaviour Evaluation Scale (La Freniere et al., 2001 was employed to obtain assessments on the children's social competence, internalizing behaviour, and externalizing behaviour. To account for the same rater bias, the children's personality and social behaviour were rated by both teachers and assisstent teachers in the first grade of a nine-year compulsory school; the predictions were based on two sets of their cross-ratings. The firstgraders' social competentnce was consistently (over the cross-ratings predicted by high conscientiousness, mainly due to ratings of child compliance, whereas low conscientiousness was predictive of internalizing behaviour, especially due to low ratings of subjectively perceived child intelligence. Disagreeableness (both antagonism and strong will and low neuroticism contributed to assessments of the observed children's externalizing behaviour. In regard to neuroticism, ratings of child fear/insecurity were positively related to externalizing and ratings of child shyness were negatively associated with the observed incidence of externalizing behaviour.

  17. Achievement of Serbian eighth grade students in science

    Directory of Open Access Journals (Sweden)

    Antonijević Radovan

    2006-01-01

    Full Text Available The paper considers the main results and some educational implications of the TIMSS 2003 assessment conducted in Serbia in the fields of the science achievement of Serbian eighth grade students and the science curriculum context of their achievement. There were 4264 students in the sample. It was confirmed that Serbian eighth graders had made average scale score of 468 points in the science, and with this achievement they are placed in the zone of the top of low international benchmarking level, very close to the point of intermediate benchmark. The average science achievement of the Serbian eighth graders is somewhat below the general international science achievement. The best results were achieved in the science content domain of "chemistry", and the lower results in the content domain of "environmental science". Across the defined science cognitive domains, it was confirmed that the Serbian students had achieved the best results in cognitive domain of "factual knowledge" and weaker results in "reasoning and analysis". The achieved results raise many questions about contents of the science curriculum in Serbia, its overall quality and basic characteristics of its implementation. These results can be eligibly used to improve the science curricula and teaching in Serbian primary school. .

  18. The Graded Alluvial River: Variable Flow and the Dominant Discharge

    Science.gov (United States)

    Blom, A.; Arkesteijn, L.; Viparelli, E.

    2016-12-01

    We derive analytical formulations for the graded or equilibrium longitudinal profile of a mixed-sediment alluvial river under variable flow. The formulations are applicable to reaches upstream from the backwater zone. The model is based on the conservation equations for the mass of two distinct sediment modes, sand and gravel, at the bed surface to account for the effects of grain size selective transport and abrasion of gravel particles. The effects of a variable flow rate are included by (a) treating the flow as a continuously changing yet steady water discharge (i.e. here termed an alternating steady discharge) and (b) assuming the time scale of changes in channel slope and bed surface texture to be much larger than the one of changes in flow rate. The equations are simplified realizing that at equilibrium the river profile finds itself in a dynamic steady state with oscillations around constant mean values of channel slope and bed surface texture. A generalized sediment transport relation representing the stochastic nature of sediment transport allows for explicit or analytical solutions to the streamwise decrease of both the channel slope and the bed surface mean grain size under variable flow for reaches unaffected by backwater effects. This modelling approach also provides a definition of a channel-forming or dominant water discharge, i.e., that steady water discharge that is equivalent in its effect on the equilibrium channel slope to the full hydrograph.

  19. Short forms of the Social Interaction Anxiety Scale and the Social Phobia Scale.

    Science.gov (United States)

    Fergus, Thomas A; Valentiner, David P; McGrath, Patrick B; Gier-Lonsway, Stephanie L; Kim, Hyun-Soo

    2012-01-01

    Mattick and Clarke's (1998) Social Interaction Anxiety Scale (SIAS) and Social Phobia Scale (SPS) are commonly used self-report measures that assess 2 dimensions of social anxiety. Given the need for short, readable measures, this research proposes short forms of both scales. Item-level analyses of readability characteristics of the SIAS and SPS items led to the selection of 6 items from each scale for use in the short forms. The SIAS and SPS short forms had reading levels at approximately the 6th and 5th grade level, respectively. Results using nonclinical (Study 1: N = 469) and clinical (Study 2: N = 145) samples identified these short forms as being factorially sound, possessing adequate internal consistency, and having strong convergence with their full-length counterparts. Moreover, these short forms showed convergence with other measures of social anxiety, showed divergence from measures assessing related constructs, and predicted concurrent interpersonal functioning. Recommendations for the use of these short forms are discussed.

  20. Laparoscopic adrenalectomy: Gaining experience by graded approach

    Directory of Open Access Journals (Sweden)

    Dalvi Abhay

    2006-01-01

    Full Text Available INTRODUCTION: Laparoscopic adrenalectomy (LA has become a gold standard in management of most of the adrenal disorders. Though report on the first laparoscopic adrenalectomy dates back to 1992, there is no series of LA reported from India. Starting Feb 2001, a graded approach to LA was undertaken in our center. Till March 2006, a total of 34 laparoscopic adrenalectomies were performed with success. MATERIALS AND METHODS: The endocrinology department primarily evaluated all patients. Patients were divided into Group A - unilateral LA and Group B - bilateral LA (BLA. The indications in Group A were pheochromocytoma (n=7, Conn′s syndrome (n=3, Cushing′s adenoma (n=2, incidentaloma (n=2; and in Group B, Cushing′s disease (CD following failed trans-sphenoid pituitary surgery (n = 8; ectopic ACTH- producing Cushing′s syndrome (n=1 and congenital adrenal hyperplasia (CAH (n=1. The lateral transabdominal route was used. RESULTS: The age group varied from 12-54 years, with mean age of 28.21 years. Average duration of surgery in Group A was 166.43 min (40-270 min and 190 min (150- 310 min in Group B. Average blood loss was 136.93 cc (20-400 cc in Group A and 92.5 cc (40-260 cc in Group B. There was one conversion in each group. Mean duration of surgical stay was 1.8 days (1-3 days in Group A and 2.6 days (2-4 days in Group B. All the patients in both groups were cured of their illness. Three patients in Group B developed Nelson′s syndrome. The mean follow up was of 24.16 months (4-61 months. CONCLUSION: LA though technically demanding, is feasible and safe. Graded approach to LA is the key to success.

