GTS Duratek, phase I Hanford low-level waste melter tests: Final report

International Nuclear Information System (INIS)

Eaton, W.C.

1995-01-01

A multiphase program was initiated in 1994 to test commercially available melter technologies for the vitrification of the low-level waste (LLW) stream from defense waste stored in underground tanks at the Hanford Site in southeastern Washington State. Phase 1 of the melter demonstration tests using simulated LLW was completed during fiscal year 1995. This document is the final report on testing performed by GTS Duratek Inc. in Columbia, Maryland. GTS Duratek (one of the seven vendors selected) was chosen to demonstrate Joule heated melter technology under WHC subcontract number MMI-SVV-384215. The report contains description of the tests, observations, test data and some analysis of the data as it pertains to application of this technology for LLW vitrification. The document also contains summaries of the melter offgas reports issued as separate documents for the 100 kg melter (WHC-SD-WM-VI-028) and for the 1000 kg melter (WHC-SD-WM-VI-029)

Signal detection to identify serious adverse events (neuropsychiatric events in travelers taking mefloquine for chemoprophylaxis of malaria

Directory of Open Access Journals (Sweden)

Naing C

2012-08-01

Full Text Available Cho Naing,1,3 Kyan Aung,1 Syed Imran Ahmed,2 Joon Wah Mak31School of Medical Sciences, 2School of Pharmacy and Health Sciences, 3School of Postgraduate Studies and Research, International Medical University, Kuala Lumpur, MalaysiaBackground: For all medications, there is a trade-off between benefits and potential for harm. It is important for patient safety to detect drug-event combinations and analyze by appropriate statistical methods. Mefloquine is used as chemoprophylaxis for travelers going to regions with known chloroquine-resistant Plasmodium falciparum malaria. As such, there is a concern about serious adverse events associated with mefloquine chemoprophylaxis. The objective of the present study was to assess whether any signal would be detected for the serious adverse events of mefloquine, based on data in clinicoepidemiological studies.Materials and methods: We extracted data on adverse events related to mefloquine chemoprophylaxis from the two published datasets. Disproportionality reporting of adverse events such as neuropsychiatric events and other adverse events was presented in the 2 × 2 contingency table. Reporting odds ratio and corresponding 95% confidence interval [CI] data-mining algorithm was applied for the signal detection. The safety signals are considered significant when the ROR estimates and the lower limits of the corresponding 95% CI are ≥2.Results: Two datasets addressing adverse events of mefloquine chemoprophylaxis (one from a published article and one from a Cochrane systematic review were included for analyses. Reporting odds ratio 1.58, 95% CI: 1.49–1.68 based on published data in the selected article, and 1.195, 95% CI: 0.94–1.44 based on data in the selected Cochrane review. Overall, in both datasets, the reporting odds ratio values of lower 95% CI were less than 2.Conclusion: Based on available data, findings suggested that signals for serious adverse events pertinent to neuropsychiatric event were

Intratumoral and peritumoral lymphovascular invasion detected by D2-40 immunohistochemistry correlates with metastasis in primary cutaneous Merkel cell carcinoma.

Science.gov (United States)

Al-Rohil, Rami N; Milton, Denái R; Nagarajan, Priyadharsini; Curry, Jonathan L; Feldmeyer, Laurence; Torres-Cabala, Carlos A; Ivan, Doina; Prieto, Victor G; Tetzlaff, Michael T; Aung, Phyu P

2018-07-01

Primary cutaneous Merkel cell carcinoma (MCC) is an aggressive neuroendocrine malignancy in which lymphovascular invasion (LVI) correlates with more aggressive phenotype. The prognostic significance of LVI detected by D2-40 immunohistochemistry (IHC) in MCC remains controversial. We aimed to determine how LVI detected by D2-40 IHC compares with LVI detected by hematoxylin and eosin (H&E) staining in predicting MCC metastasis. Clinical and histopathologic features of MCCs diagnosed and treated in 2002 to 2015 were assembled and included 58 MCC tumors from 58 patients. H&E-stained tissue sections and D2-40 IHC studies were reviewed. When LVI was present, the location (peritumoral or intratumoral) and the size of the largest invaded vessel were recorded. LVI findings by H&E staining and D2-40 IHC were compared with each other and with histologic features and clinical outcomes. H&E staining showed LVI in 37 of 58 cases; D2-40 IHC confirmed LVI in 30 of these cases but failed to confirm LVI in 7. D2-40 IHC also detected 14 cases of LVI not identified on H&E staining. Histologically, D2-40-detected LVI was associated with infiltrative growth pattern and nonbrisk lymphoid infiltrate (P = .005 and P = .055, respectively). There was a statistically significant difference between the frequency of detection of peritumoral LVI by H&E in comparison to D2-40 IHC (P = .0009). MCCs in which D2-40 IHC-detected both intratumoral and peritumoral LVI were typically larger than MCCs without (mean, 24.5 mm versus 17.3 mm; P = .03) and more frequently metastasized (87% versus 51%; P = .03). D2-40 IHC detection of both intratumoral and peritumoral LVI is associated with metastasis. Copyright © 2018 Elsevier Inc. All rights reserved.

Detection of goal events in soccer videos

Science.gov (United States)

Kim, Hyoung-Gook; Roeber, Steffen; Samour, Amjad; Sikora, Thomas

2005-01-01

In this paper, we present an automatic extraction of goal events in soccer videos by using audio track features alone without relying on expensive-to-compute video track features. The extracted goal events can be used for high-level indexing and selective browsing of soccer videos. The detection of soccer video highlights using audio contents comprises three steps: 1) extraction of audio features from a video sequence, 2) event candidate detection of highlight events based on the information provided by the feature extraction Methods and the Hidden Markov Model (HMM), 3) goal event selection to finally determine the video intervals to be included in the summary. For this purpose we compared the performance of the well known Mel-scale Frequency Cepstral Coefficients (MFCC) feature extraction method vs. MPEG-7 Audio Spectrum Projection feature (ASP) extraction method based on three different decomposition methods namely Principal Component Analysis( PCA), Independent Component Analysis (ICA) and Non-Negative Matrix Factorization (NMF). To evaluate our system we collected five soccer game videos from various sources. In total we have seven hours of soccer games consisting of eight gigabytes of data. One of five soccer games is used as the training data (e.g., announcers' excited speech, audience ambient speech noise, audience clapping, environmental sounds). Our goal event detection results are encouraging.

NCDC feed of Global Telecommunication System (GTS) marine observations in International Maritime Meteorological Archive (IMMA) Format

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The data contained here are surface marine observations from many different sources via the NCDC Global Telecommunication System (GTS) Marine in International...

Screen-level non-GTS data assimilation in a limited-area mesoscale model

Directory of Open Access Journals (Sweden)

M. Milelli

2010-06-01

Full Text Available The forecast in areas of very complex topography, as for instance the Alpine region, is still a challenge even for the new generation of numerical weather prediction models which aim at reaching the km-scale. The problem is enhanced by a general lack of standard observations, which is even more evident over the southern side of the Alps. For this reason, it would be useful to increase the performance of the mathematical models by locally assimilating non-conventional data. Since in ARPA Piemonte there is the availability of a great number of non-GTS stations, it has been decided to assimilate the 2 m temperature, coming from this dataset, in the very-high resolution version of the COSMO model, which has a horizontal resolution of about 3 km, more similar to the average resolution of the thermometers. Four different weather situations have been considered, ranging from spring to winter, from cloudy to clear sky. The aim of the work is to investigate the effects of the assimilation of non-GTS data in order to create an operational very high-resolution analysis, but also to test the option of running in the future a very short-range forecast starting from these analyses (RUC or Rapid Update Cycle. The results, in terms of Root Mean Square Error, Mean Error and diurnal cycle of some surface variables such as 2 m temperature, 2 m relative humidity and 10 m wind intensity show a positive impact during the assimilation cycle which tends to dissipate a few hours after the end of it. Moreover, the 2 m temperature assimilation has a slightly positive or neutral impact on the vertical profiles of temperature, eventhough some calibration is needed for the precipitation field which is too much perturbed during the assimilation cycle, while it is unaffected in the forecast period. So the stability of the planetary boundary layer, on the one hand, has not been particularly improved by the new-data assimilation, but, on the other hand, it has not been destroyed

Decay of 1, 2 and 3-phonon states in 40Ca

International Nuclear Information System (INIS)

Fallot, M.; Scarpaci, J.A.; Frascaria, N.; Blumenfeld, Y.; Chbihi, A.; Chomaz, Ph.; Desesquelles, P.; Frankland, J.; Khan, E.; Laville, J.L.; Plagnol, E.; Pollacco, E.C.; Roussel-Chomaz, P.; Roynette, J.C.; Shrivastava, A.; Zerguerras, T.

2007-01-01

Inelastic scattering of 40 Ca on 40 Ca at 50 A.MeV has been measured in coincidence with protons at the GANIL facility using a very performant set-up. The SPEG spectrometer was associated with 240 CsI(Tl) scintillators of the INDRA 4π array, allowing for the measurement of complete decay events. The missing energy method was applied to these events to study the particle decay of collective states. For events with excitation energy between 42 and 55 MeV, a direct decay branch by three protons towards the low energy states of 37 Cl gives the first evidence for a 3-phonon giant resonance state. A significant direct decay branch by alpha-particles of the GQR is also measured for the first time

RELATIVISTIC (E > 0.6, > 2.0, AND > 4.0 MeV) ELECTRON ACCELERATION AT GEOSYNCHRONOUS ORBIT DURING HIGH-INTENSITY, LONG-DURATION, CONTINUOUS AE ACTIVITY (HILDCAA) EVENTS

International Nuclear Information System (INIS)

Hajra, Rajkumar; Echer, Ezequiel; Gonzalez, Walter D.; Tsurutani, Bruce T.; Santolik, Ondrej

2015-01-01

Radiation-belt relativistic (E > 0.6, > 2.0, and > 4.0 MeV) electron acceleration is studied for solar cycle 23 (1995-2008). High-intensity, long-duration, continuous AE activity (HILDCAA) events are considered as the basis of the analyses. All of the 35 HILDCAA events under study were found to be characterized by flux enhancements of magnetospheric relativistic electrons of all three energies compared to the pre-event flux levels. For the E > 2.0 MeV electron fluxes, enhancement of >50% occurred during 100% of HILDCAAs. Cluster-4 passes were examined for electromagnetic chorus waves in the 5 < L < 10 and 0 < MLT < 12 region when wave data were available. Fully 100% of these HILDCAA cases were associated with enhanced whistler-mode chorus waves. The enhancements of E > 0.6, > 2.0, and > 4.0 MeV electrons occurred ∼1.0 day, ∼1.5 days, and ∼2.5 days after the statistical HILDCAA onset, respectively. The statistical acceleration rates for the three energy ranges were ∼1.8 × 10 5 , 2.2 × 10 3 , and 1.0 × 10 1 cm –2 s –1 sr –1 d –1 , respectively. The relativistic electron-decay timescales were determined to be ∼7.7, 5.5, and 4.0 days for the three energy ranges, respectively. The HILDCAAs were divided into short-duration (D ≤ 3 days) and long-duration (D > 3 days) events to study the dependence of relativistic electron variation on HILDCAA duration. For long-duration events, the flux enhancements during HILDCAAs with respect to pre-event fluxes were ∼290%, 520%, and 82% for E > 0.6, > 2.0, and > 4.0 MeV electrons, respectively. The enhancements were ∼250%, 400%, and 27% respectively, for short-duration events. The results are discussed with respect to the current understanding of radiation-belt dynamics

Latency and mode of error detection as reflected in Swedish licensee event reports

Energy Technology Data Exchange (ETDEWEB)

Svenson, Ola; Salo, Ilkka [Stockholm Univ., (Sweden). Dept. of Psychology

2002-03-01

Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety.

Latency and mode of error detection as reflected in Swedish licensee event reports

International Nuclear Information System (INIS)

Svenson, Ola; Salo, Ilkka

2002-03-01

Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety

Operation of the GTS-LHC source for the hadron injector at CERN

International Nuclear Information System (INIS)

Dumas, L.; Hill, C.; Hitz, D.; Kuchler, D.; Mastrostefano, C.; O'Neil, M.; Scrivens, R.

2007-01-01

The GTS-LHC ion source, designed and build by CEA Grenoble, was installed and commissioned at CERN in 2005. Since than the source has delivered oxygen and lead ion beams (O4+ and Pb27+ from the source, Pb54+ from the linac) for the commissioning of the Low Energy Ion Ring (LEIR). Results of this operation and attempts to improve the source performance and reliability, and the linac performance will be presented in this paper. (authors)

Operation of the GTS-LHC source for the hadron injector at CERN

Energy Technology Data Exchange (ETDEWEB)

Dumas, L.; Hill, C.; Hitz, D.; Kuchler, D.; Mastrostefano, C.; O' Neil, M.; Scrivens, R. [CERN, AB ABP HSL, CH-1211 Geneva 23, (Switzerland); CEA, DRFMC SBT, F-38054 Grenoble, (France)

2007-07-01

The GTS-LHC ion source, designed and build by CEA Grenoble, was installed and commissioned at CERN in 2005. Since than the source has delivered oxygen and lead ion beams (O4+ and Pb27+ from the source, Pb54+ from the linac) for the commissioning of the Low Energy Ion Ring (LEIR). Results of this operation and attempts to improve the source performance and reliability, and the linac performance will be presented in this paper. (authors)

Operation of the GTS-LHC Source for the Hadron Injector at CERN

CERN Document Server

Dumas, L; Hitz, D; Küchler, D; Mastrostefano, C; O'Neill, M; Scrivens, R

2007-01-01

The GTS-LHC ion source, designed and build by CEA Grenoble, was installed and commissioned at CERN in 2005. Since than the source has delivered oxygen and lead ion beams (O4+ and Pb27+ from the source, Pb54+ from the linac) for the commissioning of the Low Energy Ion Ring (LEIR). Results of this operation and attempts to improve the source performance and reliability, and the linac performance will be presented in this paper.

Neutron detector for detecting rare events of spontaneous fission

International Nuclear Information System (INIS)

Ter-Akop'yan, G.M.; Popeko, A.G.; Sokol, E.A.; Chelnokov, L.P.; Smirnov, V.I.; Gorshkov, V.A.

1981-01-01

The neutron detector for registering rare events of spontaneous fission by detecting multiple neutron emission is described. The detector represents a block of plexiglas of 550 mm diameter and 700 mm height in the centre of which there is a through 160 mm diameter channel for the sample under investigation. The detector comprises 56 3 He filled counters (up to 7 atm pressure) with 1% CO 2 addition. The counters have a 500 mm length and a 32 mm diameter. The sampling of fission events is realized by an electron system which allows determining the number of detected neutrons, numbers of operated counters, signal amplitude and time for fission event detecting. A block diagram of a neutron detector electron system is presented and its operation principle is considered. For protection against cosmic radiation the detector is surronded by a system of plastic scintillators and placed behind the concrete shield of 6 m thickness. The results of measurements of background radiation are given. It has been found that the background radiation of single neutron constitutes about 150 counts per hour, the detecting efficiency of single neutron equals 0.483 +- 0.005, for a 10l detector sensitive volume. By means of the detector described the parameters of multiplicity distribution of prompt neutrons for 256 Fm spontaneous fission are measured. The average multiplicity equals 3.59+-0.06 the dispersion being 2.30+-0.65

Studies of the beam extraction system of the GTS-LHC electron cyclotron resonance ion source at CERN.

Science.gov (United States)

Toivanen, V; Küchler, D

2016-02-01

The 14.5 GHz GTS-LHC Electron Cyclotron Resonance Ion Source (ECRIS) provides multiply charged heavy ion beams for the CERN experimental program. The GTS-LHC beam formation has been studied extensively with lead, argon, and xenon beams with varied beam extraction conditions using the ion optical code IBSimu. The simulation model predicts self-consistently the formation of triangular and hollow beam structures which are often associated with ECRIS ion beams, as well as beam loss patterns which match the observed beam induced markings in the extraction region. These studies provide a better understanding of the properties of the extracted beams and a way to diagnose the extraction system performance and limitations, which is otherwise challenging due to the lack of direct diagnostics in this region and the limited availability of the ion source for development work.

[Detection of adverse events in hospitalized adult patients by using the Global Trigger Tool method].

Science.gov (United States)

Guzmán-Ruiz, O; Ruiz-López, P; Gómez-Cámara, A; Ramírez-Martín, M

2015-01-01

To identify and characterize adverse events (AE) in an Internal Medicine Department of a district hospital using an extension of the Global Trigger Tool (GTT), analyzing the diagnostic validity of the tool. An observational, analytical, descriptive and retrospective study was conducted on 2013 clinical charts from an Internal Medicine Department in order to detect EA through the identification of 'triggers' (an event often related to an AE). The 'triggers' and AE were located by systematic review of clinical documentation. The AE were characterized after they were identified. A total of 149 AE were detected in 291 clinical charts during 2013, of which 75.3% were detected directly by the tool, while the rest were not associated with a trigger. The percentage of charts that had at least one AE was 35.4%. The most frequent AE found was pressure ulcer (12%), followed by delirium, constipation, nosocomial respiratory infection and altered level of consciousness by drugs. Almost half (47.6%) of the AE were related to drug use, and 32.2% of all AE were considered preventable. The tool demonstrated a sensitivity of 91.3% (95%CI: 88.9-93.2) and a specificity of 32.5% (95%CI: 29.9-35.1). It had a positive predictive value of 42.5% (95%CI: 40.1-45.1) and a negative predictive value of 87.1% (95%CI: 83.8-89.9). The tool used in this study is valid, useful and reproducible for the detection of AE. It also serves to determine rates of injury and to observe their progression over time. A high frequency of both AE and preventable events were observed in this study. Copyright © 2014 SECA. Published by Elsevier Espana. All rights reserved.

Automatic detection of whole night snoring events using non-contact microphone.

Directory of Open Access Journals (Sweden)

Eliran Dafna

Full Text Available OBJECTIVE: Although awareness of sleep disorders is increasing, limited information is available on whole night detection of snoring. Our study aimed to develop and validate a robust, high performance, and sensitive whole-night snore detector based on non-contact technology. DESIGN: Sounds during polysomnography (PSG were recorded using a directional condenser microphone placed 1 m above the bed. An AdaBoost classifier was trained and validated on manually labeled snoring and non-snoring acoustic events. PATIENTS: Sixty-seven subjects (age 52.5 ± 13.5 years, BMI 30.8 ± 4.7 kg/m(2, m/f 40/27 referred for PSG for obstructive sleep apnea diagnoses were prospectively and consecutively recruited. Twenty-five subjects were used for the design study; the validation study was blindly performed on the remaining forty-two subjects. MEASUREMENTS AND RESULTS: To train the proposed sound detector, >76,600 acoustic episodes collected in the design study were manually classified by three scorers into snore and non-snore episodes (e.g., bedding noise, coughing, environmental. A feature selection process was applied to select the most discriminative features extracted from time and spectral domains. The average snore/non-snore detection rate (accuracy for the design group was 98.4% based on a ten-fold cross-validation technique. When tested on the validation group, the average detection rate was 98.2% with sensitivity of 98.0% (snore as a snore and specificity of 98.3% (noise as noise. CONCLUSIONS: Audio-based features extracted from time and spectral domains can accurately discriminate between snore and non-snore acoustic events. This audio analysis approach enables detection and analysis of snoring sounds from a full night in order to produce quantified measures for objective follow-up of patients.

40 CFR 721.8145 - Propane,1,1,1,2,2,3,3-heptafluoro-3-methoxy-.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Propane,1,1,1,2,2,3,3-heptafluoro-3-methoxy-. 721.8145 Section 721.8145 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... significant new uses are: (i) Industrial, commercial, and consumer activities. Requirements as specified § 721...

40 CFR 35.2109 - Step 2+3.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Step 2+3. 35.2109 Section 35.2109... ASSISTANCE Grants for Construction of Treatment Works § 35.2109 Step 2+3. The Regional Administrator may award a Step 2+3 grant which will provide the Federal share of an allowance under appendix B and the...

National Earthquake Information Center Seismic Event Detections on Multiple Scales

Science.gov (United States)

Patton, J.; Yeck, W. L.; Benz, H.; Earle, P. S.; Soto-Cordero, L.; Johnson, C. E.

2017-12-01

The U.S. Geological Survey National Earthquake Information Center (NEIC) monitors seismicity on local, regional, and global scales using automatic picks from more than 2,000 near-real time seismic stations. This presents unique challenges in automated event detection due to the high variability in data quality, network geometries and density, and distance-dependent variability in observed seismic signals. To lower the overall detection threshold while minimizing false detection rates, NEIC has begun to test the incorporation of new detection and picking algorithms, including multiband (Lomax et al., 2012) and kurtosis (Baillard et al., 2014) pickers, and a new bayesian associator (Glass 3.0). The Glass 3.0 associator allows for simultaneous processing of variably scaled detection grids, each with a unique set of nucleation criteria (e.g., nucleation threshold, minimum associated picks, nucleation phases) to meet specific monitoring goals. We test the efficacy of these new tools on event detection in networks of various scales and geometries, compare our results with previous catalogs, and discuss lessons learned. For example, we find that on local and regional scales, rapid nucleation of small events may require event nucleation with both P and higher-amplitude secondary phases (e.g., S or Lg). We provide examples of the implementation of a scale-independent associator for an induced seismicity sequence (local-scale), a large aftershock sequence (regional-scale), and for monitoring global seismicity. Baillard, C., Crawford, W. C., Ballu, V., Hibert, C., & Mangeney, A. (2014). An automatic kurtosis-based P-and S-phase picker designed for local seismic networks. Bulletin of the Seismological Society of America, 104(1), 394-409. Lomax, A., Satriano, C., & Vassallo, M. (2012). Automatic picker developments and optimization: FilterPicker - a robust, broadband picker for real-time seismic monitoring and earthquake early-warning, Seism. Res. Lett. , 83, 531-540, doi: 10

Detecting Seismic Events Using a Supervised Hidden Markov Model

Science.gov (United States)

Burks, L.; Forrest, R.; Ray, J.; Young, C.

2017-12-01

We explore the use of supervised hidden Markov models (HMMs) to detect seismic events in streaming seismogram data. Current methods for seismic event detection include simple triggering algorithms, such as STA/LTA and the Z-statistic, which can lead to large numbers of false positives that must be investigated by an analyst. The hypothesis of this study is that more advanced detection methods, such as HMMs, may decreases false positives while maintaining accuracy similar to current methods. We train a binary HMM classifier using 2 weeks of 3-component waveform data from the International Monitoring System (IMS) that was carefully reviewed by an expert analyst to pick all seismic events. Using an ensemble of simple and discrete features, such as the triggering of STA/LTA, the HMM predicts the time at which transition occurs from noise to signal. Compared to the STA/LTA detection algorithm, the HMM detects more true events, but the false positive rate remains unacceptably high. Future work to potentially decrease the false positive rate may include using continuous features, a Gaussian HMM, and multi-class HMMs to distinguish between types of seismic waves (e.g., P-waves and S-waves). Acknowledgement: Sandia National Laboratories is a multi-mission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.SAND No: SAND2017-8154 A

Contamination Event Detection with Multivariate Time-Series Data in Agricultural Water Monitoring

Directory of Open Access Journals (Sweden)

Yingchi Mao

2017-12-01

Full Text Available Time series data of multiple water quality parameters are obtained from the water sensor networks deployed in the agricultural water supply network. The accurate and efficient detection and warning of contamination events to prevent pollution from spreading is one of the most important issues when pollution occurs. In order to comprehensively reduce the event detection deviation, a spatial–temporal-based event detection approach with multivariate time-series data for water quality monitoring (M-STED was proposed. The M-STED approach includes three parts. The first part is that M-STED adopts a Rule K algorithm to select backbone nodes as the nodes in the CDS, and forward the sensed data of multiple water parameters. The second part is to determine the state of each backbone node with back propagation neural network models and the sequential Bayesian analysis in the current timestamp. The third part is to establish a spatial model with Bayesian networks to estimate the state of the backbones in the next timestamp and trace the “outlier” node to its neighborhoods to detect a contamination event. The experimental results indicate that the average detection rate is more than 80% with M-STED and the false detection rate is lower than 9%, respectively. The M-STED approach can improve the rate of detection by about 40% and reduce the false alarm rate by about 45%, compared with the event detection with a single water parameter algorithm, S-STED. Moreover, the proposed M-STED can exhibit better performance in terms of detection delay and scalability.

40 CFR 257.3-2 - Endangered species.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Endangered species. 257.3-2 Section... Disposal Facilities and Practices § 257.3-2 Endangered species. (a) Facilities or practices shall not cause or contribute to the taking of any endangered or threatened species of plants, fish, or wildlife. (b...

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

Science.gov (United States)

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

A simple strategy for fall events detection

KAUST Repository

Harrou, Fouzi

2017-01-20

The paper concerns the detection of fall events based on human silhouette shape variations. The detection of fall events is addressed from the statistical point of view as an anomaly detection problem. Specifically, the paper investigates the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart. The MEWMA fall detection scheme has been successfully applied to two publicly available fall detection databases, the UR fall detection dataset (URFD) and the fall detection dataset (FDD). The monitoring strategy developed was able to provide early alert mechanisms in the event of fall situations.

Vibrotactile Detection, Identification and Directional Perception of signal-Processed Sounds from Environmental Events: A Pilot Field Evaluation in Five Cases

Directory of Open Access Journals (Sweden)

Parivash Ranjbar

2008-09-01

Full Text Available Objectives: Conducting field tests of a vibrotactile aid for deaf/deafblind persons for detection, identification and directional perception of environmental sounds. Methods: Five deaf (3F/2M, 22–36 years individuals tested the aid separately in a home environment (kitchen and in a traffic environment. Their eyes were blindfolded and they wore a headband and holding a vibrator for sound identification. In the headband, three microphones were mounted and two vibrators for signalling direction of the sound source. The sounds originated from events typical for the home environment and traffic. The subjects were inexperienced (events unknown and experienced (events known. They identified the events in a home and traffic environment, but perceived sound source direction only in traffic. Results: The detection scores were higher than 98% both in the home and in the traffic environment. In the home environment, identification scores varied between 25%-58% when the subjects were inexperienced and between 33%-83% when they were experienced. In traffic, identification scores varied between 20%-40% when the subjects were inexperienced and between 22%-56% when they were experienced. The directional perception scores varied between 30%-60% when inexperienced and between 61%-83% when experienced. Discussion: The vibratory aid consistently improved all participants’ detection, identification and directional perception ability.

Delay Analysis of GTS Bridging between IEEE 802.15.4 and IEEE 802.11 Networks for Healthcare Applications

Science.gov (United States)

Mišić, Jelena; (Sherman) Shen, Xuemin

2009-01-01

We consider interconnection of IEEE 802.15.4 beacon-enabled network cluster with IEEE 802.11b network. This scenario is important in healthcare applications where IEEE 802.15.4 nodes comprise patient's body area network (BAN) and are involved in sensing some health-related data. BAN nodes have very short communication range in order to avoid harming patient's health and save energy. Sensed data needs to be transmitted to an access point in the ward room using wireless technology with higher transmission range and rate such as IEEE 802.11b. We model the interconnected network where IEEE 802.15.4-based BAN operates in guaranteed time slot (GTS) mode, and IEEE 802.11b part of the bridge conveys GTS superframe to the 802.11b access point. We then analyze the network delays. Performance analysis is performed using EKG traffic from continuous telemetry, and we discuss the delays of communication due the increasing number of patients. PMID:19107184

Delay Analysis of GTS Bridging between IEEE 802.15.4 and IEEE 802.11 Networks for Healthcare Applications.

Science.gov (United States)

Misić, Jelena; Sherman Shen, Xuemin

2009-01-01

We consider interconnection of IEEE 802.15.4 beacon-enabled network cluster with IEEE 802.11b network. This scenario is important in healthcare applications where IEEE 802.15.4 nodes comprise patient's body area network (BAN) and are involved in sensing some health-related data. BAN nodes have very short communication range in order to avoid harming patient's health and save energy. Sensed data needs to be transmitted to an access point in the ward room using wireless technology with higher transmission range and rate such as IEEE 802.11b. We model the interconnected network where IEEE 802.15.4-based BAN operates in guaranteed time slot (GTS) mode, and IEEE 802.11b part of the bridge conveys GTS superframe to the 802.11b access point. We then analyze the network delays. Performance analysis is performed using EKG traffic from continuous telemetry, and we discuss the delays of communication due the increasing number of patients.

Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

Science.gov (United States)

Lee, Seong-Hun

2014-11-01

There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

Search for the 3-phonon state of 40Ca

International Nuclear Information System (INIS)

Fallot, M.

2002-09-01

We study collective vibrational states of the nucleus: giant resonances and multiphonon states. It has been shown that multiphonon states, which are built with several superimposed giant resonances, can be excited in inelastic heavy ion scattering near the grazing angle. No three photon states have been observed until now. An experiment has been performed at GANIL, aiming at the observation of the 3-phonon state built with the giant quadrupole resonance (GQR) in 40 Ca, with the reaction 40 Ca + 40 Ca at 50 A.Me.V. The ejectile was identified in the SPEG spectrometer. Light charged particles were detected in 240 CsI scintillators of the INDRA 4π array. The analysis confirms the previous results about the GQR and the 2-phonon state in 40 Ca. For the first time, we have measured an important direct decay branch of the GQR by alpha particles. Applying the so-called 'missing energy method' to events containing three protons measured in coincidence with the ejectile, we observe a direct decay branch revealing the presence of a 3-phonon state in the excitation energy region expected for the triple GQR. Dynamical processes are also studied in the inelastic channel, emphasizing a recently discovered mechanism named towing-mode. We observe for the first time the towing-mode of alpha particles. The energies of multiphonon states in 40 Ca and 208 Pb have been computed microscopically including some anharmonicities via boson mapping methods. The basis of the calculation has been extended to the 3-phonon states. Our results show large anharmonicities (several MeV), due to the coupling of 3-phonon states to 2-phonon states. The extension of the basis to 4-phonon states has been performed for the first time. The inclusion of the 4 phonon states in the calculation did not affect the previous observations concerning the 2-phonon states. Preliminary results on the anharmonicities of the 3-phonon states are presented. (author)

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Testing the interaction between analytical modules: an example with Roundup Ready® soybean line GTS 40-3-2

Directory of Open Access Journals (Sweden)

Bellocchi Gianni

2010-08-01

Full Text Available Abstract Background The modular approach to analysis of genetically modified organisms (GMOs relies on the independence of the modules combined (i.e. DNA extraction and GM quantification. The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS. Different DNA extraction modules (CTAB, Wizard and Dellaporta, were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%] containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts, the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit with a magnetic-beads system (i.e. Wizard.

Ginseng Total Saponins Reverse Corticosterone-Induced Changes in Depression-Like Behavior and Hippocampal Plasticity-Related Proteins by Interfering with GSK-3β-CREB Signaling Pathway

Directory of Open Access Journals (Sweden)

Lin Chen

2014-01-01

Full Text Available This study aimed to explore the antidepressant mechanisms of ginseng total saponins (GTS in the corticosterone-induced mouse depression model. In Experiment 1, GTS (50, 25, and 12.5 mg kg−1 d−1, intragastrically were given for 3 weeks. In Experiment 2, the same doses of GTS were administrated after each corticosterone (20 mg kg−1 d−1, subcutaneously injection for 22 days. In both experiments, mice underwent a forced swimming test and a tail suspension test on day 20 and day 21, respectively, and were sacrificed on day 22. Results of Experiment 1 revealed that GTS (50 and 25 mg kg−1 d−1 exhibited antidepressant activity and not statistically altered hippocampal protein levels of brain-derived neurotrophic factor (BDNF and neurofilament light chain (NF-L. Results of Experiment 2 showed that GTS (50 and 25 mg kg−1 d−1 ameliorated depression-like behavior without normalizing hypercortisolism. The GTS treatments reversed the corticosterone-induced changes in mRNA levels of BDNF and NF-L, and protein levels of BDNF NF-L, phosphor-cAMP response element-binding protein (Ser133, and phosphor-glycogen synthase kinase-3β (Ser9 in the hippocampus. These findings imply that the effect of GTS on corticosterone-induced depression-like behavior may be mediated partly through interfering with hippocampal GSK-3β-CREB signaling pathway and reversing decrease of some plasticity-related proteins.

Comparison of the 26 May 2012 SEP Event with the 3 November 2011 SEP Event

Science.gov (United States)

Makela, P. A.; Gopalswamy, N.; Thakur, N.; Xie, H.

2015-12-01

We compare the solar and interplanetary events associated with two large solar energetic particle (SEP) events on 26 May 2012 and 3 November 2011. Both SEP events were detected at three longitudinally widely separated locations by STEREO A and B spacecraft (more than 100 deg away from Earth) and the Wind and SOHO spacecraft near Earth. In Earth view, the November 2011 eruption occurred far behind the east limb at N09E154, whereas the May 2012 eruption occurred closer to the west limb at N15W121, suggesting that SEPs accelerated during the 2012 event might have easier access to Earth. Even though the 2012 event was more intense in the GOES >10 MeV proton channel (peak intensity 14 pfu) than the 2011 event (peak intensity 4 pfu), we find that the latter event was more intense at higher energies (> 40 MeV). Also, the initial rise at lower energies was slightly faster for the 2011 event as measured by SOHO/ERNE. In addition, the CME associated with the May 2012 event was faster with an estimated space speed of ~2029 km/s than that in the November 2011 event (1188 km/s). STEREO/EUVI images of the associated post-eruption arcades (PEAs) indicate that their orientations were different: the PEA of the May 2012 event had a high inclination (north-south), while the inclination of the PEA of the 2011 event was more moderate. Differences in the flux rope orientation may also have effect on the longitudinal extent of the SEP events. These observations suggest that the dependence of solar proton intensities on the observer's longitudinal distance from the solar source is more complex than traditionally assumed.

Adaptive Sensor Tuning for Seismic Event Detection in Environment with Electromagnetic Noise

Science.gov (United States)

Ziegler, Abra E.

The goal of this research is to detect possible microseismic events at a carbon sequestration site. Data recorded on a continuous downhole microseismic array in the Farnsworth Field, an oil field in Northern Texas that hosts an ongoing carbon capture, utilization, and storage project, were evaluated using machine learning and reinforcement learning techniques to determine their effectiveness at seismic event detection on a dataset with electromagnetic noise. The data were recorded from a passive vertical monitoring array consisting of 16 levels of 3-component 15 Hz geophones installed in the field and continuously recording since January 2014. Electromagnetic and other noise recorded on the array has significantly impacted the utility of the data and it was necessary to characterize and filter the noise in order to attempt event detection. Traditional detection methods using short-term average/long-term average (STA/LTA) algorithms were evaluated and determined to be ineffective because of changing noise levels. To improve the performance of event detection and automatically and dynamically detect seismic events using effective data processing parameters, an adaptive sensor tuning (AST) algorithm developed by Sandia National Laboratories was utilized. AST exploits neuro-dynamic programming (reinforcement learning) trained with historic event data to automatically self-tune and determine optimal detection parameter settings. The key metric that guides the AST algorithm is consistency of each sensor with its nearest neighbors: parameters are automatically adjusted on a per station basis to be more or less sensitive to produce consistent agreement of detections in its neighborhood. The effects that changes in neighborhood configuration have on signal detection were explored, as it was determined that neighborhood-based detections significantly reduce the number of both missed and false detections in ground-truthed data. The performance of the AST algorithm was

Joint Attributes and Event Analysis for Multimedia Event Detection.

Science.gov (United States)

Ma, Zhigang; Chang, Xiaojun; Xu, Zhongwen; Sebe, Nicu; Hauptmann, Alexander G

2017-06-15

Semantic attributes have been increasingly used the past few years for multimedia event detection (MED) with promising results. The motivation is that multimedia events generally consist of lower level components such as objects, scenes, and actions. By characterizing multimedia event videos with semantic attributes, one could exploit more informative cues for improved detection results. Much existing work obtains semantic attributes from images, which may be suboptimal for video analysis since these image-inferred attributes do not carry dynamic information that is essential for videos. To address this issue, we propose to learn semantic attributes from external videos using their semantic labels. We name them video attributes in this paper. In contrast with multimedia event videos, these external videos depict lower level contents such as objects, scenes, and actions. To harness video attributes, we propose an algorithm established on a correlation vector that correlates them to a target event. Consequently, we could incorporate video attributes latently as extra information into the event detector learnt from multimedia event videos in a joint framework. To validate our method, we perform experiments on the real-world large-scale TRECVID MED 2013 and 2014 data sets and compare our method with several state-of-the-art algorithms. The experiments show that our method is advantageous for MED.

Detection of lesions in multiple sclerosis by 2D FLAIR and single-slab 3D FLAIR sequences at 3.0 T: initial results

International Nuclear Information System (INIS)

Bink, Andrea; Gaa, Jochen; Lanfermann, Heinrich; Zanella, Friedhelm E.; Schmitt, Melanie; Mugler, John P.

2006-01-01

The aim of this study was to compare conventional 2D FLAIR and single-slab 3D FLAIR sequences in the detection of lesions in patients with multiple sclerosis. Eight patients with MS were examined at 3.0 T by using a 2D FLAIR sequence and a single-slab 3D FLAIR sequence. A comparison of lesion detectability was performed for the following regions: periventricular, nonperiventricular/juxtacortical and infratentorial. The contrast-to-noise ratios (CNRs) between lesions and brain tissue and CSF were calculated for each sequence. A total of 424 lesions were found using the 2D FLAIR sequence, while with the 3D FLAIR sequence 719 lesions were found. With the 2D FLAIR sequence, 41% fewer lesions were detected than with the 3D FLAIR sequence. Further, 40% fewer supratentorial and 62.5% fewer infratentorial lesions were found with the 2D FLAIR sequence. In images acquired with the 3D FLAIR sequence, the lesions had significantly higher CNRs than in images acquired with the 2D FLAIR sequence. These are the first results using a single-slab 3D FLAIR sequence at 3.0 T for detection of lesions in patients with MS. With the 3D FLAIR sequence significantly higher CNRs were achieved and significantly more lesions in patients with MS were detected. (orig.)

The Nemertine Toxin Anabaseine and Its Derivative DMXBA (GTS-21: Chemical and Pharmacological Properties

Directory of Open Access Journals (Sweden)

Hugo R. Arias

2006-04-01

Full Text Available Abstract: Nemertines are a phylum of carnivorous marine worms that possess a variety of alkaloidal, peptidic or proteinaceous toxins that serve as chemical defenses against potential predators. The hoplonemertines additionally envenomate their prey with a mixture of proboscis alkaloids delivered with the help of a calcareous stylet that punctures the skin of the victim. Anabaseine, the first of these alkaloids to be identified, stimulates a wide variety of animal nicotinic acetylcholine receptors (AChRs, especially the neuromuscular [e.g., α12β1γδ (embryogenic or α12β1γε (adult] and α7 AChRs that are inhibited by the snake peptide α-bungarotoxin. A synthetic derivative, 3-(2,4-Dimethoxybenzylidene-Anabaseine (DMXBA; also called GTS-21, improves memory in experimental animals and humans and is currently in clinical trials to determine whether it can ameliorate cognitive problems associated with schizophrenia. Here we summarize present knowledge concerning the chemistry and mechanisms of action of these two substances (anabaseine and DMXBA on AChRs, especially those found in the mammalian brain.

Statistical improvement in detection level of gravitational microlensing events from their light curves

Science.gov (United States)

Ibrahim, Ichsan; Malasan, Hakim L.; Kunjaya, Chatief; Timur Jaelani, Anton; Puannandra Putri, Gerhana; Djamal, Mitra

2018-04-01

In astronomy, the brightness of a source is typically expressed in terms of magnitude. Conventionally, the magnitude is defined by the logarithm of received flux. This relationship is known as the Pogson formula. For received flux with a small signal to noise ratio (S/N), however, the formula gives a large magnitude error. We investigate whether the use of Inverse Hyperbolic Sine function (hereafter referred to as the Asinh magnitude) in the modified formulae could allow for an alternative calculation of magnitudes for small S/N flux, and whether the new approach is better for representing the brightness of that region. We study the possibility of increasing the detection level of gravitational microlensing using 40 selected microlensing light curves from the 2013 and 2014 seasons and by using the Asinh magnitude. Photometric data of the selected events are obtained from the Optical Gravitational Lensing Experiment (OGLE). We found that utilization of the Asinh magnitude makes the events brighter compared to using the logarithmic magnitude, with an average of about 3.42 × 10‑2 magnitude and an average in the difference of error between the logarithmic and the Asinh magnitude of about 2.21 × 10‑2 magnitude. The microlensing events OB140847 and OB140885 are found to have the largest difference values among the selected events. Using a Gaussian fit to find the peak for OB140847 and OB140885, we conclude statistically that the Asinh magnitude gives better mean squared values of the regression and narrower residual histograms than the Pogson magnitude. Based on these results, we also attempt to propose a limit in magnitude value for which use of the Asinh magnitude is optimal with small S/N data.

Crystalline structure and XMCD studies of Co40Fe40B20 grown on Bi2Te3, BiTeI and Bi2Se3

OpenAIRE

Kaveev, A. K.; Sokolov, N. S.; Suturin, S. M.; Zhiltsov, N. S.; Golyashov, V. A.; Tereshchenko, O. E.; Prosvirin, I. P.; Kokh, K. A.; Sawada, M.

2018-01-01

Epitaxial films of Co40Fe40B20 (further - CoFeB) were grown on Bi2Te3(001) and Bi2Se3(001) substrates by laser molecular beam epitaxy (LMBE) technique at 200-400C. Bcc-type crystalline structure of CoFeB with (111) plane parallel to (001) plane of Bi2Te3 was observed, in contrast to polycrystalline CoFeB film formed on Bi2Se3(001) at RT using high-temperature seeding layer. Therefore, structurally ordered ferromagnetic thin films were obtained on the topological insulator surface for the firs...

Hot corrosion performance of LVOF sprayed Al2O3–40% TiO2 ...

Indian Academy of Sciences (India)

ficients of thermal expansions of the two. ... size 40 mesh just prior to deposition of the coating. Al2O3–. 40% TiO2 ... the laboratory Kanthal wire tube furnace, which was cali- ... formation of TiO2, Al2O3 and Al2Ti7O15 phases in the coat- ing.

Reactive GTS Allocation Protocol for Sporadic Events Using the IEEE 802.15.4

Directory of Open Access Journals (Sweden)

Mukhtar Azeem

2014-01-01

by the IEEE 802.15.4 standard. The proposed control protocol ensures that a given offline sporadic schedule can be adapted online in a timely manner such that the static periodic schedule has not been disturbed and the IEEE 802.15.4 standard compliance remains intact. The proposed protocol is simulated in OPNET. The simulation results are analyzed and presented in this paper to prove the correctness of the proposed protocol regarding the efficient real-time sporadic event delivery along with the periodic event propagation.

Cartan invariants and event horizon detection

Science.gov (United States)

Brooks, D.; Chavy-Waddy, P. C.; Coley, A. A.; Forget, A.; Gregoris, D.; MacCallum, M. A. H.; McNutt, D. D.

2018-04-01

We show that it is possible to locate the event horizon of a black hole (in arbitrary dimensions) by the zeros of certain Cartan invariants. This approach accounts for the recent results on the detection of stationary horizons using scalar polynomial curvature invariants, and improves upon them since the proposed method is computationally less expensive. As an application, we produce Cartan invariants that locate the event horizons for various exact four-dimensional and five-dimensional stationary, asymptotically flat (or (anti) de Sitter), black hole solutions and compare the Cartan invariants with the corresponding scalar curvature invariants that detect the event horizon.

