
Sample records for europium 167

  1. Fluorescent Europium Chelate Stain (United States)

    Scaff, W. L.; Dyer, D. L.; Mori, K.


    The europium chelate of 4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione (thenoyl-trifluoroacetone; TTA) is firmly bound to microorganisms. It fluoresces brightly at 613 nm with activation at 340 nm. Cells may be stained with 10−3m chelate in 50% ethyl alcohol, followed by washing with 50% ethyl alcohol. Equal or better stains are produced with 10−3m aqueous europium salt, water wash, and 10−2m aqueous TTA. A noncomplexing buffer should be used to maintain the pH at 6.5 to 6.8. Images PMID:4181107

  2. Europium-155 in Debris from Nuclear Weapons

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Lippert, Jørgen Emil


    The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...... of europium-155 from weapons was estimated at 1400 atoms per 10$^{6}$ fissions, which is close to the yield of europium-155 from fast fission of uranium-238....

  3. The electrochemical synthesis of europium boride

    Directory of Open Access Journals (Sweden)

    Bukatova G.A.


    Full Text Available The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. % melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  4. The electrochemical synthesis of europium boride


    Bukatova G.A.; Kuznetsov S.A.; Gaune-Escard M.


    The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. %) melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  5. Liposome Biodistribution via Europium Complexes. (United States)

    Mignet, Nathalie; Scherman, Daniel


    The drug delivery field needs tools to follow vector biodistribution. Radioactive tracers and conventional fluorophores are widely used. We propose here to use europium complexes. Use of pulsed light source time-resolved fluorimetry takes into account the fluorescence decay time of the lanthanide chelates to gain sensitivity in biological media. The method was developed to follow liposome biodistribution. Octadecyl-DTPA.Eu compound has been prepared and incorporated into liposomes without alteration of its fluorescence signal. The method has been validated by comparison with fluorophore-labeled liposomes. The way to proceed to use this method for liposomes or other vectors is detailed.

  6. Resonance ionization scheme development for europium

    CERN Document Server

    Chrysalidis, K; Fedosseev, V N; Marsh, B A; Naubereit, P; Rothe, S; Seiffert, C; Kron, T; Wendt, K


    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  7. Resonance ionization scheme development for europium

    Energy Technology Data Exchange (ETDEWEB)

    Chrysalidis, K., E-mail:; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)


    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  8. Electronic state of europium atoms on surface of oxidized tungsten

    CERN Document Server

    Davydov, S Y


    The energy scheme of the europium atoms adsorption system on the tungsten surface, coated with the oxygen monolayer, is considered. The evaluations of the europium adatoms charged state on the oxidized tungsten surface are performed. It is established, that europium, adsorbed at the oxidized tungsten surface, is a positive ion with the charge close to the unit. The zonal scheme of the Eu-O/W adsorption system for the europium low and high concentrations is proposed

  9. Europium anomaly in plagioclase feldspar - Experimental results and semiquantitative model. (United States)

    Weill, D. F.; Drake, M. J.


    The partition of europium between plagioclase feldspar and magmatic liquid is considered in terms of the distribution coefficients for divalent and trivalent europium. A model equation is derived giving the europium anomaly in plagioclase as a function of temperature and oxygen fugacity. The model explains europium anomalies in plagioclase synthesized under controlled laboratory conditions as well as the variations of the anomaly observed in natural terrestrial and extraterrestrial igneous rocks.

  10. Fermi Surface and Antiferromagnetism in Europium Metal

    DEFF Research Database (Denmark)

    Andersen, O. Krogh; Loucks, T. L.


    We have calculated the Fermi surface of europium in order to find those features which determine the wave vector of the helical moment arrangement below the Néel point. We find that there are two pieces of Fermi surface: an electron surface at the symmetry point H, which has the shape of rounded...... of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...

  11. Organophosphate Nerve Agent Detection with Europium Complexes

    Directory of Open Access Journals (Sweden)

    Jake R. Schwierking


    Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.

  12. 46 CFR 167.43-10 - Use. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use. 167.43-10 Section 167.43-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Work Vests § 167.43-10 Use. (a) Approved buoyant work vests are considered to be items of safety apparel and may be...