  1. Terahertz reflectometry imaging for low and high grade gliomas

    Science.gov (United States)

    Ji, Young Bin; Oh, Seung Jae; Kang, Seok-Gu; Heo, Jung; Kim, Sang-Hoon; Choi, Yuna; Song, Seungri; Son, Hye Young; Kim, Se Hoon; Lee, Ji Hyun; Haam, Seung Joo; Huh, Yong Min; Chang, Jong Hee; Joo, Chulmin; Suh, Jin-Suck

    2016-01-01

    Gross total resection (GTR) of glioma is critical for improving the survival rate of glioma patients. One of the greatest challenges for achieving GTR is the difficulty in discriminating low grade tumor or peritumor regions that have an intact blood brain barrier (BBB) from normal brain tissues and delineating glioma margins during surgery. Here we present a highly sensitive, label-free terahertz reflectometry imaging (TRI) that overcomes current key limitations for intraoperative detection of World Health Organization (WHO) grade II (low grade), and grade III and IV (high grade) gliomas. We demonstrate that TRI provides tumor discrimination and delineation of tumor margins in brain tissues with high sensitivity on the basis of Hematoxylin and eosin (H&E) stained image. TRI may help neurosurgeons to remove gliomas completely by providing visualization of tumor margins in WHO grade II, III, and IV gliomas without contrast agents, and hence, improve patient outcomes. PMID:27782153

  2. Corrosion resistant properties and weldabilities of ASTM Grade 12 titanium alloy

    International Nuclear Information System (INIS)

    Tsumori, Yoshikatsu; Itoh, Hideo

    1988-01-01

    Plates, sheets, bars, wires and thinner seam-welded tubings were manufactured from large-scaled ingot of ASTM Grade 12 alloy (Ti-0.8Ni-0.3Mo). The processability of G-12 alloy has proved almost similar to that of conventional commercially pure titanium grades. It has been clarified that the G-12 alloy showed several advantageous features: Chlorides-Crevice corrosion resistance of the alloy was almost equals to G-7 and Pd0/TiO 2 coated titanium, and the maximum allowable stress was able to be designed higher than that of commercially pure titanium. This alloy has been in applications also offers where such environments as seawater, brines and moist chlorine, various oil refinery and chemical industries, and others. (author)

  3. Transmutation of singularities and zeros in graded index optical instruments: a methodology for designing practical devices.

    Science.gov (United States)

    Hooper, I R; Philbin, T G

    2013-12-30

    We describe a design methodology for modifying the refractive index profile of graded-index optical instruments that incorporate singularities or zeros in their refractive index. The process maintains the device performance whilst resulting in graded profiles that are all-dielectric, do not require materials with unrealistic values, and that are impedance matched to the bounding medium. This is achieved by transmuting the singularities (or zeros) using the formalism of transformation optics, but with an additional boundary condition requiring the gradient of the co-ordinate transformation be continuous. This additional boundary condition ensures that the device is impedance matched to the bounding medium when the spatially varying permittivity and permeability profiles are scaled to realizable values. We demonstrate the method in some detail for an Eaton lens, before describing the profiles for an "invisible disc" and "multipole" lenses.

  4. Material and Thickness Grading for Aeroelastic Tailoring of the Common Research Model Wing Box

    Science.gov (United States)

    Stanford, Bret K.; Jutte, Christine V.

    2014-01-01

    This work quantifies the potential aeroelastic benefits of tailoring a full-scale wing box structure using tailored thickness distributions, material distributions, or both simultaneously. These tailoring schemes are considered for the wing skins, the spars, and the ribs. Material grading utilizes a spatially-continuous blend of two metals: Al and Al+SiC. Thicknesses and material fraction variables are specified at the 4 corners of the wing box, and a bilinear interpolation is used to compute these parameters for the interior of the planform. Pareto fronts detailing the conflict between static aeroelastic stresses and dynamic flutter boundaries are computed with a genetic algorithm. In some cases, a true material grading is found to be superior to a single-material structure.

  5. Technologies for processing low-grade uranium ores and their relevance to the Indian situation

    International Nuclear Information System (INIS)

    Murthy, T.K.S.

    1991-01-01

    The technology for uranium ore processing is well established. Various estimates have shown that on a global basis uranium resources are adequate to meet the forseeable demand. The Indian resources are estimated to be about 60,000 t U. The grade of the ores is low and the individual deposits are small. The nature of the deposits, precarious resources position and relatively small capacity of the mines do not permit the country to take advantage of large throughputs in the mill to achieve substantial cost reduction. However by resorting to as high a scale of milling as the mines would permit, by reducing the loss of solubilised uranium after leaching and by undertaking production of nuclear grade final product at the mill site, significant though not a major, economic benefit can be derived. (author). 2 figs., 3 tabs

  6. ALE: Additive Latent Effect Models for Grade Prediction

    OpenAIRE

    Ren, Zhiyun; Ning, Xia; Rangwala, Huzefa

    2018-01-01

    The past decade has seen a growth in the development and deployment of educational technologies for assisting college-going students in choosing majors, selecting courses and acquiring feedback based on past academic performance. Grade prediction methods seek to estimate a grade that a student may achieve in a course that she may take in the future (e.g., next term). Accurate and timely prediction of students' academic grades is important for developing effective degree planners and early war...

  7. Concrete manufacture with un-graded recycled aggregates

    OpenAIRE

    Richardson, Alan; Coventry, Kathryn; Graham, Sue

    2009-01-01

    Purpose – The purpose of this paper is to investigate whether concrete that includes un-graded recycled aggregates can be manufactured to a comparable strength to concrete manufactured from virgin aggregates. \\ud \\ud Design/methodology/approach – A paired comparison test was used to evaluate the difference between concrete made with virgin aggregates (plain control) and concrete including recycled waste. Un-graded construction demolition waste and un-graded ground glass were used as aggregate...