Event Coverage Detection and Event Source Determination in Underwater Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

Zhangbing Zhou

2015-12-01

Full Text Available With the advent of the Internet of Underwater Things, smart things are deployed in the ocean space and establish underwater wireless sensor networks for the monitoring of vast and dynamic underwater environments. When events are found to have possibly occurred, accurate event coverage should be detected, and potential event sources should be determined for the enactment of prompt and proper responses. To address this challenge, a technique that detects event coverage and determines event sources is developed in this article. Specifically, the occurrence of possible events corresponds to a set of neighboring sensor nodes whose sensory data may deviate from a normal sensing range in a collective fashion. An appropriate sensor node is selected as the relay node for gathering and routing sensory data to sink node(s. When sensory data are collected at sink node(s, the event coverage is detected and represented as a weighted graph, where the vertices in this graph correspond to sensor nodes and the weight specified upon the edges reflects the extent of sensory data deviating from a normal sensing range. Event sources are determined, which correspond to the barycenters in this graph. The results of the experiments show that our technique is more energy efficient, especially when the network topology is relatively steady.

Machine learning for the automatic detection of anomalous events

Science.gov (United States)

Fisher, Wendy D.

In this dissertation, we describe our research contributions for a novel approach to the application of machine learning for the automatic detection of anomalous events. We work in two different domains to ensure a robust data-driven workflow that could be generalized for monitoring other systems. Specifically, in our first domain, we begin with the identification of internal erosion events in earth dams and levees (EDLs) using geophysical data collected from sensors located on the surface of the levee. As EDLs across the globe reach the end of their design lives, effectively monitoring their structural integrity is of critical importance. The second domain of interest is related to mobile telecommunications, where we investigate a system for automatically detecting non-commercial base station routers (BSRs) operating in protected frequency space. The presence of non-commercial BSRs can disrupt the connectivity of end users, cause service issues for the commercial providers, and introduce significant security concerns. We provide our motivation, experimentation, and results from investigating a generalized novel data-driven workflow using several machine learning techniques. In Chapter 2, we present results from our performance study that uses popular unsupervised clustering algorithms to gain insights to our real-world problems, and evaluate our results using internal and external validation techniques. Using EDL passive seismic data from an experimental laboratory earth embankment, results consistently show a clear separation of events from non-events in four of the five clustering algorithms applied. Chapter 3 uses a multivariate Gaussian machine learning model to identify anomalies in our experimental data sets. For the EDL work, we used experimental data from two different laboratory earth embankments. Additionally, we explore five wavelet transform methods for signal denoising. The best performance is achieved with the Haar wavelets. We achieve up to 97.3

Subsurface event detection and classification using Wireless Signal Networks.

Science.gov (United States)

Yoon, Suk-Un; Ghazanfari, Ehsan; Cheng, Liang; Pamukcu, Sibel; Suleiman, Muhannad T

2012-11-05

Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs). The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.

Water Remedial Investigation Report, Version 3.3. Volume 3

Science.gov (United States)

1989-07-01

26084 ,.6085,26086, .6088,61627,26129 ,261.3,26.0 ,2 142 ,2 1147 27 27001 , 27002�, 27005, 27016, 27024, 27026, 27028, 27030, 27031, 27040, 27049...0.115 - 1.220 0 -- 2, Confined 28 1 0.058 I 40.300 3, Unconfined 4 0 -- 0 -- 3, Confined 20 I 0.162 I ɘ ISO 4, Unconfined 0 0 -- 0 -- 4, Confined 19...monitoring event in Sections 2, 23, 24, 27 and 34, and in the northern off-post area (Figure 4.2-8). These iso !-ted detections, except for those noted in

Increased Detection of Lymphatic Vessel Invasion by D2-40 (Podoplanin) in Early Breast Cancer: Possible Influence on Patient Selection for Accelerated Partial Breast Irradiation

International Nuclear Information System (INIS)

Debald, Manuel; Poelcher, Martin; Flucke, Uta; Walgenbach-Bruenagel, Gisela

2010-01-01

Purpose: Several international trials are currently investigating accelerated partial breast irradiation (APBI) for patients with early-stage breast cancer. According to existing guidelines, patients with lymphatic vessel invasion (LVI) do not qualify for APBI. D2-40 (podoplanin) significantly increases the frequency of LVI detection compared with conventional hematoxylin and eosin (HE) staining in early-stage breast cancer. Our purpose was to retrospectively assess the hypothetical change in management from APBI to whole breast radiotherapy with the application of D2-40. Patients and Methods: Immunostaining with D2-40 was performed on 254 invasive breast tumors of 247 patients. The following criteria were used to determine the eligibility for APBI: invasive ductal adenocarcinoma of ≤3 cm, negative axillary node status (N0), and unifocal disease. Of the 247 patients, 74 with available information concerning LVI, as detected by D2-40 immunostaining and routine HE staining, formed our study population. Results: Using D2-40, our results demonstrated a significantly greater detection rate (p = .031) of LVI compared with routine HE staining. LVI was correctly identified by D2-40 (D2-40-positive LVI) in 10 (13.5%) of 74 tumors. On routine HE staining, 4 tumors (5.4%) were classified as HE-positive LVI. Doublestaining of these specimens with D2-40 unmasked false-positive LVI status in 2 (50%) of the 4 tumors. According to the current recommendations for APBI, immunostaining with D2-40 would have changed the clinical management from APBI to whole breast radiotherapy in 8 (10.8%) of 74 patients and from whole breast radiotherapy to APBI in 2 patients (2.7%). Conclusion: These data support the implementation of D2-40 immunostaining in the routine workup to determine a patient's eligibility for APBI.

A detector module with highly efficient surface-alpha event rejection operated in CRESST-II Phase 2

Energy Technology Data Exchange (ETDEWEB)

Strauss, R. [Max-Planck-Institut fuer Physik, Munich (Germany); Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Angloher, G.; Ferreiro, N.; Hauff, D.; Kiefer, M.; Petricca, F.; Proebst, F.; Reindl, F.; Seidel, W.; Stodolsky, L.; Tanzke, A.; Wuestrich, M. [Max-Planck-Institut fuer Physik, Munich (Germany); Bento, A. [Universidade de Coimbra, CIUC, Departamento de Fisica, Coimbra (Portugal); Bucci, C.; Canonica, L.; Gorla, P.; Schaeffner, K. [Laboratori Nazionali del Gran Sasso, INFN, Assergi (Italy); Erb, A. [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Walther-Meissner-Institut fuer Tieftemperaturforschung, Garching (Germany); Feilitzsch, F. von; Guetlein, A.; Lanfranchi, J.C.; Muenster, A.; Potzel, W.; Roth, S.; Schoenert, S.; Stanger, M.; Ulrich, A.; Wawoczny, S.; Willers, M.; Zoeller, A. [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Jochum, J.; Loebell, J.; Rottler, K.; Sailer, C.; Scholl, S.; Strandhagen, C.; Uffinger, M.; Usherov, I. [Eberhard-Karls-Universitaet Tuebingen, Physikalisches Institut, Tuebingen (Germany); Kluck, H. [Institut fuer Hochenergiephysik der Oesterreichischen Akademie der Wissenschaften, Wien (Austria); Vienna University of Technology, Atominstitut, Wien (Austria); Kraus, H. [University of Oxford, Department of Physics, Oxford (United Kingdom); Schieck, J. [Institut fuer Hochenergiephysik der Oesterreichischen Akademie der Wissenschaften, Wien (Austria); Sivers, M. von [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Bern (Switzerland)

2015-08-15

The cryogenic dark matter experiment CRESSTII aims at the direct detection of WIMPs via elastic scattering off nuclei in scintillating CaWO{sub 4} crystals. We present a new, highly improved, detector design installed in the current run of CRESST-II Phase 2 with an efficient active rejection of surface-alpha backgrounds. Using CaWO{sub 4} sticks instead of metal clamps to hold the target crystal, a detector housing with fully-scintillating inner surface could be realized. The presented detector (TUM40) provides an excellent threshold of ∝0.60 keV and a resolution of σ ∼ 0.090 keV (at 2.60 keV).With significantly reduced background levels, TUM40 sets stringent limits on the spin-independent WIMP nucleon scattering cross section and probes a new region of parameter space for WIMP masses below 3GeV/c{sup 2}. In this paper, we discuss the novel detector design and the surface-alpha event rejection in detail. (orig.)

Detection of anomalous events

Science.gov (United States)

Ferragut, Erik M.; Laska, Jason A.; Bridges, Robert A.

2016-06-07

A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The system can include a plurality of anomaly detectors that together implement an algorithm to identify low-probability events and detect atypical traffic patterns. The anomaly detector provides for comparability of disparate sources of data (e.g., network flow data and firewall logs.) Additionally, the anomaly detector allows for regulatability, meaning that the algorithm can be user configurable to adjust a number of false alerts. The anomaly detector can be used for a variety of probability density functions, including normal Gaussian distributions, irregular distributions, as well as functions associated with continuous or discrete variables.

The association of colonoscopy quality indicators with the detection of screen-relevant lesions, adverse events, and postcolonoscopy cancers in an asymptomatic Canadian colorectal cancer screening population.

Science.gov (United States)

Hilsden, Robert J; Dube, Catherine; Heitman, Steven J; Bridges, Ronald; McGregor, S Elizabeth; Rostom, Alaa

2015-11-01

Although several quality indicators of colonoscopy have been defined, quality assurance activities should be directed at the measurement of quality indicators that are predictive of key screening colonoscopy outcomes. The goal of this study was to examine the association among established quality indicators and the detection of screen-relevant lesions (SRLs), adverse events, and postcolonoscopy cancers. Historical cohort study. Canadian colorectal cancer screening center. A total of 18,456 asymptomatic men and women ages 40 to 74, at either average risk or increased risk for colorectal cancer because of a family history, who underwent a screening colonoscopy from 2008 to 2010. Using univariate and multivariate analyses, we explored the association among procedural quality indicators and 3 colonoscopy outcomes: detection of SRLs, adverse events, and postcolonoscopy cancers. The crude rates of SRLs, adverse events, and postcolonoscopy cancers were 240, 6.44, and .54 per 1000 colonoscopies, respectively. Several indicators, including endoscopist withdrawal time (OR, 1.3; 95% CI, 1.2-1.4) and cecal intubation rate (OR, 13.9; 95% CI, 1.9-96.9), were associated with the detection of SRLs. No quality indicator was associated with the risk of adverse events. Endoscopist average withdrawal time over 6 minutes (OR, .12; 95% CI, .002-.85) and SRL detection rate over 20% (OR, .17; 95% CI, .03-.74) were associated with a reduced risk of postcolonoscopy cancers. Single-center study. Quality assurance programs should prioritize the measurement of endoscopist average withdrawal time and adenoma (SRL) detection rate. Copyright © 2015 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.

40 CFR 721.3031 - Boric acid (H3BO3), zinc salt (2=3).

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Boric acid (H3BO3), zinc salt (2=3). 721.3031 Section 721.3031 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.3031 Boric acid (H3BO...

Subsurface Event Detection and Classification Using Wireless Signal Networks

Directory of Open Access Journals (Sweden)

Muhannad T. Suleiman

2012-11-01

Full Text Available Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs. The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.

On-line detection of apnea/hypopnea events using SpO2 signal: a rule-based approach employing binary classifier models.

Science.gov (United States)

Koley, Bijoy Laxmi; Dey, Debangshu

2014-01-01

This paper presents an online method for automatic detection of apnea/hypopnea events, with the help of oxygen saturation (SpO2) signal, measured at fingertip by Bluetooth nocturnal pulse oximeter. Event detection is performed by identifying abnormal data segments from the recorded SpO2 signal, employing a binary classifier model based on a support vector machine (SVM). Thereafter the abnormal segment is further analyzed to detect different states within the segment, i.e., steady, desaturation, and resaturation, with the help of another SVM-based binary ensemble classifier model. Finally, a heuristically obtained rule-based system is used to identify the apnea/hypopnea events from the time-sequenced decisions of these classifier models. In the developmental phase, a set of 34 time domain-based features was extracted from the segmented SpO2 signal using an overlapped windowing technique. Later, an optimal set of features was selected on the basis of recursive feature elimination technique. A total of 34 subjects were included in the study. The results show average event detection accuracies of 96.7% and 93.8% for the offline and the online tests, respectively. The proposed system provides direct estimation of the apnea/hypopnea index with the help of a relatively inexpensive and widely available pulse oximeter. Moreover, the system can be monitored and accessed by physicians through LAN/WAN/Internet and can be extended to deploy in Bluetooth-enabled mobile phones.

Secondary scintillation yield of xenon with sub-percent levels of CO2 additive for rare-event detection

Science.gov (United States)

Henriques, C. A. O.; Freitas, E. D. C.; Azevedo, C. D. R.; González-Díaz, D.; Mano, R. D. P.; Jorge, M. R.; Fernandes, L. M. P.; Monteiro, C. M. B.; Gómez-Cadenas, J. J.; Álvarez, V.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carríon, J. V.; Cebrían, S.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Esteve, R.; Felkai, R.; Ferrario, P.; Ferreira, A. L.; Goldschmidt, A.; Gutiérrez, R. M.; Hauptman, J.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Jones, B. J. P.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; McDonald, A. D.; Monrabal, F.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Nygren, D. R.; Palmeiro, B.; Para, A.; Pérez, J.; Querol, M.; Renner, J.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Webb, R.; White, J. T.; Yahlali, N.; NEXT Collaboration

2017-10-01

Xe-CO2 mixtures are important alternatives to pure xenon in Time Projection Chambers (TPC) based on secondary scintillation (electroluminescence) signal amplification with applications in the important field of rare event detection such as directional dark matter, double electron capture and double beta decay detection. The addition of CO2 to pure xenon at the level of 0.05-0.1% can reduce significantly the scale of electron diffusion from 10 mm /√{m} to 2.5 mm /√{m}, with high impact on the discrimination efficiency of the events through pattern recognition of the topology of primary ionization trails. We have measured the electroluminescence (EL) yield of Xe-CO2 mixtures, with sub-percent CO2 concentrations. We demonstrate that the EL production is still high in these mixtures, 70% and 35% relative to that produced in pure xenon, for CO2 concentrations around 0.05% and 0.1%, respectively. The contribution of the statistical fluctuations in EL production to the energy resolution increases with increasing CO2 concentration, being smaller than the contribution of the Fano factor for concentrations below 0.1% CO2.

The sequentially discounting autoregressive (SDAR) method for on-line automatic seismic event detecting on long term observation

Science.gov (United States)

Wang, L.; Toshioka, T.; Nakajima, T.; Narita, A.; Xue, Z.

2017-12-01

In recent years, more and more Carbon Capture and Storage (CCS) studies focus on seismicity monitoring. For the safety management of geological CO2 storage at Tomakomai, Hokkaido, Japan, an Advanced Traffic Light System (ATLS) combined different seismic messages (magnitudes, phases, distributions et al.) is proposed for injection controlling. The primary task for ATLS is the seismic events detection in a long-term sustained time series record. Considering the time-varying characteristics of Signal to Noise Ratio (SNR) of a long-term record and the uneven energy distributions of seismic event waveforms will increase the difficulty in automatic seismic detecting, in this work, an improved probability autoregressive (AR) method for automatic seismic event detecting is applied. This algorithm, called sequentially discounting AR learning (SDAR), can identify the effective seismic event in the time series through the Change Point detection (CPD) of the seismic record. In this method, an anomaly signal (seismic event) can be designed as a change point on the time series (seismic record). The statistical model of the signal in the neighborhood of event point will change, because of the seismic event occurrence. This means the SDAR aims to find the statistical irregularities of the record thought CPD. There are 3 advantages of SDAR. 1. Anti-noise ability. The SDAR does not use waveform messages (such as amplitude, energy, polarization) for signal detecting. Therefore, it is an appropriate technique for low SNR data. 2. Real-time estimation. When new data appears in the record, the probability distribution models can be automatic updated by SDAR for on-line processing. 3. Discounting property. the SDAR introduces a discounting parameter to decrease the influence of present statistic value on future data. It makes SDAR as a robust algorithm for non-stationary signal processing. Within these 3 advantages, the SDAR method can handle the non-stationary time-varying long

Rubrofusarin from Aspergillus niger GTS01-4 and its biological activity

Science.gov (United States)

Megawati, Dewi, Rizna Triana; Mulyani, Hanny; Maryani, Faiza; Lotullung, Puspa Dewi N.; Minarti

2017-01-01

During the research for bioactive secondary metabolites from microorganisms, the terestrial fungi Aspergillus niger GTS01-4 has been investigated for the evaluation of antimicrobial and cytotoxic activities using brine shrimp (Artemia salina) lethality test and MCF-7 cell line. Further chromatographic separation and purification of myselium extract resulted in the isolation identified as rubrofusarin (1). The structure elucidation of isolated compound was performed using 1D-NMR, and LCMS. Furthermore, the cytotoxicity of rubrofusarin (1) was evaluated and resulted with IC50 of 11.51 µg/mL against MCF-7 and LC50 of 368.11 µg/mL against brine shrimp, respectively. However, rubrofusarin (1) showed moderate activity against E. coli, S. aureus, and B. subtilis compared to standard antibiotic, streptomycin. The average zone of inhibition was ranged from 6 to 8 mm at a concentration of 100 µg/disc. These results suggest that rubrofusarin could be a potential candidate in the field of anticancer drug discovery from terrestrial fungi.

Event storm detection and identification in communication systems

International Nuclear Information System (INIS)

Albaghdadi, Mouayad; Briley, Bruce; Evens, Martha

2006-01-01

Event storms are the manifestation of an important class of abnormal behaviors in communication systems. They occur when a large number of nodes throughout the system generate a set of events within a small period of time. It is essential for network management systems to detect every event storm and identify its cause, in order to prevent and repair potential system faults. This paper presents a set of techniques for the effective detection and identification of event storms in communication systems. First, we introduce a new algorithm to synchronize events to a single node in the system. Second, the system's event log is modeled as a normally distributed random process. This is achieved by using data analysis techniques to explore and then model the statistical behavior of the event log. Third, event storm detection is proposed using a simple test statistic combined with an exponential smoothing technique to overcome the non-stationary behavior of event logs. Fourth, the system is divided into non-overlapping regions to locate the main contributing regions of a storm. We show that this technique provides us with a method for event storm identification. Finally, experimental results from a commercially deployed multimedia communication system that uses these techniques demonstrate their effectiveness

Metrics for Polyphonic Sound Event Detection

Directory of Open Access Journals (Sweden)

Annamaria Mesaros

2016-05-01

Full Text Available This paper presents and discusses various metrics proposed for evaluation of polyphonic sound event detection systems used in realistic situations where there are typically multiple sound sources active simultaneously. The system output in this case contains overlapping events, marked as multiple sounds detected as being active at the same time. The polyphonic system output requires a suitable procedure for evaluation against a reference. Metrics from neighboring fields such as speech recognition and speaker diarization can be used, but they need to be partially redefined to deal with the overlapping events. We present a review of the most common metrics in the field and the way they are adapted and interpreted in the polyphonic case. We discuss segment-based and event-based definitions of each metric and explain the consequences of instance-based and class-based averaging using a case study. In parallel, we provide a toolbox containing implementations of presented metrics.

Improved quantification accuracy for duplex real-time PCR detection of genetically modified soybean and maize in heat processed foods

Directory of Open Access Journals (Sweden)

CHENG Fang

2013-04-01

Full Text Available Real-time PCR technique has been widely used in quantitative GMO detection in recent years.The accuracy of GMOs quantification based on the real-time PCR methods is still a difficult problem,especially for the quantification of high processed samples.To develop the suitable and accurate real-time PCR system for high processed GM samples,we made ameliorations to several real-time PCR parameters,including re-designed shorter target DNA fragment,similar lengths of amplified endogenous and exogenous gene targets,similar GC contents and melting temperatures of PCR primers and TaqMan probes.Also,one Heat-Treatment Processing Model (HTPM was established using soybean flour samples containing GM soybean GTS 40-3-2 to validate the effectiveness of the improved real-time PCR system.Tested results showed that the quantitative bias of GM content in heat processed samples were lowered using the new PCR system.The improved duplex real-time PCR was further validated using processed foods derived from GM soybean,and more accurate GM content values in these foods was also achieved.These results demonstrated that the improved duplex real-time PCR would be quite suitable in quantitative detection of high processed food products.

The value of positive Oct3/4 and D2-40 immunohistochemical expression in prediction of germ cell neoplasia in prepubertal boys with cryptorchidism

DEFF Research Database (Denmark)

Clasen-Linde, Erik; Kvist, Kolja; Cortes, Dina

2016-01-01

, where most orchiopexies are performed. The aim of the study was to evaluate the ability of Oct3/4 and D2-40 immunohistochemical markers to detect ITGCN in boys older than 2 years with cryptorchidism. MATERIALS AND METHODS: Histological sections from 309 testicular biopsies from 234 boys aged 1 month...... to 14 years, 6 months operated on for cryptorchidism were incubated with primary antibodies including anti-placental-like alkaline phosphatase, anti-Oct3/4, anti-C-kit and anti-D2-40 receptor. RESULTS: One 3-year, 8-month-old boy with 45X/46XY disorder of sexual development had ITGCN and all positive...... markers. Besides this case, none of the 192 testes except one from boys older than 2 years had any Oct3/4- or D2-40-positive germ cells identified. The germ cells of the right testis from a 3-year, 7-month-old boy had weak Oct3/4 expression but were D2-40 negative. The prevalences of Oct3/4- and D2...

Is detection of adverse events affected by record review methodology? an evaluation of the "Harvard Medical Practice Study" method and the "Global Trigger Tool".

Science.gov (United States)

Unbeck, Maria; Schildmeijer, Kristina; Henriksson, Peter; Jürgensen, Urban; Muren, Olav; Nilsson, Lena; Pukk Härenstam, Karin

2013-04-15

There has been a theoretical debate as to which retrospective record review method is the most valid, reliable, cost efficient and feasible for detecting adverse events. The aim of the present study was to evaluate the feasibility and capability of two common retrospective record review methods, the "Harvard Medical Practice Study" method and the "Global Trigger Tool" in detecting adverse events in adult orthopaedic inpatients. We performed a three-stage structured retrospective record review process in a random sample of 350 orthopaedic admissions during 2009 at a Swedish university hospital. Two teams comprised each of a registered nurse and two physicians were assigned, one to each method. All records were primarily reviewed by registered nurses. Records containing a potential adverse event were forwarded to physicians for review in stage 2. Physicians made an independent review regarding, for example, healthcare causation, preventability and severity. In the third review stage all adverse events that were found with the two methods together were compared and all discrepancies after review stage 2 were analysed. Events that had not been identified by one of the methods in the first two review stages were reviewed by the respective physicians. Altogether, 160 different adverse events were identified in 105 (30.0%) of the 350 records with both methods combined. The "Harvard Medical Practice Study" method identified 155 of the 160 (96.9%, 95% CI: 92.9-99.0) adverse events in 104 (29.7%) records compared with 137 (85.6%, 95% CI: 79.2-90.7) adverse events in 98 (28.0%) records using the "Global Trigger Tool". Adverse events "causing harm without permanent disability" accounted for most of the observed difference. The overall positive predictive value for criteria and triggers using the "Harvard Medical Practice Study" method and the "Global Trigger Tool" was 40.3% and 30.4%, respectively. More adverse events were identified using the "Harvard Medical Practice Study

Complexity of deciding detectability in discrete event systems

Czech Academy of Sciences Publication Activity Database

Masopust, Tomáš

2018-01-01

Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer science s, information science , bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www. science direct.com/ science /article/pii/S0005109818301730

Complexity of deciding detectability in discrete event systems

Czech Academy of Sciences Publication Activity Database

Masopust, Tomáš

2018-01-01

Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www.sciencedirect.com/science/article/pii/S0005109818301730

Abnormal Event Detection in Wireless Sensor Networks Based on Multiattribute Correlation

Directory of Open Access Journals (Sweden)

Mengdi Wang

2017-01-01

Full Text Available Abnormal event detection is one of the vital tasks in wireless sensor networks. However, the faults of nodes and the poor deployment environment have brought great challenges to abnormal event detection. In a typical event detection technique, spatiotemporal correlations are collected to detect an event, which is susceptible to noises and errors. To improve the quality of detection results, we propose a novel approach for abnormal event detection in wireless sensor networks. This approach considers not only spatiotemporal correlations but also the correlations among observed attributes. A dependency model of observed attributes is constructed based on Bayesian network. In this model, the dependency structure of observed attributes is obtained by structure learning, and the conditional probability table of each node is calculated by parameter learning. We propose a new concept named attribute correlation confidence to evaluate the fitting degree between the sensor reading and the abnormal event pattern. On the basis of time correlation detection and space correlation detection, the abnormal events are identified. Experimental results show that the proposed algorithm can reduce the impact of interference factors and the rate of the false alarm effectively; it can also improve the accuracy of event detection.

An Unsupervised Anomalous Event Detection and Interactive Analysis Framework for Large-scale Satellite Data

Science.gov (United States)

LIU, Q.; Lv, Q.; Klucik, R.; Chen, C.; Gallaher, D. W.; Grant, G.; Shang, L.

2016-12-01

Due to the high volume and complexity of satellite data, computer-aided tools for fast quality assessments and scientific discovery are indispensable for scientists in the era of Big Data. In this work, we have developed a framework for automated anomalous event detection in massive satellite data. The framework consists of a clustering-based anomaly detection algorithm and a cloud-based tool for interactive analysis of detected anomalies. The algorithm is unsupervised and requires no prior knowledge of the data (e.g., expected normal pattern or known anomalies). As such, it works for diverse data sets, and performs well even in the presence of missing and noisy data. The cloud-based tool provides an intuitive mapping interface that allows users to interactively analyze anomalies using multiple features. As a whole, our framework can (1) identify outliers in a spatio-temporal context, (2) recognize and distinguish meaningful anomalous events from individual outliers, (3) rank those events based on "interestingness" (e.g., rareness or total number of outliers) defined by users, and (4) enable interactively query, exploration, and analysis of those anomalous events. In this presentation, we will demonstrate the effectiveness and efficiency of our framework in the application of detecting data quality issues and unusual natural events using two satellite datasets. The techniques and tools developed in this project are applicable for a diverse set of satellite data and will be made publicly available for scientists in early 2017.

Learning Multimodal Deep Representations for Crowd Anomaly Event Detection

Directory of Open Access Journals (Sweden)

Shaonian Huang

2018-01-01

Full Text Available Anomaly event detection in crowd scenes is extremely important; however, the majority of existing studies merely use hand-crafted features to detect anomalies. In this study, a novel unsupervised deep learning framework is proposed to detect anomaly events in crowded scenes. Specifically, low-level visual features, energy features, and motion map features are simultaneously extracted based on spatiotemporal energy measurements. Three convolutional restricted Boltzmann machines are trained to model the mid-level feature representation of normal patterns. Then a multimodal fusion scheme is utilized to learn the deep representation of crowd patterns. Based on the learned deep representation, a one-class support vector machine model is used to detect anomaly events. The proposed method is evaluated using two available public datasets and compared with state-of-the-art methods. The experimental results show its competitive performance for anomaly event detection in video surveillance.

Detection of planets in extremely weak central perturbation microlensing events via next-generation ground-based surveys

International Nuclear Information System (INIS)

Chung, Sun-Ju; Lee, Chung-Uk; Koo, Jae-Rim

2014-01-01

Even though the recently discovered high-magnification event MOA-2010-BLG-311 had complete coverage over its peak, confident planet detection did not happen due to extremely weak central perturbations (EWCPs, fractional deviations of ≲ 2%). For confident detection of planets in EWCP events, it is necessary to have both high cadence monitoring and high photometric accuracy better than those of current follow-up observation systems. The next-generation ground-based observation project, Korea Microlensing Telescope Network (KMTNet), satisfies these conditions. We estimate the probability of occurrence of EWCP events with fractional deviations of ≤2% in high-magnification events and the efficiency of detecting planets in the EWCP events using the KMTNet. From this study, we find that the EWCP events occur with a frequency of >50% in the case of ≲ 100 M E planets with separations of 0.2 AU ≲ d ≲ 20 AU. We find that for main-sequence and sub-giant source stars, ≳ 1 M E planets in EWCP events with deviations ≤2% can be detected with frequency >50% in a certain range that changes with the planet mass. However, it is difficult to detect planets in EWCP events of bright stars like giant stars because it is easy for KMTNet to be saturated around the peak of the events because of its constant exposure time. EWCP events are caused by close, intermediate, and wide planetary systems with low-mass planets and close and wide planetary systems with massive planets. Therefore, we expect that a much greater variety of planetary systems than those already detected, which are mostly intermediate planetary systems, regardless of the planet mass, will be significantly detected in the near future.

Repetitive behaviours in patients with Gilles de la Tourette syndrome: tics, compulsions, or both?

Science.gov (United States)

Worbe, Yulia; Mallet, Luc; Golmard, Jean-Louis; Béhar, Cécile; Durif, Franck; Jalenques, Isabelle; Damier, Philippe; Derkinderen, Pascal; Pollak, Pierre; Anheim, Mathieu; Broussolle, Emannuel; Xie, Jing; Mesnage, Valérie; Mondon, Karl; Viallet, François; Jedynak, Pierre; Ben Djebara, Mouna; Schüpbach, Michael; Pelissolo, Antoine; Vidailhet, Marie; Agid, Yves; Houeto, Jean-Luc; Hartmann, Andreas

2010-09-24

Repetitive behaviours (RB) in patients with Gilles de la Tourette syndrome (GTS) are frequent. However, a controversy persists whether they are manifestations of obsessive-compulsive disorder (OCD) or correspond to complex tics. 166 consecutive patients with GTS aged 15-68 years were recruited and submitted to extensive neurological, psychiatric and psychological evaluations. RB were evaluated by the YBOCS symptom checklist and Mini International Neuropsychiatric Interview (M.I.N.I), and classified on the basis of a semi-directive psychiatric interview as compulsions or tics. RB were present in 64.4% of patients with GTS (107/166) and categorised into 3 major groups: a 'tic-like' group (24.3%-40/166) characterised by RB such as touching, counting, 'just right' and symmetry searching; an 'OCD-like' group (20.5%-34/166) with washing and checking rituals; and a 'mixed' group (13.2%-22/166) with both 'tics-like' and 'OCD-like' types of RB present in the same patient. In 6.3% of patients, RB could not be classified into any of these groups and were thus considered 'undetermined'. The results confirm the phenomenological heterogeneity of RB in GTS patients and allows to distinguish two types: tic-like behaviours which are very likely an integral part of GTS; and OCD-like behaviours, which can be considered as a comorbid condition of GTS and were correlated with higher score of complex tics, neuroleptic and SSRIs treatment frequency and less successful socio-professional adaptation. We suggest that a meticulous semiological analysis of RB in GTS patients will help to tailor treatment and allow to better classify patients for future pathophysiologic studies. ClinicalTrials.gov NCT00169351.

Repetitive behaviours in patients with Gilles de la Tourette syndrome: tics, compulsions, or both?

Directory of Open Access Journals (Sweden)

Yulia Worbe

2010-09-01

Full Text Available Repetitive behaviours (RB in patients with Gilles de la Tourette syndrome (GTS are frequent. However, a controversy persists whether they are manifestations of obsessive-compulsive disorder (OCD or correspond to complex tics.166 consecutive patients with GTS aged 15-68 years were recruited and submitted to extensive neurological, psychiatric and psychological evaluations. RB were evaluated by the YBOCS symptom checklist and Mini International Neuropsychiatric Interview (M.I.N.I, and classified on the basis of a semi-directive psychiatric interview as compulsions or tics.RB were present in 64.4% of patients with GTS (107/166 and categorised into 3 major groups: a 'tic-like' group (24.3%-40/166 characterised by RB such as touching, counting, 'just right' and symmetry searching; an 'OCD-like' group (20.5%-34/166 with washing and checking rituals; and a 'mixed' group (13.2%-22/166 with both 'tics-like' and 'OCD-like' types of RB present in the same patient. In 6.3% of patients, RB could not be classified into any of these groups and were thus considered 'undetermined'.The results confirm the phenomenological heterogeneity of RB in GTS patients and allows to distinguish two types: tic-like behaviours which are very likely an integral part of GTS; and OCD-like behaviours, which can be considered as a comorbid condition of GTS and were correlated with higher score of complex tics, neuroleptic and SSRIs treatment frequency and less successful socio-professional adaptation. We suggest that a meticulous semiological analysis of RB in GTS patients will help to tailor treatment and allow to better classify patients for future pathophysiologic studies.ClinicalTrials.gov NCT00169351.

INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

Energy Technology Data Exchange (ETDEWEB)

Savchenko, V.; Ferrigno, C.; Bozzo, E.; Courvoisier, T. J.-L. [ISDC, Department of Astronomy, University of Geneva, Chemin d’Écogia, 16 CH-1290 Versoix (Switzerland); Kuulkers, E. [European Space Research and Technology Centre (ESA/ESTEC), Keplerlaan 1, 2201 AZ Noordwijk (Netherlands); Bazzano, A.; Natalucci, L.; Rodi, J. [INAF-Institute for Space Astrophysics and Planetology, Via Fosso del Cavaliere 100, I-00133-Rome (Italy); Brandt, S.; Chenevez, J. [DTU Space, National Space Institute Elektrovej, Building 327 DK-2800 Kongens Lyngby (Denmark); Diehl, R.; Von Kienlin, A. [Max-Planck-Institut für Extraterrestrische Physik, Garching (Germany); Domingo, A. [Centro de Astrobiología (CAB-CSIC/INTA, ESAC Campus), Camino bajo del Castillo S/N, E-28692 Villanueva de la Cañada, Madrid (Spain); Hanlon, L.; Martin-Carrillo, A. [Space Science Group, School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Jourdain, E. [IRAP, Université de Toulouse, CNRS, UPS, CNES, 9 Av. Roche, F-31028 Toulouse (France); Laurent, P.; Lebrun, F. [APC, AstroParticule et Cosmologie, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris Sorbonne Paris Cité, 10 rue Alice Domont et Léonie Duquet, F-75205 Paris Cedex 13 (France); Lutovinov, A. [Space Research Institute of Russian Academy of Sciences, Profsoyuznaya 84/32, 117997 Moscow (Russian Federation); Mereghetti, S. [INAF, IASF-Milano, via E.Bassini 15, I-20133 Milano (Italy); and others

2017-10-20

We report the INTernational Gamma-ray Astrophysics Laboratory ( INTEGRAL ) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi -GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi -GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about 2 s after the end of the GW event. We measure a fluence of (1.4 ± 0.4 ± 0.6) × 10{sup −7} erg cm{sup −2} (75–2000 keV), where, respectively, the statistical error is given at the 1σ confidence level, and the systematic error corresponds to the uncertainty in the spectral model and instrument response. We also report on the pointed follow-up observations carried out by INTEGRAL , starting 19.5 hr after the event, and lasting for 5.4 days. We provide a stringent upper limit on any electromagnetic signal in a very broad energy range, from 3 keV to 8 MeV, constraining the soft gamma-ray afterglow flux to <7.1 × 10{sup −11} erg cm{sup −2} s{sup −1} (80–300 keV). Exploiting the unique capabilities of INTEGRAL , we constrained the gamma-ray line emission from radioactive decays that are expected to be the principal source of the energy behind a kilonova event following a BNS coalescence. Finally, we put a stringent upper limit on any delayed bursting activity, for example, from a newly formed magnetar.

Non-Linguistic Vocal Event Detection Using Online Random

DEFF Research Database (Denmark)

Abou-Zleikha, Mohamed; Tan, Zheng-Hua; Christensen, Mads Græsbøll

2014-01-01

areas such as object detection, face recognition, and audio event detection. This paper proposes to use online random forest technique for detecting laughter and filler and for analyzing the importance of various features for non-linguistic vocal event classification through permutation. The results...... show that according to the Area Under Curve measure the online random forest achieved 88.1% compared to 82.9% obtained by the baseline support vector machines for laughter classification and 86.8% to 83.6% for filler classification....

Semblance for microseismic event detection

Czech Academy of Sciences Publication Activity Database

Staněk, František; Anikiev, D.; Valenta, Jan; Eisner, Leo

2015-01-01

Roč. 201, č. 3 (2015), s. 1362-1369 ISSN 0956-540X R&D Projects: GA ČR GAP210/12/2451 Institutional support: RVO:67985891 Keywords : microseismic event * microseismic monitoring * source mechanisms Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.484, year: 2015

Semantic Context Detection Using Audio Event Fusion

Directory of Open Access Journals (Sweden)

Cheng Wen-Huang

2006-01-01

Full Text Available Semantic-level content analysis is a crucial issue in achieving efficient content retrieval and management. We propose a hierarchical approach that models audio events over a time series in order to accomplish semantic context detection. Two levels of modeling, audio event and semantic context modeling, are devised to bridge the gap between physical audio features and semantic concepts. In this work, hidden Markov models (HMMs are used to model four representative audio events, that is, gunshot, explosion, engine, and car braking, in action movies. At the semantic context level, generative (ergodic hidden Markov model and discriminative (support vector machine (SVM approaches are investigated to fuse the characteristics and correlations among audio events, which provide cues for detecting gunplay and car-chasing scenes. The experimental results demonstrate the effectiveness of the proposed approaches and provide a preliminary framework for information mining by using audio characteristics.

Search for the 3-phonon state of {sup 40}Ca; Recherche de l'etat a trois phonons dans le {sup 40}Ca

Energy Technology Data Exchange (ETDEWEB)

Fallot, M

2002-09-01

We study collective vibrational states of the nucleus: giant resonances and multiphonon states. It has been shown that multiphonon states, which are built with several superimposed giant resonances, can be excited in inelastic heavy ion scattering near the grazing angle. No three photon states have been observed until now. An experiment has been performed at GANIL, aiming at the observation of the 3-phonon state built with the giant quadrupole resonance (GQR) in {sup 40}Ca, with the reaction {sup 40}Ca + {sup 40}Ca at 50 A.Me.V. The ejectile was identified in the SPEG spectrometer. Light charged particles were detected in 240 CsI scintillators of the INDRA 4{pi} array. The analysis confirms the previous results about the GQR and the 2-phonon state in {sup 40}Ca. For the first time, we have measured an important direct decay branch of the GQR by alpha particles. Applying the so-called 'missing energy method' to events containing three protons measured in coincidence with the ejectile, we observe a direct decay branch revealing the presence of a 3-phonon state in the excitation energy region expected for the triple GQR. Dynamical processes are also studied in the inelastic channel, emphasizing a recently discovered mechanism named towing-mode. We observe for the first time the towing-mode of alpha particles. The energies of multiphonon states in {sup 40}Ca and {sup 208}Pb have been computed microscopically including some anharmonicities via boson mapping methods. The basis of the calculation has been extended to the 3-phonon states. Our results show large anharmonicities (several MeV), due to the coupling of 3-phonon states to 2-phonon states. The extension of the basis to 4-phonon states has been performed for the first time. The inclusion of the 4 phonon states in the calculation did not affect the previous observations concerning the 2-phonon states. Preliminary results on the anharmonicities of the 3-phonon states are presented. (author)

An Examination of Three Spatial Event Cluster Detection Methods

Directory of Open Access Journals (Sweden)

Hensley H. Mariathas

2015-03-01

Full Text Available In spatial disease surveillance, geographic areas with large numbers of disease cases are to be identified, so that targeted investigations can be pursued. Geographic areas with high disease rates are called disease clusters and statistical cluster detection tests are used to identify geographic areas with higher disease rates than expected by chance alone. In some situations, disease-related events rather than individuals are of interest for geographical surveillance, and methods to detect clusters of disease-related events are called event cluster detection methods. In this paper, we examine three distributional assumptions for the events in cluster detection: compound Poisson, approximate normal and multiple hypergeometric (exact. The methods differ on the choice of distributional assumption for the potentially multiple correlated events per individual. The methods are illustrated on emergency department (ED presentations by children and youth (age < 18 years because of substance use in the province of Alberta, Canada, during 1 April 2007, to 31 March 2008. Simulation studies are conducted to investigate Type I error and the power of the clustering methods.

Rapid detection of EBOLA VP40 in microchip immunofiltration assay

Science.gov (United States)

Miethe, Peter; Gary, Dominik; Hlawatsch, Nadine; Gad, Anne-Marie

2015-05-01

In the spring of 2014, the Ebola virus (EBOV) strain Zaire caused a dramatic outbreak in several regions of West Africa. The RT-PCR and antigen capture diagnostic proved to be effective for detecting EBOV in blood and serum. In this paper, we present data of a rapid antigen capture test for the detection of VP40. The test was performed in a microfluidic chip for immunofiltration analysis. The chip integrates all necessary assay components. The analytical sensitivity of the rapid test was 8 ng/ml for recombinant VP40. In serum and whole blood samples spiked with virus culture material, the detection limit was 2.2 x 102 PFU/ml. The performance data of the rapid test (15 min) are comparable to that of the VP40 laboratory ELISA.

Unsupervised Event Characterization and Detection in Multichannel Signals: An EEG application

Directory of Open Access Journals (Sweden)

Angel Mur

2016-04-01

Full Text Available In this paper, we propose a new unsupervised method to automatically characterize and detect events in multichannel signals. This method is used to identify artifacts in electroencephalogram (EEG recordings of brain activity. The proposed algorithm has been evaluated and compared with a supervised method. To this end an example of the performance of the algorithm to detect artifacts is shown. The results show that although both methods obtain similar classification, the proposed method allows detecting events without training data and can also be applied in signals whose events are unknown a priori. Furthermore, the proposed method provides an optimal window whereby an optimal detection and characterization of events is found. The detection of events can be applied in real-time.

Spatial-Temporal Event Detection from Geo-Tagged Tweets

Directory of Open Access Journals (Sweden)

Yuqian Huang

2018-04-01

Full Text Available As one of the most popular social networking services in the world, Twitter allows users to post messages along with their current geographic locations. Such georeferenced or geo-tagged Twitter datasets can benefit location-based services, targeted advertising and geosocial studies. Our study focused on the detection of small-scale spatial-temporal events and their textual content. First, we used Spatial-Temporal Density-Based Spatial Clustering of Applications with Noise (ST-DBSCAN to spatially-temporally cluster the tweets. Then, the word frequencies were summarized for each cluster and the potential topics were modeled by the Latent Dirichlet Allocation (LDA algorithm. Using two years of Twitter data from four college cities in the U.S., we were able to determine the spatial-temporal patterns of two known events, two unknown events and one recurring event, which then were further explored and modeled to identify the semantic content about the events. This paper presents our process and recommendations for both finding event-related tweets as well as understanding the spatial-temporal behaviors and semantic natures of the detected events.

Abnormal global and local event detection in compressive sensing domain

Science.gov (United States)

Wang, Tian; Qiao, Meina; Chen, Jie; Wang, Chuanyun; Zhang, Wenjia; Snoussi, Hichem

2018-05-01

Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.

40 CFR 721.9662 - Thieno[3,4-b]-1,4-dioxin, 2,3-dihydro- (9CI).

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Thieno[3,4-b]-1,4-dioxin, 2,3-dihydro... Specific Chemical Substances § 721.9662 Thieno[3,4-b]-1,4-dioxin, 2,3-dihydro- (9CI). (a) Chemical...-b]-1,4-dioxin, 2,3-dihydro- (9CI) (PMN P-95-1825; CAS No. 126213-50-1) is subject to reporting under...