  13. 32 CFR 552.167 - Activities. (United States)


    ... 32 National Defense 3 2010-07-01 2010-07-01 true Activities. 552.167 Section 552.167 National..., and Camp Bonneville § 552.167 Activities. (a) Authorized activities are listed in appendix C to this subpart. (b) Prohibited activities are listed in appendix D to this subpart. ...

  14. 46 CFR 167.20-1 - Construction. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 167.20-1 Section 167.20-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-1 Construction. Except as...

  15. 46 CFR 167.40-40 - Radar. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Radar. 167.40-40 Section 167.40-40 Shipping COAST GUARD... Requirements § 167.40-40 Radar. All mechanically propelled vessels of 1,600 gross tons and over in ocean or coastwise service must be fitted with a marine radar system for surface navigation. Facilities for plotting...

  16. 27 CFR 19.167 - Organizational documents. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Organizational documents. 19.167 Section 19.167 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU....167 Organizational documents. The supporting information required by paragraph (c) of § 19.152, and...

  17. 40 CFR 159.167 - Discontinued studies. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Discontinued studies. 159.167 Section 159.167 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS STATEMENTS OF POLICIES AND INTERPRETATIONS Reporting Requirements for Risk/Benefit Information § 159.167 Discontinued studies. The fact that a study has...

  18. 19 CFR 122.167 - Aviation smuggling. (United States)


    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Aviation smuggling. 122.167 Section 122.167... TREASURY AIR COMMERCE REGULATIONS Penalties § 122.167 Aviation smuggling. (a) Civil penalties. Any aircraft.... More severe penalties are provided in 19 U.S.C. 1590 if the smuggled merchandise is a controlled...

  19. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail:; Sony, G., E-mail:


    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  20. The Europium Oxybarometer: Power and Pitfalls (United States)

    McKay, G.


    One of the most important characteristics of a planet is the oxidation state of its mantle, as reflected in primitive basalts. Petrologists have devised several methods to estimate the oxygen fugacity under which basalts crystallized. One method that has been the subject of recent interest involves the depth of the Eu anomaly in first-crystallizing minerals. A discussion detailing the experimental calibration of the Europium oxybarometer and the application of this device to Angrites and Martian basaltic meteorites are presented. The strengths and weaknesses of the instrument are also included.

  1. Europium Effect on the Electron Transport in Graphene Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Bobadilla, Alfredo D.; Ocola, Leonidas E.; Sumant, Anirudha V.; Kaminski, Michael; Kumar, Narendra; Seminario, Jorge M.


    We report in this complementary theoretical-experimental work the effect of gating on the election transport of grapheme ribbons when exposed to very low concentration of europium in an aqueous solution. We find a direct correlation between the level of concentration of europium ions in the solvent and the change in electron transport in graphene, observing a change of up to 3 orders of magnitude at the lowest level of concentration tested (0.1 mM), suggesting a possibility that graphene ribbons can be used for detecting very low concentrations of europium in liquid solutions.

  2. Paramagnetic Europium Salen Complex and Sickle-Cell Anemia (United States)

    Wynter, Clive I.; Ryan, D. H.; May, Leopold; Oliver, F. W.; Brown, Eugene; Hoffman, Eugene J.; Bernstein, David


    A new europium salen complex, Eu(salen)2NH4, was synthesized, and its composition was confirmed by chemical analysis and infrared spectroscopy. Further characterization was carried out by 151 Eu Mössbauer spectroscopy and magnetic susceptibility measurements. Mössbauer spectroscopic measurements were made at varying temperatures between 9 K and room temperature and a value of Debye temperature of 133 ±5 K was computed. Both Mössbauer and magnetic susceptibility measurements confirmed the paramagnetic behavior of this complex and the trivalent state of the europium ion. In view of the fact that the "odd" paramagnetic molecule NO has been shown to reverse sickling of red blood cells in sickle cell anemia, the interaction between the paramagnetic europium salen complex and sickle cells was examined after incubation with this europium complex and shown to have similar effects.