  8. Tumor grading of adult astrocytic glioma on MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Kee Hyun; Choi, Choong Gon; Han, Moon Hee; Lee, Seon Kyu [Seoul National University College of Medicine, Seoul (Korea, Republic of); Suh, Jung Ho [Yonsei University College of Medicine, Seoul (Korea, Republic of); Lee, Ho Kyu; Suh, Dae Chul [Ulsan University College of Medicine, Seoul (Korea, Republic of); Choi, Kyu Ho [Catholic University College of Medicine, Seoul (Korea, Republic of); Byun, Hong Sik [Korea Cancer Center Hospital, Seoul (Korea, Republic of); Choi, Woo Suk [Kyung Hee University College of Medicine, Seoul (Korea, Republic of)

    1994-09-15

    The purpose of this study is to determine predictive MR features for grading of astrocytic gliomas and to evaluate the accuracy of MR grading in these tumors. We retrospectively reviewed 135 cases of supratentorial astrocytic gliomas in adult (age > 15 years), all of which were proved by open biopsy. Two observers analysed MR images independently with criteria of margin, edema, mass effect, signal heterogeneity, necrosis, cyst formation, hemorrhage, tumor vascularity, enhancement degree, and enhancement size. The patterns of enhancement were categorized into no, homogeneous, heterogeneous, thin smooth rim, thin irregular rim, and thick irregular rim enhancement patterns. Observers finally diagnosed each case as one of low-grade astrocytoma, anaplastic astrocytoma or glioblastoma multiforme. Statistically significant MR features for grading of these tumors were revealed as necrosis (p < 0.001), edema (0.008), and signal heterogeneity (p < 0.025). When compared with histopathologic grading, MR graded correctly 76%- 77% of cases in two tired system(low-grade astrocytoma versus high-grade astrocytoma), but only 67%-69% of cases in three tiered system(low-grade astrocytoma, anaplastic astrocytoma, glioblastoma multiforme). No contrast enhancement was seen in 45% and 23% of low-grade astrocytoma and anaplastic astrocytoma respectively. Glioblastoma multiforme frequently showed thick irregular rim enhancement (57%), but no enhancement at all in 8%. We have concluded that necrosis and edema are significant predictive MR features for grading of supratentorial astrocytic gliomas in adult, and MR was correct in 76%-77% of cases for predicting pathologic grading astrocytomas in two tiered system.

  9. Quality assurance grading of conventional equipment at nuclear power station

    International Nuclear Information System (INIS)

    Li Ping; Li Shichang

    2006-01-01

    Equipment QA grading with the systematic and standardized approach will benefit the concerned organizations by effective allocating of limited resources to guarantee the quality of essential equipment. This paper presents a new quality assurance grading system for the convention systems/equipment of nuclear power station, which is operative and at the same time could help the owner to allot resource reasonably through the analysis of the purpose of grading and the experience and lessons of LINGAO Phase I project. (authors)

  10. Tumor grading of adult astrocytic glioma on MR imaging

    International Nuclear Information System (INIS)

    Chang, Kee Hyun; Choi, Choong Gon; Han, Moon Hee; Lee, Seon Kyu; Suh, Jung Ho; Lee, Ho Kyu; Suh, Dae Chul; Choi, Kyu Ho; Byun, Hong Sik; Choi, Woo Suk

    1994-01-01

    The purpose of this study is to determine predictive MR features for grading of astrocytic gliomas and to evaluate the accuracy of MR grading in these tumors. We retrospectively reviewed 135 cases of supratentorial astrocytic gliomas in adult (age > 15 years), all of which were proved by open biopsy. Two observers analysed MR images independently with criteria of margin, edema, mass effect, signal heterogeneity, necrosis, cyst formation, hemorrhage, tumor vascularity, enhancement degree, and enhancement size. The patterns of enhancement were categorized into no, homogeneous, heterogeneous, thin smooth rim, thin irregular rim, and thick irregular rim enhancement patterns. Observers finally diagnosed each case as one of low-grade astrocytoma, anaplastic astrocytoma or glioblastoma multiforme. Statistically significant MR features for grading of these tumors were revealed as necrosis (p < 0.001), edema (0.008), and signal heterogeneity (p < 0.025). When compared with histopathologic grading, MR graded correctly 76%- 77% of cases in two tired system(low-grade astrocytoma versus high-grade astrocytoma), but only 67%-69% of cases in three tiered system(low-grade astrocytoma, anaplastic astrocytoma, glioblastoma multiforme). No contrast enhancement was seen in 45% and 23% of low-grade astrocytoma and anaplastic astrocytoma respectively. Glioblastoma multiforme frequently showed thick irregular rim enhancement (57%), but no enhancement at all in 8%. We have concluded that necrosis and edema are significant predictive MR features for grading of supratentorial astrocytic gliomas in adult, and MR was correct in 76%-77% of cases for predicting pathologic grading astrocytomas in two tiered system

  11. Strategy Guideline: Modeling Enclosure Design in Above-Grade Walls

    Energy Technology Data Exchange (ETDEWEB)

    Lstiburek, J. [Building Science Corporation, Westford, MA (United States); Ueno, K. [Building Science Corporation, Westford, MA (United States); Musunuru, S. [Building Science Corporation, Westford, MA (United States)

    2016-02-24

    The Strategy Guideline describes how to model and interpret results of models for above grade walls. The Measure Guideline analyzes the failure thresholds and criteria for above grade walls. A library of above-grade walls with historically successful performance was used to calibrate WUFI (Warme Und Feuchte Instationar) software models. The information is generalized for application to a broad population of houses within the limits of existing experience.

  12. Preventing halo bias in grading the work of university students

    OpenAIRE

    John M. Malouff; Sarah J. Stein; Lodewicka N. Bothma; Kimberley Coulter; Ashley J. Emmerton

    2014-01-01

    Experts have advocated anonymous marking as a means of minimizing bias in subjective student assessment. In the present study, 159 faculty members or teaching assistants across disciplines were randomly assigned (1) to grade a poor oral presentation of a university student, (2) to grade a good oral presentation of the same student, or (3) not to grade any oral presentation of the student. All graders then assessed the same written work by the student. A linear-contrasts analysis showed that, ...