Ganoderma Triterpenoids Exert Antiatherogenic Effects in Mice by Alleviating Disturbed Flow-Induced Oxidative Stress and Inflammation

Directory of Open Access Journals (Sweden)

Pei-Ling Hsu

2018-01-01

Full Text Available Ganoderma mushrooms, used in traditional Chinese medicine to promote health and longevity, have become widely accepted as herbal supplements. Ganoderma lucidum (GL, a commonly seen ganoderma species, is commercially cultivated under controlled conditions for more consistent chemical composition. The medicinal properties of GL are attributable to its antioxidant and anti-inflammatory activities. We intended to assess the effect of GL in atherosclerosis, an arterial condition associated with chronic oxidative stress and inflammation, using a carotid-artery-ligation mouse model. Flow turbulence created in the ligated artery induces oxidative stress and neointimal hyperplasia, a feature of early atherogenesis. Daily oral GL prevented neointimal thickening 2 weeks after ligation. Moreover, the ganoderma triterpenoid (GT crude extract isolated from GL abolished ligation-induced neointima formation. Mechanistically, endothelial dysfunction was observed 3 days after ligation before any structural changes could be detected. GTs alleviated the oxidative stress and restored the atheroresistent status of endothelium by inhibiting the induction of a series of atherogenic factors, including endothelin-1, von Willebrand factor, and monocyte chemoattractant protein-1 after 3-day ligation. The anti-inflammatory activity of GTs was tested in cultured human umbilical vein endothelial cells (HUVECs exposed to disturbed flow in an in vitro perfusion system. GTs abolished the induction of proinflammatory VCAM-1, TNF-α, and IL-6 by oscillatory shear stress. Moreover, the antioxidant activity of GTs was tested in HUVECs against the insult of H2O2. GTs dissipated the cellular superoxide accumulation imposed by H2O2, thereby mitigating H2O2-induced cell damage and proatherogenic response. Our results revealed the atheroprotective properties of ganoderma mushrooms and identified triterpenoids as the critical constituents for those effects. GTs prevent atherogenesis by

2D-Driven 3D Object Detection in RGB-D Images

KAUST Repository

Lahoud, Jean

2017-12-25

In this paper, we present a technique that places 3D bounding boxes around objects in an RGB-D scene. Our approach makes best use of the 2D information to quickly reduce the search space in 3D, benefiting from state-of-the-art 2D object detection techniques. We then use the 3D information to orient, place, and score bounding boxes around objects. We independently estimate the orientation for every object, using previous techniques that utilize normal information. Object locations and sizes in 3D are learned using a multilayer perceptron (MLP). In the final step, we refine our detections based on object class relations within a scene. When compared to state-of-the-art detection methods that operate almost entirely in the sparse 3D domain, extensive experiments on the well-known SUN RGB-D dataset [29] show that our proposed method is much faster (4.1s per image) in detecting 3D objects in RGB-D images and performs better (3 mAP higher) than the state-of-the-art method that is 4.7 times slower and comparably to the method that is two orders of magnitude slower. This work hints at the idea that 2D-driven object detection in 3D should be further explored, especially in cases where the 3D input is sparse.

Piecing together the puzzle: Improving event content coverage for real-time sub-event detection using adaptive microblog crawling.

Science.gov (United States)

Tokarchuk, Laurissa; Wang, Xinyue; Poslad, Stefan

2017-01-01

In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM) framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The novel combination of

Piecing together the puzzle: Improving event content coverage for real-time sub-event detection using adaptive microblog crawling.

Directory of Open Access Journals (Sweden)

Laurissa Tokarchuk

Full Text Available In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The

Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

Science.gov (United States)

Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

2017-01-01

A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

Abnormal global and local event detection in compressive sensing domain

Directory of Open Access Journals (Sweden)

Tian Wang

2018-05-01

Full Text Available Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.

Event-Triggered Fault Detection of Nonlinear Networked Systems.

Science.gov (United States)

Li, Hongyi; Chen, Ziran; Wu, Ligang; Lam, Hak-Keung; Du, Haiping

2017-04-01

This paper investigates the problem of fault detection for nonlinear discrete-time networked systems under an event-triggered scheme. A polynomial fuzzy fault detection filter is designed to generate a residual signal and detect faults in the system. A novel polynomial event-triggered scheme is proposed to determine the transmission of the signal. A fault detection filter is designed to guarantee that the residual system is asymptotically stable and satisfies the desired performance. Polynomial approximated membership functions obtained by Taylor series are employed for filtering analysis. Furthermore, sufficient conditions are represented in terms of sum of squares (SOSs) and can be solved by SOS tools in MATLAB environment. A numerical example is provided to demonstrate the effectiveness of the proposed results.

INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

DEFF Research Database (Denmark)

Savchenko, V.; Ferrigno, C.; Kuulkers, E.

2017-01-01

We report the INTernational Gamma-ray Astrophysics Laboratory (INTEGRAL) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi-GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS......) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi-GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about...

Multivariate algorithms for initiating event detection and identification in nuclear power plants

International Nuclear Information System (INIS)

Wu, Shun-Chi; Chen, Kuang-You; Lin, Ting-Han; Chou, Hwai-Pwu

2018-01-01

Highlights: •Multivariate algorithms for NPP initiating event detection and identification. •Recordings from multiple sensors are simultaneously considered for detection. •Both spatial and temporal information is used for event identification. •Untrained event isolation avoids falsely relating an untrained event. •Efficacy of the algorithms is verified with data from the Maanshan NPP simulator. -- Abstract: To prevent escalation of an initiating event into a severe accident, promptly detecting its occurrence and precisely identifying its type are essential. In this study, several multivariate algorithms for initiating event detection and identification are proposed to help maintain safe operations of nuclear power plants (NPPs). By monitoring changes in the NPP sensing variables, an event is detected when the preset thresholds are exceeded. Unlike existing approaches, recordings from sensors of the same type are simultaneously considered for detection, and no subjective reasoning is involved in setting these thresholds. To facilitate efficient event identification, a spatiotemporal feature extractor is proposed. The extracted features consist of the temporal traits used by existing techniques and the spatial signature of an event. Through an F-score-based feature ranking, only those that are most discriminant in classifying the events under consideration will be retained for identification. Moreover, an untrained event isolation scheme is introduced to avoid relating an untrained event to those in the event dataset so that improper recovery actions can be prevented. Results from experiments containing data of 12 event classes and a total of 125 events generated using a Taiwan’s Maanshan NPP simulator are provided to illustrate the efficacy of the proposed algorithms.

B40 fullerene as a highly sensitive molecular device for NH3 detection at low bias: a first-principles study

International Nuclear Information System (INIS)

Lin, Bin; Dong, Huilong; Du, Chunmiao; Hou, Tingjun; Lin, Haiping; Li, Youyong

2016-01-01

The adsorption of small molecules (NH 3 , N 2 , H 2 and CH 4 ) on all-boron fullerene B 40 is investigated by density functional theory (DFT) and the non-equilibrium Green’s function (NEGF) for its potential application in the field of single-molecular gas sensors. The high adsorption energies (−1.09 to −0.75 eV) of NH 3 on different adsorption sites of the B 40 surface indicate that NH 3 strongly chemisorbs to B 40 . The charge transfer induced by the NH 3 adsorption results in a modification of the density of states (DOS) of B 40 near the Fermi level, and therefore changes its electronic transport properties. For all possible adsorption sites, the adsorption of NH 3 exclusively leads to a decrease of the conductance of B 40 . Taking into consideration that the non-polar gas molecules (e.g. N 2 , H 2 and CH 4 ) are only physisorbed and show negligible effect on the conductance properties of B 40 , we would expect that B 40 can be used as a single-molecular gas sensor to distinguish NH 3 from non-polar gas molecules at low bias. (paper)

Detecting impacts of extreme events with ecological in situ monitoring networks

Directory of Open Access Journals (Sweden)

M. D. Mahecha

2017-09-01

Full Text Available Extreme hydrometeorological conditions typically impact ecophysiological processes on land. Satellite-based observations of the terrestrial biosphere provide an important reference for detecting and describing the spatiotemporal development of such events. However, in-depth investigations of ecological processes during extreme events require additional in situ observations. The question is whether the density of existing ecological in situ networks is sufficient for analysing the impact of extreme events, and what are expected event detection rates of ecological in situ networks of a given size. To assess these issues, we build a baseline of extreme reductions in the fraction of absorbed photosynthetically active radiation (FAPAR, identified by a new event detection method tailored to identify extremes of regional relevance. We then investigate the event detection success rates of hypothetical networks of varying sizes. Our results show that large extremes can be reliably detected with relatively small networks, but also reveal a linear decay of detection probabilities towards smaller extreme events in log–log space. For instance, networks with  ≈  100 randomly placed sites in Europe yield a  ≥  90 % chance of detecting the eight largest (typically very large extreme events; but only a  ≥  50 % chance of capturing the 39 largest events. These findings are consistent with probability-theoretic considerations, but the slopes of the decay rates deviate due to temporal autocorrelation and the exact implementation of the extreme event detection algorithm. Using the examples of AmeriFlux and NEON, we then investigate to what degree ecological in situ networks can capture extreme events of a given size. Consistent with our theoretical considerations, we find that today's systematically designed networks (i.e. NEON reliably detect the largest extremes, but that the extreme event detection rates are not higher than would

40 CFR 721.3032 - Boric acid (H3BO2), zinc salt.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Boric acid (H3BO2), zinc salt. 721... Substances § 721.3032 Boric acid (H3BO2), zinc salt. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as boric acid (H3BO2), zinc salt (PMN P-97-553...

Volatiles and Nonvolatiles in Flourensia campestris Griseb. (Asteraceae), How Much Do Capitate Glandular Trichomes Matter?

Science.gov (United States)

Piazza, Leonardo A; López, Daniela; Silva, Mariana P; López Rivilli, Marisa J; Tourn, Mónica G; Cantero, Juan J; Scopel, Ana L

2018-03-01

The distribution and ultrastructure of capitate glandular trichomes (GTs) in Flourensia species (Asteraceae) have been recently elucidated, but their metabolic activity and potential biological function remain unexplored. Selective nonvolatile metabolites from isolated GTs were strikingly similar to those found on leaf surfaces. The phytotoxic allelochemical sesquiterpene (-)-hamanasic acid A ((-)-HAA) was the major constituent (ca. 40%) in GTs. Although GTs are quaternary ammonium compounds (QACs)-accumulating species, glycine betaine was not found in GTs; it was only present in the leaf mesophyll. Two (-)-HAA accompanying surface secreted products: compounds 4-hydroxyacetophenone (piceol; 1) and 2-hydroxy-5-methoxyacetophenone (2), which were isolated and fully characterized (GC/MS, NMR), were present in the volatiles found in GTs. The essential oils of fresh leaves revealed ca. 33% monoterpenes, 26% hydrocarbon- and 30% oxygenated sesquiterpenes, most of them related to cadinene and bisabolene derivatives. Present results suggest a main role of GTs in determining the volatile and nonvolatile composition of F. campestris leaves. Based on the known activities of the compounds identified, it can be suggested that GTs in F. campestris would play key ecological functions in plant-pathogen and plant-plant interactions. In addition, the strikingly high contribution of compounds derived from cadinene and bisabolene pathways, highlights the potential of this species as a source of high-valued bioproducts. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

Online Detection of Abnormal Events in Video Streams

Directory of Open Access Journals (Sweden)

Tian Wang

2013-01-01

an image descriptor and online nonlinear classification method. We introduce the covariance matrix of the optical flow and image intensity as a descriptor encoding moving information. The nonlinear online support vector machine (SVM firstly learns a limited set of the training frames to provide a basic reference model then updates the model and detects abnormal events in the current frame. We finally apply the method to detect abnormal events on a benchmark video surveillance dataset to demonstrate the effectiveness of the proposed technique.

Automatic Detection and Classification of Audio Events for Road Surveillance Applications

Directory of Open Access Journals (Sweden)

Noor Almaadeed

2018-06-01

Full Text Available This work investigates the problem of detecting hazardous events on roads by designing an audio surveillance system that automatically detects perilous situations such as car crashes and tire skidding. In recent years, research has shown several visual surveillance systems that have been proposed for road monitoring to detect accidents with an aim to improve safety procedures in emergency cases. However, the visual information alone cannot detect certain events such as car crashes and tire skidding, especially under adverse and visually cluttered weather conditions such as snowfall, rain, and fog. Consequently, the incorporation of microphones and audio event detectors based on audio processing can significantly enhance the detection accuracy of such surveillance systems. This paper proposes to combine time-domain, frequency-domain, and joint time-frequency features extracted from a class of quadratic time-frequency distributions (QTFDs to detect events on roads through audio analysis and processing. Experiments were carried out using a publicly available dataset. The experimental results conform the effectiveness of the proposed approach for detecting hazardous events on roads as demonstrated by 7% improvement of accuracy rate when compared against methods that use individual temporal and spectral features.

On Event Detection and Localization in Acyclic Flow Networks

KAUST Repository

Suresh, Mahima Agumbe

2013-05-01

Acyclic flow networks, present in many infrastructures of national importance (e.g., oil and gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures have been proven costly and imprecise, particularly when dealing with large-scale distribution systems. In this article, to the best of our knowledge, for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. We propose the idea of using sensors that move along the edges of the network and detect events (i.e., attacks). To localize the events, sensors detect proximity to beacons, which are devices with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensors and beacons deployed) in a predetermined zone of interest, while ensuring a degree of coverage by sensors and a required accuracy in locating events using beacons. We propose algorithms for solving the aforementioned problem and demonstrate their effectiveness with results obtained from a realistic flow network simulator.

Maximum Redshift of Gravitational Wave Merger Events

Science.gov (United States)

Koushiappas, Savvas M.; Loeb, Abraham

2017-12-01

Future generations of gravitational wave detectors will have the sensitivity to detect gravitational wave events at redshifts far beyond any detectable electromagnetic sources. We show that if the observed event rate is greater than one event per year at redshifts z ≥40 , then the probability distribution of primordial density fluctuations must be significantly non-Gaussian or the events originate from primordial black holes. The nature of the excess events can be determined from the redshift distribution of the merger rate.

Network hydraulics inclusion in water quality event detection using multiple sensor stations data.

Science.gov (United States)

Oliker, Nurit; Ostfeld, Avi

2015-09-01

Event detection is one of the current most challenging topics in water distribution systems analysis: how regular on-line hydraulic (e.g., pressure, flow) and water quality (e.g., pH, residual chlorine, turbidity) measurements at different network locations can be efficiently utilized to detect water quality contamination events. This study describes an integrated event detection model which combines multiple sensor stations data with network hydraulics. To date event detection modelling is likely limited to single sensor station location and dataset. Single sensor station models are detached from network hydraulics insights and as a result might be significantly exposed to false positive alarms. This work is aimed at decreasing this limitation through integrating local and spatial hydraulic data understanding into an event detection model. The spatial analysis complements the local event detection effort through discovering events with lower signatures by exploring the sensors mutual hydraulic influences. The unique contribution of this study is in incorporating hydraulic simulation information into the overall event detection process of spatially distributed sensors. The methodology is demonstrated on two example applications using base runs and sensitivity analyses. Results show a clear advantage of the suggested model over single-sensor event detection schemes. Copyright © 2015 Elsevier Ltd. All rights reserved.

40 CFR 721.10088 - Thiophene, 2,5-dibromo-3-hexyl-.

Science.gov (United States)

2010-07-01

..., and consumer activities. Requirements as specified in § 721.80(s) (4,500 kilograms). (ii) Release to... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Thiophene, 2,5-dibromo-3-hexyl-. 721.10088 Section 721.10088 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

A large 2D PSD for thermal neutron detection

International Nuclear Information System (INIS)

Knott, R.B.; Watt, G.; Boldeman, J.W.; Smith, G.C.

1996-01-01

A 2D PSD based on a MWPC has been constructed for a small angle neutron scattering instrument. The active area of the detector was 640 x 640 mm 2 . To meet the specifications for neutron detection efficiency and spatial resolution, and to minimize parallax, the gas mixture was 190 kPa 3 He plus 100 kPa CF 4 and the active volume had a thickness of 30 mm. The design maximum neutron count-rate of the detector was 10 5 events per second. The (calculated) neutron detection efficiency was 60% for 2 angstrom neutrons and the (measured) neutron energy resolution on the anode grid was typically 20% (fwhm). The location of a neutron detection event within the active area was determined using the wire-by-wire method: the spatial resolution (5 x 5 mm 2 ) was thereby defined by the wire geometry. A 16 channel charge-sensitive preamplifier/amplifier/comparator module has been developed with a channel sensitivity of 0.1 V/fC, noise linewidth of 0.4 fC (fwhm) and channel-to-channel cross-talk of less than 5%. The Proportional Counter Operating System (PCOS III) (LeCroy Corp USA) was used for event encoding. The ECL signals produced by the 16 channel modules were latched in PCOS III by a trigger pulse from the anode and the fast encoders produce a position and width for each event. The information was transferred to a UNIX workstation for accumulation and online display

3D Silicon Coincidence Avalanche Detector (3D-SiCAD) for charged particle detection

Science.gov (United States)

Vignetti, M. M.; Calmon, F.; Pittet, P.; Pares, G.; Cellier, R.; Quiquerez, L.; Chaves de Albuquerque, T.; Bechetoille, E.; Testa, E.; Lopez, J.-P.; Dauvergne, D.; Savoy-Navarro, A.

2018-02-01

Single-Photon Avalanche Diodes (SPADs) are p-n junctions operated in Geiger Mode by applying a reverse bias above the breakdown voltage. SPADs have the advantage of featuring single photon sensitivity with timing resolution in the picoseconds range. Nevertheless, their relatively high Dark Count Rate (DCR) is a major issue for charged particle detection, especially when it is much higher than the incoming particle rate. To tackle this issue, we have developed a 3D Silicon Coincidence Avalanche Detector (3D-SiCAD). This novel device implements two vertically aligned SPADs featuring on-chip electronics for the detection of coincident avalanche events occurring on both SPADs. Such a coincidence detection mode allows an efficient discrimination of events related to an incoming charged particle (producing a quasi-simultaneous activation of both SPADs) from dark counts occurring independently on each SPAD. A 3D-SiCAD detector prototype has been fabricated in CMOS technology adopting a 3D flip-chip integration technique, and the main results of its characterization are reported in this work. The particle detection efficiency and noise rejection capability for this novel device have been evaluated by means of a β- strontium-90 radioactive source. Moreover the impact of the main operating parameters (i.e. the hold-off time, the coincidence window duration, the SPAD excess bias voltage) over the particle detection efficiency has been studied. Measurements have been performed with different β- particles rates and show that a 3D-SiCAD device outperforms single SPAD detectors: the former is indeed capable to detect particle rates much lower than the individual DCR observed in a single SPAD-based detectors (i.e. 2 to 3 orders of magnitudes lower).

Gilles de la Tourette Syndrome: Clinical Features of 75 Cases from Argentina

Directory of Open Access Journals (Sweden)

F. Micheli

1995-01-01

Full Text Available A series of 75 cases of Gilles de la Tourette syndrome (GTS from Argentina, whose ages ranged from 6 to 55 with a mean of 20.02, were evaluated to compare findings with those reported for other countries. Mean age at onset was 7.44 years and mean overall duration of symptoms was 12.58 years; 6.7% of cases were mild, 49% moderate and 44.3% severe. Most frequent presenting motor tics were excessive blinking in 41 followed by head jerking in 16 and eye winking in six, while phonic tics included coprolalia in 28.0%, echolalia in 17.5% and palilalia in 10.8%. Abnormal perinatal events were reported in 40.5%, while positive family history for tics was present in 26.66%. Obsessive–compulsive behaviour was evident in 66% and attention deficit disorder in 16% of cases. Self-injurious behaviour comprised onychophagia in 28 patients, lip-biting in seven and self-slapping in eight cases. Almost half of our patients were initially interpreted as having a psychogenic disorder indicating that GTS in Argentina is most likely underdiagnosed. It may be concluded that the overall pattern of GTS is not dissimilar to that described for European, Asian and American populations, thus highlighting the previously recognized cross-cultural uniformity.

On the event detected by the Mont Blanc underground neutrino detector on February 23, 1987

Energy Technology Data Exchange (ETDEWEB)

Dadykin, V L; Zatsepin, G T; Korchagin, V B

1988-02-01

The event detected by the Mont Balnc Soviet -Italian scintillation detector on February 23, 1987 at 2:52:37 are discussed. The corrected energies of the pulases of the event and the probability of the event imitation by the background are presented.

Insertable cardiac event recorder in detection of atrial fibrillation after cryptogenic stroke: an audit report.

Science.gov (United States)

Etgen, Thorleif; Hochreiter, Manfred; Mundel, Markus; Freudenberger, Thomas

2013-07-01

Atrial fibrillation (AF) is the most frequent risk factor in ischemic stroke but often remains undetected. We analyzed the value of insertable cardiac event recorder in detection of AF in a 1-year cohort of patients with cryptogenic ischemic stroke. All patients with cryptogenic stroke and eligibility for oral anticoagulation were offered the insertion of a cardiac event recorder. Regular follow-up for 1 year recorded the incidence of AF. Of the 393 patients with ischemic stroke, 65 (16.5%) had a cryptogenic stroke, and in 22 eligible patients, an event recorder was inserted. After 1 year, in 6 of 22 patients (27.3%), AF was detected. These preliminary data show that insertion of cardiac event recorder was eligible in approximately one third of patients with cryptogenic stroke and detected in approximately one quarter of these patients new AF.

Biodistribution of the GATA-3-specific DNAzyme hgd40 after inhalative exposure in mice, rats and dogs

International Nuclear Information System (INIS)

Turowska, Agnieszka; Librizzi, Damiano; Baumgartl, Nadja; Kuhlmann, Jens; Dicke, Tanja; Merkel, Olivia; Homburg, Ursula; Höffken, Helmut; Renz, Harald; Garn, Holger

2013-01-01

The DNAzyme hgd40 was shown to effectively reduce expression of the transcription factor GATA-3 RNA which plays an important role in the regulation of Th2-mediated immune mechanisms such as in allergic bronchial asthma. However, uptake, biodistribution and pharmacokinetics of hgd40 have not been investigated yet. We examined local and systemic distribution of hgd40 in naive mice and mice suffering from experimental asthma. Furthermore, we evaluated the pharmacokinetics as a function of dose following single and repeated administration in rats and dogs. Using intranasal administration of fluorescently labeled hgd40 we demonstrated that the DNAzyme was evenly distributed in inflamed asthmatic mouse lungs within minutes after single dose application. Systemic distribution was investigated in mice using radioactive labeled hgd40. After intratracheal application, highest amounts of hgd40 were detected in the lungs. High amounts were also detected in the bladder indicating urinary excretion as a major elimination pathway. In serum, low systemic hgd40 levels were detected already at 5 min post application (p.a.), subsequently decreasing over time to non-detectable levels at 2 h p.a. As revealed by Single Photon Emission Computed Tomography, trace amounts of hgd40 were detectable in lungs up to 7 days p.a. Also in the toxicologically relevant rats and dogs, hgd40 was detectable in blood only shortly after inhalative application. The plasma pharmacokinetic profile was dose and time dependent. Repeated administration did not lead to drug accumulation in plasma of dogs and rats. These pharmacokinetic of hgd40 provide guidance for clinical development, and support an infrequent and convenient dose administration regimen. - Highlights: • Local and systemic distribution of GATA-3-specific DNAzyme hgd40 was investigated. • Pharmacokinetics of hgd40 was tested in rats and dogs. • hgd40 dissolved in PBS was easily taken up into the lungs after local application. • No

Biodistribution of the GATA-3-specific DNAzyme hgd40 after inhalative exposure in mice, rats and dogs

Energy Technology Data Exchange (ETDEWEB)

Turowska, Agnieszka [sterna biologicals GmbH and Co. KG, Marburg (Germany); Librizzi, Damiano [Department of Nuclear Medicine, University Hospital Giessen and Marburg GmbH, Baldingerstrasse, 35043 Marburg (Germany); Baumgartl, Nadja [Institute of Laboratory Medicine and Pathobiochemistry-Molecular Diagnostics, Philipps University of Marburg (Germany); Kuhlmann, Jens; Dicke, Tanja [sterna biologicals GmbH and Co. KG, Marburg (Germany); Merkel, Olivia [Department of Pharmaceutical Sciences, Wayne State University, Detroit (United States); Homburg, Ursula [sterna biologicals GmbH and Co. KG, Marburg (Germany); Höffken, Helmut [Department of Nuclear Medicine, University Hospital Giessen and Marburg GmbH, Baldingerstrasse, 35043 Marburg (Germany); Renz, Harald [Institute of Laboratory Medicine and Pathobiochemistry-Molecular Diagnostics, Philipps University of Marburg (Germany); Garn, Holger, E-mail: garn@staff.uni-marburg.de [Institute of Laboratory Medicine and Pathobiochemistry-Molecular Diagnostics, Philipps University of Marburg (Germany)

2013-10-15

The DNAzyme hgd40 was shown to effectively reduce expression of the transcription factor GATA-3 RNA which plays an important role in the regulation of Th2-mediated immune mechanisms such as in allergic bronchial asthma. However, uptake, biodistribution and pharmacokinetics of hgd40 have not been investigated yet. We examined local and systemic distribution of hgd40 in naive mice and mice suffering from experimental asthma. Furthermore, we evaluated the pharmacokinetics as a function of dose following single and repeated administration in rats and dogs. Using intranasal administration of fluorescently labeled hgd40 we demonstrated that the DNAzyme was evenly distributed in inflamed asthmatic mouse lungs within minutes after single dose application. Systemic distribution was investigated in mice using radioactive labeled hgd40. After intratracheal application, highest amounts of hgd40 were detected in the lungs. High amounts were also detected in the bladder indicating urinary excretion as a major elimination pathway. In serum, low systemic hgd40 levels were detected already at 5 min post application (p.a.), subsequently decreasing over time to non-detectable levels at 2 h p.a. As revealed by Single Photon Emission Computed Tomography, trace amounts of hgd40 were detectable in lungs up to 7 days p.a. Also in the toxicologically relevant rats and dogs, hgd40 was detectable in blood only shortly after inhalative application. The plasma pharmacokinetic profile was dose and time dependent. Repeated administration did not lead to drug accumulation in plasma of dogs and rats. These pharmacokinetic of hgd40 provide guidance for clinical development, and support an infrequent and convenient dose administration regimen. - Highlights: • Local and systemic distribution of GATA-3-specific DNAzyme hgd40 was investigated. • Pharmacokinetics of hgd40 was tested in rats and dogs. • hgd40 dissolved in PBS was easily taken up into the lungs after local application. • No

Detection of Abnormal Events via Optical Flow Feature Analysis

Directory of Open Access Journals (Sweden)

Tian Wang

2015-03-01

Full Text Available In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm.

Detection of Abnormal Events via Optical Flow Feature Analysis

Science.gov (United States)

Wang, Tian; Snoussi, Hichem

2015-01-01

In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm. PMID:25811227

A novel seizure detection algorithm informed by hidden Markov model event states

Science.gov (United States)

Baldassano, Steven; Wulsin, Drausin; Ung, Hoameng; Blevins, Tyler; Brown, Mesha-Gay; Fox, Emily; Litt, Brian

2016-06-01

Objective. Recently the FDA approved the first responsive, closed-loop intracranial device to treat epilepsy. Because these devices must respond within seconds of seizure onset and not miss events, they are tuned to have high sensitivity, leading to frequent false positive stimulations and decreased battery life. In this work, we propose a more robust seizure detection model. Approach. We use a Bayesian nonparametric Markov switching process to parse intracranial EEG (iEEG) data into distinct dynamic event states. Each event state is then modeled as a multidimensional Gaussian distribution to allow for predictive state assignment. By detecting event states highly specific for seizure onset zones, the method can identify precise regions of iEEG data associated with the transition to seizure activity, reducing false positive detections associated with interictal bursts. The seizure detection algorithm was translated to a real-time application and validated in a small pilot study using 391 days of continuous iEEG data from two dogs with naturally occurring, multifocal epilepsy. A feature-based seizure detector modeled after the NeuroPace RNS System was developed as a control. Main results. Our novel seizure detection method demonstrated an improvement in false negative rate (0/55 seizures missed versus 2/55 seizures missed) as well as a significantly reduced false positive rate (0.0012 h versus 0.058 h-1). All seizures were detected an average of 12.1 ± 6.9 s before the onset of unequivocal epileptic activity (unequivocal epileptic onset (UEO)). Significance. This algorithm represents a computationally inexpensive, individualized, real-time detection method suitable for implantable antiepileptic devices that may considerably reduce false positive rate relative to current industry standards.

Microseismic Events Detection on Xishancun Landslide, Sichuan Province, China

Science.gov (United States)

Sheng, M.; Chu, R.; Wei, Z.

2016-12-01

On landslide, the slope movement and the fracturing of the rock mass often lead to microearthquakes, which are recorded as weak signals on seismographs. The distribution characteristics of temporal and spatial regional unstability as well as the impact of external factors on the unstable regions can be understand and analyzed by monitoring those microseismic events. Microseismic method can provide some information inside the landslide, which can be used as supplementary of geodetic methods for monitoring the movement of landslide surface. Compared to drilling on landslide, microseismic method is more economical and safe. Xishancun Landslide is located about 60km northwest of Wenchuan earthquake centroid, it keep deforming after the earthquake, which greatly increases the probability of disasters. In the autumn of 2015, 30 seismometers were deployed on the landslide for 3 months with intervals of 200 500 meters. First, we used regional earthquakes for time correction of seismometers to eliminate the influence of inaccuracy GPS clocks and the subsurface structure of stations. Due to low velocity of the loose medium, the travel time difference of microseismic events on the landslide up to 5s. According to travel time and waveform characteristics, we found many microseismic events and converted them into envelopes as templates, then we used a sliding-window cross-correlation technique based on waveform envelope to detect the other microseismic events. Consequently, 100 microseismic events were detected with the waveforms recorded on all seismometers. Based on the location, we found most of them located on the front of the landslide while the others located on the back end. The bottom and top of the landslide accumulated considerable energy and deformed largely, radiated waves could be recorded by all stations. What's more, the bottom with more events seemed very active. In addition, there were many smaller events happened in middle part of the landslide where released

Very low frequency earthquakes (VLFEs) detected during episodic tremor and slip (ETS) events in Cascadia using a match filter method indicate repeating events

Science.gov (United States)

Hutchison, A. A.; Ghosh, A.

2016-12-01

Very low frequency earthquakes (VLFEs) occur in transitional zones of faults, releasing seismic energy in the 0.02-0.05 Hz frequency band over a 90 s duration and typically have magntitudes within the range of Mw 3.0-4.0. VLFEs can occur down-dip of the seismogenic zone, where they can transfer stress up-dip potentially bringing the locked zone closer to a critical failure stress. VLFEs also occur up-dip of the seismogenic zone in a region along the plate interface that can rupture coseismically during large megathrust events, such as the 2011 Tohoku-Oki earthquake [Ide et al., 2011]. VLFEs were first detected in Cascadia during the 2011 episodic tremor and slip (ETS) event, occurring coincidentally with tremor [Ghosh et al., 2015]. However, during the 2014 ETS event, VLFEs were spatially and temporally asynchronous with tremor activity [Hutchison and Ghosh, 2016]. Such contrasting behaviors remind us that the mechanics behind such events remain elusive, yet they are responsible for the largest portion of the moment release during an ETS event. Here, we apply a match filter method using known VLFEs as template events to detect additional VLFEs. Using a grid-search centroid moment tensor inversion method, we invert stacks of the resulting match filter detections to ensure moment tensor solutions are similar to that of the respective template events. Our ability to successfully employ a match filter method to VLFE detection in Cascadia intrinsically indicates that these events can be repeating, implying that the same asperities are likely responsible for generating multiple VLFEs.

DETECT: a MATLAB toolbox for event detection and identification in time series, with applications to artifact detection in EEG signals.

Science.gov (United States)

Lawhern, Vernon; Hairston, W David; Robbins, Kay

2013-01-01

Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG) data as an additional illustration.

DETECT: a MATLAB toolbox for event detection and identification in time series, with applications to artifact detection in EEG signals.

Directory of Open Access Journals (Sweden)

Vernon Lawhern

Full Text Available Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG data as an additional illustration.

A robust neural network-based approach for microseismic event detection

KAUST Repository

Akram, Jubran

2017-08-17

We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset for event detection. The input features used include the average of absolute amplitudes, variance, energy-ratio and polarization rectilinearity. These features are calculated in a moving-window of same length for the entire waveform. The output is set as a user-specified relative probability curve, which provides a robust way of distinguishing between weak and strong events. An optimal network is selected by studying the weight-based saliency and effect of number of neurons on the predicted results. Using synthetic data examples, we demonstrate that this approach is effective in detecting weaker events and reduces the number of false positives.

Full-waveform detection of non-impulsive seismic events based on time-reversal methods

Science.gov (United States)

Solano, Ericka Alinne; Hjörleifsdóttir, Vala; Liu, Qinya

2017-12-01

We present a full-waveform detection method for non-impulsive seismic events, based on time-reversal principles. We use the strain Green's tensor as a matched filter, correlating it with continuous observed seismograms, to detect non-impulsive seismic events. We show that this is mathematically equivalent to an adjoint method for detecting earthquakes. We define the detection function, a scalar valued function, which depends on the stacked correlations for a group of stations. Event detections are given by the times at which the amplitude of the detection function exceeds a given value relative to the noise level. The method can make use of the whole seismic waveform or any combination of time-windows with different filters. It is expected to have an advantage compared to traditional detection methods for events that do not produce energetic and impulsive P waves, for example glacial events, landslides, volcanic events and transform-fault earthquakes for events which velocity structure along the path is relatively well known. Furthermore, the method has advantages over empirical Greens functions template matching methods, as it does not depend on records from previously detected events, and therefore is not limited to events occurring in similar regions and with similar focal mechanisms as these events. The method is not specific to any particular way of calculating the synthetic seismograms, and therefore complicated structural models can be used. This is particularly beneficial for intermediate size events that are registered on regional networks, for which the effect of lateral structure on the waveforms can be significant. To demonstrate the feasibility of the method, we apply it to two different areas located along the mid-oceanic ridge system west of Mexico where non-impulsive events have been reported. The first study area is between Clipperton and Siqueiros transform faults (9°N), during the time of two earthquake swarms, occurring in March 2012 and May

COMPARISON OF FOUR METHODS TO DETECT ADVERSE EVENTS IN HOSPITAL

Directory of Open Access Journals (Sweden)

Inge Dhamanti

2015-09-01

Full Text Available AbstrakDeteksi terjadinya kejadian yang tidak diharapkan (KTD telah menjadi salah satu tantangan dalam keselamatan pasien oleh karena itu metode untuk mendeteksi terjadinya KTD sangatlah penting untuk meningkatkan keselamatan pasien. Tujuan dari artikel ini adalah untuk membandingkan kelebihan dan kekurangan dari beberapa metode untuk mendeteksi terjadinya KTD di rumah sakit, meliputi review rekam medis, pelaporan insiden secara mandiri, teknologi informasi, dan pelaporan oleh pasien. Studi ini merupakan kajian literatur untuk membandingkan dan menganalisa metode terbaik untuk mendeteksi KTD yang dapat diimplementasikan oleh rumah sakit. Semua dari empat metode telah terbukti mampu untuk mendeteksi terjadinya KTD di rumah sakit, tetapi masing-masing metode mempunyai kelebihan dan kekurangan yang perlu diatasi. Tidak ada satu metode terbaik yang akan memberikan hasil terbaik untuk mendeteksi KTD di rumah sakit. Sehingga untuk mendeteksi lebih banyak KTD yang seharusnya dapat dicegah, atau KTD yang telah terjadi, rumah sakit seharusnya mengkombinasikan lebih dari satu metode untuk mendeteksi, karena masing-masing metode mempunyai sensitivitas berbeda-beda.AbstractDetecting adverse events has become one of the challenges in patient safety thus methods to detect adverse events become critical for improving patient safety. The purpose of this paper is to compare the strengths and weaknesses of several methods of identifying adverse events in hospital, including medical records reviews, self-reported incidents, information technology, and patient self-reports. This study is a literature review to compared and analyzed to determine the best method implemented by the hospital. All of four methods have been proved in their ability in detecting adverse events in hospitals, but each method had strengths and limitations to be overcome. There is no ‘best’ single method that will give the best results for adverse events detection in hospital. Thus to

Analysis of arrhythmic events is useful to detect lead failure earlier in patients followed by remote monitoring.

Science.gov (United States)

Nishii, Nobuhiro; Miyoshi, Akihito; Kubo, Motoki; Miyamoto, Masakazu; Morimoto, Yoshimasa; Kawada, Satoshi; Nakagawa, Koji; Watanabe, Atsuyuki; Nakamura, Kazufumi; Morita, Hiroshi; Ito, Hiroshi

2018-03-01

Remote monitoring (RM) has been advocated as the new standard of care for patients with cardiovascular implantable electronic devices (CIEDs). RM has allowed the early detection of adverse clinical events, such as arrhythmia, lead failure, and battery depletion. However, lead failure was often identified only by arrhythmic events, but not impedance abnormalities. To compare the usefulness of arrhythmic events with conventional impedance abnormalities for identifying lead failure in CIED patients followed by RM. CIED patients in 12 hospitals have been followed by the RM center in Okayama University Hospital. All transmitted data have been analyzed and summarized. From April 2009 to March 2016, 1,873 patients have been followed by the RM center. During the mean follow-up period of 775 days, 42 lead failure events (atrial lead 22, right ventricular pacemaker lead 5, implantable cardioverter defibrillator [ICD] lead 15) were detected. The proportion of lead failures detected only by arrhythmic events, which were not detected by conventional impedance abnormalities, was significantly higher than that detected by impedance abnormalities (arrhythmic event 76.2%, 95% CI: 60.5-87.9%; impedance abnormalities 23.8%, 95% CI: 12.1-39.5%). Twenty-seven events (64.7%) were detected without any alert. Of 15 patients with ICD lead failure, none has experienced inappropriate therapy. RM can detect lead failure earlier, before clinical adverse events. However, CIEDs often diagnose lead failure as just arrhythmic events without any warning. Thus, to detect lead failure earlier, careful human analysis of arrhythmic events is useful. © 2017 Wiley Periodicals, Inc.

Object-Oriented Query Language For Events Detection From Images Sequences

Science.gov (United States)

Ganea, Ion Eugen

2015-09-01

In this paper is presented a method to represent the events extracted from images sequences and the query language used for events detection. Using an object oriented model the spatial and temporal relationships between salient objects and also between events are stored and queried. This works aims to unify the storing and querying phases for video events processing. The object oriented language syntax used for events processing allow the instantiation of the indexes classes in order to improve the accuracy of the query results. The experiments were performed on images sequences provided from sport domain and it shows the reliability and the robustness of the proposed language. To extend the language will be added a specific syntax for constructing the templates for abnormal events and for detection of the incidents as the final goal of the research.

A large 2D PSD for thermal neutron detection

Energy Technology Data Exchange (ETDEWEB)

Knott, R.B.; Watt, G.; Boldeman, J.W. [Australian Nucl. Sci. and Tech. Organ., Menai, NSW (Australia). Phys. Div.; Smith, G.C. [Instrumentation Division, Brookhaven National Laboratory, Upton, NY 11973 (United States)

1997-06-21

A 2D PSD based on a MWPC has been constructed for a small angle neutron scattering instrument. The active area of the detector was 640 x 640 mm{sup 2}. To meet the specifications for neutron detection efficiency and spatial resolution, and to minimise parallax, the gas mixture was 190 kPa {sup 3}He plus 100 kPa CF{sub 4}, and the active volume had a thickness of 30 mm. The design maximum neutron count rate of the detector was 10{sup 5} events per second. The (calculated) neutron detection efficiency was 60% for 2 A neutrons and the (measured) neutron energy resolution on the anode grid was typically 20% (fwhm). The location of a neutron detection event within the active area was determined using the wire-by-wire method: the spatial resolution (5 x 5 mm{sup 2}) was thereby defined by the wire geometry. A 16-channel charge-sensitive preamplifier/amplifier/comparator module has been developed with a channel sensitivity of 0.1 V/fC, noise line width of 0.4 fC (fwhm) and channel-to-channel cross-talk of less than 5%. The proportional counter operating system (PCOS III) (LeCroy Corp, USA) was used for event encoding. The ECL signals produced by the 16 channel modules were latched in PCOS III by a trigger pulse from the anode and the fast encoders produce a position and width for each event. The information was transferred to a UNIX workstation for accumulation and online display. (orig.).

TACKLING EVENT DETECTION IN THE CONTEXT OF VIDEO SURVEILLANCE

Directory of Open Access Journals (Sweden)

Raducu DUMITRESCU

2011-11-01

Full Text Available In this paper we address the problem of event detection in the context of video surveillance systems. First we deal with background extraction. Three methods are being tested, namely: frame differencing, running average and an estimate of median filtering technique. This provides information about changing contents. Further, we use this information to address human presence detection in the scene. This is carried out thought a contour-based approach. Contours are extracted from moving regions and parameterized. Human silhouettes show particular signatures of these parameters. Experimental results prove the potential of this approach to event detection. However, these are our first preliminary results to this application.

Observations of mechanical-hydraulic-geochemical interactions due to drainage of a surface water reservoir in Switzerland

Science.gov (United States)

Lunn, R. J.; Kinali, M.; Pytharouli, S.; Shipton, Z.; Stillings, M.; Lord, R.

2016-12-01

The drainage and refilling of a surface water reservoir beside the Grimsel Test Site (GTS) underground rock laboratory in Switzerland, has provided a unique opportunity to study in-situ rock mechanical, hydraulic and chemical interactions under large-scale stress changes. The reservoir was drained in October/November 2014 to enable dam maintenance and extension of the regional hydropower tunnel system. Reservoir drainage will have caused rapid unloading of the surrounding rock mass. The GTS sits 37m below the top of the reservoir and 200-600m away laterally within the mountainside on the eastern bank of the reservoir. Gradual refilling of the reservoir, via natural snowmelt and runoff, commenced in February 2015. As part of the European LASMO Project, researchers at Strathclyde, funded by Radioactive Waste Management Ltd., have been investigating mechanical-chemical-hydraulic coupling within the rock mass as an analogue for glacial unloading and loading of a future Geological Disposal Facility. We have deployed three 3-component and 6 single-component micro-seismometers within the GTS and surrounding hydropower tunnel network. In parallel, we have implemented a groundwater sampling programme, using boreholes within the GTS, for temporal determination of geochemistry and flow rate. Preliminary data analyses show geochemical anomalies during unloading, as well as detection of microseismic events. The signal-to-noise ratio of the micro-seismic data is extremely poor. Noise amplitude, and frequency content, variy throughout each day, between days, and from month-to-month on a highly unpredictable basis. This is probably due to the multitude of hydropower turbines and pump-storage systems within the surrounding mountains. To discriminate micro-seismic events, we have developed a new methodology for characterizing background noise within the seismic signal and combined this with cross-correlations techniques generally applied in microseismic analysis of hydraulic

Hospital staff should use more than one method to detect adverse events and potential adverse events: incident reporting, pharmacist surveillance and local real‐time record review may all have a place

Science.gov (United States)

Olsen, Sisse; Neale, Graham; Schwab, Kat; Psaila, Beth; Patel, Tejal; Chapman, E Jane; Vincent, Charles

2007-01-01

Background Over the past five years, in most hospitals in England and Wales, incident reporting has become well established but it remains unclear how well reports match clinical adverse events. International epidemiological studies of adverse events are based on retrospective, multi‐hospital case record review. In this paper the authors describe the use of incident reporting, pharmacist surveillance and local real‐time record review for the recognition of clinical risks associated with hospital inpatient care. Methodology Data on adverse events were collected prospectively on 288 patients discharged from adult acute medical and surgical units in an NHS district general hospital using incident reports, active surveillance of prescription charts by pharmacists and record review at time of discharge. Results Record review detected 26 adverse events (AEs) and 40 potential adverse events (PAEs) occurring during the index admission. In contrast, in the same patient group, incident reporting detected 11 PAEs and no AEs. Pharmacy surveillance found 10 medication errors all of which were PAEs. There was little overlap in the nature of events detected by the three methods. Conclusion The findings suggest that incident reporting does not provide an adequate assessment of clinical adverse events and that this method needs to be supplemented with other more systematic forms of data collection. Structured record review, carried out by clinicians, provides an important component of an integrated approach to identifying risk in the context of developing a safety and quality improvement programme. PMID:17301203

Intermediate-duration burst from AX J1754.2-2754 detected by INTEGRAL

DEFF Research Database (Denmark)

Chenevez, Jérôme; Beeck, Sarah; Brandt, Søren

2017-01-01

any emission from the source, and we infer a 3-σ upper limit on the persistent flux of 10-10 erg/cm2/s between 3-40 keV. We tentatively interpret this as an intermediate-duration burst (see, e.g., Cumming et al., ApJ 646, 429, 2006) with a superexpansion phase (see in 't Zand & Weinberg, A&A 520, 81...... is not detected outside the burst interval, with a 3-σ upper limit of 4 mCrab in the JEM-X range, and the burst is only marginally detected by the IBIS/ISGRI instrument in the 20-40 keV energy band. Previous observations regularly taken since February 13, when the region became visible by INTEGRAL, do not reveal....... At this distance, the upper-limit on the persistent emission translates to a 3-40 keV luminosity of 5.2×1035 erg/s, which is consistent with previous values measured when the source was observed in outburst with Chandra (Jonker & Keek 2008, ATel #1643) and Swift (Maccarone et al. 2012, ATel #4109). INTEGRAL...

Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

Science.gov (United States)

Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-02-18

In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

Characterization of nanosized Al2(WO4)3

International Nuclear Information System (INIS)

Nihtianova, D.; Velichkova, N.; Nikolova, R.; Koseva, I.; Yordanova, A.; Nikolov, V.

2011-01-01

Graphical abstract: TEM method allows to detect small quantities of impurities not detectable by other methods. In our case impurities of W 5 O 14 are detected in Al 2 (WO 4 ) 3 nanopowder. Highlights: → Nanosized Al 2 (WO 4 ) 3 by simple co-precipitation method. → Spherical particles with mean size of 22 nm distributed between 10 and 40 nm at 630 o C. → XRD, DTA and TEM confirm well defined products with perfect structure. → TEM locality allows detection of impurities not detectable by XRD and DTA. -- Abstract: Nanosized aluminum tungstate Al 2 (WO 4 ) 3 was prepared by co-precipitation reaction between Na 2 WO 4 and Al(NO 3 ) 3 aqueous solutions. The powder size and shape, as well as size distribution are estimated after different conditions of powder preparation. The purity of the final product was investigated by XRD and DTA analyses, using the single crystal powder as reference. Between the specimen and the reference no difference was detected. The crystal structure of Al 2 (WO 4 ) 3 nanosized powder was confirmed by TEM (SAED, HRTEM). In additional, TEM locality allows to detect some W 5 O 14 impurities, which are not visible by conventional X-ray powder diffraction and thermal analyses.

Immobilization of [Cu(bpy)2]Br2 complex onto a glassy carbon electrode modified with alpha-SiMo12O40(4-) and single walled carbon nanotubes: application to nanomolar detection of hydrogen peroxide and bromate.

Science.gov (United States)

Salimi, Abdollah; Korani, Aazam; Hallaj, Rahman; Khoshnavazi, Roshan; Hadadzadeh, Hasan

2009-03-02

A simple procedure has been used for preparation of modified glassy carbon electrode with carbon nanotubes and copper complex. Copper complex [Cu(bpy)(2)]Br(2) was immobilized onto glassy carbon (GC) electrode modified with silicomolybdate, alpha-SiMo(12)O(40)(4-) and single walled carbon nanotubes (SWCNTs). Copper complex and silicomolybdate irreversibly and strongly adsorbed onto GC electrode modified with CNTs. Electrostatic interactions between polyoxometalates (POMs) anions and Cu-complex, cations mentioned as an effective method for fabrication of three-dimensional structures. The modified electrode shows three reversible redox couples for polyoxometalate and one redox couple for Cu-complex at wide range of pH values. The electrochemical behavior, stability and electron transfer kinetics of the adsorbed redox couples were investigated using cyclic voltammetry. Due to electrostatic interaction, copper complex immobilized onto GC/CNTs/alpha-SiMo(12)O(40)(4-) electrode shows more stable voltammetric response compared to GC/CNTs/Cu-complex modified electrode. In comparison to GC/CNTs/Cu-complex the GC/CNTs/alpha-SiMo(12)O(40)(4-) modified electrodes shows excellent electrocatalytic activity toward reduction H(2)O(2) and BrO(3)(-) at more reduced overpotential. The catalytic rate constants for catalytic reduction hydrogen peroxide and bromate were 4.5(+/-0.2)x10(3) M(-1) s(-1) and 3.0(+/-0.10)x10(3) M(-1) s(-1), respectively. The hydrodynamic amperommetry technique at 0.08 V was used for detection of nanomolar concentration of hydrogen peroxide and bromate. Detection limit, sensitivity and linear concentration range proposed sensor for bromate and hydrogen peroxide detection were 1.1 nM and 6.7 nA nM(-1), 10 nM-20 microM, 1 nM, 5.5 nA nM(-1) and 10 nM-18 microM, respectively.

Multilingual event extraction for epidemic detection.

Science.gov (United States)

Lejeune, Gaël; Brixtel, Romain; Doucet, Antoine; Lucas, Nadine

2015-10-01

This paper presents a multilingual news surveillance system applied to tele-epidemiology. It has been shown that multilingual approaches improve timeliness in detection of epidemic events across the globe, eliminating the wait for local news to be translated into major languages. We present here a system to extract epidemic events in potentially any language, provided a Wikipedia seed for common disease names exists. The Daniel system presented herein relies on properties that are common to news writing (the journalistic genre), the most useful being repetition and saliency. Wikipedia is used to screen common disease names to be matched with repeated characters strings. Language variations, such as declensions, are handled by processing text at the character-level, rather than at the word level. This additionally makes it possible to handle various writing systems in a similar fashion. As no multilingual ground truth existed to evaluate the Daniel system, we built a multilingual corpus from the Web, and collected annotations from native speakers of Chinese, English, Greek, Polish and Russian, with no connection or interest in the Daniel system. This data set is available online freely, and can be used for the evaluation of other event extraction systems. Experiments for 5 languages out of 17 tested are detailed in this paper: Chinese, English, Greek, Polish and Russian. The Daniel system achieves an average F-measure of 82% in these 5 languages. It reaches 87% on BEcorpus, the state-of-the-art corpus in English, slightly below top-performing systems, which are tailored with numerous language-specific resources. The consistent performance of Daniel on multiple languages is an important contribution to the reactivity and the coverage of epidemiological event detection systems. Most event extraction systems rely on extensive resources that are language-specific. While their sophistication induces excellent results (over 90% precision and recall), it restricts their

Towards Detecting the Crowd Involved in Social Events

Directory of Open Access Journals (Sweden)

Wei Huang

2017-10-01

Full Text Available Knowing how people interact with urban environments is fundamental for a variety of fields, ranging from transportation to social science. Despite the fact that human mobility patterns have been a major topic of study in recent years, a challenge to understand large-scale human behavior when a certain event occurs remains due to a lack of either relevant data or suitable approaches. Psychological crowd refers to a group of people who are usually located at different places and show different behaviors, but who are very sensitively driven to take the same act (gather together by a certain event, which has been theoretically studied by social psychologists since the 19th century. This study aims to propose a computational approach using a machine learning method to model psychological crowds, contributing to the better understanding of human activity patterns under events. Psychological features and mental unity of the crowd are computed to detect the involved individuals. A national event happening across the USA in April, 2015 is analyzed using geotagged tweets as a case study to test our approach. The result shows that 81% of individuals in the crowd can be successfully detected. Through investigating the geospatial pattern of the involved users, not only can the event related users be identified but also those unobserved users before the event can be uncovered. The proposed approach can effectively represent the psychological feature and measure the mental unity of the psychological crowd, which sheds light on the study of large-scale psychological crowd and provides an innovative way to understanding human behavior under events.

A t(3;9)(q25.1;q34.3) translocation leading to OLFM1 fusion transcripts in Gilles de la Tourette syndrome, OCD and ADHD

DEFF Research Database (Denmark)

Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars Riff

2015-01-01

Gilles de la Tourette syndrome (GTS) is a neuropsychiatric disorder with a strong genetic etiology; however, finding of candidate genes is hampered by its genetic heterogeneity and the influence of non-genetic factors on disease pathogenesis. We report a case of a male patient with GTS, obsessive...... compulsive disorder, attention-deficit/hyperactivity-disorder, as well as other comorbidities, and a translocation t(3;9)(q25.1;q34.3) inherited from a mother with tics. Mate-pair sequencing revealed that the translocation breakpoints truncated the olfactomedin 1 (OLFM1) gene and two uncharacterized...

Detecting Micro-seismicity and Long-duration Tremor-like Events from the Oklahoma Wavefield Experiment

Science.gov (United States)

Li, C.; Li, Z.; Peng, Z.; Zhang, C.; Nakata, N.

2017-12-01

Oklahoma has experienced abrupt increase of induced seismicity in the last decade. An important way to fully understand seismic activities in Oklahoma is to obtain more complete earthquake catalogs and detect different types of seismic events. The IRIS Community Wavefield Demonstration Experiment was deployed near Enid, Oklahoma in Summer of 2016. The dataset from this ultra-dense array provides an excellent opportunity for detecting microseismicity in that region with wavefield approaches. Here we examine continuous waveforms recorded by 3 seismic lines using local coherence for ultra-dense arrays (Li et al., 2017), which is a measure of cross-correlation of waveform at each station with its nearby stations. So far we have detected more than 5,000 events from 06/22/2016 to 07/20/2016, and majority of them are not listed on the regional catalog of Oklahoma or global catalogs, indicating that they are local events. We also identify 15-20 long-period long-duration events, some of them lasting for more than 500 s. Such events have been found at major plate-boundary faults (also known as deep tectonic tremor), as well as during hydraulic fracturing, slow-moving landslides and glaciers. Our next step is to locate these possible tremor-like events with their relative arrival times across the array and compare their occurrence times with solid-earth tides and injection histories to better understand their driving mechanisms.

An integrated logit model for contamination event detection in water distribution systems.

Science.gov (United States)

Housh, Mashor; Ostfeld, Avi

2015-05-15

The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Radiative detection of spin 3/2 particles in e+e- interactions

International Nuclear Information System (INIS)

Klimenko, K.G.; Tikhonin, F.F.

1983-01-01

Cross-section for the process e + e - → γgsub(3/2)gtidlesub(3/2) has been calculated all the spin projections being taken into account. Photon energy dependence differs greatly from that of process e + e - →γωω tidle. In the case of eXistence of spin 3/2 neutral fermions such processes give a good possibility for their signal detection

Association of ADORA1 rs2228079 and ADORA2A rs5751876 Polymorphisms with Gilles de la Tourette Syndrome in the Polish Population.

Directory of Open Access Journals (Sweden)

Piotr Janik

Full Text Available Gilles de la Tourette syndrome (GTS is a neurodevelopmental disorder characterized by motor and vocal tics. Hyperactivity of dopaminergic transmission is considered a prime abnormality in the pathophysiology of tics. There are reciprocal antagonistic interactions between adenosine and dopamine transmission. The aim of the study was to analyze the association of two polymorphisms, rs2228079 in ADORA1 and rs5751876 in ADORA2A, with the risk of GTS and co-morbid disorders.A total of 162 Polish GTS patients and 270 healthy persons were enrolled in the study. Two polymorphisms were selected on the basis of knowledge of SNPs frequencies in ADORA1 and ADORA2A. Chi-square test was used for allelic and genotypic association studies. Association of genotypes with age of tic onset was analyzed with Mann-Whitney test. Multivariate logistic regression was used to find independent predictors of GTS risk.We found that the risk of GTS was associated with rs2228079 and rs5751876 polymorphisms. The GG+GT genotypes of rs2228079 in ADORA1 were underrepresented in GTS patients (p = 0.011, whereas T allele of rs5751876 in ADORA2A was overrepresented (p = 0.017. The GG genotype of rs2228079 was associated with earlier age of tic onset (p = 0.046. We found also that the minor allele G of rs2228079 was more frequent in GTS patients with depression as compared to the patients without depression (p = 0.015. Also the genotype GG was significantly more frequent in patients with obsessive compulsive disorder/behavior (OCD/OCB, p = 0.021 and depression (p = 0.032, as compared to the patients without these co-morbidities. The minor allele T frequency of rs5751876 was lower in GTS patients with co-morbid attention deficit hyperactivity disorder (p = 0.022, and TT+TC genotypes were less frequent in the non-OCD anxiety disorder group (p = 0.045.ADORA1 and ADORA2A variants are associated with the risk of GTS, co-morbid disorders, and may affect the age of tic onset.

A simple strategy for fall events detection

KAUST Repository

Harrou, Fouzi; Zerrouki, Nabil; Sun, Ying; Houacine, Amrane

2017-01-01

the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart

2D-Driven 3D Object Detection in RGB-D Images

KAUST Repository

Lahoud, Jean; Ghanem, Bernard

2017-01-01

In this paper, we present a technique that places 3D bounding boxes around objects in an RGB-D scene. Our approach makes best use of the 2D information to quickly reduce the search space in 3D, benefiting from state-of-the-art 2D object detection

EDICAM (Event Detection Intelligent Camera)

Energy Technology Data Exchange (ETDEWEB)

Zoletnik, S. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Szabolics, T., E-mail: szabolics.tamas@wigner.mta.hu [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Kocsis, G.; Szepesi, T.; Dunai, D. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary)

2013-10-15

Highlights: ► We present EDICAM's hardware modules. ► We present EDICAM's main design concepts. ► This paper will describe EDICAM firmware architecture. ► Operation principles description. ► Further developments. -- Abstract: A new type of fast framing camera has been developed for fusion applications by the Wigner Research Centre for Physics during the last few years. A new concept was designed for intelligent event driven imaging which is capable of focusing image readout to Regions of Interests (ROIs) where and when predefined events occur. At present these events mean intensity changes and external triggers but in the future more sophisticated methods might also be defined. The camera provides 444 Hz frame rate at full resolution of 1280 × 1024 pixels, but monitoring of smaller ROIs can be done in the 1–116 kHz range even during exposure of the full image. Keeping space limitations and the harsh environment in mind the camera is divided into a small Sensor Module and a processing card interconnected by a fast 10 Gbit optical link. This camera hardware has been used for passive monitoring of the plasma in different devices for example at ASDEX Upgrade and COMPASS with the first version of its firmware. The new firmware and software package is now available and ready for testing the new event processing features. This paper will present the operation principle and features of the Event Detection Intelligent Camera (EDICAM). The device is intended to be the central element in the 10-camera monitoring system of the Wendelstein 7-X stellarator.

Validating administrative data for the detection of adverse events in older hospitalized patients

Directory of Open Access Journals (Sweden)

Ackroyd-Stolarz S

2014-08-01

Full Text Available Stacy Ackroyd-Stolarz,1,2 Susan K Bowles,3–5 Lorri Giffin6 1Performance Excellence Portfolio, Capital District Health Authority, Halifax, Nova Scotia, Canada; 2Department of Emergency Medicine, Dalhousie University, Halifax, Nova Scotia, Canada; 3Geriatric Medicine, Capital District Health Authority, Halifax, Nova Scotia, Canada; 4College of Pharmacy and Division of Geriatric Medicine, Dalhousie University, Halifax, Nova Scotia, Canada; 5Department of Pharmacy at Capital District Health Authority, Halifax, Nova Scotia, Canada; 6South Shore Family Health, Bridgewater, Nova Scotia, Canada Abstract: Older hospitalized patients are at risk of experiencing adverse events including, but not limited to, hospital-acquired pressure ulcers, fall-related injuries, and adverse drug events. A significant challenge in monitoring and managing adverse events is lack of readily accessible information on their occurrence. Purpose: The objective of this retrospective cross-sectional study was to validate diagnostic codes for pressure ulcers, fall-related injuries, and adverse drug events found in routinely collected administrative hospitalization data. Methods: All patients 65 years of age or older discharged between April 1, 2009 and March 31, 2011 from a provincial academic health sciences center in Canada were eligible for inclusion in the validation study. For each of the three types of adverse events, a random sample of 50 patients whose records were positive and 50 patients whose records were not positive for an adverse event was sought for review in the validation study (n=300 records in total. A structured health record review was performed independently by two health care providers with experience in geriatrics, both of whom were unaware of the patient's status with respect to adverse event coding. A physician reviewed 40 records (20 reviewed by each health care provider to establish interrater agreement. Results: A total of 39 pressure ulcers, 56 fall

Energy-Efficient Fault-Tolerant Dynamic Event Region Detection in Wireless Sensor Networks

DEFF Research Database (Denmark)

Enemark, Hans-Jacob; Zhang, Yue; Dragoni, Nicola

2015-01-01

to a hybrid algorithm for dynamic event region detection, such as real-time tracking of chemical leakage regions. Considering the characteristics of the moving away dynamic events, we propose a return back condition for the hybrid algorithm from distributed neighborhood collaboration, in which a node makes......Fault-tolerant event detection is fundamental to wireless sensor network applications. Existing approaches usually adopt neighborhood collaboration for better detection accuracy, while need more energy consumption due to communication. Focusing on energy efficiency, this paper makes an improvement...... its detection decision based on decisions received from its spatial and temporal neighbors, to local non-communicative decision making. The simulation results demonstrate that the improved algorithm does not degrade the detection accuracy of the original algorithm, while it has better energy...

Temporal and spatial predictability of an irrelevant event differently affect detection and memory of items in a visual sequence

Directory of Open Access Journals (Sweden)

Junji eOhyama

2016-02-01

Full Text Available We examined how the temporal and spatial predictability of a task-irrelevant visual event affects the detection and memory of a visual item embedded in a continuously changing sequence. Participants observed 11 sequentially presented letters, during which a task-irrelevant visual event was either present or absent. Predictabilities of spatial location and temporal position of the event were controlled in 2 × 2 conditions. In the spatially predictable conditions, the event occurred at the same location within the stimulus sequence or at another location, while, in the spatially unpredictable conditions, it occurred at random locations. In the temporally predictable conditions, the event timing was fixed relative to the order of the letters, while in the temporally unpredictable condition, it could not be predicted from the letter order. Participants performed a working memory task and a target detection reaction time task. Memory accuracy was higher for a letter simultaneously presented at the same location as the event in the temporally unpredictable conditions, irrespective of the spatial predictability of the event. On the other hand, the detection reaction times were only faster for a letter simultaneously presented at the same location as the event when the event was both temporally and spatially predictable. Thus, to facilitate ongoing detection processes, an event must be predictable both in space and time, while memory processes are enhanced by temporally unpredictable (i.e., surprising events. Evidently, temporal predictability has differential effects on detection and memory of a visual item embedded in a sequence of images.

Data Bookkeeping Service 3 - Providing event metadata in CMS

CERN Document Server

Giffels, Manuel; Riley, Daniel

2014-01-01

The Data Bookkeeping Service 3 provides a catalog of event metadata for Monte Carlo and recorded data of the Compact Muon Solenoid (CMS) experiment at the Large Hadron Collider (LHC) at CERN, Geneva. It comprises all necessary information for tracking datasets, their processing history and associations between runs, files and datasets, on a large scale of about $200,000$ datasets and more than $40$ million files, which adds up in around $700$ GB of metadata. The DBS is an essential part of the CMS Data Management and Workload Management (DMWM) systems, all kind of data-processing like Monte Carlo production, processing of recorded event data as well as physics analysis done by the users are heavily relying on the information stored in DBS.

Data Bookkeeping Service 3 - Providing Event Metadata in CMS

Energy Technology Data Exchange (ETDEWEB)

Giffels, Manuel [CERN; Guo, Y. [Fermilab; Riley, Daniel [Cornell U.

2014-01-01

The Data Bookkeeping Service 3 provides a catalog of event metadata for Monte Carlo and recorded data of the Compact Muon Solenoid (CMS) experiment at the Large Hadron Collider (LHC) at CERN, Geneva. It comprises all necessary information for tracking datasets, their processing history and associations between runs, files and datasets, on a large scale of about 200, 000 datasets and more than 40 million files, which adds up in around 700 GB of metadata. The DBS is an essential part of the CMS Data Management and Workload Management (DMWM) systems [1], all kind of data-processing like Monte Carlo production, processing of recorded event data as well as physics analysis done by the users are heavily relying on the information stored in DBS.

Detecting failure events in buildings: a numerical and experimental analysis

OpenAIRE

Heckman, V. M.; Kohler, M. D.; Heaton, T. H.

2010-01-01

A numerical method is used to investigate an approach for detecting the brittle fracture of welds associated with beam -column connections in instrumented buildings in real time through the use of time-reversed Green’s functions and wave propagation reciprocity. The approach makes use of a prerecorded catalog of Green’s functions for an instrumented building to detect failure events in the building during a later seismic event by screening continuous data for the presence of wavef...

Abnormal Event Detection Using Local Sparse Representation

DEFF Research Database (Denmark)

Ren, Huamin; Moeslund, Thomas B.

2014-01-01

We propose to detect abnormal events via a sparse subspace clustering algorithm. Unlike most existing approaches, which search for optimized normal bases and detect abnormality based on least square error or reconstruction error from the learned normal patterns, we propose an abnormality measurem...... is found that satisfies: the distance between its local space and the normal space is large. We evaluate our method on two public benchmark datasets: UCSD and Subway Entrance datasets. The comparison to the state-of-the-art methods validate our method's effectiveness....

Oceanic mantle rocks reveal evidence for an ancient, 1.2-1.3 Ga global melting event

Science.gov (United States)

Dijkstra, A. H.; Sergeev, D.; McTaminey, L.; Dale, C. W.; Meisel, T. C.

2011-12-01

It is now increasingly being recognized that many oceanic peridotites are refertilized harzburgites, and that the refertilization often masks an extremely refractory character of the original mantle rock 'protolith'. Oceanic peridotites are, when the effects of melt refertilization are undone, often too refractory to be simple mantle melting residues after the extraction of mid-ocean ridge basalts at a spreading center. Rhenium-osmium isotope analysis is a powerful method to look through the effects of refertilization and to obtain constraints on the age of the melting that produced the refractory mantle protolith. Rhenium-depletion model ages of such anomalously refractory oceanic mantle rocks - found as abyssal peridotites or as mantle xenoliths on ocean islands - are typically >1 Ga, i.e., much older than the ridge system at which they were emplaced. In my contribution I will show results from two case studies of refertilized anciently depleted mantle rocks (Macquarie Island 'abyssal' peridotites and Lanzarote mantle xenoliths). Interestingly, very refractory oceanic mantle rocks from sites all around the world show recurring evidence for a Mesoproterozoic (~1.2-1.3 Ga) melting event [1]. Therefore, oceanic mantle rocks seem to preserve evidence for ancient melting events of global significance. Alternatively, such mantle rocks may be samples of rafts of ancient continental lithospheric mantle. Laser-ablation osmium isotope 'dating' of large populations of individual osmium-bearing alloys from mantle rocks is the key to better constrain the nature and significance of these ancient depletion events. Osmium-bearing alloys form when mantle rocks are melted to high-degrees. We have now extracted over >250 detrital osmium alloys from placer gold occurrences in the river Rhine. These alloys are derived from outcrops of ophiolitic mantle rocks in the Alps, which include blocks of mantle rocks emplaced within the Tethys Ocean, and ultramafic lenses of unknown

Fusion events

International Nuclear Information System (INIS)

Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

1998-01-01

The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

Adaptive prediction applied to seismic event detection

International Nuclear Information System (INIS)

Clark, G.A.; Rodgers, P.W.

1981-01-01

Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data

40 CFR 721.10018 - Calcium hydroxide oxide silicate (Ca6(OH)2O2(Si2O5)3).

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Calcium hydroxide oxide silicate (Ca6... New Uses for Specific Chemical Substances § 721.10018 Calcium hydroxide oxide silicate (Ca6(OH)2O2... substance identified as calcium hydroxide oxide silicate (Ca6(OH)2O2(Si2O5)3) (PMN P-01-442; CAS No. 13169...

Towards Optimal Event Detection and Localization in Acyclic Flow Networks

KAUST Repository

Agumbe Suresh, Mahima

2012-01-03

Acyclic flow networks, present in many infrastructures of national importance (e.g., oil & gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures, have been proven costly and imprecise, especially when dealing with large scale distribution systems. In this paper, to the best of our knowledge for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. Sensor nodes move along the edges of the network and detect events (i.e., attacks) and proximity to beacon nodes with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensor and beacon nodes deployed), while ensuring a degree of sensing coverage in a zone of interest and a required accuracy in locating events. We propose algorithms for solving these problems and demonstrate their effectiveness with results obtained from a high fidelity simulator.

41 CFR 109-40.103-3 - International transportation.

Science.gov (United States)

2010-07-01

... transportation. 109-40.103-3 Section 109-40.103-3 Public Contracts and Property Management Federal Property..., TRANSPORTATION, AND MOTOR VEHICLES 40-TRANSPORTATION AND TRAFFIC MANAGEMENT 40.1-General Provision § 109-40.103-3 International transportation. See 4 CFR 52.2 for a certificate required in nonuse of U.S. flag vessels or U.S...

Sudden Event Recognition: A Survey

Directory of Open Access Journals (Sweden)

Mohd Asyraf Zulkifley

2013-08-01

Full Text Available Event recognition is one of the most active research areas in video surveillance fields. Advancement in event recognition systems mainly aims to provide convenience, safety and an efficient lifestyle for humanity. A precise, accurate and robust approach is necessary to enable event recognition systems to respond to sudden changes in various uncontrolled environments, such as the case of an emergency, physical threat and a fire or bomb alert. The performance of sudden event recognition systems depends heavily on the accuracy of low level processing, like detection, recognition, tracking and machine learning algorithms. This survey aims to detect and characterize a sudden event, which is a subset of an abnormal event in several video surveillance applications. This paper discusses the following in detail: (1 the importance of a sudden event over a general anomalous event; (2 frameworks used in sudden event recognition; (3 the requirements and comparative studies of a sudden event recognition system and (4 various decision-making approaches for sudden event recognition. The advantages and drawbacks of using 3D images from multiple cameras for real-time application are also discussed. The paper concludes with suggestions for future research directions in sudden event recognition.

Event Detection Challenges, Methods, and Applications in Natural and Artificial Systems

Science.gov (United States)

2009-03-01

Sauvageon, Agogino, Mehr, and Tumer [2006], for instance, use a fourth degree polynomial within an event detection algorithm to sense high... cancer , and coronary artery disease. His study examines the age at which to begin screening exams, the intervals between the exams, and (possibly...AM, Mehr AF, and Tumer IY. 2006. “Comparison of Event Detection Methods for Centralized Sensor Networks.” IEEE Sensors Applications Symposium 2006

Predictors of Arrhythmic Events Detected by Implantable Loop Recorders in Renal Transplant Candidates

Energy Technology Data Exchange (ETDEWEB)

Silva, Rodrigo Tavares; Martinelli Filho, Martino, E-mail: martino@cardiol.br; Peixoto, Giselle de Lima; Lima, José Jayme Galvão de; Siqueira, Sérgio Freitas de; Costa, Roberto; Gowdak, Luís Henrique Wolff [Instituto do Coração do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Paula, Flávio Jota de [Unidade de Transplante Renal - Divisão de Urologia do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Kalil Filho, Roberto; Ramires, José Antônio Franchini [Instituto do Coração do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil)

2015-11-15

The recording of arrhythmic events (AE) in renal transplant candidates (RTCs) undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used. We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR). A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE. During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT) occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002), and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001) were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD) was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041). In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT.

Predictors of Arrhythmic Events Detected by Implantable Loop Recorders in Renal Transplant Candidates

Directory of Open Access Journals (Sweden)

Rodrigo Tavares Silva

2015-11-01

Full Text Available AbstractBackground:The recording of arrhythmic events (AE in renal transplant candidates (RTCs undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used.Objective:We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR.Methods:A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE.Results:During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002, and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001 were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041.Conclusions:In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT.

Predictors of Arrhythmic Events Detected by Implantable Loop Recorders in Renal Transplant Candidates

Science.gov (United States)

Silva, Rodrigo Tavares; Martinelli Filho, Martino; Peixoto, Giselle de Lima; de Lima, José Jayme Galvão; de Siqueira, Sérgio Freitas; Costa, Roberto; Gowdak, Luís Henrique Wolff; de Paula, Flávio Jota; Kalil Filho, Roberto; Ramires, José Antônio Franchini

2015-01-01

Background The recording of arrhythmic events (AE) in renal transplant candidates (RTCs) undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used. Objective We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR). Methods A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE. Results During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT) occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002), and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001) were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD) was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041). Conclusions In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT. PMID:26351983

Adaptive prediction applied to seismic event detection

Energy Technology Data Exchange (ETDEWEB)

Clark, G.A.; Rodgers, P.W.

1981-09-01

Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data.

First CNGS events detected by LVD

International Nuclear Information System (INIS)

Selvi, M.

2007-01-01

The Cern Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at Cern and send it towards the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Montecarlo simulations

Pulse oximetry recorded from the Phone Oximeter for detection of obstructive sleep apnea events with and without oxygen desaturation in children.

Science.gov (United States)

Garde, Ainara; Dehkordi, Parastoo; Wensley, David; Ansermino, J Mark; Dumont, Guy A

2015-01-01

Obstructive sleep apnea (OSA) disrupts normal ventilation during sleep and can lead to serious health problems in children if left untreated. Polysomnography, the gold standard for OSA diagnosis, is resource intensive and requires a specialized laboratory. Thus, we proposed to use the Phone Oximeter™, a portable device integrating pulse oximetry with a smartphone, to detect OSA events. As a proportion of OSA events occur without oxygen desaturation (defined as SpO2 decreases ≥ 3%), we suggest combining SpO2 and pulse rate variability (PRV) analysis to identify all OSA events and provide a more detailed sleep analysis. We recruited 160 children and recorded pulse oximetry consisting of SpO2 and plethysmography (PPG) using the Phone Oximeter™, alongside standard polysomnography. A sleep technician visually scored all OSA events with and without oxygen desaturation from polysomnography. We divided pulse oximetry signals into 1-min signal segments and extracted several features from SpO2 and PPG analysis in the time and frequency domain. Segments with OSA, especially the ones with oxygen desaturation, presented greater SpO2 variability and modulation reflected in the spectral domain than segments without OSA. Segments with OSA also showed higher heart rate and sympathetic activity through the PRV analysis relative to segments without OSA. PRV analysis was more sensitive than SpO2 analysis for identification of OSA events without oxygen desaturation. Combining SpO2 and PRV analysis enhanced OSA event detection through a multiple logistic regression model. The area under the ROC curve increased from 81% to 87%. Thus, the Phone Oximeter™ might be useful to monitor sleep and identify OSA events with and without oxygen desaturation at home.

Off-on fluorescent sensor based on the bis(2,4,7,8,9-pentamethyldipyrrolylmethene-3-yl)methane for detection of Cd{sup 2+} and Hg{sup 2+} cations

Energy Technology Data Exchange (ETDEWEB)

Bumagina, Natalia A., E-mail: nad@isc-ras.ru [G.A. Krestov Institute of Solution Chemistry of Russian Academy of Sciences (ISC RAS), 1 Akademicheskaya St., 153045 Ivanovo (Russian Federation); Antina, Elena V., E-mail: eva@isc-ras.ru [G.A. Krestov Institute of Solution Chemistry of Russian Academy of Sciences (ISC RAS), 1 Akademicheskaya St., 153045 Ivanovo (Russian Federation); Sozonov, Dmitry I., E-mail: super_dk@mail.ru [Ivanovo State University of Chemistry and Technology (ISUCT), 7 Sheremetevskij Prosp., 153000 Ivanovo (Russian Federation)

2017-03-15

The off-on fluorescent chemosensor based on the bis(2,4,7,8,9-pentamethyldipyrrolylmethene-3-yl)methane for detection of Cd{sup 2+} and Hg{sup 2+} ions was obtained and its metal ion sensing properties were investigated. The bis(dipyrrin) exhibited remarkably fluorescence enhancement (150- and 40-fold) to Cd{sup 2+} and Hg{sup 2+} ions, respectively, with significant color change on the background of other metal ions in propanol-1/cyclohexane (1:30) binary mixture. Consequently, it can be used as a “naked eye” indicator with an obvious color change from yellow-orange to orange-green color upon the addition of Cd{sup 2+} and Hg{sup 2+}. The fluorescent response mechanism of bis(dipyrrin) to Cd{sup 2+} and Hg{sup 2+} was based on the fluorescence enhancement effect upon complexation (CHEF) due to formation of a metal–ligand (2:2) complex [M{sub 2}L{sub 2}]. The detection limit of Cd{sup 2+} and Hg{sup 2+} ions was 2 × 10{sup –9} and 1.7 × 10{sup –8} M ions, respectively.

Context-aware event detection smartphone application for first responders

Science.gov (United States)

Boddhu, Sanjay K.; Dave, Rakesh P.; McCartney, Matt; West, James A.; Williams, Robert L.

2013-05-01

The rise of social networking platforms like Twitter, Facebook, etc…, have provided seamless sharing of information (as chat, video and other media) among its user community on a global scale. Further, the proliferation of the smartphones and their connectivity networks has powered the ordinary individuals to share and acquire information regarding the events happening in his/her immediate vicinity in a real-time fashion. This human-centric sensed data being generated in "human-as-sensor" approach is tremendously valuable as it delivered mostly with apt annotations and ground truth that would be missing in traditional machine-centric sensors, besides high redundancy factor (same data thru multiple users). Further, when appropriately employed this real-time data can support in detecting localized events like fire, accidents, shooting, etc…, as they unfold and pin-point individuals being affected by those events. This spatiotemporal information, when made available for first responders in the event vicinity (or approaching it) can greatly assist them to make effective decisions to protect property and life in a timely fashion. In this vein, under SATE and YATE programs, the research team at AFRL Tec^Edge Discovery labs had demonstrated the feasibility of developing Smartphone applications, that can provide a augmented reality view of the appropriate detected events in a given geographical location (localized) and also provide an event search capability over a large geographic extent. In its current state, the application thru its backend connectivity utilizes a data (Text & Image) processing framework, which deals with data challenges like; identifying and aggregating important events, analyzing and correlating the events temporally and spatially and building a search enabled event database. Further, the smartphone application with its backend data processing workflow has been successfully field tested with live user generated feeds.

Automated detection and association of surface waves

Directory of Open Access Journals (Sweden)

C. R. D. Woodgold

1994-06-01

Full Text Available An algorithm for the automatic detection and association of surface waves has been developed and tested over an 18 month interval on broad band data from the Yellowknife array (YKA. The detection algorithm uses a conventional STA/LTA scheme on data that have been narrow band filtered at 20 s periods and a test is then applied to identify dispersion. An average of 9 surface waves are detected daily using this technique. Beamforming is applied to determine the arrival azimuth; at a nonarray station this could be provided by poIarization analysis. The detected surface waves are associated daily with the events located by the short period array at Yellowknife, and later with the events listed in the USGS NEIC Monthly Summaries. Association requires matching both arrival time and azimuth of the Rayleigh waves. Regional calibration of group velocity and azimuth is required. . Large variations in both group velocity and azimuth corrections were found, as an example, signals from events in Fiji Tonga arrive with apparent group velocities of 2.9 3.5 krn/s and azimuths from 5 to + 40 degrees clockwise from true (great circle azimuth, whereas signals from Kuriles Kamchatka have velocities of 2.4 2.9 km/s and azimuths off by 35 to 0 degrees. After applying the regional corrections, surface waves are considered associated if the arrival time matches to within 0.25 km/s in apparent group velocity and the azimuth is within 30 degrees of the median expected. Over the 18 month period studied, 32% of the automatically detected surface waves were associated with events located by the Yellowknife short period array, and 34% (1591 with NEIC events; there is about 70% overlap between the two sets of events. Had the automatic detections been reported to the USGS, YKA would have ranked second (after LZH in terms of numbers of associated surface waves for the study period of April 1991 to September 1992.

Event display of a H -> 2e2mu candidate event

CERN Multimedia

ATLAS, Collaboration

2012-01-01

Event display of a H -> 2e2mu candidate event with m(4l) = 122.6 (123.9) GeV without (with) Z mass constraint. The masses of the lepton pairs are 87.9 GeV and 19.6 GeV. The event was recorded by ATLAS on 18-Jun-2012, 11:07:47 CEST in run number 205113 as event number 12611816. Zoom into the tracking detector. Muon tracks are colored red, electron tracks and clusters in the LAr calorimeter are colored green.

DETECTIONS OF WATER ICE, HYDROCARBONS, AND 3.3 μm PAH IN z ∼ 2 ULIRGs

International Nuclear Information System (INIS)

Sajina, Anna; Spoon, Henrik; Yan Lin; Imanishi, Masatoshi; Fadda, Dario; Elitzur, Moshe

2009-01-01

We present the first detections of the 3 μm water ice and 3.4 μm amorphous hydrocarbon (HAC) absorption features in z ∼ 2 ULIRGs. These are based on deep rest-frame 2-8 μm Spitzer Infrared Spectrograph spectra of 11 sources selected for their appreciable silicate absorption. The HAC-to-silicate ratio for our z ∼ 2 sources is typically higher by a factor of 2-5 than that observed in the Milky Way. This HAC 'excess' suggests compact nuclei with steep temperature gradients as opposed to predominantly host obscuration. Beside the above molecular absorption features, we detect the 3.3 μm polycyclic aromatic hydrocarbon (PAH) emission feature in one of our sources with three more individual spectra showing evidence for it. Stacking analysis suggests that water ice, hydrocarbons, and PAH are likely present in the bulk of this sample even when not individually detected. The most unexpected result of our study is the lack of clear detections of the 4.67 μm CO gas absorption feature. Only three of the sources show tentative signs of this feature at significantly lower levels than has been observed in local ULIRGs. Overall we find that the closest local analogs to our sources, in terms of 3-4 μm color, HAC-to-silicate and ice-to-silicate ratios, as well as low PAH equivalent widths, are sources dominated by deeply obscured nuclei. Such sources form only a small fraction of ULIRGs locally and are commonly believed to be dominated by buried active galactic nuclei (AGNs). Our sample suggests that, in an absolute number, such buried AGNs are at least an order of magnitude more common at z ∼ 2 than today. The presence of PAH suggests that significant levels of star formation are present even if the obscured AGNs typically dominate the power budget.

Study of the γ-decay behavior of (2{sup +} x 3{sup -}){sub 1}{sup -} candidates with the γ{sup 3} setup at HIγS

Energy Technology Data Exchange (ETDEWEB)

Sauerwein, Anne; Derya, Vera; Endres, Janis; Hennig, Andreas; Zilges, Andreas [Koeln Univ. (Germany). Inst. fuer Kernphysik; Loeher, Bastian; Savran, Deniz [GSI Helmholtzzentrum fuer Schwerionenforschung, Darmstadt (Germany). ExtreMe Matter Institute EMMI; Gesellschaft fuer Schwerionenforschung mbH (GSI), Darmstadt (Germany). Research Div.; Frankfurt Institute for Advanced Studies (FIAS), Frankfurt am Main (Germany); Tornow, Werner [Duke Univ., Durham, NC (United States). Dept. of Physics

2013-07-01

Vibrational excitations in atomic nuclei can be described within the scope of the harmonic phonon-model. The coupling of a quadrupole phonon with an octupole phonon leads to a quintuplet of negative-parity states, including the two-phonon J{sup π} = 1{sup -} state. A direct test of the two-phonon character is the study of the γ decay into constituent one-phonon excitations, and the comparison of their reduced transition strengths to model predictions. The high-efficiency γ{sup 3} setup at the High Intensity γ-ray Source facility was used, in order to investigate the γ-decay behavior of (2{sup +} x 3{sup -}){sub 1}{sup -} candidates in {sup 40}Ca and {sup 140}Ce. A detector-array consisting of four High-Purity Germanium detectors, four 3'' LaBr detectors and three 1.5'' LaBr detectors was used for γ-ray detection. The data acquisition is capable of storing γ-γ coincidence events as well as singles events, allowing for the determination of γ-decay branching ratios.

3D computer-aided detection for digital breast tomosynthesis: Comparison with 2D computer-aided detection for digital mammography in the detection of calcifications

Energy Technology Data Exchange (ETDEWEB)

Chu, A Jung; Cho, Nariya; Chang, Jung Min; Kim, Won Hwa; Lee, Su Hyun; Song, Sung Eun; Shin, Sung Ui; Moon, Woo Kyung [Dept. of Radiology, Seoul National University College of Medicine, Seoul National University Hospital, Seoul (Korea, Republic of)

2017-08-15

To retrospectively evaluate the performance of 3D computer-aided detection (CAD) for digital breast tomosynthesis (DBT) in the detection of calcifications in comparison with 2D CAD for digital mammography (DM). Between 2012 and 2013, both 3D CAD and 2D CAD systems were retrospectively applied to the calcification data set including 69 calcifications (31 malignant calcifications and 38 benign calcifications) and the normal data set including 20 bilateral normal mammograms. Each data set consisted of paired DBT and DM images. Sensitivities for the detection of malignant calcifications were calculated from the calcification data set. False-positive mark rates were calculated from the normal data set. They were compared between the two systems. Sensitivities of 3D CAD [100% (31/31) at levels 2, 1, and 0] were same as those of the 2D CAD system [100% (31/31) at levels 2 and 1] (p = 1.0, respectively). The mean value of false-positive marks per view with 3D CAD was higher than that with 2D CAD at level 2 (0.52 marks ± 0.91 vs. 0.07 marks ± 0.26, p = 0.009). 3D CAD for DBT showed equivalent sensitivity, albeit with a higher false-positive mark rate, than 2D CAD for DM in the detection of calcifications.

Using Dawn to Observe SEP Events Past 2 AU

Science.gov (United States)

Villarreal, M. N.; Russell, C. T.; Prettyman, T. H.

2017-12-01

The launch of the STEREO spacecraft provided much insight into the longitudinal and radial distribution of solar energetic particles (SEPs) relative to their origin site. However, almost all of the observations of SEP events have been made exclusively near 1 AU. The Dawn mission, which orbited around Vesta before arriving at Ceres, provides an opportunity to analyze these events at much further distances. Although Dawn's Gamma Ray and Neutron Detector (GRaND) is not optimized for SEP characterization, it is sensitive to protons greater than 4 MeV, making it capable of detecting a solar energetic particle event in its vicinity. Solar energetic particles in this area of the solar system are important as they are believed to cause sputtering at bodies such as Ceres and comets (Villarreal et al., 2017; Wurz et al., 2015). In this study, we use Dawn's GRaND data from 2011-2015 when Dawn was at distances between 2-3 AU. We compare the SEP events seen by Dawn with particle measurements at 1 AU using STEREO, Wind, and ACE to understand how the SEP events evolved past 1 AU.References: Villarreal, M. N., et al. (2017), The dependence of the Cerean exosphere on solar energetic particle events, Astrophys. J. Lett., 838, L8.Wurz, P. et al. (2015), Solar wind sputtering of dust on the surface of 67P/Churyumov-Gerasimenko, A&A, 583, A22.

Impact of sensor detection limits on protecting water distribution systems from contamination events

International Nuclear Information System (INIS)

McKenna, Sean Andrew; Hart, David Blaine; Yarrington, Lane

2006-01-01

Real-time water quality sensors are becoming commonplace in water distribution systems. However, field deployable, contaminant-specific sensors are still in the development stage. As development proceeds, the necessary operating parameters of these sensors must be determined to protect consumers from accidental and malevolent contamination events. This objective can be quantified in several different ways including minimization of: the time necessary to detect a contamination event, the population exposed to contaminated water, the extent of the contamination within the network, and others. We examine the ability of a sensor set to meet these objectives as a function of both the detection limit of the sensors and the number of sensors in the network. A moderately sized distribution network is used as an example and different sized sets of randomly placed sensors are considered. For each combination of a certain number of sensors and a detection limit, the mean values of the different objectives across multiple random sensor placements are calculated. The tradeoff between the necessary detection limit in a sensor and the number of sensors is evaluated. Results show that for the example problem examined here, a sensor detection limit of 0.01 of the average source concentration is adequate for maximum protection. Detection of events is dependent on the detection limit of the sensors, but for those events that are detected, the values of the performance measures are not a function of the sensor detection limit. The results of replacing a single sensor in a network with a sensor having a much lower detection limit show that while this replacement can improve results, the majority of the additional events detected had performance measures of relatively low consequence.