  13. High-grade renal injuries are often isolated in sports-related trauma.

    Science.gov (United States)

    Patel, Darshan P; Redshaw, Jeffrey D; Breyer, Benjamin N; Smith, Thomas G; Erickson, Bradley A; Majercik, Sarah D; Gaither, Thomas W; Craig, James R; Gardner, Scott; Presson, Angela P; Zhang, Chong; Hotaling, James M; Brant, William O; Myers, Jeremy B

    2015-07-01

    Most high-grade renal injuries (American Association for Surgery of Trauma (AAST) grades III-V) result from motor vehicle collisions associated with numerous concomitant injuries. Sports-related blunt renal injury tends to have a different mechanism, a solitary blow to the flank. We hypothesized that high-grade renal injury is often isolated in sports-related renal trauma. We identified patients with AAST grades III-V blunt renal injuries from four level 1 trauma centres across the United States between 1/2005 and 1/2014. Patients were divided into "Sport" or "Non-sport" related groups. Outcomes included rates of hypotension (systolic blood pressure 110bpm), concomitant abdominal injury, and procedural/surgical intervention between sports and non-sports related injury. 320 patients met study criteria. 18% (59) were sports-related injuries with the most common mechanisms being skiing, snowboarding and contact sports (25%, 25%, and 24%, respectively). Median age was 24 years for sports and 30 years for non-sports related renal injuries (p=0.049). Males were more commonly involved in sports related injuries (85% vs. 72%, p=0.011). Median injury severity score was lower for sports related injuries (10 vs. 27, pinjury scale scores. Sports related trauma was more likely to be isolated without other significant injury (69% vs. 39% (psports and non-sports renal injuries (p=0.30). Sports injuries had lower transfusion (7% vs. 47%, psports vs. 18% non-sports, p=0.95). High-grade sports-related blunt renal trauma is more likely to occur in isolation without other abdominal or thoracic injuries and clinicians must have a high suspicion of renal injury with significant blows to the flank during sports activities. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. The 2014 International Society of Urological Pathology (ISUP) Consensus Conference on Gleason Grading of Prostatic Carcinoma: Definition of Grading Patterns and Proposal for a New Grading System.

    Science.gov (United States)

    Epstein, Jonathan I; Egevad, Lars; Amin, Mahul B; Delahunt, Brett; Srigley, John R; Humphrey, Peter A

    2016-02-01

    In November, 2014, 65 prostate cancer pathology experts, along with 17 clinicians including urologists, radiation oncologists, and medical oncologists from 19 different countries gathered in a consensus conference to update the grading of prostate cancer, last revised in 2005. The major conclusions were: (1) Cribriform glands should be assigned a Gleason pattern 4, regardless of morphology; (2) Glomeruloid glands should be assigned a Gleason pattern 4, regardless of morphology; (3) Grading of mucinous carcinoma of the prostate should be based on its underlying growth pattern rather than grading them all as pattern 4; and (4) Intraductal carcinoma of the prostate without invasive carcinoma should not be assigned a Gleason grade and a comment as to its invariable association with aggressive prostate cancer should be made. Regarding morphologies of Gleason patterns, there was clear consensus on: (1) Gleason pattern 4 includes cribriform, fused, and poorly formed glands; (2) The term hypernephromatoid cancer should not be used; (3) For a diagnosis of Gleason pattern 4, it needs to be seen at 10x lens magnification; (4) Occasional/seemingly poorly formed or fused glands between well-formed glands is insufficient for a diagnosis of pattern 4; (5) In cases with borderline morphology between Gleason pattern 3 and pattern 4 and crush artifacts, the lower grade should be favored; (6) Branched glands are allowed in Gleason pattern 3; (7) Small solid cylinders represent Gleason pattern 5; (8) Solid medium to large nests with rosette-like spaces should be considered to represent Gleason pattern 5; and (9) Presence of unequivocal comedonecrosis, even if focal is indicative of Gleason pattern 5. It was recognized by both pathologists and clinicians that despite the above changes, there were deficiencies with the Gleason system. The Gleason grading system ranges from 2 to 10, yet 6 is the lowest score currently assigned. When patients are told that they have a Gleason score 6 out

  15. Food grade titanium dioxide disrupts intestinal brush border microvilli in vitro independent of sedimentation.

    Science.gov (United States)

    Faust, James J; Doudrick, Kyle; Yang, Yu; Westerhoff, Paul; Capco, David G

    2014-06-01

    Bulk- and nano-scale titanium dioxide (TiO2) has found use in human food products for controlling color, texture, and moisture. Once ingested, and because of their small size, nano-scale TiO2 can interact with a number of epithelia that line the human gastrointestinal tract. One such epithelium responsible for nutrient absorption is the small intestine, whose constituent cells contain microvilli to increase the total surface area of the gut. Using a combination of scanning and transmission electron microscopy it was found that food grade TiO2 (E171 food additive coded) included ∼25% of the TiO2 as nanoparticles (NPs; TiO2 sedimentation. It was found that TiO2 isolated from the candy coating of chewing gum and a commercially available TiO2 food grade additive samples were of the anatase crystal structure. Exposure to food grade TiO2 additives, containing nanoparticles, at the lowest concentration tested within this experimental paradigm to date at 350 ng/mL (i.e., 100 ng/cm(2) cell surface area) resulted in disruption of the brush border. Through the use of two independent techniques to remove the effects of gravity, and subsequent TiO2 sedimentation, it was found that disruption of the microvilli was independent of sedimentation. These data indicate that food grade TiO2 exposure resulted in the loss of microvilli from the Caco-2BBe1 cell system due to a biological response, and not simply a physical artifact of in vitro exposure.

  16. 2015 Strategic Petroleum Reserve Bayou Choctaw Well Integrity Grading Report.

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Barry L; Lord, David; Lord, Anna C. Snider; Bettin, Giorgia; Park, Byoung; Rudeen, D.K.; Eldredge, L.L.; Wynn, K.; Checkai, D.; Osborne, G.; Moore, D.

    2015-10-01

    This report summarizes the work performed in the prioritization of cavern access wells for remediation and monitoring at the Bayou Choctaw Strategic Petroleum Reserve site. The grading included consideration of all 15 wells at the Bayou Choctaw site, with each active well receiving a separate grade for remediation and monitoring. Numerous factors affecting well integrity were incorporated into the grading including casing survey results, cavern pressure history, results from geomechanical simulations, and site geologic factors. The factors and grading framework used here are the same as those used in developing similar well remediation and monitoring priorities at the Big Hill, Bryan Mound, and West Hackberry Strategic Petroleum Reserve Sites.

  17. Grading of direct laryngoscopy. A survey of current practice.

    Science.gov (United States)

    Cohen, A M; Fleming, B G; Wace, J R

    1994-06-01

    One hundred and twenty anaesthetists (30 of each grade), from three separate regions, were interviewed as to how they recorded the appearance of laryngeal structures at direct laryngoscopy and about their knowledge of the commonly used numerical grading system. About two-thirds of anaesthetists surveyed (69.2%) used the numerical grading system, but of these, over half could not identify a 'grade 2' laryngoscopic appearance correctly. Of anaesthetists who did not use the numerical method, over half could not correctly state the difference between a 'grade 2' and a 'grade 3' laryngoscopic appearance. Over 40% of anaesthetists stated incorrectly that the grading should be made on the initial view, even when laryngeal pressure had been needed. Junior anaesthetists were more likely to use the numerical method of recording. The results show that there is unacceptable uncertainty and inaccuracy in the use of the numerical grading system by users as well as non-users, which makes the current routine clinical use of the numerical grading system unsatisfactory.

  18. Will Instructors Save Time Using a Specifications Grading System?

    Directory of Open Access Journals (Sweden)

    Sarah Grace Prescott

    2015-08-01

    Full Text Available Review of: Specifications Grading: Restoring Rigor, Motivating Students, and Saving Faculty Time; Linda Nilson and Claudia J. Stranny; (2014. Stylus Publishing, Sterling, VA. 184 pages.

  19. 2015 Strategic Petroleum Reserve West Hackberry Well Integrity Grading Report.

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Barry L; Lord, David; Lord, Anna C. Snider; Bettin, Giorgia; Sobolik, Steven R.; Rudeen, David Keith; Eldredge, Lisa L. (FFPO); Wynn, Karen (FFPO); Checkai, Dean (FFPO); Osborne, Gerad (FFPO); Moore, Darryl (FFPO)

    2015-04-01

    This report summarizes the work performed in the prioritization of cavern access wells for remediation and monitoring at the West Hackberry Strategic Petroleum Reserve site. The grading included consideration of all 31 wells at the West Hackberry site, with each well receiving a separate grade for remediation and monitoring. Numerous factors affecting well integrity were incorporated into the grading including casing survey results, cavern pressure history, results from geomechanical simulations, and site geologic factors. The factors and grading framework used here are the same as those used in developing similar well remediation and monitoring priorities at the Big Hill and Bryan Mound Strategic Petroleum Reserve Sites.

  20. 2014 Strategic Petroleum Reserve Bryan Mound Well Integrity Grading Report.

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Barry L; Lord, David; Lord, Anna C. Snider; Bettin, Giorgia; Sobolik, Steven R.; Rudeen, David Keith; Eldredge, Lisa L. (FFPO); Wynn, Karen (FFPO); Checkai, Dean (FFPO); Osborne, Gerad (FFPO); Moore, Darryl (FFPO)

    2015-04-01

    This report summarizes the work performed in the prioritization of cavern access wells for remediation and monitoring at the Bryan Mound Strategic Petroleum Reserve site. The grading included consideration of all 47 wells at the Bryan Mound site, with each well receiving a separate grade for remediation and monitoring. Numerous factors affecting well integrity were incorporated into the grading including casing survey results, cavern pressure history, results from geomechanical simulations, and site geologic factors. The factors and grading framework used here are the same as those used in developing similar well remediation and monitoring priorities at the Big Hill Strategic Petroleum Reserve Site.

  1. Electronic transport behavior of diameter-graded Ag nanowires

    International Nuclear Information System (INIS)

    Wang Xuewei; Yuan Zhihao

    2010-01-01

    Ag nanowires with a graded diameter in anodic aluminum oxide (AAO) membranes were fabricated by the direct-current electrodeposition. The Ag nanowires have a graded-change in diameter from 8 to 32 nm, which is matched with the graded-change of the AAO pore diameter. Electronic transport measurements show that there is a transport behavior similar to that of a metal-semiconductor junction along the axial direction in the diameter-graded Ag nanowires. Such a novel homogeneous nanojunction will be of great fundamental and practical significance.

  2. Electronic transport behavior of diameter-graded Ag nanowires

    Science.gov (United States)

    Wang, Xue Wei; Yuan, Zhi Hao

    2010-05-01

    Ag nanowires with a graded diameter in anodic aluminum oxide (AAO) membranes were fabricated by the direct-current electrodeposition. The Ag nanowires have a graded-change in diameter from 8 to 32 nm, which is matched with the graded-change of the AAO pore diameter. Electronic transport measurements show that there is a transport behavior similar to that of a metal-semiconductor junction along the axial direction in the diameter-graded Ag nanowires. Such a novel homogeneous nanojunction will be of great fundamental and practical significance.

  3. Setting standards to determine core clerkship grades in pediatrics.

    Science.gov (United States)

    Dudas, Robert A; Barone, Michael A

    2014-01-01

    One of the greatest challenges for clerkship directors is assigning a final grade and determining the precise point at which a student either passes or fails a clinical clerkship. The process of incorporating both subjective and objective assessment data to provide a final summative grade can be challenging. We describe our experience conducting a standard-setting exercise to set defensible cut points in a 4-tiered grading system in our pediatric clerkship. Using the Hofstee standard-setting approach, 8 faculty members participated in an exercise to establish grade cut points. These faculty members were subsequently surveyed to assess their attitudes toward the standard-setting process as well as their reactions to these newly proposed standards. We applied the new cut points to a historic cohort of 116 Johns Hopkins University School of Medicine students from the academic year 2012-2013 to assess the potential impact on grade distributions. The resultant grading schema would lead to a significant increase in the number of students receiving a failing grade and a decrease in the number of students receiving a grade of honors in a historical cohort. Faculty reported that the Hofstee method was easy to understand and fair. All faculty members thought that grade inflation presently exists within the pediatric clerkship. This study demonstrates that practical standards using the Hofstee method can be set for medical students in a pediatric clerkship in which multiple performance measures are used. Copyright © 2014 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  4. Cut-off Grade Optimization for Maximizing the Output Rate

    Directory of Open Access Journals (Sweden)

    A. Khodayari

    2012-12-01

    Full Text Available In the open-pit mining, one of the first decisions that must be made in production planning stage, after completing the design of final pit limits, is determining of the processing plant cut-off grade. Since this grade has an essential effect on operations, choosing the optimum cut-off grade is of considerable importance. Different goals may be used for determining optimum cut-off grade. One of these goals may be maximizing the output rate (amount of product per year, which is very important, especially from marketing and market share points of view. Objective of this research is determining the optimum cut-off grade of processing plant in order to maximize output rate. For performing this optimization, an Operations Research (OR model has been developed. The object function of this model is output rate that must be maximized. This model has two operational constraints namely mining and processing restrictions. For solving the model a heuristic method has been developed. Results of research show that the optimum cut-off grade for satisfying pre-stated goal is the balancing grade of mining and processing operations, and maximum production rate is a function of the maximum capacity of processing plant and average grade of ore that according to the above optimum cut-off grade must be sent to the plant.