Identification of thermotectonics events by 40Ar/39Ar methodology, in Jauru, Pontes e Lacerda and Rio Alegre Terrane - southwest portion of Amazon Craton

International Nuclear Information System (INIS)

Paulo, Valeria Guimaraes de

2005-01-01

The southwest portion of Amazon Craton, subject of these work, correspond to the southwest region of Mato Grosso State and is inserted on Rio Negro-Juruena, Rondoniana-San Ignacio and Sunsas-Aguapei geochronologic Provinces. This region is surrounded by three big terranes: Jauru, Pontes e Lacerda and Rio Alegre. The main aim of this study is to use the ages of termochronologic events obtained by 40 Ar/ 39 Ar methodology, including data of literature, to contribute with the study of the geotectonic evolution on this region. Twenty samples were analyzed and 40 Ar/ 39 Ar ages found for the Jauru Terrane vary of 1539 ± 3 Ma to 1338 ± 3 Ma, for the Pontes e Lacerda Terrane the interval obtained was of 946,1 ± 0,8 Ma to 890 ± 2 Ma and for Rio Alegre Terrane the ages are between 1407 ± 3 Ma to 1321 ± 2 Ma. U/Pb, Rb/Sr and Sm/Nd data from previous works, together with 40 Ar/ 39 Ar results allowed to obtain cooling average rates to each terrane. The Jauru Terrane units cooling age is equivalent to 1,52 Ga. The cooling average rates found to Alto Jauru Greenstone belt rocks is 2,4 deg C - 1,0 Ma and to Magmatic Arc Cachoeirinha is 10,8 deg C - 1,0 Ma. Stabilization age obtained for Pontes and Lacerda Terrane is about 900 Ma coherent with the cooling age of the Sunsas Aguapei Event (1,0 - 0,9 Ga) and cooling average rates calculate were the lower, equivalent to 1,0 deg C - 1,0 Ma. Cooling age found in Rio Alegre Terrane was 1,35 Ga, possibility correspond to collision age these terrane with Amazonian protoCraton and cooling average rates of 5,0 deg C - 1,0 Ma. Finally, younger age found of 900 Ma, coherent to the Sunsas - Aguapei Event, probably represent the last regional event that affected these rocks, characterizing the stabilization period of the southwest portion of Amazon Craton. (author)

Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

International Nuclear Information System (INIS)

Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

2007-01-01

primarily the result of spurious identification and incorrect association of phases, and of excessive variability in estimates for the velocity and direction of incoming seismic phases. The mitigation of these causes has led to the development of two complimentary techniques for classifying seismic sources by testing detected signals under mutually exclusive event hypotheses. Both of these techniques require appropriate calibration data from the region to be monitored, and are therefore ideally suited to mining areas or other sites with recurring seismicity. The first such technique is a classification and location algorithm where a template is designed for each site being monitored which defines which phases should be observed, and at which times, for all available regional array stations. For each phase, the variability of measurements (primarily the azimuth and apparent velocity) from previous events is examined and it is determined which processing parameters (array configuration, data window length, frequency band) provide the most stable results. This allows us to define optimal diagnostic tests for subsequent occurrences of the phase in question. The calibration of templates for this project revealed significant results with major implications for seismic processing in both automatic and analyst reviewed contexts: (1) one or more fixed frequency bands should be chosen for each phase tested for; (2) the frequency band providing the most stable parameter estimates varies from site to site and a frequency band which provides optimal measurements for one site may give substantially worse measurements for a nearby site; (3) slowness corrections applied depend strongly on the frequency band chosen; (4) the frequency band providing the most stable estimates is often neither the band providing the greatest SNR nor the band providing the best array gain. For this reason, the automatic template location estimates provided here are frequently far better than those obtained by

Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

Science.gov (United States)

van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

2010-05-01

Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

First CNGS events detected by LVD

International Nuclear Information System (INIS)

Agafonova, N.Yu.; Boyarkin, V.V.; Kuznetsov, V.V.; Kuznetsov, V.A.; Malguin, A.S.; Ryasny, V.G.; Ryazhskaya, O.G.; Yakushev, V.F.; Zatsepin, G.T.; Aglietta, M.; Bonardi, A.; Fulgione, W.; Galeotti, P.; Porta, A.; Saavedra, O.; Vigorito, C.; Antonioli, P.; Bari, G.; Giusti, P.; Menghetti, H.; Persiani, R.; Pesci, A.; Sartorelli, G.; Selvi, M.; Zichichi, A.; Bruno, G.; Ghia, P.L.; Garbini, M.; Kemp, E.; Pless, I.A.; Votano, L.

2007-01-01

The CERN Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at CERN and send it toward the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 x 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Monte Carlo simulations. (orig.)

Application of Polymerase Chain Reaction for High Sensitivity Detection of Roundup Ready™ Soybean Seeds and Grains in Varietal Mixtures

Directory of Open Access Journals (Sweden)

Ashok Pandey

2011-01-01

Full Text Available Strong increase in the production of genetically modified organisms (GMOs observed over the years has led to a consolidation of transgenic seed industries worldwide. The dichotomy between the evaluated risk and the perceived risk of transgenic use has defined their level of acceptability among different global societies. GMOs have been widely applied to agricultural commodities, among them the Roundup Ready™ (RR™ soybean line GTS 40-3-2 has become the most prevalent transgenic crop in the world. This variety was developed to confer plant tolerance against glyphosate-based agricultural herbicide Roundup Ready™. Issues related to detection and traceability of GMOs have gained worldwide interest due to their increasing global diffusion and the related socioeconomic and health implications. Also, due to the widespread use of GMOs in food production, labelling regulations have been established in some countries to protect the right of consumers and producers. Besides regulatory demand, consumer concern issues have resulted in the development of several methods of detecting and quantifying foods derived from genetically engineered crops and their raw materials. Polymerase chain reaction (PCR has been proven to be the method of choice to detect the presence or absence of the introduced genes of GMOs at DNA level. The present paper aims to verify whether the PCR technique can detect RR™ soybean seeds among conventional ones to further certification as non-GM soybean seeds and grains. This analysis could be accomplished through the development of new methodology called 'intentional contamination' of soybean conventional seeds or grains with the respective RR™ soybeans. The results show that the PCR method can be applied with high sensitivity in order to certify conventional soybean seeds and grains.

Detection and interpretation of seismoacoustic events at German infrasound stations

Science.gov (United States)

Pilger, Christoph; Koch, Karl; Ceranna, Lars

2016-04-01

Three infrasound arrays with collocated or nearby installed seismometers are operated by the Federal Institute for Geosciences and Natural Resources (BGR) as the German National Data Center (NDC) for the verification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). Infrasound generated by seismoacoustic events is routinely detected at these infrasound arrays, but air-to-ground coupled acoustic waves occasionally show up in seismometer recordings as well. Different natural and artificial sources like meteoroids as well as industrial and mining activity generate infrasonic signatures that are simultaneously detected at microbarometers and seismometers. Furthermore, many near-surface sources like earthquakes and explosions generate both seismic and infrasonic waves that can be detected successively with both technologies. The combined interpretation of seismic and acoustic signatures provides additional information about the origin time and location of remote infrasound events or about the characterization of seismic events distinguishing man-made and natural origins. Furthermore, seismoacoustic studies help to improve the modelling of infrasound propagation and ducting in the atmosphere and allow quantifying the portion of energy coupled into ground and into air by seismoacoustic sources. An overview of different seismoacoustic sources and their detection by German infrasound stations as well as some conclusions on the benefit of a combined seismoacoustic analysis are presented within this study.

Coherent Detection for 1550 nm, 5 Gbit/s VCSEL Based 40 km Bidirectional PON Transmission

DEFF Research Database (Denmark)

Jensen, Jesper Bevensee; Rodes Lopez, Roberto; Zibar, Darko

2011-01-01

Coherent detection of directly modulated 1550nm VCSELs in 5Gbit/s bidirectional 40km SSMF PON-links is presented. Receiver sensitivity of –37.3dBm after transmission is achieved with 30dB system margin, corresponding to 1:1024 passive powersplitting.......Coherent detection of directly modulated 1550nm VCSELs in 5Gbit/s bidirectional 40km SSMF PON-links is presented. Receiver sensitivity of –37.3dBm after transmission is achieved with 30dB system margin, corresponding to 1:1024 passive powersplitting....

Anti-3D Weapon Model Detection for Safe 3D Printing Based on Convolutional Neural Networks and D2 Shape Distribution

Directory of Open Access Journals (Sweden)

Giao N. Pham

2018-03-01

Full Text Available With the development of 3D printing, weapons are easily printed without any restriction from the production managers. Therefore, anti-3D weapon model detection is necessary issue in safe 3D printing to prevent the printing of 3D weapon models. In this paper, we would like to propose an anti-3D weapon model detection algorithm to prevent the printing of anti-3D weapon models for safe 3D printing based on the D2 shape distribution and an improved convolutional neural networks (CNNs. The purpose of the proposed algorithm is to detect anti-3D weapon models when they are used in 3D printing. The D2 shape distribution is computed from random points on the surface of a 3D weapon model and their geometric features in order to construct a D2 vector. The D2 vector is then trained by improved CNNs. The CNNs are used to detect anti-3D weapon models for safe 3D printing by training D2 vectors which have been constructed from the D2 shape distribution of 3D weapon models. Experiments with 3D weapon models proved that the D2 shape distribution of 3D weapon models in the same class is the same. Training and testing results also verified that the accuracy of the proposed algorithm is higher than the conventional works. The proposed algorithm is applied in a small application, and it could detect anti-3D weapon models for safe 3D printing.

Detection of zero anisotropy at 5.2 AU during the November 1998 solar particle event: Ulysses Anisotropy Telescopes observations

Directory of Open Access Journals (Sweden)

S. Dalla

Full Text Available For the first time during the mission, the Anisotropy Telescopes instrument on board the Ulysses spacecraft measured constant zero anisotropy of protons in the 1.3-2.2 MeV energy range, for a period lasting more than three days. This measurement was made during the energetic particle event taking place at Ulysses between 25 November and 15 December 1998, an event characterised by constant high proton fluxes within a region delimited by two interplanetary forward shocks, at a distance of 5.2 AU from the Sun and heliographic latitude of 17°S. We present the ATs results for this event and discuss their possible interpretation and their relevance to the issue of intercalibration of the two telescopes.

Key words: Interplanetary physics (energetic particles - Solar physics, astrophysics and astronomy (energetic particles - Space plasma physics (instruments and techniques

Event display of a H -> 2e2mu candidate event

CERN Multimedia

ATLAS, Collaboration

2012-01-01

Event display of a H -> 2e2mu candidate event with m(4l) = 122.6 (123.9) GeV without (with) Z mass constraint. The masses of the lepton pairs are 87.9 GeV and 19.6 GeV. The event was recorded by ATLAS on 18-Jun-2012, 11:07:47 CEST in run number 205113 as event number 12611816. Muon tracks are colored red, electron tracks and clusters in the LAr calorimeter are colored green. The larger inset shows a zoom into the tracking detector. The smaller inset shows a zoom into the vertex region, indicating that the 4 leptons originate from the same primary vertex.

Reaction rate constant of HO2+O3 measured by detecting HO2 from photofragment fluorescence

Science.gov (United States)

Manzanares, E. R.; Suto, Masako; Lee, Long C.; Coffey, Dewitt, Jr.

1986-01-01

A room-temperature discharge-flow system investigation of the rate constant for the reaction 'HO2 + O3 yields OH + 2O2' has detected HO2 through the OH(A-X) fluorescence produced by photodissociative excitation of HO2 at 147 nm. A reaction rate constant of 1.9 + or - 0.3 x 10 to the -15th cu cm/molecule per sec is obtained from first-order decay of HO2 in excess O3; this agrees well with published data.

Automatic detection of lift-off and touch-down of a pick-up walker using 3D kinematics.

Science.gov (United States)

Grootveld, L; Thies, S B; Ogden, D; Howard, D; Kenney, L P J

2014-02-01

Walking aids have been associated with falls and it is believed that incorrect use limits their usefulness. Measures are therefore needed that characterize their stable use and the classification of key events in walking aid movement is the first step in their development. This study presents an automated algorithm for detection of lift-off (LO) and touch-down (TD) events of a pick-up walker. For algorithm design and initial testing, a single user performed trials for which the four individual walker feet lifted off the ground and touched down again in various sequences, and for different amounts of frame loading (Dataset_1). For further validation, ten healthy young subjects walked with the pick-up walker on flat ground (Dataset_2a) and on a narrow beam (Dataset_2b), to challenge balance. One 88-year-old walking frame user was also assessed. Kinematic data were collected with a 3D optoelectronic camera system. The algorithm detected over 93% of events (Dataset_1), and 95% and 92% in Dataset_2a and b, respectively. Of the various LO/TD sequences, those associated with natural progression resulted in up to 100% correctly identified events. For the 88-year-old walking frame user, 96% of LO events and 93% of TD events were detected, demonstrating the potential of the approach. Copyright © 2013 IPEM. Published by Elsevier Ltd. All rights reserved.

A coupled classification - evolutionary optimization model for contamination event detection in water distribution systems.

Science.gov (United States)

Oliker, Nurit; Ostfeld, Avi

2014-03-15

This study describes a decision support system, alerts for contamination events in water distribution systems. The developed model comprises a weighted support vector machine (SVM) for the detection of outliers, and a following sequence analysis for the classification of contamination events. The contribution of this study is an improvement of contamination events detection ability and a multi-dimensional analysis of the data, differing from the parallel one-dimensional analysis conducted so far. The multivariate analysis examines the relationships between water quality parameters and detects changes in their mutual patterns. The weights of the SVM model accomplish two goals: blurring the difference between sizes of the two classes' data sets (as there are much more normal/regular than event time measurements), and adhering the time factor attribute by a time decay coefficient, ascribing higher importance to recent observations when classifying a time step measurement. All model parameters were determined by data driven optimization so the calibration of the model was completely autonomic. The model was trained and tested on a real water distribution system (WDS) data set with randomly simulated events superimposed on the original measurements. The model is prominent in its ability to detect events that were only partly expressed in the data (i.e., affecting only some of the measured parameters). The model showed high accuracy and better detection ability as compared to previous modeling attempts of contamination event detection. Copyright © 2013 Elsevier Ltd. All rights reserved.

Data filtering and expected muon and neutrino event rates in the KM3NeT neutrino telescope

Energy Technology Data Exchange (ETDEWEB)

Shanidze, Rezo [ECAP, University of Erlangen-Nuremberg, Erwin-Rommel-Str.1, 91058 Erlangen (Germany); Collaboration: ANTARES-KM3NeT-Erlangen-Collaboration

2011-07-01

KM3NeT is a future Mediterranean deep sea neutrino telescope with an instrumented volume of several cubic kilometres. The neutrino and muon events in KM3NeT will be reconstructed from the signals collected from the telescope's photo detectors. However, in the deep sea the dominant source of photon signals are the decays of K40 nuclei and bioluminescence. The selection of neutrino and muon events requires the implementation of fast and efficient data filtering algorithms for the reduction of accidental background event rates. Possible data filtering and triggering schemes for the KM3NeT neutrino telescope and expected muon and neutrino event rates are discussed.

Ca(2+ release events in cardiac myocytes up close: insights from fast confocal imaging.

Directory of Open Access Journals (Sweden)

Vyacheslav M Shkryl

Full Text Available The spatio-temporal properties of Ca(2+ transients during excitation-contraction coupling and elementary Ca(2+ release events (Ca(2+ sparks were studied in atrial and ventricular myocytes with ultra-fast confocal microscopy using a Zeiss LSM 5 LIVE system that allows sampling rates of up to 60 kHz. Ca(2+ sparks which originated from subsarcolemmal junctional sarcoplasmic reticulum (j-SR release sites in atrial myocytes were anisotropic and elongated in the longitudinal direction of the cell. Ca(2+ sparks in atrial cells originating from non-junctional SR and in ventricular myocytes were symmetrical. Ca(2+ spark recording in line scan mode at 40,000 lines/s uncovered step-like increases of [Ca(2+]i. 2-D imaging of Ca(2+ transients revealed an asynchronous activation of release sites and allowed the sequential recording of Ca(2+ entry through surface membrane Ca(2+ channels and subsequent activation of Ca(2+-induced Ca(2+ release. With a latency of 2.5 ms after application of an electrical stimulus, Ca(2+ entry could be detected that was followed by SR Ca(2+ release after an additional 3 ms delay. Maximum Ca(2+ release was observed 4 ms after the beginning of release. The timing of Ca(2+ entry and release was confirmed by simultaneous [Ca(2+]i and membrane current measurements using the whole cell voltage-clamp technique. In atrial cells activation of discrete individual release sites of the j-SR led to spatially restricted Ca(2+ release events that fused into a peripheral ring of elevated [Ca(2+]i that subsequently propagated in a wave-like fashion towards the center of the cell. In ventricular myocytes asynchronous Ca(2+ release signals from discrete sites with no preferential subcellular location preceded the whole-cell Ca(2+ transient. In summary, ultra-fast confocal imaging allows investigation of Ca(2+ signals with a time resolution similar to patch clamp technique, however in a less invasive fashion.

Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

Directory of Open Access Journals (Sweden)

Lehrke Stephanie

2008-10-01

Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

Pharyngeal pH alone is not reliable for the detection of pharyngeal reflux events: A study with oesophageal and pharyngeal pH-impedance monitoring

Science.gov (United States)

Desjardin, Marie; Roman, Sabine; des Varannes, Stanislas Bruley; Gourcerol, Guillaume; Coffin, Benoit; Ropert, Alain; Mion, François

2013-01-01

Background Pharyngeal pH probes and pH-impedance catheters have been developed for the diagnosis of laryngo-pharyngeal reflux. Objective To determine the reliability of pharyngeal pH alone for the detection of pharyngeal reflux events. Methods 24-h pH-impedance recordings performed in 45 healthy subjects with a bifurcated probe for detection of pharyngeal and oesophageal reflux events were reviewed. Pharyngeal pH drops to below 4 and 5 were analysed for the simultaneous occurrence of pharyngeal reflux, gastro-oesophageal reflux, and swallows, according to impedance patterns. Results Only 7.0% of pharyngeal pH drops to below 5 identified with impedance corresponded to pharyngeal reflux, while 92.6% were related to swallows and 10.2 and 13.3% were associated with proximal and distal gastro-oesophageal reflux events, respectively. Of pharyngeal pH drops to below 4, 13.2% were related to pharyngeal reflux, 87.5% were related to swallows, and 18.1 and 21.5% were associated with proximal and distal gastro-oesophageal reflux events, respectively. Conclusions This study demonstrates that pharyngeal pH alone is not reliable for the detection of pharyngeal reflux and that adding distal oesophageal pH analysis is not helpful. The only reliable analysis should take into account impedance patterns demonstrating the presence of pharyngeal reflux event preceded by a distal and proximal reflux event within the oesophagus. PMID:24917995

Method for detecting binding events using micro-X-ray fluorescence spectrometry

Science.gov (United States)

Warner, Benjamin P.; Havrilla, George J.; Mann, Grace

2010-12-28

Method for detecting binding events using micro-X-ray fluorescence spectrometry. Receptors are exposed to at least one potential binder and arrayed on a substrate support. Each member of the array is exposed to X-ray radiation. The magnitude of a detectable X-ray fluorescence signal for at least one element can be used to determine whether a binding event between a binder and a receptor has occurred, and can provide information related to the extent of binding between the binder and receptor.

Two sugar-rhodamine "turn-on" fluorescent probes for the selective detection of Fe3 +

Science.gov (United States)

Chen, Qing; Fang, Zhijie

2018-03-01

Two new sugar-rhodamine fluorescent probes (RDG1 and RDG2) have been synthesized and characterized by 1H NMR, 13C NMR and HRMS. Their UV-Vis, fluorescence spectra and fluorescence-response to Fe3 + are investigated and discussed. RDG1 had a very nice linear relationship between UV absorbance and Fe3 + concentration with the correlation coefficient as high as 0.997 and the detection limit is 3.46 × 10- 6 M. Upon the addition of Fe3 +, the spirolactam ring of RDG1 was opened and a 1:1 metal ligand complex was formed from Job's plot. The results showed that RDG1 can be used as an effective fluorescent probe for selective detection of Fe3 + in water. RDG2 was incorporated the well-known rhodamine group and a water-soluble D-glucose group within one molecule and can be used for detecting Fe3 + in natural water as a selective fluorescent sensor. The addition of Fe3 + into RDG2 resulted in a strongly enhanced fluorescence as well as color change of solution from colorless to pink. Job's plot of RDG2 indicated 1:1 stoichiometry of RDG2-Fe3 +. RDG2 can serve as a probe for Fe3 + between pH = 4.0 to 7.0 and it's detection limit is 2.09 × 10- 6 M. The OFF-ON fluorescent mechanisms of RDG1-Fe3 + and RDG2-Fe3 + are proposed.

Mössbauer spectroscopy study of 60P2O5-40Fe2O3 glass crystallization

Directory of Open Access Journals (Sweden)

Stoch Paweł

2015-03-01

Full Text Available 60P2O5-40Fe2O3 glass was synthesized and 57Fe Mössbauer spectroscopy study was presented. The main goal of the research was to investigate structural changes of local environment of iron ions during gradual crystallization of the glass. It was observed that some changes were evidenced at temperature of heat treatment higher than 400°C, above which content of tetrahedrally coordinated Fe3+ was increased in cost of octahedral sites. This led to formation of areas of nucleation of α-FePO4. Crystallization of α-Fe3(P2O72 and Fe2P2O7 was also observed.

Event display of a H -> 2e2mu candidate event

CERN Multimedia

ATLAS, Collaboration

2012-01-01

Event display of a H -> 2e2mu candidate event with m(4l) = 122.6 (123.9) GeV without (with) Z mass constraint. The masses of the lepton pairs are 87.9 GeV and 19.6 GeV. The event was recorded by ATLAS on 18-Jun-2012, 11:07:47 CEST in run number 205113 as event number 12611816. Muon tracks are colored red, electron tracks and clusters in the LAr calorimeter are colored green. The Lego plot inset indicates the amount of transverse energy Et measured in the calorimeters. The second inset shows a zoom into the vertex region, indicating that the 4 leptons originate from the same primary vertex.

HPLC Determination of α-Keto Acids from Human Serum Using 2, 3-Diamino-2, 3- Dimethyl Butane as Derivatizing Reagent

International Nuclear Information System (INIS)

Mahar, K.P.; Shar, G.Q.; Khuhawar, M.Y.; Abbasi, K.U.; Azmat, R.; Jameel Ahmed Biag, J.A.

2013-01-01

Seven α-keto acids, pyruvic acid (PYR), 2-oxobutyric acid (KB), 3-methyl-2-oxobutyric acid (MKBA), 3-methyl-2-oxovaleric acid (K3MVA), 4-methyl-2-oxovaleric acid (K4MVA), 2-oxoglutaric acid (KG) and Phenyl pyruvic acid (PPY) as derivatives of 2,3-diamino-2,3-dimethybutane (DDB) were separated by HPLC column Zorbax C-18 (4.6x150 mm-id). The compounds were eluted with methanol-water-acetonitrile (40:58:2 V/V/V) with flow rate 1 ml/min. UV detection was carried out by photodiode array at 255 nm. Linear calibration plots were obtained with 0.1 to 60 μg/ml with limits of detection (LoD) within 0.04-0.4 μg/ml. The method was applied for the analysis of α-keto acids from serum of diabetic patients with blood glucose level 430-458 mg/dl and healthy volunteers. The amounts of α-keto acids observed 3.24-9.71 μg/ml with RSD 1.1-1.9 percentage in diabetic patients were higher than healthy volunteer's 0.11-1.3 μg/ml with RSD 0.9-2.6 percentage. (author)

Detection of intracranial aneurysms using multi-detector row CT 3D-angiography: comparison with operative findings

Energy Technology Data Exchange (ETDEWEB)

Han, You Mie; Lim, Soo Mee; Seo, Eui Kyo; Kim, Yoo Kyung [Mokdong Hospital, Ewha Womans University, Seoul (Korea, Republic of)

2006-04-15

To assess the efficacy of three-dimensional CT angiography (3D-CTA) using multi-detector row computed tomography (MDCT) in the evaluation of intracranial aneurysms in patients with non-traumatic acute subarachnoid hemorrhage and to describe those aneurysms which were not found 3D-CTA. 3D-CTA was done in 40 patients with non-traumatic subarachnoid hemorrhage by using a 16-slice MDCT; conventional digital subtraction angiography (DSA) was done in 36 of those patients within 12 hours. The CT and DSA images were reviewed by two radiologists and the site, size and neck of the aneurysms were evaluated. The results from these two modalities were then compared with the operative findings. We calculated the detection rates by 3D-CTA and DSA and evaluated the size differences of aneurysms diagnosed with 3D-DTA and those found at surgery. We also analyzed the locations and sizes of aneurysms missed by 3D-CTA and attempted to explain these false negatives. A total of 55 aneurysms were surgically confirmed in 40 patients. 48 of these were detected pre-operatively by 3D-CTA. Thus, the detection rate by 3D-CTA was 87%. The size difference of aneurysms as calculated by 3-D CTA and found operatively was as follows: less than 1 mm in 17 cases, within 1-2 mm in 15 cases, and more than 2 mm in 16 cases. Seven aneurysms were not detected by 3D-CTA. The major cause of these missed aneurysms was their small size. The undetected aneurysms were less than 2 mm in size, except for 2 instances of PCoA aneurysms. One case was not detected due to difficult image evaluation. A possible explanation of the one remaining missed aneurysms was the filling of the aneurismal sac by thrombosis. Though there were some limitations in the detection of aneurysms, 3D-CTA using 16-channel MDCT may provide sufficient pre-operative information for the management of patients with intracranial aneurysms in cases of emergency operations or DSA-failure.

Detection of intracranial aneurysms using multi-detector row CT 3D-angiography: comparison with operative findings

International Nuclear Information System (INIS)

Han, You Mie; Lim, Soo Mee; Seo, Eui Kyo; Kim, Yoo Kyung

2006-01-01

To assess the efficacy of three-dimensional CT angiography (3D-CTA) using multi-detector row computed tomography (MDCT) in the evaluation of intracranial aneurysms in patients with non-traumatic acute subarachnoid hemorrhage and to describe those aneurysms which were not found 3D-CTA. 3D-CTA was done in 40 patients with non-traumatic subarachnoid hemorrhage by using a 16-slice MDCT; conventional digital subtraction angiography (DSA) was done in 36 of those patients within 12 hours. The CT and DSA images were reviewed by two radiologists and the site, size and neck of the aneurysms were evaluated. The results from these two modalities were then compared with the operative findings. We calculated the detection rates by 3D-CTA and DSA and evaluated the size differences of aneurysms diagnosed with 3D-DTA and those found at surgery. We also analyzed the locations and sizes of aneurysms missed by 3D-CTA and attempted to explain these false negatives. A total of 55 aneurysms were surgically confirmed in 40 patients. 48 of these were detected pre-operatively by 3D-CTA. Thus, the detection rate by 3D-CTA was 87%. The size difference of aneurysms as calculated by 3-D CTA and found operatively was as follows: less than 1 mm in 17 cases, within 1-2 mm in 15 cases, and more than 2 mm in 16 cases. Seven aneurysms were not detected by 3D-CTA. The major cause of these missed aneurysms was their small size. The undetected aneurysms were less than 2 mm in size, except for 2 instances of PCoA aneurysms. One case was not detected due to difficult image evaluation. A possible explanation of the one remaining missed aneurysms was the filling of the aneurismal sac by thrombosis. Though there were some limitations in the detection of aneurysms, 3D-CTA using 16-channel MDCT may provide sufficient pre-operative information for the management of patients with intracranial aneurysms in cases of emergency operations or DSA-failure

Accuracy and precision of equine gait event detection during walking with limb and trunk mounted inertial sensors

DEFF Research Database (Denmark)

Olsen, Emil; Andersen, Pia Haubro; Pfau, Thilo

2012-01-01

The increased variations of temporal gait events when pathology is present are good candidate features for objective diagnostic tests. We hypothesised that the gait events hoof-on/off and stance can be detected accurately and precisely using features from trunk and distal limb-mounted Inertial....... Accuracy (bias) and precision (SD of bias) was calculated to compare force plate and IMU timings for gait events. Data were collected from seven horses. One hundred and twenty three (123) front limb steps were analysed; hoof-on was detected with a bias (SD) of -7 (23) ms, hoof-off with 0.7 (37) ms...... and front limb stance with -0.02 (37) ms. A total of 119 hind limb steps were analysed; hoof-on was found with a bias (SD) of -4 (25) ms, hoof-off with 6 (21) ms and hind limb stance with 0.2 (28) ms. IMUs mounted on the distal limbs and sacrum can detect gait events accurately and precisely....

Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed

International Nuclear Information System (INIS)

Semmens, Kathryn Alese; Ramage, Joan; Bartsch, Annett; Liston, Glen E

2013-01-01

High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change

Event detection for car park entries by video-surveillance

Science.gov (United States)

Coquin, Didier; Tailland, Johan; Cintract, Michel

2007-10-01

Intelligent surveillance has become an important research issue due to the high cost and low efficiency of human supervisors, and machine intelligence is required to provide a solution for automated event detection. In this paper we describe a real-time system that has been used for detecting car park entries, using an adaptive background learning algorithm and two indicators representing activity and identity to overcome the difficulty of tracking objects.

How does structured sparsity work in abnormal event detection?

DEFF Research Database (Denmark)

Ren, Huamin; Pan, Hong; Olsen, Søren Ingvor

the training, which is the due to the fact that abnormal videos are limited or even unavailable in advance in most video surveillance applications. As a result, there could be only one label in the training data which hampers supervised learning; 2) Even though there are multiple types of normal behaviors, how...... many normal patterns lie in the whole surveillance data is still unknown. This is because there is huge amount of video surveillance data and only a small proportion is used in algorithm learning, consequently, the normal patterns in the training data could be incomplete. As a result, any sparse...... structure learned from the training data could have a high bias and ruin the precision of abnormal event detection. Therefore, we in the paper propose an algorithm to solve the abnormality detection problem by sparse representation, in which local structured sparsity is preserved in coefficients. To better...

An Ensemble Approach for Emotion Cause Detection with Event Extraction and Multi-Kernel SVMs

Institute of Scientific and Technical Information of China (English)

Ruifeng Xu; Jiannan Hu; Qin Lu; Dongyin Wu; Lin Gui

2017-01-01

In this paper,we present a new challenging task for emotion analysis,namely emotion cause extraction.In this task,we focus on the detection of emotion cause a.k.a the reason or the stimulant of an emotion,rather than the regular emotion classification or emotion component extraction.Since there is no open dataset for this task available,we first designed and annotated an emotion cause dataset which follows the scheme of W3C Emotion Markup Language.We then present an emotion cause detection method by using event extraction framework,where a tree structure-based representation method is used to represent the events.Since the distribution of events is imbalanced in the training data,we propose an under-sampling-based bagging algorithm to solve this problem.Even with a limited training set,the proposed approach may still extract sufficient features for analysis by a bagging of multi-kernel based SVMs method.Evaluations show that our approach achieves an F-measure 7.04％ higher than the state-of-the-art methods.

LAN attack detection using Discrete Event Systems.

Science.gov (United States)

Hubballi, Neminath; Biswas, Santosh; Roopa, S; Ratti, Ritesh; Nandi, Sukumar

2011-01-01

Address Resolution Protocol (ARP) is used for determining the link layer or Medium Access Control (MAC) address of a network host, given its Internet Layer (IP) or Network Layer address. ARP is a stateless protocol and any IP-MAC pairing sent by a host is accepted without verification. This weakness in the ARP may be exploited by malicious hosts in a Local Area Network (LAN) by spoofing IP-MAC pairs. Several schemes have been proposed in the literature to circumvent these attacks; however, these techniques either make IP-MAC pairing static, modify the existing ARP, patch operating systems of all the hosts etc. In this paper we propose a Discrete Event System (DES) approach for Intrusion Detection System (IDS) for LAN specific attacks which do not require any extra constraint like static IP-MAC, changing the ARP etc. A DES model is built for the LAN under both a normal and compromised (i.e., spoofed request/response) situation based on the sequences of ARP related packets. Sequences of ARP events in normal and spoofed scenarios are similar thereby rendering the same DES models for both the cases. To create different ARP events under normal and spoofed conditions the proposed technique uses active ARP probing. However, this probing adds extra ARP traffic in the LAN. Following that a DES detector is built to determine from observed ARP related events, whether the LAN is operating under a normal or compromised situation. The scheme also minimizes extra ARP traffic by probing the source IP-MAC pair of only those ARP packets which are yet to be determined as genuine/spoofed by the detector. Also, spoofed IP-MAC pairs determined by the detector are stored in tables to detect other LAN attacks triggered by spoofing namely, man-in-the-middle (MiTM), denial of service etc. The scheme is successfully validated in a test bed. Copyright © 2010 ISA. Published by Elsevier Ltd. All rights reserved.

123I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

International Nuclear Information System (INIS)

Horiguchi, Yoriko; Morita, Yukiko; Tsurikisawa, Naomi; Akiyama, Kazuo

2011-01-01

In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether 123 I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. 123 I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using 123 I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M ≤ 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP ≤ 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. 123 I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

Vision-based Event Detection of the Sit-to-Stand Transition

Directory of Open Access Journals (Sweden)

Victor Shia

2015-12-01

Full Text Available Sit-to-stand (STS motions are one of the most important activities of daily living as they serve as a precursor to mobility and walking. However, there exist no standard method of segmenting STS motions. This is partially due to the variety of different sensors and modalities used to study the STS motion such as force plate, vision, and accelerometers, each providing different types of data, and the variability of the STS motion in video data. In this work, we present a method using motion capture to detect events in the STS motion by estimating ground reaction forces, thereby eliminating the variability in joint angles from visual data. We illustrate the accuracy of this method with 10 subjects with an average difference of 16.5ms in event times obtained via motion capture vs force plate. This method serves as a proof of concept for detecting events in the STS motion via video which are comparable to those obtained via force plate.

Heinrich event 4 characterized by terrestrial proxies in southwestern Europe

Directory of Open Access Journals (Sweden)

J. M. López-García

2013-05-01

Full Text Available Heinrich event 4 (H4 is well documented in the North Atlantic Ocean as a cooling event that occurred between 39 and 40 Ka. Deep-sea cores around the Iberian Peninsula coastline have been analysed to characterize the H4 event, but there are no data on the terrestrial response to this event. Here we present for the first time an analysis of terrestrial proxies for characterizing the H4 event, using the small-vertebrate assemblage (comprising small mammals, squamates and amphibians from Terrassa Riera dels Canyars, an archaeo-palaeontological deposit located on the seaboard of the northeastern Iberian Peninsula. This assemblage shows that the H4 event is characterized in northeastern Iberia by harsher and drier terrestrial conditions than today. Our results were compared with other proxies such as pollen, charcoal, phytolith, avifauna and large-mammal data available for this site, as well as with the general H4 event fluctuations and with other sites where H4 and the previous and subsequent Heinrich events (H5 and H3 have been detected in the Mediterranean and Atlantic regions of the Iberian Peninsula. We conclude that the terrestrial proxies follow the same patterns as the climatic and environmental conditions detected by the deep-sea cores at the Iberian margins.

40 CFR 73.3 - General.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 16 2010-07-01 2010-07-01 false General. 73.3 Section 73.3 Protection... ALLOWANCE SYSTEM Background and Summary § 73.3 General. Part 72 of this chapter, including §§ 72.2... under this part are contained in part 78 of this chapter. Sections 73.3 (Definitions) and 73.4...

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

Science.gov (United States)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Reaction π-p→X deg n, X deg → 2γ at momenta 15 and 40 GeV/c

International Nuclear Information System (INIS)

Apel, W.D.; Bertolucci, E; Donskov, S.V.

1974-01-01

The cross sections for reaction π - p→X deg n with X deg → 2γ decay have been measured at momenta 15 and 40 GeV/c. About 500 events have been detected. A hodoscope spectrometer with the computer on-line was used to detect photon pairs. t-dependence of differential cross section has been obtained similar to that of reaction π - p→eta deg n. From the ratio of differential cross section for X deg and eta deg production at t=0 an angle of the singlet-octet mixing of pseudoscalar mesons has been found to be equal to β=-19 deg

Colloidal GdVO4:Eu3+@SiO2 nanocrystals for highly selective and sensitive detection of Cu2+ ions

Science.gov (United States)

Liang, Yanjie; Noh, Hyeon Mi; Park, Sung Heum; Choi, Byung Chun; Jeong, Jung Hyun

2018-03-01

Nowadays, in view of health and safety demands, the controlled design of selective and sensitive sensors for Cu2+ detection is of considerable importance. Therefore, we construct herein core-shell colloidal GdVO4:Eu3+@SiO2 nanocrystals (NCs) as optical sensor for the detection of Cu2+, which were synthesized by a facile hydrothermal reaction and encapsulated with a uniform layer of ultrathin silica through a sol-gel strategy. The NCs present strong red emission due to energy transfer from VO43- groups to Eu3+ when exciting with ultraviolet (UV) light. This intense red emission from Eu3+ could be selectively quenched in the presence of Cu2+ in comparison to other metal ions and the limit of detection is as low as 80 nM in aqueous solution. It is revealed that the spectral overlap between the emission band of NCs and the absorption of Cu2+ accounts for this intriguing luminescence behavior. The detection ability is highly reversible by the addition of ethylenediaminetetraacetic acid (EDTA) with the recovery of almost 100% of the original luminescence. The luminescence quenching and recovery processes can be performed repeatedly with good sensing ability. These remarkable performances allow the colloidal GdVO4:Eu3+@SiO2 NCs a promising fluorescence chemosensor for detecting Cu2+ ions in aqueous solution.

Automatic Multi-sensor Data Quality Checking and Event Detection for Environmental Sensing

Science.gov (United States)

LIU, Q.; Zhang, Y.; Zhao, Y.; Gao, D.; Gallaher, D. W.; Lv, Q.; Shang, L.

2017-12-01

With the advances in sensing technologies, large-scale environmental sensing infrastructures are pervasively deployed to continuously collect data for various research and application fields, such as air quality study and weather condition monitoring. In such infrastructures, many sensor nodes are distributed in a specific area and each individual sensor node is capable of measuring several parameters (e.g., humidity, temperature, and pressure), providing massive data for natural event detection and analysis. However, due to the dynamics of the ambient environment, sensor data can be contaminated by errors or noise. Thus, data quality is still a primary concern for scientists before drawing any reliable scientific conclusions. To help researchers identify potential data quality issues and detect meaningful natural events, this work proposes a novel algorithm to automatically identify and rank anomalous time windows from multiple sensor data streams. More specifically, (1) the algorithm adaptively learns the characteristics of normal evolving time series and (2) models the spatial-temporal relationship among multiple sensor nodes to infer the anomaly likelihood of a time series window for a particular parameter in a sensor node. Case studies using different data sets are presented and the experimental results demonstrate that the proposed algorithm can effectively identify anomalous time windows, which may resulted from data quality issues and natural events.

Photocatalytic performance of TiO2 catalysts modified by H3PW12O40, ZrO2 and CeO2

Institute of Scientific and Technical Information of China (English)

CAI Tiejun; LIAO Yuchao; PENG Zhenshan; LONG Yunfei; WEI Zongyuan; DENG Qian

2009-01-01

The binary composite photo-catalysts CeO2/TiO2, ZrO2/TiO2 and the ternary composite photo-catalysts H3PW12O40-CeO2/TiO2,H2PW12O40-ZrO2/TiO2 were prepared by sol-gel method. The catalysts were characterized by thermogravimetric-differential thermal analysis (TG-DTA), scanning electron microscopy (SEM) and X-ray diffraction (XRD). The photocatalyfic elimination of methanol was used as model reaction to evaluate the photocatalytic activity of the composite catalysts under ultraviolet light irradiation. The effects of doped content, activation temperature, time, initial concentration of methanol and gas flow rate on the catalytic activity were investigated. The results showed that after doping a certain amount of CeO2 and ZrO2, crystaniTation process of TiO2 was restrained, particles of catalysts are smaller and more uniform. Doping ZrO2 not only significantly improved the catalytic activity, but also increased thermal stability. Doping H3PW12O40 also enhanced the catalytic activity. The catalytic activities of binary and ternary composite photocatalysts were significantly higher than tin-doped TiO2. The dynamics law of photocatalytic reaction over the binary CeO2/TiO2 and ZrO2/TiO2 catalysts has been studied. The activation energy 15.627 and 15.631 kJ/mol and pre-exponential factors 0.5176 and 0.9899 s-1 over each corresponding catalyst were obtained. This reaction accords to the first order dynamics law.

OGLE-2017-BLG-0173Lb: Low-mass-ratio Planet in a “Hollywood” Microlensing Event

Science.gov (United States)

Hwang, K.-H.; Udalski, A.; Shvartzvald, Y.; Ryu, Y.-H.; Albrow, M. D.; Chung, S.-J.; Gould, A.; Han, C.; Jung, Y. K.; Shin, I.-G.; Yee, J. C.; Zhu, W.; Cha, S.-M.; Kim, D.-J.; Kim, H.-W.; Kim, S.-L.; Lee, C.-U.; Lee, D.-J.; Lee, Y.; Park, B.-G.; Pogge, R. W.; KMTNet Collaboration; Skowron, J.; Mróz, P.; Poleski, R.; Kozłowski, S.; Soszyński, I.; Pietrukowicz, P.; Szymański, M. K.; Ulaczyk, K.; Pawlak, M.; OGLE Collaboration; Bryden, G.; Beichman, C.; Calchi Novati, S.; Gaudi, B. S.; Henderson, C. B.; Jacklin, S.; Penny, M. T.; UKIRT Microlensing Team

2018-01-01

We present microlensing planet OGLE-2017-BLG-0173Lb, with planet–host mass ratio of either q≃ 2.5× {10}-5 or q≃ 6.5× {10}-5, the lowest or among the lowest ever detected. The planetary perturbation is strongly detected, Δχ 2 ∼ 10000, because it arises from a bright (therefore, large) source passing over and enveloping the planetary caustic: a so-called “Hollywood” event. The factor ∼2.5 offset in q arises because of a previously unrecognized discrete degeneracy between Hollywood events in which the caustic is fully enveloped and those in which only one flank is enveloped, which we dub “Cannae” and “von Schlieffen,” respectively. This degeneracy is “accidental” in that it arises from gaps in the data. Nevertheless, the fact that it appears in a Δχ 2 = 10000 planetary anomaly is striking. We present a simple formalism to estimate the sensitivity of other Hollywood events to planets and show that they can lead to detections close to, but perhaps not quite reaching, the Earth/Sun mass ratio of 3× {10}-6. This formalism also enables an analytic understanding of the factor ∼2.5 offset in q between the Cannae and von Schlieffen solutions. The Bayesian estimates for the host mass, system distance, and planet–host projected separation are M={0.39}-0.24+0.40 {M}ȯ , {D}L={4.8}-1.8+1.5 {kpc}, and {a}\\perp =3.8+/- 1.6 {au}, respectively. The two estimates of the planet mass are {m}p={3.3}-2.1+3.8 {M}\\oplus and {m}p={8}-6+11 {M}\\oplus . The measured lens-source relative proper motion μ =6 {mas} {{yr}}-1 will permit imaging of the lens in about 15 years or at first light on adaptive-optics imagers on next-generation telescopes. These will allow one to measure the host mass but probably will not be able to resolve the planet–host mass-ratio degeneracy.

2-D or 3-D Mammography?: The Future of Breast Cancer Detection | NIH MedlinePlus the Magazine

Science.gov (United States)

... Future of Breast Cancer Detection Follow us 2-D or 3-D Mammography?: The Future of Breast Cancer Detection NIH- ... will test two types of imaging tools—2-D and 3-D mammography. 2-D mammography takes ...

ON THE DETECTABILITY OF A PREDICTED MESOLENSING EVENT ASSOCIATED WITH THE HIGH PROPER MOTION STAR VB 10

International Nuclear Information System (INIS)

Lépine, Sébastien; DiStefano, Rosanne

2012-01-01

Extrapolation of the astrometric motion of the nearby low-mass star VB 10 indicates that sometime in late 2011 December or during the first 2-3 months of 2012, the star will make a close approach to a background point source. Based on astrometric uncertainties, we estimate a 1 in 2 chance that the distance of closest approach ρ min will be less than 100 mas, a 1 in 5 chance that ρ min min J planet on a moderately wide (≈0.18 AU–0.84 AU) orbit, there is a chance (1% to more than 10%, depending on the distance of closest approach and orbital period and inclination) that a passage of the planet closer to the background source will result in a secondary event of higher magnification. The detection of secondary events could be made possible with a several-times-per-night multi-site monitoring campaign.