  5. Advanced soft computing diagnosis method for tumour grading.

    Science.gov (United States)

    Papageorgiou, E I; Spyridonos, P P; Stylios, C D; Ravazoula, P; Groumpos, P P; Nikiforidis, G N

    2006-01-01

    To develop an advanced diagnostic method for urinary bladder tumour grading. A novel soft computing modelling methodology based on the augmentation of fuzzy cognitive maps (FCMs) with the unsupervised active Hebbian learning (AHL) algorithm is applied. One hundred and twenty-eight cases of urinary bladder cancer were retrieved from the archives of the Department of Histopathology, University Hospital of Patras, Greece. All tumours had been characterized according to the classical World Health Organization (WHO) grading system. To design the FCM model for tumour grading, three experts histopathologists defined the main histopathological features (concepts) and their impact on grade characterization. The resulted FCM model consisted of nine concepts. Eight concepts represented the main histopathological features for tumour grading. The ninth concept represented the tumour grade. To increase the classification ability of the FCM model, the AHL algorithm was applied to adjust the weights of the FCM. The proposed FCM grading model achieved a classification accuracy of 72.5%, 74.42% and 95.55% for tumours of grades I, II and III, respectively. An advanced computerized method to support tumour grade diagnosis decision was proposed and developed. The novelty of the method is based on employing the soft computing method of FCMs to represent specialized knowledge on histopathology and on augmenting FCMs ability using an unsupervised learning algorithm, the AHL. The proposed method performs with reasonably high accuracy compared to other existing methods and at the same time meets the physicians' requirements for transparency and explicability.

  6. Scaling of Metabolic Scaling within Physical Limits

    Directory of Open Access Journals (Sweden)

    Douglas S. Glazier

    2014-10-01

    Full Text Available Both the slope and elevation of scaling relationships between log metabolic rate and log body size vary taxonomically and in relation to physiological or developmental state, ecological lifestyle and environmental conditions. Here I discuss how the recently proposed metabolic-level boundaries hypothesis (MLBH provides a useful conceptual framework for explaining and predicting much, but not all of this variation. This hypothesis is based on three major assumptions: (1 various processes related to body volume and surface area exert state-dependent effects on the scaling slope for metabolic rate in relation to body mass; (2 the elevation and slope of metabolic scaling relationships are linked; and (3 both intrinsic (anatomical, biochemical and physiological and extrinsic (ecological factors can affect metabolic scaling. According to the MLBH, the diversity of metabolic scaling relationships occurs within physical boundary limits related to body volume and surface area. Within these limits, specific metabolic scaling slopes can be predicted from the metabolic level (or scaling elevation of a species or group of species. In essence, metabolic scaling itself scales with metabolic level, which is in turn contingent on various intrinsic and extrinsic conditions operating in physiological or evolutionary time. The MLBH represents a “meta-mechanism” or collection of multiple, specific mechanisms that have contingent, state-dependent effects. As such, the MLBH is Darwinian in approach (the theory of natural selection is also meta-mechanistic, in contrast to currently influential metabolic scaling theory that is Newtonian in approach (i.e., based on unitary deterministic laws. Furthermore, the MLBH can be viewed as part of a more general theory that includes other mechanisms that may also affect metabolic scaling.

  7. Otological and vestibular symptoms in patients with low grade (Quebec grades one and two) whiplash injury.

    Science.gov (United States)

    Rowlands, R G; Campbell, I K; Kenyon, G S

    2009-02-01

    To establish the prevalence of new vestibular and otological symptoms in a group of patients who had sustained a low grade (Quebec grades one or two) whiplash injury. A retrospective review of the case records of 109 patients undergoing assessment by a single practitioner for the purposes of compiling a medicolegal report on their whiplash injury. Four patients complained of short-lived, non-specific dizziness symptoms in the acute phase following their original injury. There were no reports of vertigo, tinnitus or hearing loss after a mean period of 149 days following the whiplash injury. No patients reported otological or persistent vestibular symptoms in the acute phase following their whiplash injury. This suggests that caution should be exercised when attributing these symptoms to such an injury. Before whiplash injuries are admitted as an aetiological factor in the development of such symptoms, other causes should be excluded.

  8. Flux scaling: Ultimate regime

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Flux scaling: Ultimate regime. With the Nusselt number and the mixing length scales, we get the Nusselt number and Reynolds number (w'd/ν) scalings: and or. and. scaling expected to occur at extremely high Ra Rayleigh-Benard convection. Get the ultimate regime ...

  9. Grade III or Grade IV Hypertensive Retinopathy with Severely Elevated Blood Pressure

    Directory of Open Access Journals (Sweden)

    Amanda D Henderson

    2012-12-01

    Full Text Available Introduction: Hypertensive retinopathy describes a spectrum of retinal changes in patients with elevated blood pressure (BP. It is unknown why some patients are more likely to develop acute ocular end-organ damage than others with similar BP. We examined risk factors for grade III/IV hypertensive retinopathy among patients with hypertensive urgency in the emergency department (ED and compared healthcare utilization and mortality between patients with and without grade III/IV hypertensive retinopathy.Methods: A preplanned subanalysis of patients who presented to a university hospital ED with diastolic BP > 120 mmHg and who enrolled in the Fundus Photography versus Ophthalmoscopy Trial Outcomes in the ED study was performed. Bilateral nonmydriatic ocular fundus photographs, vital signs, and demographics were obtained at presentation. Past medical history, laboratory values, healthcare utilization, and mortality were ascertained from medical record review at least 8 months after initial ED visit.Results: Twenty-one patients with diastolic BP > 120 mmHg, 7 of whom (33% had grade III/IV hypertensive retinopathy, were included. Patients with retinopathy were significantly younger than those without (median 33 vs 50 years, P = 0.02. Mean arterial pressure (165 vs 163 mmHg was essentially equal in the 2 groups. Patients with retinopathy had substantially increased but nonsignificant rates of ED revisit (57% vs 29%, P = 0.35 and hospital admission after ED discharge (43% vs 14%, P = 0.28. One of the patients with retinopathy died, but none without.Conclusion: Younger patients may be at higher risk for grade III/IV hypertensive retinopathy among patients with hypertensive urgency. Chronic compensatory mechanisms may have not yet developed in these younger patients. Alternatively, older patients with retinopathy may be underrepresented secondary to increased mortality among these patients at a younger age (survivorship bias. Further research is needed to

  10. RELATIONSHIP BETWEEN ESOPHAGITIS GRADES AND HELICOBACTER PYLORI.

    Science.gov (United States)

    Ribeiro, Patrícia Fernanda Saboya; Kubrusly, Luiz Fernandao; Nassif, Paulo Afonso Nunes; Ribeiro, Irma Cláudia Saboya; Bertoldi, Andressa de Souza; Batistão, Venessa Caroline

    2016-01-01

    The Helicobacter pylori infection (HP) is related to the development of gastric lesions and lymphoma; however, it is not known if there is a relation with gastroesophageal reflux disease and reflux esophagitis. To evaluate HP's relationship with esophagitis in patients undergoing upper endoscopy. Observational, retrospective and cross-sectional study, being evaluated 9576 patients undergoing outpatient endoscopic examination during the period between January and December 2015. Were included patients with any esophageal alteration at the examination; greater than 18; of both genders; independent of the complaint or the reason for the examination, illness or drug use. Were excluded those with active bleeding during the examination and in use of anticoagulants. The variables gender, age, esophagitis and result of the urease test, were studied. For statistical analysis was used the Epi Info software 7.1.5.2. Most of the samples consisted of women and the overall average age was 46.54±16.32 years. The presence of infection was balanced for gender: 1204 (12.56%) women and 952 (13.92%) men. Relating degree of esophagitis HP- and HP+ was observed that the type A was the most common (58.79%, n=1460); 604 (24.32%) had grade B; 334 (13.45%) grade C, and 85 (3.42%) grade D. In the relation between the grade of esophagitis with gender, esophagitis A was predominant in women and present in 929 (63.33%), followed by type B, 282 (46.68%), 136 C (40.71%) and D 30 (35.29%). In men 531 (36.36%) showed type A, 322 (53.31%) B, 198 (59.28%) C, and 55 (64.70%) D. Among the groups 40-50 and over 60 years there was a significant difference in whether have or not have HP+. There is no significant difference between HP infection and the different grades of esophagitis. A infecção pelo Helicobacter pylori (HP) é relacionada com o desenvolvimento de lesões e linfoma gástricos; porém, ainda não se sabe ao certo se há relação dele com a doença do refluxo gastroesofágico e esofagite

  11. Analysis of DTI-Derived Tensor Metrics in Differential Diagnosis between Low-grade and High-grade Gliomas.

    Science.gov (United States)

    Jiang, Liang; Xiao, Chao-Yong; Xu, Quan; Sun, Jun; Chen, Huiyou; Chen, Yu-Chen; Yin, Xindao

    2017-01-01

    Purpose: It is critical and difficult to accurately discriminate between high- and low-grade gliomas preoperatively. This study aimed to ascertain the role of several scalar measures in distinguishing high-grade from low-grade gliomas, especially the axial diffusivity (AD), radial diffusivity (RD), planar tensor (Cp), spherical tensor (Cs), and linear tensor (Cl) derived from diffusion tensor imaging (DTI). Materials and Methods: Fifty-three patients with pathologically confirmed brain gliomas (21 low-grade and 32 high-grade) were included. Contrast-enhanced T1-weighted images and DTI were performed in all patients. The AD, RD, Cp, Cs, and Cl values in the tumor zone, peritumoral edema zone, white matter (WM) adjacent to edema and contralateral normal-appearing white matter (NAWM) were calculated. The DTI parameters and tumor grades were statistically analyzed, and receiver operating characteristic (ROC) curve analysis was also performed. Results: The DTI metrics in the affected hemisphere showed significant differences from those in the NAWM, except for the AD values in the tumor zone and the RD values in WM adjacent to edema in the low-grade groups, as well as the Cp values in WM adjacent to edema in the high-grade groups. AD in the tumor zone as well as Cs and Cl in WM adjacent to edema revealed significant differences between the low- and high-grade gliomas. The areas under the curve (Az) of all three metrics were greater than 0.5 in distinguishing low-grade from high-grade gliomas by ROC curve analysis, and the best DTI metric was Cs in WM adjacent to edema (Az: 0.692). Conclusion: AD in the tumor zone as well as Cs and Cl in WM adjacent to edema will provide additional information to better classify gliomas and can be used as non-invasive reliable biomarkers in glioma grading.

  12. SURFACE TREATMENT AND EXAMINATION OF GRADE 2 AND GRADE 5 TITANIUM

    Directory of Open Access Journals (Sweden)

    Peter Nagy

    2016-02-01

    Full Text Available Surface characteristics play an important role in the implant-bone integration that is required for the long-term reliability of dental and orthopedic implants. In this paper, we investigate the effect of acid etching on the mass reduction and roughness of grade 2 and grade 5 Ti under controlled experimental conditions. Three different etching compounds were investigated: 30% HCl, 85% H3PO4 and the compound of 30% (COOH2 × 2H2O and 30% H2O2 in various treatment intervals under controlled temperature. Stereo microscopy, scanning electron microscopy, roughness and weight measurements were carried out on the samples. We found that neither 85% H3PO4 nor the compound of 30% (COOH2 × 2H2O and 30% H2O2 were able to remove the machining marks from the surface of Ti discs in our experimental setting. On the other hand, etching in 30% HCl yielded even surfaces both on Ti grade 2 and 5 discs. We also found that etching at higher temperatures in 30% HCl resulted in significant mass loss.

  13. To scale or not to scale

    DEFF Research Database (Denmark)

    Svendsen, Morten Bo Søndergaard; Christensen, Emil Aputsiaq Flindt; Steffensen, John Fleng

    2017-01-01

    Conventionally, dynamic energy budget (DEB) models operate with animals that have maintenance rates scaling with their body volume, and assimilation rates scaling with body surface area. However, when applying such criteria for the individual in a population level model, the emergent behaviour...