Clinical events in coronary heart disease patients with an ejection fraction of 40% or less: 3-year follow-up results.

Science.gov (United States)

Pischke, Claudia R; Elliott-Eller, Melanie; Li, Minmin; Mendell, Nancy; Ornish, Dean; Weidner, Gerdi

2010-01-01

It is unclear whether lifestyle changes can delay the need for surgical procedures in coronary heart disease (CHD) patients with asymptomatic reduced left ventricular ejection fraction (LVEF). The aim of this pilot study was to examine whether lifestyle changes can delay the need for surgical procedures in this population. We compared 3-year clinical events in 27 CHD patients eligible to receive revascularization (by insurance standards), but underwent lifestyle changes (low-fat diet, exercise, stress management) instead (intervention group [IG], LVEF Lifestyle Demonstration Project, an insurance-sponsored, community-based, secondary prevention study implemented at 8 hospital sites in the United States. At 3 months, there were more cardiac events in the UCG (6 events) than in the IG (1 event; P changes in lifestyle with no increased risk for cardiac events or overt heart failure over 3 years.

EVENT DETECTION USING MOBILE PHONE MASS GPS DATA AND THEIR RELIAVILITY VERIFICATION BY DMSP/OLS NIGHT LIGHT IMAGE

Directory of Open Access Journals (Sweden)

A. Yuki

2016-06-01

Full Text Available In this study, we developed a method to detect sudden population concentration on a certain day and area, that is, an “Event,” all over Japan in 2012 using mass GPS data provided from mobile phone users. First, stay locations of all phone users were detected using existing methods. Second, areas and days where Events occurred were detected by aggregation of mass stay locations into 1-km-square grid polygons. Finally, the proposed method could detect Events with an especially large number of visitors in the year by removing the influences of Events that occurred continuously throughout the year. In addition, we demonstrated reasonable reliability of the proposed Event detection method by comparing the results of Event detection with light intensities obtained from the night light images from the DMSP/OLS night light images. Our method can detect not only positive events such as festivals but also negative events such as natural disasters and road accidents. These results are expected to support policy development of urban planning, disaster prevention, and transportation management.

Screen printed In2O3-SnO2 nanocomposite: Structural and morphological properties and application for NO2 detection

Directory of Open Access Journals (Sweden)

Bessaïs B.

2012-06-01

Full Text Available In this work, we report on the sensing properties of screen-printed In2O3 (Indium Oxide while adding a moderate quantity of SnO2. It was found that the addition of SnO2 improves the response and decreases the operating temperature of the sensitive element for NO2 detection. However, a non-controlled amount of SnO2 leads to opposite result; for this reason in the present investigation we test films with different composition in order to optimize the quantity of SnO2 to be added. The crystallinity, roughness and morphology of the obtained In2O3-SnO2 anocomposite were analyzed using X-ray Diffraction (XRD, Transmission Electronic Microscopy (TEM and Atomic Force Microscopy (AFM. The atomic composition of the In2O3-SnO2 films was determined with the energy dispersive spectroscopy (EDX analysis during TEM observations. The effect of the composition on the cristallinity and morphological properties of the films was analyzed. Finally, the In2O3-SnO2 films were tested like sensitive elements for NO2 detection, wherein the effect of the composition was correlated with the sensor response in NO2 ambient. It was found that the addition of a moderate quantity of SnO2 to In2O3 exhibited high sensitivity at rather lower operating temperatures.

Impact parameter determination for 40Ca + 40Ca reactions using a neural network

International Nuclear Information System (INIS)

Haddad, F.; Hagel, K.; Li, J.; Mdeiwayeh, N.; Natowitz, J.B.; Wada, R.; Xiao, B.; David, C.; Freslier, M.; Aichelin, J.

1995-01-01

A neural network is used for the impact parameter determination in 40 Ca + 40 Ca reactions at energies between 35 and 70 AMeV. A special attention is devoted to the effect of experimental constraints such as the detection efficiency. An overall improvement of the impact parameter determination of 25% is obtained with the neural network. The neural network technique is then used in the analysis of the Ca+Ca data at 35 AMeV and allows separation of three different class of events among the selected 'complete' events. (authors). 8 refs., 5 figs

1.3 mm WAVELENGTH VLBI OF SAGITTARIUS A*: DETECTION OF TIME-VARIABLE EMISSION ON EVENT HORIZON SCALES

International Nuclear Information System (INIS)

Fish, Vincent L.; Doeleman, Sheperd S.; Beaudoin, Christopher; Bolin, David E.; Rogers, Alan E. E.; Blundell, Ray; Gurwell, Mark A.; Moran, James M.; Primiani, Rurik; Bower, Geoffrey C.; Plambeck, Richard; Chamberlin, Richard; Freund, Robert; Friberg, Per; Honma, Mareki; Oyama, Tomoaki; Inoue, Makoto; Krichbaum, Thomas P.; Lamb, James; Marrone, Daniel P.

2011-01-01

Sagittarius A*, the ∼4 x 10 6 M sun black hole candidate at the Galactic center, can be studied on Schwarzschild radius scales with (sub)millimeter wavelength very long baseline interferometry (VLBI). We report on 1.3 mm wavelength observations of Sgr A* using a VLBI array consisting of the JCMT on Mauna Kea, the Arizona Radio Observatory's Submillimeter Telescope on Mt. Graham in Arizona, and two telescopes of the CARMA array at Cedar Flat in California. Both Sgr A* and the quasar calibrator 1924-292 were observed over three consecutive nights, and both sources were clearly detected on all baselines. For the first time, we are able to extract 1.3 mm VLBI interferometer phase information on Sgr A* through measurement of closure phase on the triangle of baselines. On the third night of observing, the correlated flux density of Sgr A* on all VLBI baselines increased relative to the first two nights, providing strong evidence for time-variable change on scales of a few Schwarzschild radii. These results suggest that future VLBI observations with greater sensitivity and additional baselines will play a valuable role in determining the structure of emission near the event horizon of Sgr A*.

Real-time detection and classification of anomalous events in streaming data

Science.gov (United States)

Ferragut, Erik M.; Goodall, John R.; Iannacone, Michael D.; Laska, Jason A.; Harrison, Lane T.

2016-04-19

A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The events can be displayed to a user in user-defined groupings in an animated fashion. The system can include a plurality of anomaly detectors that together implement an algorithm to identify low probability events and detect atypical traffic patterns. The atypical traffic patterns can then be classified as being of interest or not. In one particular example, in a network environment, the classification can be whether the network traffic is malicious or not.

40 CFR 40.160-3 - Reporting of inventions.

Science.gov (United States)

2010-07-01

... application. (b) A final invention report is required within 90 days after completion of the project period... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Reporting of inventions. 40.160-3... ASSISTANCE RESEARCH AND DEMONSTRATION GRANTS § 40.160-3 Reporting of inventions. As provided in appendix B of...

Design and construction of a large-scale sand-bentonite seal for controlled gas release from a L/ILW repository - The GAST project at GTS

International Nuclear Information System (INIS)

Rueedi, J.; Marschall, P.; Vaissiere, R. de la; Jung, H.; Reinhold, M.; Steiner, P.; Garcia-Sineriz, J.L.

2012-01-01

experiments on the real scale are needed for benchmarking the performance of the two-phase flow models. The Gas-Permeable Seal Test (GAST) was initiated in 2010 as a GTS partner project with Andra and KRMC as project partners. The experiment was emplaced at Grimsel Test Site (GTS) in 2011/2012. The S/B seal with a length of 8 m and a diameter of 3m was emplaced to demonstrate the effective functioning of gas permeable seals at realistic scales and under realistic hydraulic boundary conditions ('proof of concept'). The latter condition required the experiment to be emplaced in an existing TBM (tunnel boring machine) drilled tunnel at GTS where the surrounding granite has shown to provide a negligible excavation damaged zone (EDZ) and the stiff rock enables water injection at pressures similar to those expected for a L/ILW repository seal, i.e. 3-5 MPa corresponding to the hydrostatic pressure at 300-500 m depth. The S/B body was compacted manually in horizontal sheets of about 10 cm thickness with a target dry density of 1.7 g/cm 3 . The remaining head space as well as all S/B interfaces (i.e. towards granite and concrete plug) were sealed with granular bentonite and/or with bentonite blocks. The experiment is planned to be saturated until 2014 followed by gas injection from the far end of the tunnel in 2015. The experiment aims at validating and, if necessary, improving current conceptual models for the re-saturation and gas invasion processes into S/B seals and the determination of up-scaled gas / water permeabilities of S/B seals (i.e. two-phase flow parameters for large-scale models). For this reason material saturation, water pressures and earth pressures are monitored continuously by more than 150 sensors distributed among 15 instrumentation cross sections, comprising of piezometers for pore pressure, relative humidity sensors, psychrometers and TDRs for water saturation, total pressure cells for stress state and piezo-crystals for seismic tomography. All instruments and

Description and detection of burst events in turbulent flows

Science.gov (United States)

Schmid, P. J.; García-Gutierrez, A.; Jiménez, J.

2018-04-01

A mathematical and computational framework is developed for the detection and identification of coherent structures in turbulent wall-bounded shear flows. In a first step, this data-based technique will use an embedding methodology to formulate the fluid motion as a phase-space trajectory, from which state-transition probabilities can be computed. Within this formalism, a second step then applies repeated clustering and graph-community techniques to determine a hierarchy of coherent structures ranked by their persistencies. This latter information will be used to detect highly transitory states that act as precursors to violent and intermittent events in turbulent fluid motion (e.g., bursts). Used as an analysis tool, this technique allows the objective identification of intermittent (but important) events in turbulent fluid motion; however, it also lays the foundation for advanced control strategies for their manipulation. The techniques are applied to low-dimensional model equations for turbulent transport, such as the self-sustaining process (SSP), for varying levels of complexity.

Detection of lymphovascular invasion in early breast cancer by D2-40 (podoplanin): a clinically useful predictor for axillary lymph node metastases.

NARCIS (Netherlands)

Braun, M.; Flucke, U.E.; Debald, M.; Walgenbach-Bruenagel, G.; Walgenbach, K.J.; Holler, T.; Polcher, M.; Wolfgarten, M.; Sauerwald, A.; Keyver-Paik, M.; Kuhr, M.; Buttner, R.; Kuhn, W.

2008-01-01

PURPOSE: The aim of this study was to investigate the use of D2-40 for the detection of lymphovascular invasion (LVI) in node positive and negative early breast cancer. LVI is associated with axillary lymph node metastases (ALNM) and a long-term prognostic factor. A precise identification of LVI

Modelling the enigmatic Late Pliocene Glacial Event - Marine Isotope Stage M2

Science.gov (United States)

Dolan, Aisling M.; Haywood, Alan M.; Hunter, Stephen J.; Tindall, Julia C.; Dowsett, Harry J.; Hill, Daniel J.; Pickering, Steven J.

2015-01-01

The Pliocene Epoch (5.2 to 2.58 Ma) has often been targeted to investigate the nature of warm climates. However, climate records for the Pliocene exhibit significant variability and show intervals that apparently experienced a cooler than modern climate. Marine Isotope Stage (MIS) M2 (~ 3.3 Ma) is a globally recognisable cooling event that disturbs an otherwise relatively (compared to present-day) warm background climate state. It remains unclear whether this event corresponds to significant ice sheet build-up in the Northern and Southern Hemisphere. Estimates of sea level for this interval vary, and range from modern values to estimates of 65 m sea level fall with respect to present day. Here we implement plausible M2 ice sheet configurations into a coupled atmosphere–ocean climate model to test the hypothesis that larger-than-modern ice sheet configurations may have existed at M2. Climate model results are compared with proxy climate data available for M2 to assess the plausibility of each ice sheet configuration. Whilst the outcomes of our data/model comparisons are not in all cases straight forward to interpret, there is little indication that results from model simulations in which significant ice masses have been prescribed in the Northern Hemisphere are incompatible with proxy data from the North Atlantic, Northeast Arctic Russia, North Africa and the Southern Ocean. Therefore, our model results do not preclude the possibility of the existence of larger ice masses during M2 in the Northern or Southern Hemisphere. Specifically they are not able to discount the possibility of significant ice masses in the Northern Hemisphere during the M2 event, consistent with a global sea-level fall of between 40 m and 60 m. This study highlights the general need for more focused and coordinated data generation in the future to improve the coverage and consistency in proxy records for M2, which will allow these and future M2 sensitivity tests to be interrogated

Anti-basal ganglia antibodies and Tourette's syndrome: a voxel-based morphometry and diffusion tensor imaging study in an adult population.

Science.gov (United States)

Martino, D; Draganski, B; Cavanna, A; Church, A; Defazio, G; Robertson, M M; Frackowiak, R S J; Giovannoni, G; Critchley, H D

2008-07-01

Anti-basal ganglia antibodies (ABGAs) have been suggested to be a hallmark of autoimmunity in Gilles de la Tourette's syndrome (GTS), possibly related to prior exposure to streptococcal infection. In order to detect whether the presence of ABGAs was associated with subtle structural changes in GTS, whole-brain analysis using independent sets of T(1) and diffusion tensor imaging MRI-based methods were performed on 22 adults with GTS with (n = 9) and without (n = 13) detectable ABGAs in the serum. Voxel-based morphometry analysis failed to detect any significant difference in grey matter density between ABGA-positive and ABGA-negative groups in caudate nuclei, putamina, thalami and frontal lobes. These results suggest that ABGA synthesis is not related to structural changes in grey and white matter (detectable with these methods) within frontostriatal circuits.

Why conventional detection methods fail in identifying the existence of contamination events.

Science.gov (United States)

Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

2016-04-15

Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

Three-gamma annihilation of ortho-positronium in NiO/γ-Al2O3 catalysts detected by positron lifetime and coincidence Doppler broadening measurements

International Nuclear Information System (INIS)

Huang, S.H.; Chen, Z.Q.; Zhang, H.J.

2012-01-01

The pore structure of NiO/γ-Al 2 O 3 catalysts is characterized by positron lifetime and Doppler broadening measurements. A very long lifetime τ 4 of 92 ns is resolved from the positron lifetime spectrum measured for pure Al 2 O 3 , which could be attributed to the ortho-positronium (o-Ps) lifetime in large pores. It was also found that the fitted lifetime τ 4 and its corresponding intensity I 4 obtained from the lifetime spectra both decrease with narrowing energy window of the stop channel in the fast–fast coincidence lifetime measurement system. This suggests that the ultra long lifetime is primarily due to the self annihilation of o-Ps which emits three gamma-rays. Such 3γ annihilation is further evidenced by measuring the Doppler broadening of annihilation gamma rays in coincidence with the prompt gamma rays (1.28 MeV) emitted from the 22 Na positron source. In NiO/γ-Al 2 O 3 catalysts both the lifetime τ 4 and its intensity I 4 decreases with increasing NiO content (from 3 wt% to 40 wt%), which indicates decreasing of the number of 3γ events. The 3γ annihilation parameter analyzed from the coincidence Doppler broadening spectrum shows consistent decrease with increasing NiO content. - Highlights: ► Above paper reported study of the 3-gamma annihilation of o-Ps. ► 3γ annihilation was verified by varying the energy window of the lifetime system. ► A new coincidence Doppler broadening technique is also used to record 3γ events. ► 3γ parameter decreases with NiO content in NiO/γ-Al 2 O 3 catalysts.

Treatment of complementary events in event trees in constructing linked fault trees for level 1 and level 2 PRA

International Nuclear Information System (INIS)

Jo, Y. G.

2008-01-01

Complementary events in the event trees for a PRA model should be treated properly in order to evaluate plant risk correctly. In this study, the characteristics of the following three different cut-set generation methods were investigated first in order to find the best practical way for treating complementary events: 1) exact method which treats complementary events logically, 2) no-delete term method which does not treat complementary events at all, and 3) delete term method which treats complementary events by deleting nonsense cut-sets which are generated as a result of ignoring complementary events. Then, practical methods for treating complementary events in constructing linked fault trees for level 1 and level 2 PRA in EPRI R and R workstation software environment, where CAFTA is the fault tree editor and FORTE is the cut-set engine, were suggested and demonstrated. The suggested methods deal with the following selected four typical cases: Case 1: an event tree event (E) is represented by a fault tree gate whose inputs consist of only fault tree gates, Case 2: E is represented by a single basic event, Case 3: E is represented by an OR fault tree gate which has a single basic event and a fault tree gate as inputs, and Case 4: E is represented by an AND fault tree gate which has a single basic event and a fault tree gate as inputs. In the suggested methods, first the high level logic structures of event tree events are examined and restructured, if needed. Then, the delete term method, the exact method, and the combination of the two methods are applied to Case 1, Case 2, and Cases 3 and 4, respectively. Also, it is recommended to treat complementary events, using the suggested methods, before level 1 and level 2 PRA fault trees are coupled. It should be noted that the selected four typical cases may not cover all different cases encountered in level 1 and level 2 PRA modeling. However, a process similar to the one suggested in this study may be used to find

Investigation of SNP rs2060546 immediately upstream to NTN4 in a Danish Gilles de la Tourette syndrome cohort

Directory of Open Access Journals (Sweden)

Shanmukha Sampath Padmanabhuni

2016-11-01

Full Text Available Gilles de la Tourette syndrome (GTS is a neuropsychiatric disorder characterized by multiple motor and vocal tics. GTS is a complex disorder, with environmental factors and several genes involved. Although variations within a few genes such as AADAC, NRXN1, SLITRK1, HDC, and IMMP2L have been tentatively associated with GTS (in a small number of patients, the causative genes underlying GTS pathophysiology remain unknown. In a previous genome-wide association study (GWAS a single nucleotide polymorphism (SNP, rs2060546 near the Netrin-4 (NTN4 - MIM 610401 gene was shown to be associated with GTS [odds ratio (OR = 1.7; p-value = 5.8x10-7] thus warranting further investigations. As NTN4 is one of the axon guidance molecules expressed in the central nervous system and it interacts with encoded protein of SLIT and WNT genes guiding the growth cone towards its target, it is an attractive candidate susceptibility gene for GTS. In this study we attempted to replicate the association of rs2060546 with GTS by genotyping a cohort of 240 Danish GTS patients and 1007 healthy controls. Our results did not reveal an association (OR= 1.363; p-value = 0.3329 in the Danish cohort alone, which may be due to the small sample size. However, a meta-analysis including the present cohort and a total of 1316 GTS patients and 5023 controls from GTS GWAS Replication Initiative (GGRI and the first GTS-GWAS yielded a significant signal (OR = 3.74; p-value = 0.00018 and same direction of effect in the three cohorts. Thus, our study strengthens the evidence of the possible involvement of NTN4 in GTS etiology, suggesting that further studies in even larger samples and functional studies are warranted to investigate the role of this region in GTS pathogenesis.

40 CFR 721.10175 - 1-Propanaminium, N-(3-aminopropyl)-2-hydroxy-N,N-dimethyl-3-sulfo-, N-(C12-18 and C18-unsatd...

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false 1-Propanaminium, N-(3-aminopropyl)-2... 1-Propanaminium, N-(3-aminopropyl)-2-hydroxy-N,N-dimethyl-3-sulfo-, N-(C12-18 and C18-unsatd. acyl... chemical substance identified as 1-Propanaminium, N-(3-aminopropyl)-2-hydroxy-N,N-dimethyl-3-sulfo-, N-(C12...

Simulation and prototyping of 2 m long resistive plate chambers for detection of fast neutrons and multi-neutron event identification

Energy Technology Data Exchange (ETDEWEB)

Elekes, Z., E-mail: z.elekes@hzdr.de [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Aumann, T. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Technische Universität Darmstadt, Darmstadt (Germany); Bemmerer, D. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Boretzky, K. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Caesar, C. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Technische Universität Darmstadt, Darmstadt (Germany); Cowan, T.C. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Technische Universität Dresden, Dresden (Germany); Hehner, J.; Heil, M. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Kempe, M. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Rossi, D. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Röder, M. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Technische Universität Dresden, Dresden (Germany); Simon, H. [GSI Helmholtzzentrumfür Schwerionenforschung, Darmstadt (Germany); Sobiella, M.; Stach, D. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Reinhardt, T. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Technische Universität Dresden, Dresden (Germany); Wagner, A.; Yakorev, D. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Zilges, A. [Universität zu Köln, Köln (Germany); Zuber, K. [Technische Universität Dresden, Dresden (Germany)

2013-02-11

Resistive plate chamber (RPC) prototypes of 2 m length were simulated and built. The experimental tests using a 31 MeV electron beam, discussed in details, showed an efficiency higher than 90% and an excellent time resolution of around σ=100ps. Furthermore, comprehensive simulations were performed by GEANT4 toolkit in order to study the possible use of these RPCs for fast neutron (200 MeV–1 GeV) detection and multi-neutron event identification. The validation of simulation parameters was carried out via a comparison to experimental data. A possible setup for invariant mass spectroscopy of multi-neutron emission is presented and the characteristics are discussed. The results show that the setup has a high detection efficiency. Its capability of determining the momentum of the outgoing neutrons and reconstructing the relative energy between the fragments from nuclear reactions is demonstrated for different scenarios.

Ontology-based knowledge management for personalized adverse drug events detection.

Science.gov (United States)

Cao, Feng; Sun, Xingzhi; Wang, Xiaoyuan; Li, Bo; Li, Jing; Pan, Yue

2011-01-01

Since Adverse Drug Event (ADE) has become a leading cause of death around the world, there arises high demand for helping clinicians or patients to identify possible hazards from drug effects. Motivated by this, we present a personalized ADE detection system, with the focus on applying ontology-based knowledge management techniques to enhance ADE detection services. The development of electronic health records makes it possible to automate the personalized ADE detection, i.e., to take patient clinical conditions into account during ADE detection. Specifically, we define the ADE ontology to uniformly manage the ADE knowledge from multiple sources. We take advantage of the rich semantics from the terminology SNOMED-CT and apply it to ADE detection via the semantic query and reasoning.

Detection of red tide events in the Ariake Sound, Japan

Science.gov (United States)

Ishizaka, Joji

2003-05-01

High resolution SeaWiFS data was used to detect a red tide event occurred in the Ariake Sound, Japan, in winter of 2000 to 2001. The area is small embayment surrounding by tidal flat, and it is known as one of the most productive areas in coast of Japan. The red tide event damaged to seaweed (Nori) culture, and the relation to the reclamation at the Isahaya Bay in the Sound has been discussed. SeaWiFS chlorophyll data showed the red tide started early December 2000, from the Isahaya Bay, although direct relationship to the reclamation was not clear. The red tide persisted to the end of February. Monthly average of SeaWiFS data from May 1998 to December 2001 indicated that the chlorophyll increased twice a year, early summer and fall after the rain. The red tide event was part of the fall bloom which started later and continued longer than other years. Ocean color is useful to detect the red tide; however, it is required to improve the algorithms to accurately estimate chlorophyll in high turbid water and to discriminate toxic flagellates.

Event displays from Beam 2 in ATLAS, November 20th, 2009

CERN Multimedia

ATLAS collaboration

2009-01-01

ATLAS event displays and related information from the LHC restart in 2009. We recorded today, Friday November 20th, the first so-called "Beam Splash" events. For these events the beam in one arm of the LHC was dumped onto closed collimators located 140 meters upstream and downstream of ATLAS. The collision leads to a large number of detectable secondary particles longitudinally traversing the detect

Video2vec Embeddings Recognize Events When Examples Are Scarce.

Science.gov (United States)

Habibian, Amirhossein; Mensink, Thomas; Snoek, Cees G M

2017-10-01

This paper aims for event recognition when video examples are scarce or even completely absent. The key in such a challenging setting is a semantic video representation. Rather than building the representation from individual attribute detectors and their annotations, we propose to learn the entire representation from freely available web videos and their descriptions using an embedding between video features and term vectors. In our proposed embedding, which we call Video2vec, the correlations between the words are utilized to learn a more effective representation by optimizing a joint objective balancing descriptiveness and predictability. We show how learning the Video2vec embedding using a multimodal predictability loss, including appearance, motion and audio features, results in a better predictable representation. We also propose an event specific variant of Video2vec to learn a more accurate representation for the words, which are indicative of the event, by introducing a term sensitive descriptiveness loss. Our experiments on three challenging collections of web videos from the NIST TRECVID Multimedia Event Detection and Columbia Consumer Videos datasets demonstrate: i) the advantages of Video2vec over representations using attributes or alternative embeddings, ii) the benefit of fusing video modalities by an embedding over common strategies, iii) the complementarity of term sensitive descriptiveness and multimodal predictability for event recognition. By its ability to improve predictability of present day audio-visual video features, while at the same time maximizing their semantic descriptiveness, Video2vec leads to state-of-the-art accuracy for both few- and zero-example recognition of events in video.

D2-40/podoplanin expression in the human placenta

Science.gov (United States)

Wang, Yuping; Sun, Jingxia; Gu, Yang; Zhao, Shuang; Groome, Lynn J.; Alexander, J. Steven

2011-01-01

Placental tissue expresses many lymphatic markers. The current study was undertaken to examine if D2-40/podoplanin, a lymphatic endothelial marker, was expressed in the human placentas, and how it is altered developmentally and pathologically. We studied D2-40/podoplanin and VEGFR-3 expressions in placentas from normotensive pregnancies at different gestational ages and in placentas from women with clinically defined preeclampsia. D2-40 expression in systemic lymphatic vessel endothelium served as a positive control. Protein expression for D2-40, VEGFR-3, and β-actin were determined by Western blot in placentas from normotensive (n=6) and preeclamptic (n=5) pregnancies. Our results show that D2-40/podoplanin was strongly expressed in the placenta, mainly as a network plexus pattern in the villous stroma throughout gestation. CD31 was limited to villous core fetal vessel endothelium and VEGFR-3 was found in both villous core fetal vessel endothelium and trophoblasts. D2-40/podoplanin expression was significantly decreased, and VEGFR-3 significantly increased in preeclamptic placental tissues compared to normotensive placental controls. Placental villous stroma is a reticular-like structure, and the localization of D2-40 to the stroma suggests that a lymphatic-like conductive network may exist in the human placenta. D2-40/podoplanin is an O-linked sialoglycoprotein. Although little is known regarding biological functions of sialylated glycoproteins within the placenta, placental D2-40/podoplanin may support fetal vessel angiogenesis during placenta development and reduced D2-40/podoplanin expression in preeclamptic placenta may contribute to altered interstitial fluid homeostasis and impaired angiogenesis in this pregnancy disorder. PMID:21095001

Event detection intelligent camera development

International Nuclear Information System (INIS)

Szappanos, A.; Kocsis, G.; Molnar, A.; Sarkozi, J.; Zoletnik, S.

2008-01-01

A new camera system 'event detection intelligent camera' (EDICAM) is being developed for the video diagnostics of W-7X stellarator, which consists of 10 distinct and standalone measurement channels each holding a camera. Different operation modes will be implemented for continuous and for triggered readout as well. Hardware level trigger signals will be generated from real time image processing algorithms optimized for digital signal processor (DSP) and field programmable gate array (FPGA) architectures. At full resolution a camera sends 12 bit sampled 1280 x 1024 pixels with 444 fps which means 1.43 Terabyte over half an hour. To analyse such a huge amount of data is time consuming and has a high computational complexity. We plan to overcome this problem by EDICAM's preprocessing concepts. EDICAM camera system integrates all the advantages of CMOS sensor chip technology and fast network connections. EDICAM is built up from three different modules with two interfaces. A sensor module (SM) with reduced hardware and functional elements to reach a small and compact size and robust action in harmful environment as well. An image processing and control unit (IPCU) module handles the entire user predefined events and runs image processing algorithms to generate trigger signals. Finally a 10 Gigabit Ethernet compatible image readout card functions as the network interface for the PC. In this contribution all the concepts of EDICAM and the functions of the distinct modules are described

Performance of a 64-channel, 3.2×3.2 cm2 SiPM tile for TOF-PET application

International Nuclear Information System (INIS)

Ferri, Alessandro; Acerbi, Fabio; Gola, Alberto; Piemonte, Claudio; Paternoster, Giovanni; Zorzi, Nicola

2016-01-01

In this work, we present a new 3.2×3.2 cm 2 detector tile, composed of 8×8 single SiPMs, having a regular 4 mm pitch in both the X and Y directions. The tile fill factor is 85%. We produced two versions of the tile with different SiPM technologies: RGB-HD and NUV. The first one features square micro-cells with 25 µm pitch, a PDE peaked at 550 nm and a DCR of 300 kHz/mm 2 , at 20 °C and at maximum detection efficiency. The second one features micro-cells with 40 µm pitch and a PDE peaked in the blue part of the spectrum. The dark count rate at 20 °C and at maximum PDE is 100 kHz/mm 2 . In this work, we show the energy and timing resolution measurements at 511 keV obtained coupling the two tiles to an 8×8 LYSO array with a pixel size of 4×4×22 mm 3 , perfectly matching the photo-detector array.

Facilitating Follow-up of LIGO–Virgo Events Using Rapid Sky Localization

Energy Technology Data Exchange (ETDEWEB)

Chen, Hsin-Yu [Department of Astronomy and Astrophysics and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Holz, Daniel E. [Enrico Fermi Institute, Department of Physics, Department of Astronomy and Astrophysics, and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States)

2017-05-10

We discuss an algorithm for accurate and very low-latency (<1 s) localization of gravitational-wave (GW) sources using only the relative times of arrival, relative phases, and relative signal-to-noise ratios for pairs of detectors. The algorithm is independent of distances and masses to leading order, and can be generalized to all discrete (as opposed to stochastic and continuous) sources detected by ground-based detector networks. Our approach is similar to that of BAYESTAR with a few modifications, which result in increased computational efficiency. For the LIGO two-detector configuration (Hanford+Livingston) operating in O1 we find a median 50% (90%) localization of 143 deg{sup 2} (558 deg{sup 2}) for binary neutron stars. We use our algorithm to explore the improvement in localization resulting from loud events, finding that the loudest out of the first 4 (or 10) events reduces the median sky-localization area by a factor of 1.9 (3.0) for the case of two GW detectors, and 2.2 (4.0) for three detectors. We also consider the case of multi-messenger joint detections in both the gravitational and the electromagnetic radiation, and show that joint localization can offer significant improvements (e.g., in the case of LIGO and Fermi /GBM joint detections). We show that a prior on the binary inclination, potentially arising from GRB observations, has a negligible effect on GW localization. Our algorithm is simple, fast, and accurate, and may be of particular utility in the development of multi-messenger astronomy.

{sup 123}I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

Energy Technology Data Exchange (ETDEWEB)

Horiguchi, Yoriko; Morita, Yukiko [National Hospital Organization Sagamihara National Hospital, Department of Cardiology, Sagamihara City, Kanagawa (Japan); Tsurikisawa, Naomi; Akiyama, Kazuo [National Hospital Organization Sagamihara National Hospital, Clinical Research Centre for Allergy and Rheumatology, Sagamihara City, Kanagawa (Japan)

2011-02-15

In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. {sup 123}I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using {sup 123}I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M {<=} 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP {<=} 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. {sup 123}I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

Science.gov (United States)

Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

2017-05-01

We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Assessment of urinary cotinine as a marker of nicotine absorption from tobacco leaves: a study on tobacco farmers in Malaysia.

Science.gov (United States)

Onuki, Mayumi; Yokoyama, Kazuhito; Kimura, Kaoru; Sato, Hajime; Nordin, Rusli Bin; Naing, Lin; Morita, Yoko; Sakai, Tadashi; Kobayashi, Yasuki; Araki, Shunichi

2003-05-01

To assess dermal absorption of nicotine from tobacco leaves in relation to Green Tobacco Sickness (GTS), urinary cotinine concentrations were measured in 80 male tobacco-growing farmers and in 40 healthy males (controls) who did not handle wet tobacco leaves in Kelantan, Malaysia. Among non-smokers, urinary cotinine levels in farmers were significantly higher than those of controls; farmers with urinary cotinine of 50 ng/ml/m2 or above showed eye symptoms more frequently than those below this level (ptobacco farmers evidence a risk of nicotine poisoning from tobacco leaves, assessment including GTS together with effects of pesticides will be necessary.

Atmospheric deposition of 7Be by rain events, incentral Argentina

Science.gov (United States)

Ayub, J. Juri; Di Gregorio, D. E.; Huck, H.; Velasco, H.; Rizzotto, M.

2008-08-01

Beryllium-7 is a natural radionuclide that enters into the ecosystems through wet and dry depositions and has numerous environmental applications in terrestrial and aquatic ecosystems. Atmospheric wet deposition of 7Be was measured in central Argentina. Rain traps were installed (1 m above ground) and individual rain events have been collected. Rain samples were filtered and analyzed by gamma spectrometry. The gamma counting was undertaken using a 40%-efficient p-type coaxial intrinsic high-purity natural germanium crystal built by Princeton Gamma-Tech. The cryostat was made from electroformed high-purity copper using ultralow-background technology. The detector was surrounded by 50 cm of lead bricks to provide shielding against radioactive background. The detector gamma efficiency was determined using a water solution with known amounts of chemical compounds containing long-lived naturally occurring radioisotopes, 176Lu, 138La and 40K. Due to the geometry of the sample and its position close to the detector, the efficiency points from the 176Lu decay, had to be corrected for summing effects. The measured samples were 400 ml in size and were counted curing one day. The 7Be detection limit for the present measurements was as low as 0.2 Bq l-1. Thirty two rain events were sampled and analyzed (November 2006-May 2007). The measured values show that the events corresponding to low rainfall (<20 mm) are characterized by significantly higher activity concentrations (Bq l-1). The activity concentration of each individual event varied from 0.8 to 3.5 Bq l-1, while precipitations varied between 4 and 70 mm. The integrated activity by event of 7Be was fitted with a model that takes into account the precipitation amount and the elapsed time between two rain events. The integrated activities calculated with this model show a good agreement with experimental values.

AGAPEROS Searches for microlensing in the LMC with the Pixel Method; 2, Selection of possible microlensing events

CERN Document Server

Melchior, A.L.; Ansari, R; Aubourg, E.; Baillon, P.; Bareyre, P.; Bauer, F.; Beaulieu, J.-Ph.; Bouquet, A.; Brehin, S.; Cavalier, F.; Char, S.; Couchot, F.; Coutures, C.; Ferlet, R.; Fernandez, J.; Gaucherel, C.; Giraud-Heraud, Y.; Glicenstein, J.-F.; Goldman, B.; Gondolo, P.; Gros, M.; Guibert, J.; Hardin, D.; Kaplan, J.; de Kat, J.; Lachieze-Rey, M.; Laurent, B; Lesquoy, E; Magneville, Ch.; Mansoux, B.; Marquette, J.-B.; Maurice, E.; Milsztajn, A.; Moniez, M.; Moreau, O.; Moscoso, L.; Palanque-Delabrouille, N.; Perdereau. O.; Prevot, L.; Renault, C.; Queinnec, F.; Rich, J.; Spiro, M.; Vidal-Madjar, A.; Vigroux, L.; Zylberajch, S.; Magneville, Ch.

1998-01-01

We apply the pixel method of analysis (sometimes called ``pixel lensing'') to a small subset of the EROS-1 microlensing observations of the bar of the Large Magellanic Cloud (LMC). The pixel method is designed to find microlensing events of unresolved source stars and had heretofore been applied only to M31 where essentially all sources are unresolved. With our analysis optimised for the detection of long-duration microlensing events due to 0.01-1 Mo Machos, we detect no microlensing events and compute the corresponding detection efficiencies. We show that the pixel method should detect 10 to 20 times more microlensing events for M>0.05 Mo Machos compared to a classical analysis of the same data which latter monitors only resolved stars. In particular, we show that for a full halo of Machos in the mass range 0.1 -- 0.5 Mo, a pixel analysis of the three-year EROS-1 data set covering 0.39 deg^2 would yield 4 events.

Integrated hydraulic and organophosphate pesticide injection simulations for enhancing event detection in water distribution systems.

Science.gov (United States)

Schwartz, Rafi; Lahav, Ori; Ostfeld, Avi

2014-10-15

As a complementary step towards solving the general event detection problem of water distribution systems, injection of the organophosphate pesticides, chlorpyrifos (CP) and parathion (PA), were simulated at various locations within example networks and hydraulic parameters were calculated over 24-h duration. The uniqueness of this study is that the chemical reactions and byproducts of the contaminants' oxidation were also simulated, as well as other indicative water quality parameters such as alkalinity, acidity, pH and the total concentration of free chlorine species. The information on the change in water quality parameters induced by the contaminant injection may facilitate on-line detection of an actual event involving this specific substance and pave the way to development of a generic methodology for detecting events involving introduction of pesticides into water distribution systems. Simulation of the contaminant injection was performed at several nodes within two different networks. For each injection, concentrations of the relevant contaminants' mother and daughter species, free chlorine species and water quality parameters, were simulated at nodes downstream of the injection location. The results indicate that injection of these substances can be detected at certain conditions by a very rapid drop in Cl2, functioning as the indicative parameter, as well as a drop in alkalinity concentration and a small decrease in pH, both functioning as supporting parameters, whose usage may reduce false positive alarms. Copyright © 2014 Elsevier Ltd. All rights reserved.

Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

Science.gov (United States)

Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

2017-07-01

One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

A robust neural network-based approach for microseismic event detection

KAUST Repository

Akram, Jubran; Ovcharenko, Oleg; Peter, Daniel

2017-01-01

We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset

Complex Event Detection via Multi Source Video Attributes (Open Access)

Science.gov (United States)

2013-10-03

Complex Event Detection via Multi-Source Video Attributes Zhigang Ma† Yi Yang‡ Zhongwen Xu‡§ Shuicheng Yan Nicu Sebe† Alexander G. Hauptmann...under its International Research Centre @ Singapore Fund- ing Initiative and administered by the IDM Programme Of- fice, and the Intelligence Advanced

Energy Reconstruction for Events Detected in TES X-ray Detectors

Science.gov (United States)

Ceballos, M. T.; Cardiel, N.; Cobo, B.

2015-09-01

The processing of the X-ray events detected by a TES (Transition Edge Sensor) device (such as the one that will be proposed in the ESA AO call for instruments for the Athena mission (Nandra et al. 2013) as a high spectral resolution instrument, X-IFU (Barret et al. 2013)), is a several step procedure that starts with the detection of the current pulses in a noisy signal and ends up with their energy reconstruction. For this last stage, an energy calibration process is required to convert the pseudo energies measured in the detector to the real energies of the incoming photons, accounting for possible nonlinearity effects in the detector. We present the details of the energy calibration algorithm we implemented as the last part of the Event Processing software that we are developing for the X-IFU instrument, that permits the calculation of the calibration constants in an analytical way.

Discrepancy detection in the retrieval-enhanced suggestibility paradigm.

Science.gov (United States)

Butler, Brendon Jerome; Loftus, Elizabeth F

2018-04-01

Retrieval-enhanced suggestibility (RES) refers to the finding that immediately recalling the details of a witnessed event can increase susceptibility to later misinformation. In three experiments, we sought to gain a deeper understanding of the role that retrieval plays in the RES paradigm. Consistent with past research, initial testing did increase susceptibility to misinformation - but only for those who failed to detect discrepancies between the original event and the post-event misinformation. In all three experiments, subjects who retrospectively detected discrepancies in the post-event narratives were more resistant to misinformation than those who did not. In Experiments 2 and 3, having subjects concurrently assess the consistency of the misinformation narratives negated the RES effect. Interestingly, in Experiments 2 and 3, subjects who had retrieval practice and detected discrepancies were more likely to endorse misinformation than control subjects who detected discrepancies. These results call attention to limiting conditions of the RES effect and highlight the complex relationship between retrieval practice, discrepancy detection, and misinformation endorsement.

Detection of D2-40 monoclonal antibody-labeled lymphatic vessel invasion in esophageal squamous cell carcinoma and its clinicopathologic significance

International Nuclear Information System (INIS)

Bai, Bing; Ma, Wei; Wang, Kai; Ha, Sita; Wang, Jian-Bo; Tan, Bing-Xu; Wang, Na-Na; Yang, Sheng-Si; Jia, Yi-Bin; Cheng, Yu-Feng

2013-01-01

This study aims to investigate the clinicopathologic significance of lymphatic vessel invasion (LVI) labeled by D2-40 monoclonal antibody in esophageal squamous cell carcinoma (ESCC). Immunohistochemical assay was used to detect the expression of D2-40 and LVI in 107 ESCC patients. Then, the correlation between the clinicopathologic feature and the overall survival time of the patients was analyzed. The lymph node metastasis rates were 70% and 21% in the LVI-positive and LVI-negative groups, respectively. The nodal metastasis rate was higher in the LVI-positive group than in the LVI-negative group. Multivariate regression analysis showed that LVI was related to nodal metastasis (P<0.001). The median survival time of the patients was 26 and 43 months in the LVI-positive and LVI-negative groups, respectively. Although univariate regression analysis showed significant difference between the two groups (P=0.014), multivariate regression analysis revealed that LVI was not an independent prognostic factor for overall survival in the ESCC patients (P=0.062). Lymphatic node metastasis (P=0.031), clinical stage (P=0.019), and residual tumor (P=0.026) were the independent prognostic factors. LVI labeled by D2-40 monoclonal antibody is a risk factor predictive of lymph node metastasis in ESCC patients

40 CFR 721.1000 - Benzenamine, 3-chloro-2,6-dinitro-N,N-dipropyl-4-(tri-fluoro-methyl)-.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Benzenamine, 3-chloro-2,6-dinitro-N,N-dipropyl-4-(tri-fluoro-methyl)-. 721.1000 Section 721.1000 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.1000 Benzenamine, 3-chloro-2,6-dinitro-N,N...

3,9-Dithia-6-azaundecane-appended Iridium (III) Complex for the Selective Detection of Hg2+ in Aqueous Acetonitrile

International Nuclear Information System (INIS)

Ann, Jee Hye; Li, Yinan; Hyun, Myung Ho

2012-01-01

Detection of mercuric ion (Hg 2+ ) originated from natural or industrial sources is very important because it is extremely toxic even at low levels and causes serious environmental and health problems. Consequently, many efforts have been devoted to the development of sensitive chemosensors for the detection of Hg 2+ . For example, various fluorescent chemosensors based on rhodamine, nitrobenzoxadiazole, fluorescein, boradiazaindacene (BODIPY), dansyl, pyrene, or other fluorophores have been developed for the selective detection of Hg 2+ . While various fluorescent chemosensors for the selective detection of Hg 2+ have been developed, phosphorescent chemosensors for the selective detection of Hg 2+ are relatively rare. Among various phosphors, iridium (III) complexes with sulfur containing cyclometalated ligands have been used as phosphorescent chemosensors for the selective detection of Hg 2+ . Azacrown ether-appended iridium (III) complex developed in our laboratory has also been utilized as a phosphorescent chemosensor for the selective detection of Hg 2+ . As an another iridium (III) complex-based phosphorescent chemosensors for the selective detection of Hg 2+ , in this study, we wish to prepare iridium (III) complex containing two 3,9-dithia-6-azaundecane units as chelating ligands for metal ions. Some fluorophores containing 3,9-dithia-6-azaundecane unit have been successfully applied for the selective detection of Hg 2+ . In this instance, iridium (III) complex containing two 3,9-dithia-6-azaundecane units is expected to be useful as a phosphorescent chemosensor for the selective detection of Hg 2+ . Iridium (III) complex containing two 3,9-dithia-6-azaundecane units was prepared starting from 2-phenylpyridine according to the procedure shown in Scheme 1. 2-Phenylpyridine was transformed into chloride bridged dimeric iridium complex, [(ppy) 2 IrCl] 2 , via the reported procedure. By treating [(ppy) 2 IrCl] 2 with 4,4'-bis(bromomethyl)-2,2'-bipyridine, which

Gilles de la Tourette Syndrome, Depression, Depressive Illness, and Correlates in a Child and Adolescent Population.