  14. A STUDY ON STUDENTS’ DIRECT LISTENING STRATEGIES IN COMPREHENDING A PASSAGE AT THE SECOND GRADE STUDENTS OF SMAN OLAHRAGA RIAU

    Directory of Open Access Journals (Sweden)

    Kurniawan Kurniawan

    2016-04-01

    Full Text Available The purpose of this research was to identify the students’ directlistening strategies in comprehending a passage at the second grade students ofSMAN Olahraga Riau. The design of this research was survey attitudes andpractices. Sample of the research was 50 students at the second grade students ofSMAN Olahraga Riau. The instrument that was used was questionnaire. Thequestionnaire was design the students’ direct listening. The questionnaire wasanalyzed by using descriptive statistics and Likert scale. The result of analyzingdata in terms of memory strategy, the students’ mean score was 3.99 in moderatelevel. In terms of cognitive strategy, the students’ mean score was 3.74 inmoderate level, while in terms of compensation strategy, the students had meanscore 3.86 in moderate level. In conclusion, the students were interested usingmemory strategy as the main direct strategy in comprehending a passage at thesecond grade students of SMAN Olahraga Riau.Keywords : Direct Listening Strategy, Comprehension, and Passage

  15. Mechanical analysis of non-uniform bi-directional functionally graded intelligent micro-beams using modified couple stress theory

    Science.gov (United States)

    Bakhshi Khaniki, Hossein; Rajasekaran, Sundaramoorthy

    2018-05-01

    This study develops a comprehensive investigation on mechanical behavior of non-uniform bi-directional functionally graded beam sensors in the framework of modified couple stress theory. Material variation is modelled through both length and thickness directions using power-law, sigmoid and exponential functions. Moreover, beam is assumed with linear, exponential and parabolic cross-section variation through the length using power-law and sigmoid varying functions. Using these assumptions, a general model for microbeams is presented and formulated by employing Hamilton’s principle. Governing equations are solved using a mixed finite element method with Lagrangian interpolation technique, Gaussian quadrature method and Wilson’s Lagrangian multiplier method. It is shown that by using bi-directional functionally graded materials in nonuniform microbeams, mechanical behavior of such structures could be affected noticeably and scale parameter has a significant effect in changing the rigidity of nonuniform bi-directional functionally graded beams.

  16. Size-dependent electro-magneto-elastic bending analyses of the shear-deformable axisymmetric functionally graded circular nanoplates

    Science.gov (United States)

    Arefi, Mohammad; Zenkour, Ashraf M.

    2017-10-01

    This paper develops nonlocal elasticity equations and magneto-electro-elastic relations to size-dependent electro-magneto-elastic bending analyses of the functionally graded axisymmetric circular nanoplates based on the first-order shear deformation theory. All material properties are graded along the thickness direction based on exponential varying. It is assumed that a circular nanoplate is made from piezo-magnetic materials. The energy method and Ritz approach is employed for the derivation of governing equations of electro-magneto-elastic bending and the solution of the problem, respectively. The nanoplate is subjected to applied electric and magnetic potentials at top and transverse loads while it is rested on Pasternak's foundation. Some important numerical results are presented in various figures to show the influence of applied electric and magnetic potentials, small scale parameter and inhomogeneous index of an exponentially graded nanoplate.

  17. Development of the Self-Esteem Rating Scale for Children (Revised).

    Science.gov (United States)

    Chiu, Lian-Hwang

    1987-01-01

    Developed a teacher's rating scale of self-esteem for children. Participants were 231 school children in grades K-7. Used sociometric measures, popularity ranking by teachers, and the Coopersmith Self-Esteem Inventory to estimate validity. The Self-Esteem Rating Scale for Children (SERSC) included 12 behavioral characteristics rated most…

  18. A Lifelong Learning Scale for Research and Evaluation of Teaching and Curricular Effectiveness

    Science.gov (United States)

    Wielkiewicz, Richard M.; Meuwissen, Alyssa S.

    2014-01-01

    A 16-item lifelong learning scale (LLS), appropriate for college students and others, was evaluated using a sample of 575 college students. The scale demonstrated excellent reliability and was correlated with college grade point average (GPA), agreeableness, conscientiousness, and intellect/imagination. Scores were higher for those who had studied…

  19. Department of Health and Children Consolidated Salary Scales effective from June 2007

    OpenAIRE

    Department of Health (Ireland)

    2007-01-01

    Department of Health and Children Consolidated Salary Scales effective from June 2007 For the 1st worksheet, the pay-scales for grades read across. The current rate (1/06/07), 2% (2.5% if earning less than â,¬20,859 per annum) Towards 2016 and one historical rate are shown for the 1st worksheet. The grades within each section are displayed in the same order as in previous Pay Scales. Click here to download PDF 173kb

  20. Evaluation of aesthetic abdominal surgery using a new clinical scale.

    Science.gov (United States)

    Salles, Alessandra Grassi; Ferreira, Marcus Castro; do Nascimento Remigio, Adelina Fatima; Gemperli, Rolf

    2012-02-01

    Evaluation of outcomes after aesthetic surgery still is a challenge in plastic surgery. The evaluation frequently is based on subjective criteria. This study used a new clinical grading scale to evaluate aesthetic results for plastic surgeries to the abdomen. The method scores each of the following five parameters: volume of subcutaneous tissue, contour, excess of skin, aspect of the navel, and quality of the scar on the abdominal wall. The scale options are 0 (poor), 1 (fair), and 2 (good), and the total rate can range from 0 to 10. The study included 40 women ages 18-53 years. Of these 40 women, 20 underwent traditional abdominoplasty, and 20 had liposuction alone. Preoperatively and at least 1 year later, photographic results were analyzed and scored by three independent plastic surgeons. In the abdominoplasty group, the average grade rose from 2.9±0.4 to 6.8±0.4 postoperatively. In the liposuction group, the average grade was 5.3±0.5 preoperatively and 7.7±0.4 postoperatively. In both groups, the average postoperative grade was significantly higher than the preoperative grade. The mean scores for groups A and L were significantly different, demonstrating that the scale was sensitive in identifying different anatomic abnormalities in the abdomen. The rating scale used for the aesthetic evaluation of the abdomen was effective in the analysis of two different procedures: conventional abdominoplasty and liposuction. Abdominoplasty provided the greater gain according to a comparison of the pre- and postoperative scores.