Science.gov (United States)

Rizzo, Renata; Gulisano, Mariangela; Martino, Davide; Robertson, Mary May

2017-04-01

Gilles de la Tourette syndrome (GTS) and depression are both common disorders. It has been suggested that depression occurs in 13%-76% GTS patients. Despite this, there are few studies into the specific relationships and correlates between the two disorders. There is only some consensus as to the precise relationship between the two disorders. We undertook the study to investigate the relationship between depressive symptomatology and the core clinical features of GTS in a well-characterized clinical population of youth with this disorder. Our aim was to verify the association between depression and comorbid obsessive-compulsive disorder and explore further other potential associations highlighted in some, but not all, of the studies focused on this topic. Our results demonstrated that (1) the GTS patients were significantly older than the controls, (2) the GTS patients were significantly more depressed than controls, (3) depression was associated with tic severity, (4) the Diagnostic Confidence Index scores were higher in GTS patients without depression, (5) anxiety, attention-deficit/hyperactivity disorder (ADHD), conduct disorder (CD), and behavioral problems were significantly associated with depression, and (6) finally, patients with GTS and depression have a positive family history of depression. However, obsessionality (CY-BOCS) did not differentiate between depressed and not depressed GTS patients. Depression is common in patients with GTS and occurs significantly more in GTS than in controls. Depression is significantly associated with GTS factors such as tic severity, comorbidity with ADHD, and the presence of coexistent anxiety, CDs, and behavior problems. Depression is importantly significantly associated with a positive family history of depression. Intriguingly, depression in our sample was not related to obsessionality.

A STATISTICAL STUDY OF SOLAR ELECTRON EVENTS OVER ONE SOLAR CYCLE

International Nuclear Information System (INIS)

Wang Linghua; Lin, R. P.; Krucker, Säm; Mason, Glenn M.

2012-01-01

We survey the statistical properties of 1191 solar electron events observed by the WIND 3DP instrument from 300 keV for a solar cycle (1995 through 2005). After taking into account times of high background, the corrected occurrence frequency of solar electron events versus peak flux exhibits a power-law distribution over three orders of magnitude with exponents between –1.0 and –1.6 for different years, comparable to the frequency distribution of solar proton events, microflares, and coronal mass ejections (CMEs), but significantly flatter than that of soft X-ray (SXR) flares. At 40 keV (2.8 keV), the integrated occurrence rate above ∼0.29 (∼330) cm –2 s –1 sr –1 keV –1 near 1 AU is ∼1000 year –1 (∼600 year –1 ) at solar maximum and ∼35 year –1 (∼25 year –1 ) at solar minimum, about an order of magnitude larger than the observed occurrence rate. We find these events typically extend over ∼45° in longitude, implying the occurrence rate over the whole Sun is ∼10 4 year –1 near solar maximum. The observed solar electron events have a 98.75% association with type III radio bursts, suggesting all type III bursts may be associated with a solar electron event. They have a close (∼76%) association with the presence of low-energy (∼0.02-2 MeV nucleon –1 ), 3 He-rich ( 3 He/ 4 He ≥ 0.01) ion emissions measured by the ACE ULEIS instrument. For these electron events, only ∼35% are associated with a reported GOES SXR flare, but ∼60% appear to be associated with a CME, with ∼50% of these CMEs being narrow. These electrons are often detected down to below 1 keV, indicating a source high in the corona.

Automated Feature and Event Detection with SDO AIA and HMI Data

Science.gov (United States)

Davey, Alisdair; Martens, P. C. H.; Attrill, G. D. R.; Engell, A.; Farid, S.; Grigis, P. C.; Kasper, J.; Korreck, K.; Saar, S. H.; Su, Y.; Testa, P.; Wills-Davey, M.; Savcheva, A.; Bernasconi, P. N.; Raouafi, N.-E.; Delouille, V. A.; Hochedez, J. F..; Cirtain, J. W.; Deforest, C. E.; Angryk, R. A.; de Moortel, I.; Wiegelmann, T.; Georgouli, M. K.; McAteer, R. T. J.; Hurlburt, N.; Timmons, R.

The Solar Dynamics Observatory (SDO) represents a new frontier in quantity and quality of solar data. At about 1.5 TB/day, the data will not be easily digestible by solar physicists using the same methods that have been employed for images from previous missions. In order for solar scientists to use the SDO data effectively they need meta-data that will allow them to identify and retrieve data sets that address their particular science questions. We are building a comprehensive computer vision pipeline for SDO, abstracting complete metadata on many of the features and events detectable on the Sun without human intervention. Our project unites more than a dozen individual, existing codes into a systematic tool that can be used by the entire solar community. The feature finding codes will run as part of the SDO Event Detection System (EDS) at the Joint Science Operations Center (JSOC; joint between Stanford and LMSAL). The metadata produced will be stored in the Heliophysics Event Knowledgebase (HEK), which will be accessible on-line for the rest of the world directly or via the Virtual Solar Observatory (VSO) . Solar scientists will be able to use the HEK to select event and feature data to download for science studies.

Distributed Event Detection in Wireless Sensor Networks for Disaster Management

NARCIS (Netherlands)

Bahrepour, M.; Meratnia, Nirvana; Poel, Mannes; Taghikhaki, Zahra; Havinga, Paul J.M.

2010-01-01

Recently, wireless sensor networks (WSNs) have become mature enough to go beyond being simple fine-grained continuous monitoring platforms and become one of the enabling technologies for disaster early-warning systems. Event detection functionality of WSNs can be of great help and importance for

DETECTION OF NONPOLAR IONS IN 2Π3/2 STATES BY RADIOASTRONOMY VIA MAGNETIC DIPOLE TRANSITIONS

International Nuclear Information System (INIS)

Morse, Michael D.; Maier, John P.

2011-01-01

The possibility of magnetic dipole-induced pure rotational transitions in the interstellar medium is investi- gated for symmetric Hund's case (a) linear molecules, such as H-C≡C-H + (X-tilde 2 Π 3/2u ), CO 2 + (X-tilde 2 Π 3/2g ), H-C≡C-C≡C-H + (X-tilde 2 Π 3/2g ), and N 3 (X-tilde 2 Π 3/2g ). These species lack an electric dipole moment and therefore cannot undergo pure rotational electric dipole transitions. These species can undergo pure rotational transitions via the parallel component of the magnetic dipole operator, however. The transition moments and Einstein A coefficients for the allowed pure rotational transitions are derived for a general Hund's case (a) linear molecule, and tabulated for the examples of H-C≡C-H + ( 2 Π 3/2u ) and H-C≡C-C≡C-H + ( 2 Π 3/2g ). It is found that the rates of emission are comparable to collision rates in interstellar clouds, suggesting that this decay mechanism may be important in simulating rotational population distributions in diffuse clouds and for detecting these molecules by radioastronomy. Expected line positions for the magnetic dipole-allowed R ef (J) and R fe (J) transitions of H-C≡C-H + ( 2 Π 3/2u ), H-C≡C-C≡C-H + ( 2 Π 3/2g ), CO 2 + ( 2 Π 3/2g ), and N 3 ( 2 Π 3/2g ) are tabulated to assist in their observation by radioastronomy or in the laboratory.

Detection of endogenous DNA adducts, O-carboxymethyl-2'-deoxyguanosine and 3-ethanesulfonic acid-2'-deoxycytidine, in the rat stomach after duodenal reflux.

Science.gov (United States)

Terasaki, Masaru; Totsuka, Yukari; Nishimura, Koichi; Mukaisho, Ken-Ichi; Chen, Kuan-Hao; Hattori, Takanori; Takamura-Enya, Takeji; Sugimura, Takashi; Wakabayashi, Keiji

2008-09-01

The endogenous DNA adducts O(6)-carboxymethyl-deoxyguanosine (O(6)-CM-dG) and 3-ethanesulfonic acid-deoxycytidine (3-ESA-dC) are produced from N-nitroso bile acid conjugates, such as N-nitrosoglycocholic acid (NO-GCA) and N-nitrosotaurocholic acid (NO-TCA), respectively. Formation of these DNA adducts in vivo was here analyzed by 32P-postlabeling in the glandular stomach of rats subjected to duodenal content reflux surgery. In this model, all duodenal contents, including bile acid conjugates, flow back from the jejunum into the gastric corpus. The levels of O(6)-CM-dG found at 4 and 8 weeks after surgery were 40.9 +/- 9.4 and 56.3 +/- 3.2 per 10(8) nucleotides, respectively, whereas the sham operation groups had values of 5.8 +/- 2.3 and 5.9 +/- 0.5 per 10(8) nucleotides. Moreover, adduct spots corresponding to 3-ESA-dC were detected in both duodenal reflux and sham operation groups and levels in the duodenal reflux groups were around four-fold elevated at 11.2 +/- 1.0 and 8.9 +/- 1.0 per 10(8) nucleotides after 4 and 8 weeks, respectively. When the duodenal reflux animals were treated with a nitrite trapping agent, thiazolidine- 4-carboxylic acid (thioproline, TPRO), the levels of O(6)-CM-dG and 3-ESA-dC were reduced to the same levels as in the sham operation animals. These observations suggest that NO-TCA and NO-GCA are formed by nitrosation of glycocholic acid and taurocholic acid, respectively, and these nitroso compounds produce DNA adducts in the glandular stomach of rats subjected to duodenal content reflux surgery.

Prescription-event monitoring: developments in signal detection.

Science.gov (United States)

Ferreira, Germano

2007-01-01

Prescription-event monitoring (PEM) is a non-interventional intensive method for post-marketing drug safety monitoring of newly licensed medicines. PEM studies are cohort studies where exposure is obtained from a centralised service and outcomes from simple questionnaires completed by general practitioners. Follow-up forms are sent for selected events. Because PEM captures all events and not only the suspected adverse drug reactions, PEM cohorts potentially differ in respect to the distribution of number of events per person depending on the nature of the drug under study. This variance can be related either with the condition for which the drug is prescribed (e.g. a condition causing high morbidity will have, in average, a higher number of events per person compared with a condition with lower morbidity) or with the drug effect itself. This paper describes an exploratory investigation of the distortion caused by product-related variations of the number of events to the interpretation of the proportional reporting ratio (PRR) values ("the higher the PRR, the greater the strength of the signal") computed using drug-cohort data. We studied this effect by assessing the agreement between the PRR based on events (event of interest vs all other events) and PRR based on cases (cases with the event of interest vs cases with any other events). PRR were calculated for all combinations reported to ten selected drugs against a comparator of 81 other drugs. Three of the ten drugs had a cohort with an apparent higher proportion of patients with lower number of events. The PRRs based on events were systematically higher than the PRR based on cases for the combinations reported to these three drugs. Additionally, when applying the threshold criteria for signal screening (n > or =3, PRR > or =1.5 and Chi-squared > or =4), the binary agreement was generally high but apparently lower for these three drugs. In conclusion, the distribution of events per patient in drug cohorts shall be

Performance of a 64-channel, 3.2×3.2 cm{sup 2} SiPM tile for TOF-PET application

Energy Technology Data Exchange (ETDEWEB)

Ferri, Alessandro, E-mail: aleferri@fbk.eu; Acerbi, Fabio; Gola, Alberto; Piemonte, Claudio; Paternoster, Giovanni; Zorzi, Nicola

2016-07-11

In this work, we present a new 3.2×3.2 cm{sup 2} detector tile, composed of 8×8 single SiPMs, having a regular 4 mm pitch in both the X and Y directions. The tile fill factor is 85%. We produced two versions of the tile with different SiPM technologies: RGB-HD and NUV. The first one features square micro-cells with 25 µm pitch, a PDE peaked at 550 nm and a DCR of 300 kHz/mm{sup 2}, at 20 °C and at maximum detection efficiency. The second one features micro-cells with 40 µm pitch and a PDE peaked in the blue part of the spectrum. The dark count rate at 20 °C and at maximum PDE is 100 kHz/mm{sup 2}. In this work, we show the energy and timing resolution measurements at 511 keV obtained coupling the two tiles to an 8×8 LYSO array with a pixel size of 4×4×22 mm{sup 3}, perfectly matching the photo-detector array.

Effect of Gold (Au) Doping on the Surface of CeO2 Materials Surface Gas Sensor to NH3, CO and HNO3 Detection Sensitivity

International Nuclear Information System (INIS)

Sayono; Tjipto Sujitno; Agus Santoso; Sunardi

2002-01-01

Research on the effect of various dose and energy of gold ions (1.2 x 10 16 ion/cm 2 , 40 keV; 4.4 x 10 16 ion/cm 2 , 60 keV and 4.6 x 10 16 ion/cm 2 , 80 keV) implanted into CeO 2 thin layer gas sensor has been carried out using ion accelerator. The effect such as their resistance and sensitivity for various temperature and gas sensor such as NH 3 , CO and HNO 3 has been done. It was found that the best resistance and sensitivity was achieved at ion dose 1.2 x 10 16 ion/cm 2 and 40 keV. At this conditions, the resistance was 2.22 MΩ and sensitivity was (70.3 ± 8.38)% for NH 3 ; (45 ± 6.78)% for CO and (30.3 ± 5.5)% for HNO 3 gas, at the sensor temperature of 325 o C and concentration of 4800 ppm. (author)

High northern geomagnetic field behavior and new constraints on the Gilsá event: Paleomagnetic and ⁴⁰Ar/³⁹Ar results of ∼0.5–3.1 Ma basalts from Jökuldalur, Iceland

DEFF Research Database (Denmark)

Døssing Andreasen, Arne; Muxworthy, Adrian R.; Supakulopas, Radchagrit

2016-01-01

.2–1.83 Ma, thus filling a large data gap of the high-northern stable field behavior. We obtain a median VADM of 57±3ZAm2 (VDM of 60±5Am2), which is higher than the median VADM of 16 intensity estimates from Antarctica (39±7 ZAm2) from the same period. A higher northern field is also found when using less...... strict cut-off criteria resulting in 14 field estimates from Jökuldalur, i.e. we find support for higher field strength in the northern hemisphere as compared to the southern hemisphere during the Matuyama. Finally, we deliver a revised magneto-chronostratigraphic model of Jökuldalur and conduct...... an investigation of the type sections of the so-called Gilsá normal polarity event around 1.62 Ma. Our revised model is based on 11 new 40Ar/39Ar ages. No evidence is found of the existence of the Gilsá event in Jökuldalur. Instead we find that the normal polarity intervals in the type sections can both...

Calcium Isotope (δ44/40Ca) Composition of Morozovella Velascoensis During the Paleocene Eocene Thermal Maximum Ocean Acidification Event

Science.gov (United States)

Kitch, G. D.; Jacobson, A. D.; Hurtgen, M.; Sageman, B. B.; Harper, D. T.; Zachos, J. C.

2017-12-01

Ocean acidification (OA) events are transient disruptions to the carbonate chemistry of seawater that involve decreases in pH, [CO32-] and carbonate mineral saturation states (Ω). Numerical modeling studies predict that the Ca isotope (δ44/40Ca) composition of primary marine carbonate should be sensitive to OA1, and recent evidence from the rock record may support this hypothesis2. Boron isotope (δ11B) data for the planktonic foraminifera Morozovella velascoensis indicate that the Paleocene-Eocene Thermal Maximum (PETM; 55 Mya) was an interval of pronounced OA3, although the Ca isotope composition of the bulk carbonate record appears to show post-burial diagenetic effects4. To further evaluate the Ca isotope proxy, we used a high-precision (2σSD=±0.04‰), double-spike (43Ca-42Ca) TIMS method5 to measure δ44/40Ca values of well-preserved M. velascoensis tests spanning the PETM. M. velascoensis tests (250-355 µm) were picked from samples recovered during ODP Leg 198, Site 1209 on Shatsky Rise in the equatorial Pacific. Five M. velascoensis tests were combined per sample, dissolved, spiked, and analyzed using a Triton TIMS. Repeat dissolutions of ten samples gave δ44/40Ca values within ±0.04‰ of the original measurements. Method and procedural blanks were negligible. δ44/40Ca values are elevated, even before the negative carbon isotope excursion (CIE) that marks the PETM. When δ11/10B values decrease during the CIE, δ44/40Ca values remain elevated, but then decrease by 0.10‰ as δ11B values return to pre-CIE levels. The apparent inverse correlation between δ44/40Ca and δ11B values suggests that Ca isotope fractionation by M. velascoensis was sensitive to OA. A decrease in pH indicated by lower δ11B values is consistent with higher δ44/40Ca values (decreased fractionation) due to elevated [Ca2+]/[CO32-] ratios and reduced W. The Ca isotope composition of pristine foraminiferal calcite may have potential for reconstructing [CO32-]. The current

Towards Real-Time Detection of Gait Events on Different Terrains Using Time-Frequency Analysis and Peak Heuristics Algorithm.

Science.gov (United States)

Zhou, Hui; Ji, Ning; Samuel, Oluwarotimi Williams; Cao, Yafei; Zhao, Zheyi; Chen, Shixiong; Li, Guanglin

2016-10-01

Real-time detection of gait events can be applied as a reliable input to control drop foot correction devices and lower-limb prostheses. Among the different sensors used to acquire the signals associated with walking for gait event detection, the accelerometer is considered as a preferable sensor due to its convenience of use, small size, low cost, reliability, and low power consumption. Based on the acceleration signals, different algorithms have been proposed to detect toe off (TO) and heel strike (HS) gait events in previous studies. While these algorithms could achieve a relatively reasonable performance in gait event detection, they suffer from limitations such as poor real-time performance and are less reliable in the cases of up stair and down stair terrains. In this study, a new algorithm is proposed to detect the gait events on three walking terrains in real-time based on the analysis of acceleration jerk signals with a time-frequency method to obtain gait parameters, and then the determination of the peaks of jerk signals using peak heuristics. The performance of the newly proposed algorithm was evaluated with eight healthy subjects when they were walking on level ground, up stairs, and down stairs. Our experimental results showed that the mean F1 scores of the proposed algorithm were above 0.98 for HS event detection and 0.95 for TO event detection on the three terrains. This indicates that the current algorithm would be robust and accurate for gait event detection on different terrains. Findings from the current study suggest that the proposed method may be a preferable option in some applications such as drop foot correction devices and leg prostheses.

Effect of parameters in moving average method for event detection enhancement using phase sensitive OTDR

Science.gov (United States)

Kwon, Yong-Seok; Naeem, Khurram; Jeon, Min Yong; Kwon, Il-bum

2017-04-01

We analyze the relations of parameters in moving average method to enhance the event detectability of phase sensitive optical time domain reflectometer (OTDR). If the external events have unique frequency of vibration, then the control parameters of moving average method should be optimized in order to detect these events efficiently. A phase sensitive OTDR was implemented by a pulsed light source, which is composed of a laser diode, a semiconductor optical amplifier, an erbium-doped fiber amplifier, a fiber Bragg grating filter, and a light receiving part, which has a photo-detector and high speed data acquisition system. The moving average method is operated with the control parameters: total number of raw traces, M, number of averaged traces, N, and step size of moving, n. The raw traces are obtained by the phase sensitive OTDR with sound signals generated by a speaker. Using these trace data, the relation of the control parameters is analyzed. In the result, if the event signal has one frequency, then the optimal values of N, n are existed to detect the event efficiently.

Integrating physically based simulators with Event Detection Systems: Multi-site detection approach.

Science.gov (United States)

Housh, Mashor; Ohar, Ziv

2017-03-01

The Fault Detection (FD) Problem in control theory concerns of monitoring a system to identify when a fault has occurred. Two approaches can be distinguished for the FD: Signal processing based FD and Model-based FD. The former concerns of developing algorithms to directly infer faults from sensors' readings, while the latter uses a simulation model of the real-system to analyze the discrepancy between sensors' readings and expected values from the simulation model. Most contamination Event Detection Systems (EDSs) for water distribution systems have followed the signal processing based FD, which relies on analyzing the signals from monitoring stations independently of each other, rather than evaluating all stations simultaneously within an integrated network. In this study, we show that a model-based EDS which utilizes a physically based water quality and hydraulics simulation models, can outperform the signal processing based EDS. We also show that the model-based EDS can facilitate the development of a Multi-Site EDS (MSEDS), which analyzes the data from all the monitoring stations simultaneously within an integrated network. The advantage of the joint analysis in the MSEDS is expressed by increased detection accuracy (higher true positive alarms and fewer false alarms) and shorter detection time. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of Ga2O3 addition on the properties of Y2O3-doped AlN ceramics

Directory of Open Access Journals (Sweden)

Shin H.

2015-01-01

Full Text Available Effect Ga2O3 addition on the densification and properties of Y2O3-doped AlN ceramics was investigated under the constraint of total sintering additives (Y2O3 and Ga2O3 of 4.5 wt%. Ga was detected in the AlN grain as well as the grain boundary phases. YAlO3 and Y4Al2O9 were observed as the secondary crystalline phases in all of the investigated compositions. As the substitution of Ga2O3 for Y2O3 increased, the quantity of the Y4Al2O9 phase decreased while that of YAlO3 was more or less similar. Neither additional secondary phases was identified, nor was the sinterability inhibited by the Ga2O3 addition; the linear shrinkage and apparent density were above 20 percent and 3.34-3.37 g/cm3, respectively. However, the optical reflectance and the elastic modulus generally decreased whereas the Poisson ratio increased significantly. The dielectric constant and the loss tangent of 4.0Y2O3-0.5Ga2O3-95.5Y2O3 at the resonant frequency of 8.22 GHz were 8.63 and 0.003, respectively.

Chemical synthesis, characterization studies and reactivity of a catalytic material based on ZrO2-H3PW12O40

International Nuclear Information System (INIS)

Hernandez Enriquez, Juan Manuel; Garcia Alamilla, Ricardo; Paramo Garcia, Ulises; Rodrigo, Rebeca Silva; Garcia Serrano, Luz Arcelia

2013-01-01

In this work, the preparation and characterization of materials such as zirconium oxide (ZrO 2 ) and phosphotungstic acid promoted zirconium oxide (ZrO 2 -H 3 PW 12 O 40 ) is presented. Physico-chemical characterization results showed that addition of H 3 PW 12 O 40 acted as both a textural and chemical promoter of zirconium oxide. The incorporation of phosphotungstic acid into the ZrO 2 matrix delayed the sintering of the material and stabilized ZrO 2 in the tetragonal phase. ZrO 2 acidity was also enhanced, developing strong acid sites on its surface. The Pt/ZrO 2 -H 3 PW 12 O 40 catalyst was active for n-pentane isomerization at 250 deg C, exhibiting high selectivity to iso-pentane (95%). This result is probably due to its suitable acidity (author)

Secure access control and large scale robust representation for online multimedia event detection.

Science.gov (United States)

Liu, Changyu; Lu, Bin; Li, Huiling

2014-01-01

We developed an online multimedia event detection (MED) system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC) model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK) event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.

Secure Access Control and Large Scale Robust Representation for Online Multimedia Event Detection

Directory of Open Access Journals (Sweden)

Changyu Liu

2014-01-01

Full Text Available We developed an online multimedia event detection (MED system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.

40 CFR 40.160-2 - Financial status report.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Financial status report. 40.160-2 Section 40.160-2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE RESEARCH AND DEMONSTRATION GRANTS § 40.160-2 Financial status report. A financial status report...

A Quantitative PCR-Electrochemical Genosensor Test for the Screening of Biotech Crops

Directory of Open Access Journals (Sweden)

Suely Moura-Melo

2017-04-01

Full Text Available The design of screening methods for the detection of genetically modified organisms (GMOs in food would improve the efficiency in their control. We report here a PCR amplification method combined with a sequence-specific electrochemical genosensor for the quantification of a DNA sequence characteristic of the 35S promoter derived from the cauliflower mosaic virus (CaMV. Specifically, we employ a genosensor constructed by chemisorption of a thiolated capture probe and p-aminothiophenol gold surfaces to entrap on the sensing layer the unpurified PCR amplicons, together with a signaling probe labeled with fluorescein. The proposed test allows for the determination of a transgene copy number in both hemizygous (maize MON810 trait and homozygous (soybean GTS40-3-2 transformed plants, and exhibits a limit of quantification of at least 0.25% for both kinds of GMO lines.

TNO at TRECVID 2013: Multimedia Event Detection and Instance Search

NARCIS (Netherlands)

Bouma, H.; Azzopardi, G.; Spitters, M.M.; Wit, J.J. de; Versloot, C.A.; Zon, R.W.L. van der; Eendebak, P.T.; Baan, J.; Hove, R.J.M. ten; Eekeren, A.W.M. van; Haar, F.B. ter; Hollander, R.J.M. den; Huis, R.J. van; Boer, M.H.T. de; Antwerpen, G. van; Broekhuijsen, B.J.; Daniele, L.M.; Brandt, P.; Schavemaker, J.G.M.; Kraaij, W.; Schutte, K.

2013-01-01

We describe the TNO system and the evaluation results for TRECVID 2013 Multimedia Event Detection (MED) and instance search (INS) tasks. The MED system consists of a bag-of-word (BOW) approach with spatial tiling that uses low-level static and dynamic visual features, an audio feature and high-level

Field Comparisons of the Elwha Bedload Sampler and an Acoustic Gravel-transport Sensor: Middle Fork of the Piedra River, Colorado, USA

Science.gov (United States)

Downing, J.; Ryan, S. E.

2001-12-01

Ten simultaneous bedload measurements were made with an Elhwa sampler and an acoustic-gravel-transport sensor (GTS) on the Middle Fork of the Piedra River in southwestern Colorado near the end of the spring freshet in water year 2001. The purpose was to compare bedload samples with acoustic measurements acquired under field conditions. Upstream of the measurement site, the river drains 86 km2 of andesite, ash flows, tuffs, and breccias in the San Juan Mountains, contributing a relatively high sediment load to the river system. The channel transitions from step-pools at high elevations to a plane bed with a slope of 0.018 in the study reach. Channel width, mean depth and bank-full velocity at the site are: 13.6 m, 0.52, and 1.5 m s-1. The D50 of the riverbed surface is 0.08 m which is 6 to 40 times larger than the D50s of the bedload samples. D16 and D84 of the bed = 0.02 and 0.21 m respectively. Water discharges from 7.3 to 9.3 m3 s-1 transported about 0.01 kg of gravel m-1 s-1 in the channel. Transport of coarse gravel (8-64 mm) ranged from 0.00063 to 0.024 kg m-1 s-1. The Elwha sampler is a portable, pressure-differential trap with a 0.2 m wide by 0.1 m high opening. The acoustic sensor is a 0.025-m wide by 0.1 m high strip of PVDF piezoelectric film connected to a signal processor and bonded to an aluminum pressure plate. When the plate is struck by stones, the GTS produces signal peaks with areas that are accurate measures of stone momentum. The GTS was calibrated with steels balls dropped on the pressure plate in still water to develop a curve of ball momentum as a function of peak areas. Based on these calibrations, the standard error of the GTS momentum estimates is 0.0017 kg m s-1. Five transects with 30 verticals, each occupied for 60 s, were completed with the sampler and GTS separated by < 1 m. Five additional verticals were occupied for about 1800 s each with the instruments separated by < 0.5 m. The trapped material was sieved and weighed and the water

Recurring events - Volume 2

International Nuclear Information System (INIS)

2003-04-01

revealed, in spite of long histories of gathering and disseminating reports about these events. Conclusion 2: Recurring events have a wide range of risk significance, from low (or negligible) up to high. Conclusion 3: There appears to be deficiencies in the evaluation and application of lessons learned from reports on operating experience. Conclusion 4: Corrective actions to minimize recurring events are straightforward and there is no reason not to implement them at NPPs. Conclusion 5: CSNI WGOE needs to consider additional efforts to communicate results from its review and analysis of operating events. Generally, it can be concluded that recurrence will never be totally avoidable. But efforts can be taken to minimize recurrence, especially if safety significant consequences are likely to result. These efforts should be made by all participants by using the national, international, utility, vendors, and regulatory body experience feedback processes

RELAP5/MOD 3.3 analysis of Reactor Coolant Pump Trip event at NPP Krsko

International Nuclear Information System (INIS)

Bencik, V.; Debrecin, N.; Foretic, D.

2003-01-01

In the paper the results of the RELAP5/MOD 3.3 analysis of the Reactor Coolant Pump (RCP) Trip event at NPP Krsko are presented. The event was initiated by an operator action aimed to prevent the RCP 2 bearing damage. The action consisted of a power reduction, that lasted for 50 minutes, followed by a reactor and a subsequent RCP 2 trip when the reactor power was reduced to 28 %. Two minutes after reactor trip, the Main Steam Isolation Valves (MSIV) were isolated and the steam dump flow was closed. On the secondary side the Steam Generator (SG) pressure rose until SG 1 Safety Valve (SV) 1 opened. The realistic RELAP5/MOD 3.3 analysis has been performed in order to model the particular plant behavior caused by operator actions. The comparison of the RELAP5/MOD 3.3 results with the measurement for the power reduction transient has shown small differences for the major parameters (nuclear power, average temperature, secondary pressure). The main trends and physical phenomena following the RCP Trip event were well reproduced in the analysis. The parameters that have the major influence on transient results have been identified. In the paper the influence of SG 1 relief and SV valves on transient results was investigated more closely. (author)

Detection of adverse events in general surgery using the " Trigger Tool" methodology.

Science.gov (United States)

Pérez Zapata, Ana Isabel; Gutiérrez Samaniego, María; Rodríguez Cuéllar, Elías; Andrés Esteban, Eva María; Gómez de la Cámara, Agustín; Ruiz López, Pedro

2015-02-01

Surgery is one of the high-risk areas for the occurrence of adverse events (AE). The purpose of this study is to know the percentage of hospitalisation-related AE that are detected by the «Global Trigger Tool» methodology in surgical patients, their characteristics and the tool validity. Retrospective, observational study on patients admitted to a general surgery department, who underwent a surgical operation in a third level hospital during the year 2012. The identification of AE was carried out by patient record review using an adaptation of «Global Trigger Tool» methodology. Once an AE was identified, a harm category was assigned, including the grade in which the AE could have been avoided and its relation with the surgical procedure. The prevalence of AE was 36,8%. There were 0,5 AE per patient. 56,2% were deemed preventable. 69,3% were directly related to the surgical procedure. The tool had a sensitivity of 86% and a specificity of 93,6%. The positive predictive value was 89% and the negative predictive value 92%. Prevalence of AE is greater than the estimate of other studies. In most cases the AE detected were related to the surgical procedure and more than half were also preventable. The adapted «Global Trigger Tool» methodology has demonstrated to be highly effective and efficient for detecting AE in surgical patients, identifying all the serious AE with few false negative results. Copyright © 2014 AEC. Publicado por Elsevier España, S.L.U. All rights reserved.

A novel CUSUM-based approach for event detection in smart metering

Science.gov (United States)

Zhu, Zhicheng; Zhang, Shuai; Wei, Zhiqiang; Yin, Bo; Huang, Xianqing

2018-03-01

Non-intrusive load monitoring (NILM) plays such a significant role in raising consumer awareness on household electricity use to reduce overall energy consumption in the society. With regard to monitoring low power load, many researchers have introduced CUSUM into the NILM system, since the traditional event detection method is not as effective as expected. Due to the fact that the original CUSUM faces limitations given the small shift is below threshold, we therefore improve the test statistic which allows permissible deviation to gradually rise as the data size increases. This paper proposes a novel event detection and corresponding criterion that could be used in NILM systems to recognize transient states and to help the labelling task. Its performance has been tested in a real scenario where eight different appliances are connected to main line of electric power.

Phase relationships in the BaO-Ga2O3-Ta2O5 system and the structure of Ba6Ga21TaO40.

Science.gov (United States)

Cao, Jiang; Yu, Xiaodi; Kuang, Xiaojun; Su, Qiang

2012-07-16

Phase relationships in the BaO-Ga(2)O(3)-Ta(2)O(5) ternary system at 1200 °C were determined. The A(6)B(10)O(30) tetragonal tungsten bronze (TTB) related solution in the BaO-Ta(2)O(5) subsystem dissolved up to ~11 mol % Ga(2)O(3), forming a ternary trapezoid-shaped TTB-related solid solution region defined by the BaTa(2)O(6), Ba(1.1)Ta(5)O(13.6), Ba(1.58)Ga(0.92)Ta(4.08)O(13.16), and Ba(6)GaTa(9)O(30) compositions in the BaO-Ga(2)O(3)-Ta(2)O(5) system. Two ternary phases Ba(6)Ga(21)TaO(40) and eight-layer twinned hexagonal perovskite solid solution Ba(8)Ga(4-x)Ta(4+0.6x)O(24) were confirmed in the BaO-Ga(2)O(3)-Ta(2)O(5) system. Ba(6)Ga(21)TaO(40) crystallized in a monoclinic cell of a = 15.9130(2) Å, b = 11.7309(1) Å, c = 5.13593(6) Å, β = 107.7893(9)°, and Z = 1 in space group C2/m. The structure of Ba(6)Ga(21)TaO(40) was solved by the charge flipping method, and it represents a three-dimensional (3D) mixed GaO(4) tetrahedral and GaO(6)/TaO(6) octahedral framework, forming mixed 1D 5/6-fold tunnels that accommodate the Ba cations along the c axis. The electrical property of Ba(6)Ga(21)TaO(40) was characterized by using ac impedance spectroscopy.

A positive feedback loop between progesterone and microsomal prostaglandin E synthase-1-mediated PGE2 promotes production of both in mouse granulosa cells.

Science.gov (United States)

Tamura, Kazuhiro; Naraba, Hiroaki; Hara, Takahiko; Nakamura, Kota; Yoshie, Mikihiro; Kogo, Hiroshi; Tachikawa, Eiichi

2016-03-01

Microsomal prostaglandin E synthase-1 (mPGES-1) is primarily expressed in granulosa cells (GCs) in the preovulatory follicle. Both prostaglandin E2 (PGE2) and progesterone (P4) are implicated in various reproductive functions. Here, we demonstrate that mPges-1 may be a direct downstream target gene of the P4 receptor and P4-stimulated PGE2 secretion can stimulate P4 production in a newly generated mouse GC line (GtsT). Treatment of GtsT cells with a P4 receptor agonist, norgestrel, markedly increased mPGES-1 expression detected by RT-PCR analysis. PGE2 secretion measured by an enzyme-linked immunosorbent assay was enhanced by P4 treatment. Luciferase assays revealed that the proximal promoter region of the mPges-1 gene was responsible for the effects of P4 treatment. Conversely, PGE2 treatment stimulated P4 secretion, which coordinated with mRNA expression of steroidogenic acute regulatory protein. Taken together, P4 may regulate mPGES-1 expression to increase PGE2 secretion and in turn P4 production. An autocrine loop between P4 and PGE2 might function to maintain the increased levels of both in GCs. Copyright © 2016 Elsevier Inc. All rights reserved.

3D versus 2D Systematic Transrectal Ultrasound-Guided Prostate Biopsy: Higher Cancer Detection Rate in Clinical Practice

Directory of Open Access Journals (Sweden)

Alexandre Peltier

2013-01-01

Full Text Available Objectives. To compare prostate cancer detection rates of extended 2D versus 3D biopsies and to further assess the clinical impact of this method in day-to-day practice. Methods. We analyzed the data of a cohort of 220 consecutive patients with no prior history of prostate cancer who underwent an initial prostate biopsy in daily practice due to an abnormal PSA and/or DRE using, respectively, the classical 2D and the new 3D systems. All the biopsies were done by a single experienced operator using the same standardized protocol. Results. There was no significant difference in terms of age, total PSA, or prostate volume between the two groups. However, cancer detection rate was significantly higher using the 3D versus the 2D system, 50% versus 34% (P<0.05. There was no statistically significant difference while comparing the 2 groups in term of nonsignificant cancer detection. Conclusion. There is reasonable evidence demonstrating the superiority of the 3D-guided biopsies in detecting prostate cancers that would have been missed using the 2D extended protocol.

Patients' identification and reporting of unsafe events at six hospitals in Japan.

Science.gov (United States)

Hasegawa, Tomonori; Fujita, Shigeru; Seto, Kanako; Kitazawa, Takefumi; Matsumoto, Kunichika

2011-11-01

Hospitals and other health care organizations have increasingly recognized the need to engage patients as participants in patient safety. A study was conducted to compare patients' and health care staff's identification and reporting of such events. A questionnaire was administered at six hospitals in Japan to outpatients and inpatients from November 2004 through February 2007. Patients were asked to respond to questions about experiences of possibly unsafe events. Patients experiencing such events were then asked about the events and whether they had reported their experience to health care staff. A specialist panel classified reported events as "uneasy-dissatisfying" or "unsafe." The response rates of outpatients and inpatients were 85.4% (1,506/1,764) and 54.3% (1,738/3,198), respectively. Among the respondents (> or = 20 years of age), 125 (8.7%) of the outpatients and 185 (10.9%) of the inpatients experienced uneasy-dissatisfying or unsafe events; 35 (2.4%) of the outpatients and 67 (4.0%) of the inpatients experienced unsafe events, the percent increasing with hospital stay. Only 38 (30.4%) of the outpatients and 62 (33.5%) of the inpatients reported the unsafe events to health care staff Only 17.1% of unsafe events reported by inpatients were identified by the in-house reporting systems of adverse events and near misses. For the uneasy-dissatisfying or unsafe events that patients did not think necessary to report, the patients often felt they were self-evident or easily identifiable by health care staff, had difficulty evaluating the event, did not expect their report to bring any improvement, or even felt that reporting it would create some disadvantage in their medical treatment. Patient reporting programs and in-house reporting systems, among other detection methods, should be regarded as complementary sources of information.

Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.

Science.gov (United States)

Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J

2011-09-01

Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.

Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells.

Science.gov (United States)

Chihara, Kazuyasu; Kimura, Yukihiro; Honjoh, Chisato; Yamauchi, Shota; Takeuchi, Kenji; Sada, Kiyonao

2014-03-10

Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr(174), Tyr(183) and Tyr(446) in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr(183) and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr(174), Tyr(183) and Tyr(426) of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr(426) is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr(426) was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr(426) following BCR stimulation. Copyright © 2014 Elsevier Inc. All rights reserved.

One Novel Multiple-Target Plasmid Reference Molecule Targeting Eight Genetically Modified Canola Events for Genetically Modified Canola Detection.

Science.gov (United States)

Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao

2017-09-27

Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.

Phase separation, crystallization and polyamorphism in the Y{sub 2}O{sub 3}-Al{sub 2}O{sub 3} system

Energy Technology Data Exchange (ETDEWEB)

Skinner, Lawrie B; Barnes, Adrian C [H H Wills Physics Laboratory, Royal Fort, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Salmon, Philip S [Department of Physics, University of Bath, Bath BA2 7AY (United Kingdom); Crichton, Wilson A [European Synchrotron Radiation Facility, 6 rue Jules Horowitz, BP 220, Grenoble Cedex, F-38043 (France)], E-mail: a.c.barnes@bristol.ac.uk

2008-05-21

A detailed study of glass formation from aerodynamically levitated liquids in the (Y{sub 2}O{sub 3}){sub x}(Al{sub 2}O{sub 3}){sub 1-x} system for the composition range 0.21{<=}x{<=}0.41 was undertaken by using pyrometric, optical imaging and x-ray diffraction methods. Homogeneous and clear single-phase glasses were produced over the composition range 0.27{<=}x{<=}0.33. For Y{sub 2}O{sub 3}-rich compositions (0.33{<=}x{<=}0.375), cloudy materials were produced which contain inclusions of crystalline yttrium aluminium garnet (YAG) of diameter up to 40 {mu}m in a glassy matrix. For Y{sub 2}O{sub 3}-poor compositions around x = 0.24, cloudy materials were also produced, but it was not possible to deduce whether this resulted from (i) sub-micron inclusions of a nano-crystalline or glassy material in a glassy matrix or (ii) a glass formed by spinodal decomposition. For x = 0.21, however, the sample cloudiness results from crystallization into at least two phases comprising yttrium aluminium perovskite and alumina. The associated pyrometric cooling curve shows slow recalescence events with a continuous and slow evolution of excess heat which contrasts with the sharp recalescence events observed for the crystallization of YAG at compositions near x = 0.375. The materials that are the most likely candidates for demonstrating homogeneous nucleation of a second liquid phase occur around x = 0.25, which corresponds to the limit for formation of a continuous random network of corner-shared AlO{sub 4} tetrahedra.

Form factors in Kμ3 decay

International Nuclear Information System (INIS)

Wilke, W.G.

1976-01-01

The decay of 1.83 GeV/c K + mesons in flight was studied using a magnetic spectrometer with multi-wire proportional chambers for the charged particles and an array of lead glass to detect γ-rays from π 0 decay. For the decay mode K + yields π 0 μ + nu/sub μ/ the muons were stopped after the spectrometer in a polarimeter, an array of carbon blocks and scintillators in a 40 g magnetic field. Four scintillators surrounded each carbon clock. The pattern of polarimeter counters in coincidence with the entering muon, and the pattern in coincidence with the decay positron were recorded, as well as the time delay between the μ + and the e + . For events with two γ-rays striking the lead glass, the positions and energies of the γ-rays were also recorded. Each Kμ 3 decay with two detected γ-rays was a 2-C fit, with an additional constraint of range-momentum consistency for the muon. Polarization analysis on a final sample of 24,669 events gave a value Xi(q 2 )/sub avg./ = -.25 +- .25. The experiment also gave values for Xi(q 2 ) in each of four q 2 bins

Combining magnetic nanoparticle with biotinylated nanobodies for rapid and sensitive detection of influenza H3N2

Science.gov (United States)

Zhu, Min; Hu, Yonghong; Li, Guirong; Ou, Weijun; Mao, Panyong; Xin, Shaojie; Wan, Yakun

2014-09-01

Our objective is to develop a rapid and sensitive assay based on magnetic beads to detect the concentration of influenza H3N2. The possibility of using variable domain heavy-chain antibodies (nanobody) as diagnostic tools for influenza H3N2 was investigated. A healthy camel was immunized with inactivated influenza H3N2. A nanobody library of 8 × 108 clones was constructed and phage displayed. After three successive biopanning steps, H3N2-specific nanobodies were successfully isolated, expressed in Escherichia coli, and purified. Sequence analysis of the nanobodies revealed that we possessed four classes of nanobodies against H3N2. Two nanobodies were further used to prepare our rapid diagnostic kit. Biotinylated nanobody was effectively immobilized onto the surface of streptavidin magnetic beads. The modified magnetic beads with nanobody capture specifically influenza H3N2 and can still be recognized by nanobodies conjugated to horseradish peroxidase (HRP) conjugates. Under optimized conditions, the present immunoassay exhibited a relatively high sensitive detection with a limit of 50 ng/mL. In conclusion, by combining magnetic beads with specific nanobodies, this assay provides a promising influenza detection assay to develop a potential rapid, sensitive, and low-cost diagnostic tool to screen for influenza infections.

Event-by-event fluctuations of the mean transverse momentum in 40, 80, and 158 AGeV/c Pb-Au collisions

CERN Document Server

AUTHOR|(CDS)2073202; Appelshäuser, H; Belaga, V; Braun-Munzinger, P; Campagnolo, R; Castillo, A; Cherlin, A; Damjanovic, S; Dietel, T; Dietrich, L; Drees, A; Esumi, S; Filimonov, K; Fomenko, K; Fraenkel, Zeev; Garabatos, C; Glässel, P; Hering, G; Holeczek, J; Kushpil, V; Lenkeit, B C; Ludolphs, W; Maas, A; Marin, A; Milosevic, J; Milov, A; Miskowiec, D; Musa, L; Panebratsev, Yu A; Petchenova, O Yu; Petracek, V; Pfeiffer, A; Rak, J; Ravinovich, I; Rehak, P; Richter, M; Sako, H; Schmitz, W; Schükraft, J; Sedykh, S; Seipp, W; Sharma, A; Shimansky, S S; Slivova, J; Specht, H J; Stachel, J; Sumbera, M; Tilsner, H; Tserruya, Itzhak; Wessels, J P; Wienold, T; Windelband, B; Wurm, J P; Xie, W; Yurevich, S; Yurevich, V

2003-01-01

Measurements of event-by-event fluctuations of the mean transverse momentum in Pb-Au collisions at 40, 80, and 158 AGeV/c are presented. A significant excess of mean $p_{T}$ fluctuations at midrapidity is observed over the expectation from statistically independent particle emission. The results are somewhat smaller than recent measurements at RHIC. A possible nonmonotonic behavior of the mean $p_{T}$ fluctuations as function of collision energy, which may have indicated that the system has passed the critical point of the QCD phase diagram in the range of $\\mu_{B}$ under investigation, has not been observed. The centrality dependence of mean $p_{T}$ fluctuations in Pb-Au is consistent with an extrapolation from $pp$ collisions assuming that the nonstatistical fluctuations scale with multiplicity. The results are compared to calculations by the RQMD and URQMD event generators.

A randomized study of the efficacy and safety of transdermal granisetron in the control of nausea and vomiting induced by moderately emetogenic chemotherapy in Korean patients.

Science.gov (United States)

Kim, Jeong Eun; Hong, Yong Sang; Lee, Jae-Lyun; Kim, Kyu-Pyo; Park, Seong Joon; Sym, Sun Jin; Shin, Dong Bok; Lee, Jeeyun; Park, Young Suk; Ahn, Jin Seok; Kim, Tae Won

2015-06-01

The granisetron transdermal system (GTS) showed non-inferior efficacy to oral granisetron to control chemotherapy-induced nausea and vomiting (CINV) during multiday chemotherapy. We compared the efficacy and safety of GTS with that of intravenous and oral granisetron in Korean patients receiving moderately emetogenic chemotherapy (MEC). A total of 276 patients were randomized into GTS (n = 139, one patch on days 1-4) or control group (n = 137, intravenous on day 1 and oral on days 2-4). The primary endpoint was the percentage of patients achieving complete response (CR) from chemotherapy initiation until 24 h after the final administration. Out of 234 patients (112 in GTS and 122 in control group) included in the per protocol analysis, 97.9 % had gastrointestinal cancer and 76.9 % received 3-day chemotherapy. The GTS showed non-inferior efficacy achieving CR in 75.0 % of the patients; 74.6 % of the patients in the control group achieved CR (95 % confidence interval -10.73 to 11.55 %). The CR rate did not change after subgroup analyses by sex, age, and chemotherapy naivety and analysis per day and overall days of treatment. The GTS group showed sustained CR from day 1 to day 4. Patients' satisfaction, assessed using Functional Living Index-Emesis (FLI-E), showed no difference. Both treatments were well tolerated and safe. The GTS showed non-inferior efficacy to intravenous and oral granisetron. The safety, tolerability, and FLI-E scores of the GTS were comparable to those of control group. The GTS offers a convenient alternative option for relieving CINV in patients receiving MEC.

Event-by-Event Hydrodynamics+Jet Energy Loss: A Solution to the R_{AA}⊗v_{2} Puzzle.

Science.gov (United States)

Noronha-Hostler, Jacquelyn; Betz, Barbara; Noronha, Jorge; Gyulassy, Miklos

2016-06-24

High p_{T}>10  GeV elliptic flow, which is experimentally measured via the correlation between soft and hard hadrons, receives competing contributions from event-by-event fluctuations of the low-p_{T} elliptic flow and event-plane angle fluctuations in the soft sector. In this Letter, a proper account of these event-by-event fluctuations in the soft sector, modeled via viscous hydrodynamics, is combined with a jet-energy-loss model to reveal that the positive contribution from low-p_{T} v_{2} fluctuations overwhelms the negative contributions from event-plane fluctuations. This leads to an enhancement of high-p_{T}>10  GeV elliptic flow in comparison to previous calculations and provides a natural solution to the decade-long high-p_{T} R_{AA}⊗v_{2} puzzle. We also present the first theoretical calculation of high-p_{T} v_{3}, which is shown to be compatible with current LHC data. Furthermore, we discuss how short-wavelength jet-medium physics can be deconvoluted from the physics of soft, bulk event-by-event flow observables using event-shape engineering techniques.

Prototypical spent nuclear fuel rod consolidation equipment: Phase 2, Final design report: Volume 3, Appendices: Part 2

International Nuclear Information System (INIS)

1987-01-01

The purpose of this report is to identify and analyze a range of credible events and accident occurrences (from minor to the design basis accidents) and their causes and consequences. For each situation, the considerations to prevent or mitigate the event or accident are to be addressed. The report includes a description of the approach used to identify the potential events or accidents (Section 3.0), a discussion of Off-Normal Events (Section 4.0), and finally a discussion of Accidents (Section 5.0)

40 CFR 96.3 - Measurements, abbreviations, and acronyms.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 96.3 Section 96.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... pounds. CO2—carbon dioxide. NOX—nitrogen oxides. O2—oxygen. ...

Risk factors for hazardous events in olfactory-impaired patients.

Science.gov (United States)

Pence, Taylor S; Reiter, Evan R; DiNardo, Laurence J; Costanzo, Richard M

2014-10-01

Normal olfaction provides essential cues to allow early detection and avoidance of potentially hazardous situations. Thus, patients with impaired olfaction may be at increased risk of experiencing certain hazardous events such as cooking or house fires, delayed detection of gas leaks, and exposure to or ingestion of toxic substances. To identify risk factors and potential trends over time in olfactory-related hazardous events in patients with impaired olfactory function. Retrospective cohort study of 1047 patients presenting to a university smell and taste clinic between 1983 and 2013. A total of 704 patients had both clinical olfactory testing and a hazard interview and were studied. On the basis of olfactory function testing results, patients were categorized as normosmic (n = 161), mildly hyposmic (n = 99), moderately hyposmic (n = 93), severely hyposmic (n = 142), and anosmic (n = 209). Patient evaluation including interview, examination, and olfactory testing. Incidence of specific olfaction-related hazardous events (ie, burning pots and/or pans, starting a fire while cooking, inability to detect gas leaks, inability to detect smoke, and ingestion of toxic substances or spoiled foods) by degree of olfactory impairment. The incidence of having experienced any hazardous event progressively increased with degree of impairment: normosmic (18.0%), mildly hyposmic (22.2%), moderately hyposmic (31.2%), severely hyposmic (32.4%), and anosmic (39.2%). Over 3 decades there was no significant change in the overall incidence of hazardous events. Analysis of demographic data (age, sex, race, smoking status, and etiology) revealed significant differences in the incidence of hazardous events based on age (among 397 patients hazardous event, vs 31 of 146 patients ≥65 years [21.3%]; P hazardous event, vs 73 of 265 men [27.6%]; P = .009), and race (among 98 African Americans, 41 [41.8%] with hazardous event, vs 134 of 434 whites [30.9%]; P = .04

Predictive modeling of structured electronic health records for adverse drug event detection.

Science.gov (United States)

Zhao, Jing; Henriksson, Aron; Asker, Lars; Boström, Henrik

2015-01-01

The digitization of healthcare data, resulting from the increasingly widespread adoption of electronic health records, has greatly facilitated its analysis by computational methods and thereby enabled large-scale secondary use thereof. This can be exploited to support public health activities such as pharmacovigilance, wherein the safety of drugs is monitored to inform regulatory decisions about sustained use. To that end, electronic health records have emerged as a potentially valuable data source, providing access to longitudinal observations of patient treatment and drug use. A nascent line of research concerns predictive modeling of healthcare data for the automatic detection of adverse drug events, which presents its own set of challenges: it is not yet clear how to represent the heterogeneous data types in a manner conducive to learning high-performing machine learning models. Datasets from an electronic health record database are used for learning predictive models with the purpose of detecting adverse drug events. The use and representation of two data types, as well as their combination, are studied: clinical codes, describing prescribed drugs and assigned diagnoses, and measurements. Feature selection is conducted on the various types of data to reduce dimensionality and sparsity, while allowing for an in-depth feature analysis of the usefulness of each data type and representation. Within each data type, combining multiple representations yields better predictive performance compared to using any single representation. The use of clinical codes for adverse drug event detection significantly outperforms the use of measurements; however, there is no significant difference over datasets between using only clinical codes and their combination with measurements. For certain adverse drug events, the combination does, however, outperform using only clinical codes. Feature selection leads to increased predictive performance for both data types, in isolation and

Podoplanin (D2-40): A New Immunohistochemical Marker for Reactive Follicular Dendritic Cells and Follicular Dendritic Cell Sarcomas

Science.gov (United States)

Xie, Qingmei; Chen, Lugen; Fu, Kai; Harter, Josephine; Young, Ken H; Sunkara, Jaya; Novak, Deborah; Villanueva-Siles, Esperanza; Ratech, Howard

2008-01-01

The diagnosis of follicular dendritic cell (FDC) sarcoma can be challenging because of its morphologic overlaps with many other spindle cell neoplasms and, therefore, new phenotypic markers will be helpful in its differential diagnosis. Podoplanin is a mucin-type transmembrane glycoprotein that has recently been detected in reactive FDCs. In this study, we investigated the expression patterns of podoplanin using a new mouse monoclonal antibody D2-40, and compared them with CD21, a well-established FDC marker, in a comprehensive panel of cases. The panel included 4 FDC sarcomas, 38 spindle cell neoplasms of other types, 25 reactive lymphoid hyperplasia, and 117 lymphoid and 5 myeloid malignant hematopoietic neoplasms. Our study revealed that D2-40 strongly stained 3 of 4 FDC sarcomas. In contrast, D2-40 stained only 2/38 other spindle cell neoplasms tested. Furthermore, we observed that D2-40 highlighted more FDC meshworks than CD21 in Castleman's disease, follicular lymphoma, nodular lymphocyte predominance Hodgkin lymphoma, and residual reactive germinal centers in a variety of lymphoma types. D2-40 and CD21 stained an equal number of cases of reactive lymphoid hyperplasia, progressively transformed germinal centers and angioimmunoblastic T-cell lymphoma. No expression of podoplanin was detected in normal or neoplastic lymphoid and myeloid cells. We conclude that podoplanin (D2-40) is a sensitive and specific FDC marker, which is superior or equal to CD21 in evaluating both reactive and neoplastic FDCs. In addition, our results suggest that podoplanin (D2-40) can be used to support the diagnosis of FDC sarcoma. PMID:18784810

Detection of visual events along the apparent motion trace in patients with paranoid schizophrenia.

Science.gov (United States)

Sanders, Lia Lira Olivier; Muckli, Lars; de Millas, Walter; Lautenschlager, Marion; Heinz, Andreas; Kathmann, Norbert; Sterzer, Philipp

2012-07-30

Dysfunctional prediction in sensory processing has been suggested as a possible causal mechanism in the development of delusions in patients with schizophrenia. Previous studies in healthy subjects have shown that while the perception of apparent motion can mask visual events along the illusory motion trace, such motion masking is reduced when events are spatio-temporally compatible with the illusion, and, therefore, predictable. Here we tested the hypothesis that this specific detection advantage for predictable target stimuli on the apparent motion trace is reduced in patients with paranoid schizophrenia. Our data show that, although target detection along the illusory motion trace is generally impaired, both patients and healthy control participants detect predictable targets more often than unpredictable targets. Patients had a stronger motion masking effect when compared to controls. However, patients showed the same advantage in the detection of predictable targets as healthy control subjects. Our findings reveal stronger motion masking but intact prediction of visual events along the apparent motion trace in patients with paranoid schizophrenia and suggest that the sensory prediction mechanism underlying apparent motion is not impaired in paranoid schizophrenia. Copyright © 2012. Published by Elsevier Ireland Ltd.

Detection of unusual events and trends in complex non-stationary data streams

International Nuclear Information System (INIS)

Charlton-Perez, C.; Perez, R.B.; Protopopescu, V.; Worley, B.A.

2011-01-01

The search for unusual events and trends hidden in multi-component, nonlinear, non-stationary, noisy signals is extremely important for diverse applications, ranging from power plant operation to homeland security. In the context of this work, we define an unusual event as a local signal disturbance and a trend as a continuous carrier of information added to and different from the underlying baseline dynamics. The goal of this paper is to investigate the feasibility of detecting hidden events inside intermittent signal data sets corrupted by high levels of noise, by using the Hilbert-Huang empirical mode decomposition method.

One-pot synthesis of porphyrin functionalized γ-Fe{sub 2}O{sub 3} nanocomposites as peroxidase mimics for H{sub 2}O{sub 2} and glucose detection

Energy Technology Data Exchange (ETDEWEB)

Liu, Qingyun, E-mail: qyliu@sdust.edu.cn; Zhang, Leyou; Li, Hui; Jia, Qingyan; Jiang, Yanling; Yang, Yanting; Zhu, Renren

2015-10-01

Meso-tetrakis(4-carboxyphenyl)-porphyrin-functionalized γ-Fe{sub 2}O{sub 3} nanoparticles (H{sub 2}TCPP-γ-Fe{sub 2}O{sub 3}) were successfully prepared by one-pot method under hydrothermal conditions and were found to possess intrinsic peroxidase-like activity. The H{sub 2}TCPP-γ-Fe{sub 2}O{sub 3} nanocomposites can catalytically oxidize peroxidase substrate 3,3′,5,5′-tetramethylbenzidine (TMB) in the presence of H{sub 2}O{sub 2} to produce a blue color reaction, which can be easily observed by the naked eye. Furthermore, kinetic studies indicate that the H{sub 2}TCPP-γ-Fe{sub 2}O{sub 3} nanocomposites have an even higher affinity to TMB than that of the natural enzyme, horseradish peroxidase (HRP). On the basis of the high activity, the reaction provides a simple, sensitive and selective method for colorimetric detection of H{sub 2}O{sub 2} over a range of 10–100 μM with a minimum detection limit of 1.73 μM. Moreover, H{sub 2}TCPP-γ-Fe{sub 2}O{sub 3}/glucose oxidase (GOx)/TMB system provides a novel colorimetric sensor for glucose and shows good response toward glucose detection over a range of 5–25 μM with a minimum detection limit of 2.54 μM. The results indicated that it is a simple, cheap, convenient, highly selective, sensitive and easy handling colorimetric assay. Results of a fluorescent probe suggest that the catalase-mimic activity of the H{sub 2}TCPP-γ-Fe{sub 2}O{sub 3} nanocomposites effectively catalyze the decomposition of H{sub 2}O{sub 2} into H{sub 2}O and O{sub 2}. - Graphical abstract: 5,10,15,20-Tetrakis(4-carboxyl phenyl)-porphyrin (H{sub 2}TCPP)-γ-Fe{sub 2}O{sub 3} nanocomposites were demonstrated to possess intrinsic peroxidase-like activity and showed a higher catalytic activity, compared to that of γ-Fe{sub 2}O{sub 3} nanoparticles alone. - Highlights: • Porphyrin-functionalized γ-Fe{sub 2}O{sub 3} nanoparticles were prepared by one-pot method. • The porphyrin-γ-Fe{sub 2}O{sub 3} nanocomposites were found to possess

Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?

Directory of Open Access Journals (Sweden)

Soo-Kyung Park

2017-10-01

Full Text Available Background/Aims: Colorectal cancer (CRC screening using stool DNA was recently found to yield good detection rates. A multi-target stool DNA test (Cologuard®, Exact Sciences, including methylated genes has been recently approved by the U.S. Food and Drug Administration. The aim of this study was to validate these aberrantly methylated genes as stool-based DNA markers for detecting CRC and colorectal advanced adenoma (AA in the Korean population.Methods: A single-center study was conducted in 36 patients with AA; 35 patients with CRC; and 40 endoscopically diagnosed healthy controls using CRC screening colonoscopy. The methylation status of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was investigated blindly using bisulfate-modified stool DNA obtained from 111 participants. Methylation status was investigated by methylation-specific polymerase chain reaction.Results: Methylated SFRP2, TFPI2, NDRG4, and BMP3 promoters were detected in 60.0%, 31.4%, 68.8%, and 40.0% of CRC samples and in 27.8%, 27.8%, 27.8%, and 33.3% of AA samples, respectively. The sensitivities obtained using 4 markers to detect CRC and AA were 94.3% and 72.2%, respectively. The specificity was 55.0%.Conclusions: Our results demonstrate that the SFRP2, TFPI2, NDRG4, and BMP3 promoter methylation analysis of stool sample DNA showed high sensitivity but low specificity for detecting CRC and AA. Because of the low specificity, 4 methylated markers might not be sufficient for CRC screening in the Korean population. Further large-scale studies are required to validate the methylation of these markers in the Asian population and to find new markers for the Asian population.

Acoustic Event Detection in Multichannel Audio Using Gated Recurrent Neural Networks with High‐Resolution Spectral Features

Directory of Open Access Journals (Sweden)

Hyoung‐Gook Kim

2017-12-01

Full Text Available Recently, deep recurrent neural networks have achieved great success in various machine learning tasks, and have also been applied for sound event detection. The detection of temporally overlapping sound events in realistic environments is much more challenging than in monophonic detection problems. In this paper, we present an approach to improve the accuracy of polyphonic sound event detection in multichannel audio based on gated recurrent neural networks in combination with auditory spectral features. In the proposed method, human hearing perception‐based spatial and spectral‐domain noise‐reduced harmonic features are extracted from multichannel audio and used as high‐resolution spectral inputs to train gated recurrent neural networks. This provides a fast and stable convergence rate compared to long short‐term memory recurrent neural networks. Our evaluation reveals that the proposed method outperforms the conventional approaches.

Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

Energy Technology Data Exchange (ETDEWEB)

Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

2007-01-30

In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

9 CFR 3.40 - Terminal facilities.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.40 Section 3.40... Pigs and Hamsters Transportation Standards § 3.40 Terminal facilities. No person subject to the Animal... animal holding areas of a terminal facility where shipments of live guinea pigs or hamsters are...

Event detection and exception handling strategies in the ASDEX Upgrade discharge control system

International Nuclear Information System (INIS)

Treutterer, W.; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.

2013-01-01

Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control

Event detection and exception handling strategies in the ASDEX Upgrade discharge control system

Energy Technology Data Exchange (ETDEWEB)

Treutterer, W., E-mail: Wolfgang.Treutterer@ipp.mpg.de; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.

2013-10-15

Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control

NuSTAR DETECTION OF THE BLAZAR B2 1023+25 AT REDSHIFT 5.3

Energy Technology Data Exchange (ETDEWEB)

Sbarrato, T. [Dipartimento di Scienza e Alta Tecnologia, Università dell' Insubria, Via Valleggio 11, I-22100 Como (Italy); Tagliaferri, G.; Ghisellini, G. [INAF-Osservatorio Astronomico di Brera, via E. Bianchi 46, I-23807 Merate (Italy); Perri, M.; Puccetti, S.; Giommi, P. [ASI-Science Data Center, via Galileo Galilei, I-00044 Frascati (Italy); Baloković, M.; Harrison, F. A.; Hovatta, T. [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Nardini, M. [Dipartimento di Fisica G. Occhialini, Università di Milano Bicocca, Piazza della Scienza 3, I-20126 Milano (Italy); Stern, D. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Boggs, S. E. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Brandt, W. N. [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Christensen, F. E. [DTU Space-National Space Institute, Technical University of Denmark, Elektrovej 327, DK-2800 Lyngby (Denmark); Greiner, J.; Rau, A.; Schady, P.; Sudilovsky, V. [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstrasse 1, D-85748 Garching (Germany); Hailey, C. J. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Madejski, G. M., E-mail: tullia.sbarrato@brera.inaf.it [Kavli Institute for Particle Astrophysics and Cosmology, SLAC National Accelerator Laboratory, Menlo Park, CA 94025 (United States); and others

2013-11-10

B2 1023+25 is an extremely radio-loud quasar at z = 5.3 that was first identified as a likely high-redshift blazar candidate in the SDSS+FIRST quasar catalog. Here, we use the Nuclear Spectroscopic Telescope Array (NuSTAR) to investigate its non-thermal jet emission, whose high-energy component we detected in the hard X-ray energy band. The X-ray flux is ∼ 5.5 x 10{sup -14} erg cm{sup -2} s{sup -1} (5-10 keV) and the photon spectral index is Γ{sub X} ≅ 1.3-1.6. Modeling the full spectral energy distribution, we find that the jet is oriented close to the line of sight, with a viewing angle of ∼3°, and has significant Doppler boosting, with a large bulk Lorentz factor ∼13, which confirms the identification of B2 1023+25 as a blazar. B2 1023+25 is the first object at redshift larger than 5 detected by NuSTAR, demonstrating the ability of NuSTAR to investigate the early X-ray universe and to study extremely active supermassive black holes located at very high redshift.

Evaluation of cartilage surface injuries using 3D-double echo steady state (3D-DESS): Effect of changing flip angle from 40 deg to 90 deg

International Nuclear Information System (INIS)

Moriya, Susumu; Yokobayashi, Tsuneo; Ishikawa, Mitsunori; Miki, Yukio; Kanagaki, Mitsunori; Yamamoto, Akira; Okudaira, Shuzo; Nakamura, Shinichiro

2011-01-01

Background. In magnetic resonance imaging (MRI) with 3D-double-echo steady-state (3D-DESS) sequences, the cartilage-synovial fluid contrast is reported to be better with a flip angle of 90 deg than with the conventional flip angle of 40 deg, and the detection rate of knee cartilage injury may be improved. Purpose. To compare the diagnostic performance and certainty of diagnosis with 3D-DESS images made using two flip angle settings, 40 deg and 90 deg, for knee cartilage surface lesions of Grade 2 or above confirmed by arthroscopy. Material and Methods. Images were obtained with 3D-DESS flip angles of 40 deg and 90 deg at 1.0T in 13 consecutive patients (2 men, 11 women, age range 18-68 years) evaluated for superficial cartilage injury by arthroscopy. Two radiologists classified the presence or absence of cartilage damage of ≥Grade 2 as 'positive (p)' or 'negative (n)', respectively. The rate of agreement with arthroscopic diagnosis was then examined, and the diagnostic performance compared. Diagnostic confidence was assessed scoring the presence or absence of cartilage damage into three categories: 3 = can diagnose with absolute confidence; 2 = can diagnose with a level of certainty as probably present or probably absent; and 1 = cannot make a diagnosis. Results. In a comparison of the rate of agreement between diagnosis by 3D-DESS images and arthroscopy, the rate of agreement was significantly higher and diagnostic performance was better in 90 deg images for the medial femoral condyle only. Diagnostic confidence was significantly better with 90 deg flip angle images than with 40 deg flip angle images for all six cartilage surfaces. Conclusion. In evaluating knee cartilage surface lesions with 3D-DESS sequences, a flip angle setting of 90 deg is more effective than the conventional setting of 40 deg

Evaluation of cartilage surface injuries using 3D-double echo steady state (3D-DESS): Effect of changing flip angle from 40 deg to 90 deg

Energy Technology Data Exchange (ETDEWEB)

Moriya, Susumu; Yokobayashi, Tsuneo; Ishikawa, Mitsunori (Ishikawa Clinic, Kyoto (Japan)), email: smoyari@yahoo.co.jp; Miki, Yukio (Dept. of Radiology, Osaka City Univ. Graduate School of Medicine, Osaka (Japan)); Kanagaki, Mitsunori; Yamamoto, Akira (Dept. of Diagnostic Imaging and Nuclear Medicine, Kyoto Univ., Kyoto (Japan)); Okudaira, Shuzo (Dept. of Orthopaedics, Kyoto Police Hospital, Kyoto (Japan)); Nakamura, Shinichiro (Center for Musculoskeletal Research, Univ. of Tennessee, Knoxville, TN (United States))

2011-12-15

Background. In magnetic resonance imaging (MRI) with 3D-double-echo steady-state (3D-DESS) sequences, the cartilage-synovial fluid contrast is reported to be better with a flip angle of 90 deg than with the conventional flip angle of 40 deg, and the detection rate of knee cartilage injury may be improved. Purpose. To compare the diagnostic performance and certainty of diagnosis with 3D-DESS images made using two flip angle settings, 40 deg and 90 deg, for knee cartilage surface lesions of Grade 2 or above confirmed by arthroscopy. Material and Methods. Images were obtained with 3D-DESS flip angles of 40 deg and 90 deg at 1.0T in 13 consecutive patients (2 men, 11 women, age range 18-68 years) evaluated for superficial cartilage injury by arthroscopy. Two radiologists classified the presence or absence of cartilage damage of >=Grade 2 as 'positive (p)' or 'negative (n)', respectively. The rate of agreement with arthroscopic diagnosis was then examined, and the diagnostic performance compared. Diagnostic confidence was assessed scoring the presence or absence of cartilage damage into three categories: 3 = can diagnose with absolute confidence; 2 = can diagnose with a level of certainty as probably present or probably absent; and 1 = cannot make a diagnosis. Results. In a comparison of the rate of agreement between diagnosis by 3D-DESS images and arthroscopy, the rate of agreement was significantly higher and diagnostic performance was better in 90 deg images for the medial femoral condyle only. Diagnostic confidence was significantly better with 90 deg flip angle images than with 40 deg flip angle images for all six cartilage surfaces. Conclusion. In evaluating knee cartilage surface lesions with 3D-DESS sequences, a flip angle setting of 90 deg is more effective than the conventional setting of 40 deg

The necessity of recognizing all events in x-ray detection

International Nuclear Information System (INIS)

Papp, T.; Maxwell, J.A.; Papp, A.T.

2008-01-01

-ray detection. Examples will be given in detection of x-rays in nuclear backgrounds, and in industrial measurements for ROHS and WEEE compliance with input rates of up to several hundred thousands counts per seconds. The availability of all the events allows one to see the other part of the spectrum, and thus offer explanations why the basic parameters are in such a bad shape

Closing the Gap: The Challenges of Treating Hepatitis C Virus Genotype 3 Infection.

Science.gov (United States)

Martin, Michelle T; Deming, Paulina

2017-06-01

The efficacy of hepatitis C virus (HCV) treatment has increased over the last 5 years to nearly 100% for many patient groups. Patients with genotype (GT) 3 HCV infection, however, and specifically cirrhotic or treatment-experienced patients, have lower sustained virologic response (SVR) rates than patients with other GTs. Because GT 3 presents more clinical challenges than other GTs, this review focuses on the evolution and efficacy of direct-acting antiviral (DAA) treatment options for HCV GT 3 infection after the historical standard of care with pegylated interferon and ribavirin. Our objective was to review the SVR rates with available and late-pipeline DAAs for HCV GT 3 infection and discuss challenges with successful GT 3 treatment. Authors performed a literature search of the PubMed/MEDLINE database (inception to March 27, 2017) and narrowed the field to clinical trials published in English. Trials that evaluated alternative treatments, non-DAA historical treatment, and DAAs not currently indicated for HCV were excluded. Trials only involving patients with human immunodeficiency virus/HCV coinfection were also excluded. Additional trials were identified from a review of the ClinicalTrials.gov database. Authors further identified references from a review of literature citations and reviewed annual meeting abstracts from the American Association for the Study of Liver Diseases and the European Association for the Study of the Liver for pipeline and real-world GT 3 data. Phase III trial data were not available to support all GT 3 treatment recommendations found in the guidelines. The SVR rates were lower in treatment-experienced and cirrhotic patients with GT 3 than other HCV populations. Treatment failure was associated with resistance to current treatment regimens. Clinical studies included patients with various levels of advanced liver disease, but few patients with decompensated cirrhosis were represented. Recent advances in pharmacologic treatment with DAAs

Novel measurement method of heat and light detection for neutrinoless double beta decay

Science.gov (United States)

Kim, G. B.; Choi, J. H.; Jo, H. S.; Kang, C. S.; Kim, H. L.; Kim, I.; Kim, S. R.; Kim, Y. H.; Lee, C.; Lee, H. J.; Lee, M. K.; Li, J.; Oh, S. Y.; So, J. H.

2017-05-01

We developed a cryogenic phonon-scintillation detector to search for 0νββ decay of 100Mo. The detector module, a proto-type setup of the AMoRE experiment, has a scintillating 40Ca100MoO4 absorber composed of 100Mo-enriched and 48Ca-depleted elements. This new detection method employs metallic magnetic calorimeters (MMCs) as the sensor technology for simultaneous detection of heat and light signals. It is designed to have high energy and timing resolutions to increase sensitivity to probe the rare event. The detector, which is composed of a 200 g 40Ca100MoO4 crystal and phonon/photon sensors, showed an energy resolution of 8.7 keV FWHM at 2.6 MeV, with a weak temperature dependence in the range of 10-40 mK. Using rise-time and mean-time parameters and light/heat ratios, the proposed method showed a strong capability of rejecting alpha-induced events from electron events with as good as 20σ separation. Moreover, we discussed how the signal rise-time improves the rejection efficiency for random coincidence signals.

Hazardous Traffic Event Detection Using Markov Blanket and Sequential Minimal Optimization (MB-SMO

Directory of Open Access Journals (Sweden)

Lixin Yan

2016-07-01

Full Text Available The ability to identify hazardous traffic events is already considered as one of the most effective solutions for reducing the occurrence of crashes. Only certain particular hazardous traffic events have been studied in previous studies, which were mainly based on dedicated video stream data and GPS data. The objective of this study is twofold: (1 the Markov blanket (MB algorithm is employed to extract the main factors associated with hazardous traffic events; (2 a model is developed to identify hazardous traffic event using driving characteristics, vehicle trajectory, and vehicle position data. Twenty-two licensed drivers were recruited to carry out a natural driving experiment in Wuhan, China, and multi-sensor information data were collected for different types of traffic events. The results indicated that a vehicle’s speed, the standard deviation of speed, the standard deviation of skin conductance, the standard deviation of brake pressure, turn signal, the acceleration of steering, the standard deviation of acceleration, and the acceleration in Z (G have significant influences on hazardous traffic events. The sequential minimal optimization (SMO algorithm was adopted to build the identification model, and the accuracy of prediction was higher than 86%. Moreover, compared with other detection algorithms, the MB-SMO algorithm was ranked best in terms of the prediction accuracy. The conclusions can provide reference evidence for the development of dangerous situation warning products and the design of intelligent vehicles.

Fundamental aspects of seismic event detection, magnitude estimation and their interrelation

International Nuclear Information System (INIS)

Ringdal, F.

1977-01-01

The main common subject of the papers forming this thesis is statistical model development within the seismological disciplines of seismic event detection and event magnitude estimation. As more high quality seismic data become available as a result of recent seismic network developments, the opportunity will exist for large scale application and further refinement of these models. It is hoped that the work presented here will facilitate improved understanding of the basic issues, both within earthquake-explosion discrimination, in the framework of which most of this work originated, and in seismology in general. (Auth.)

3,9-Dithia-6-azaundecane-appended Iridium (III) Complex for the Selective Detection of Hg{sup 2+} in Aqueous Acetonitrile

Energy Technology Data Exchange (ETDEWEB)

Ann, Jee Hye; Li, Yinan; Hyun, Myung Ho [Pusan National Univ., Busan (Korea, Republic of)

2012-10-15

Detection of mercuric ion (Hg{sup 2+}) originated from natural or industrial sources is very important because it is extremely toxic even at low levels and causes serious environmental and health problems. Consequently, many efforts have been devoted to the development of sensitive chemosensors for the detection of Hg{sup 2+}. For example, various fluorescent chemosensors based on rhodamine, nitrobenzoxadiazole, fluorescein, boradiazaindacene (BODIPY), dansyl, pyrene, or other fluorophores have been developed for the selective detection of Hg{sup 2+}. While various fluorescent chemosensors for the selective detection of Hg{sup 2+} have been developed, phosphorescent chemosensors for the selective detection of Hg{sup 2+} are relatively rare. Among various phosphors, iridium (III) complexes with sulfur containing cyclometalated ligands have been used as phosphorescent chemosensors for the selective detection of Hg{sup 2+}. Azacrown ether-appended iridium (III) complex developed in our laboratory has also been utilized as a phosphorescent chemosensor for the selective detection of Hg{sup 2+}. As an another iridium (III) complex-based phosphorescent chemosensors for the selective detection of Hg{sup 2+}, in this study, we wish to prepare iridium (III) complex containing two 3,9-dithia-6-azaundecane units as chelating ligands for metal ions. Some fluorophores containing 3,9-dithia-6-azaundecane unit have been successfully applied for the selective detection of Hg{sup 2+}. In this instance, iridium (III) complex containing two 3,9-dithia-6-azaundecane units is expected to be useful as a phosphorescent chemosensor for the selective detection of Hg{sup 2+}. Iridium (III) complex containing two 3,9-dithia-6-azaundecane units was prepared starting from 2-phenylpyridine according to the procedure shown in Scheme 1. 2-Phenylpyridine was transformed into chloride bridged dimeric iridium complex, [(ppy){sub 2}IrCl]{sub 2}, via the reported procedure. By treating [(ppy){sub 2}Ir

Individual differences in event-based prospective memory: Evidence for multiple processes supporting cue detection.

Science.gov (United States)

Brewer, Gene A; Knight, Justin B; Marsh, Richard L; Unsworth, Nash

2010-04-01

The multiprocess view proposes that different processes can be used to detect event-based prospective memory cues, depending in part on the specificity of the cue. According to this theory, attentional processes are not necessary to detect focal cues, whereas detection of nonfocal cues requires some form of controlled attention. This notion was tested using a design in which we compared performance on a focal and on a nonfocal prospective memory task by participants with high or low working memory capacity. An interaction was found, such that participants with high and low working memory performed equally well on the focal task, whereas the participants with high working memory performed significantly better on the nonfocal task than did their counterparts with low working memory. Thus, controlled attention was only necessary for detecting event-based prospective memory cues in the nonfocal task. These results have implications for theories of prospective memory, the processes necessary for cue detection, and the successful fulfillment of intentions.

Label-free SnO2 nanowire FET biosensor for protein detection

Science.gov (United States)

Jakob, Markus H.; Dong, Bo; Gutsch, Sebastian; Chatelle, Claire; Krishnaraja, Abinaya; Weber, Wilfried; Zacharias, Margit

2017-06-01

Novel tin oxide field-effect-transistors (SnO2 NW-FET) for pH and protein detection applicable in the healthcare sector are reported. With a SnO2 NW-FET the proof-of-concept of a bio-sensing device is demonstrated using the carrier transport control of the FET channel by a (bio-) liquid modulated gate. Ultra-thin Al2O3 fabricated by a low temperature atomic layer deposition (ALD) process represents a sensitive layer to H+ ions safeguarding the nanowire at the same time. Successful pH sensitivity is demonstrated for pH ranging from 3 to 10. For protein detection, the SnO2 NW-FET is functionalized with a receptor molecule which specifically interacts with the protein of interest to be detected. The feasibility of this approach is demonstrated via the detection of a biotinylated protein using a NW-FET functionalized with streptavidin. An immediate label-free electronic read-out of the signal is shown. The well-established Enzyme-Linked Immunosorbent Assay (ELISA) method is used to determine the optimal experimental procedure which would enable molecular binding events to occur while being compatible with a final label-free electronic read-out on a NW-FET. Integration of the bottom-up fabricated SnO2 NW-FET pH- and biosensor into a microfluidic system (lab-on-a-chip) allows the automated analysis of small volumes in the 400 μl range as would be desired in portable on-site point-of-care (POC) devices for medical diagnosis.

Coprolalia and copropraxia in patients with Gilles de la Tourette syndrome.

Science.gov (United States)

Kobierska, Magdalena; Sitek, Martyna; Gocyła, Katarzyna; Janik, Piotr

2014-01-01

Involuntary expression of socially unacceptable words (coprolalia) or gestures (copropraxia) is the best-known symptom of Gilles de Tourette syndrome (GTS) that contributes to the social impairment. The aim of the study was to assess the prevalence, age at onset and co-occurring symptoms of coprophenomena. One hundred and sixty-eight consecutive subjects with GTS including 94 adults and 74 children and aged between 4 and 54 years (mean: 18.0±8.3) were studied. Demographic and clinical data were obtained from medical history and neurological examination. Coprolalia or copropraxia appeared in 44 patients. Both coprophenomena were present in 9 patients. Coprolalia occurred in 25.0% (n=42) and copropraxia in 6.5% (n=11) of patients. Mean age at onset was 12.2±5.7 years (range: 4-33) for coprolalia and 12.4±4.9 years (range: 7-24) for copropraxia. Coprolalia started 4.4±3.7 years (range: 0-16) after the onset of disease; copropraxia started 6.1±4.0 years (range: 1-12) after the onset of the disease. Coprolalia began in adulthood in six patients only, and copropraxia in one person. In six patients, coprolalia appeared in the first year of the disease. Copropraxia was never seen in the first year of the disease. Coprophenomena were more frequent in patients with comorbid mental disorders, behavioral problems and severe tics. Three quarters of patients reported significant influence of coprophenomena on daily living. Coprophenomena affect one quarter of GTS patients, appear in the time when tics are most severe, and are positively associated with comorbidity and more severe form of disease. Coprophenomena may reflect more widespread dysfunction of brain in GTS. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Limits of 2D-TCA in detecting BOLD responses to epileptic activity.

Science.gov (United States)

Khatamian, Yasha Borna; Fahoum, Firas; Gotman, Jean

2011-05-01

Two-dimensional temporal clustering analysis (2D-TCA) is a relatively new functional MRI (fMRI) based technique that breaks blood oxygen level dependent activity into separate components based on timing and has shown potential for localizing epileptic activity independently of electroencephalography (EEG). 2D-TCA has only been applied to detect epileptic activity in a few studies and its limits in detecting activity of various forms (i.e. activation size, amplitude, and frequency) have not been investigated. This study evaluated 2D-TCA's ability to detect various forms of both simulated epileptic activity and EEG-fMRI activity detected in patients. When applied to simulated data, 2D-TCA consistently detected activity in 6min runs containing 5 spikes/run, 10 spikes/run, and one 5s long event with hemodynamic response function amplitudes of at least 1.5%, 1.25%, and 1% above baseline respectively. When applied to patient data, while detection of interictal spikes was inconsistent, 2D-TCA consistently produced results similar to those obtained by EEG-fMRI when at least 2 prolonged interictal events (a few seconds each) occurred during the run. However, even for such cases it was determined that 2D-TCA can only be used to validate localization by other means or to create hypotheses as to where activity may occur, as it also detects changes not caused by epileptic activity. Copyright © 2011 Elsevier B.V. All rights reserved.

Flow detection via sparse frame analysis for suspicious event recognition in infrared imagery

Science.gov (United States)

Fernandes, Henrique C.; Batista, Marcos A.; Barcelos, Celia A. Z.; Maldague, Xavier P. V.

2013-05-01

It is becoming increasingly evident that intelligent systems are very bene¯cial for society and that the further development of such systems is necessary to continue to improve society's quality of life. One area that has drawn the attention of recent research is the development of automatic surveillance systems. In our work we outline a system capable of monitoring an uncontrolled area (an outside parking lot) using infrared imagery and recognizing suspicious events in this area. The ¯rst step is to identify moving objects and segment them from the scene's background. Our approach is based on a dynamic background-subtraction technique which robustly adapts detection to illumination changes. It is analyzed only regions where movement is occurring, ignoring in°uence of pixels from regions where there is no movement, to segment moving objects. Regions where movement is occurring are identi¯ed using °ow detection via sparse frame analysis. During the tracking process the objects are classi¯ed into two categories: Persons and Vehicles, based on features such as size and velocity. The last step is to recognize suspicious events that may occur in the scene. Since the objects are correctly segmented and classi¯ed it is possible to identify those events using features such as velocity and time spent motionless in one spot. In this paper we recognize the suspicious event suspicion of object(s) theft from inside a parked vehicle at spot X by a person" and results show that the use of °ow detection increases the recognition of this suspicious event from 78:57% to 92:85%.

Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells

Energy Technology Data Exchange (ETDEWEB)

Chihara, Kazuyasu [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Kimura, Yukihiro [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Division of Otorhinolaryngology Head and Neck Surgery, Department of Sensory and Locomotor Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Honjoh, Chisato [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Third Department of Internal Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Yamauchi, Shota; Takeuchi, Kenji [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Sada, Kiyonao, E-mail: ksada@u-fukui.ac.jp [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan)

2014-03-10

Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 446} in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr{sup 183} and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 426} of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr{sup 426} is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr{sup 426} was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr{sup 426} following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation.

Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells

International Nuclear Information System (INIS)

Chihara, Kazuyasu; Kimura, Yukihiro; Honjoh, Chisato; Yamauchi, Shota; Takeuchi, Kenji; Sada, Kiyonao

2014-01-01

Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr 174 , Tyr 183 and Tyr 446 in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr 183 and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr 174 , Tyr 183 and Tyr 426 of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr 426 is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr 426 was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr 426 following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation

Asian dust events of April 1998

Science.gov (United States)

Husar, R.B.; Tratt, D.M.; Schichtel, B.A.; Falke, S.R.; Li, F.; Jaffe, D.; Gasso, S.; Gill, T.; Laulainen, N.S.; Lu, F.; Reheis, M.C.; Chun, Y.; Westphal, D.; Holben, B.N.; Gueymard, C.; McKendry, I.; Kuring, N.; Feldman, G.C.; McClain, C.; Frouin, R.J.; Merrill, J.; DuBois, D.; Vignola, F.; Murayama, T.; Nickovic, S.; Wilson, W.E.; Sassen, K.; Sugimoto, N.; Malm, W.C.

2001-01-01

On April 15 and 19, 1998, two intense dust storms were generated over the Gobi desert by springtime low-pressure systems descending from the northwest. The windblown dust was detected and its evolution followed by its yellow color on SeaWiFS satellite images, routine surface-based monitoring, and through serendipitous observations. The April 15 dust cloud was recirculating, and it was removed by a precipitating weather system over east Asia. The April 19 dust cloud crossed the Pacific Ocean in 5 days, subsided to the surface along the mountain ranges between British Columbia and California, and impacted severely the optical and the concentration environments of the region. In east Asia the dust clouds increased the albedo over the cloudless ocean and land by up to 10-20%, but it reduced the near-UV cloud reflectance, causing a yellow coloration of all surfaces. The yellow colored backscattering by the dust eludes a plausible explanation using simple Mie theory with constant refractive index. Over the West Coast the dust layer has increased the spectrally uniform optical depth to about 0.4, reduced the direct solar radiation by 30-40%, doubled the diffuse radiation, and caused a whitish discoloration of the blue sky. On April 29 the average excess surface-level dust aerosol concentration over the valleys of the West Coast was about 20-50 ??g/m3 with local peaks >100 ??g/m3. The dust mass mean diameter was 2-3 ??m, and the dust chemical fingerprints were evident throughout the West Coast and extended to Minnesota. The April 1998 dust event has impacted the surface aerosol concentration 2-4 times more than any other dust event since 1988. The dust events were observed and interpreted by an ad hoc international web-based virtual community. It would be useful to set up a community-supported web-based infrastructure to monitor the global aerosol pattern for such extreme aerosol events, to alert and to inform the interested communities, and to facilitate collaborative

Detection of sul1, sul2 and sul3 in sulphonamide resistant Escherichia coli isolates obtained from healthy humans, pork and pigs in Denmark

DEFF Research Database (Denmark)

Hammerum, Anette Marie; Sandvag, Dorthe; Andersen, Sigrid R.

2006-01-01

The occurrence of sulphonamide resistance was investigated in 998 Escherichia coli isolates, obtained from pig faeces collected at slaughter, Danish pork collected at retail outlets and from faeces from healthy persons in Denmark. In total 18% (n = 35), 20% (n = 38) and 26% (n = 161) of the E. coli...... isolates obtained from humans, pork and pigs, respectively, were resistant to sulphonamide. All sulphonamide resistant E. coli isolates were investigated for the presence of sul1, sul2, sul3 and intl1 genes by PCR. The sul1 gene was detected in 40% (n = 14), 29% (n = 11) and 55% (n = 88...

High Performance Computing and Visualization Infrastructure for Simultaneous Parallel Computing and Parallel Visualization Research

Science.gov (United States)

2016-11-09

Total Number: Sub Contractors (DD882) Names of Personnel receiving masters degrees Names of personnel receiving PHDs Names of other research staff...Broadcom 5720 QP 1Gb Network Daughter Card (2) Intel Xeon E5-2680 v3 2.5GHz, 30M Cache, 9.60GT/s QPI, Turbo, HT , 12C/24T (120W...Broadcom 5720 QP 1Gb Network Daughter Card (2) Intel Xeon E5-2680 v3 2.5GHz, 30M Cache, 9.60GT/s QPI, Turbo, HT , 12C/24T (120W

Seismic Monitoring Prior to and During DFDP-2 Drilling, Alpine Fault, New Zealand: Matched-Filter Detection Testing and the Real-Time Monitoring System