  3. Europium polyoxometalates encapsulated in silica nanoparticles - characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)


    The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  4. Spectral Properties of a bis-Azospiropyran Complexed with Europium (United States)

    Nourmohammadian, F.; Ghahari, M.; Gholami, M. Davoudzadeh


    The complexation of recently synthesized symmetrical bifunctional bis-azospiropyran photochromic dye with europium nitrate and its effect on UV-vis absorption and fluorescent emission was studied. Upon addition of Eu 3+ to colorless spiropyran, a yellow merocyanine europium complex was obtained with an absorption band at 410 nm. Negatively charged phenolic oxygenin zwitterionic ring-open form provides an effective metal binding site for Eu 3+ . Meanwhile, the inherent fluorescence emission of the photochromic dye at 380 nm is switched off due to the Eu 3+ - induced drive of spiro-mero equilibrium to form mero form. The stoichiometry of dye-europium complexation was evaluated by fluorescence emission and UV-vis absorption spectroscopy and a 8:1 ratio was obtained in both cases. The binding constant (K) value of the dye-europium complex was 3 × 106 M -1 . In conclusion, the current molecular switch is a useful sensitive dual measuring tool for solutions containing europium or europium-like elements by evaluation of visible absorption or fluorescent emission spectroscopy.

  5. Metal plasmon enhanced europium complex luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Liu Feng [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Aldea, Gabriela [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Petru Poni Institute of Macromolecular Chemistry Iasi, Aleea Grigore Ghica Voda 41A, 700487 Iasi (Romania); Nunzi, Jean-Michel, E-mail: nunzijm@queensu.c [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada)


    The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod){sub 3}) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.

  6. Novel fluorescent probe for low density lipoprotein, based on the enhancement of Europium emission band


    Courrol, Lilia Coronato; Monteiro, A.M.; SILVA, F.R.O.; L. Gomes; VIEIRA, N.D.; Gidlund, Magnus; Figueiredo Neto, A.M.


    We report here the observation of the enhancement of Europium-tetracycline complex emission in Low Density Lipoprotein (LDL) solutions. Europium emission band of tetracycline solution containing Europium (III) chloride hexahydrate was tested to obtain effective enhancement in the presence of native LDL and oxidized LDL. Europium emission lifetime in the presence of lipoproteins was measured, resulting in a simple method to measure the lipoproteins quantity in an aqueous solution at physiologi...

  7. Dicty_cDB: SLF167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF167 (Link to dictyBase) - - - Contig-U16176-1 SLF167Z (Link... to Original site) - - SLF167Z 480 - - - - Show SLF167 Library SL (Link to library) Clone ID SLF167 (Link Representative seq. ID SLF16...7Z (Link to Original site) Representative DNA sequence >SLF167 (SLF167Q) /CSM/SL/SLF1-C/SLF167Q.Seq.d/ XXXXX...hckft qknk*isyr*rrlgtiwywc*nlcindgtcf*lfrcpn*knlwc*csnaicfklgkccyg pnskhcqcc*ksyskk*inlkkkks*inffsrkkrnndkek

  8. Europium ion as a probe for binding sites to carrageenans

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail:; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)


    Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.

  9. First-Principles Investigations on Europium Monoxide

    KAUST Repository

    Wang, Hao


    Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.

  10. Chloride, bromide and iodide scintillators with europium (United States)

    Zhuravleva, Mariya; Yang, Kan


    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  11. Electrochemical extraction of europium from molten fluoride media

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Massot, L., E-mail: [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Chamelot, P.; Cassayre, L.; Taxil, P. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France)


    This work concerns the extraction of europium from molten fluoride media. Two electrochemical ways have been examined: (i) the use of a reactive cathode made of copper and (ii) the co-deposition with aluminium on inert electrode, leading to the formation of europium-copper and europium-aluminium alloys, respectively, as identified by SEM-EDS analysis. Cyclic voltammetry and square wave voltammetry were used to identify the reduction pathway and to characterise the step of Cu-Eu and Al-Eu alloys formation. Then, electrochemical extractions using the two methodologies have been performed with extraction efficiency around 92% for copper electrode and 99.7% for co-reduction with aluminium ions.

  12. Solubilization of europium fulvate in aqueous solutions containing complexing agents

    Energy Technology Data Exchange (ETDEWEB)

    Legin, E.K.; Trifonov, Yu.I.; Khokhlov, M.L. [Khlopin Radium Inst., St. Petersburg (Russian Federation)] [and others


    The europium fulvate complex is synthesized and characterized by spectroscopic and chemical methods. By an example of this complex, it is demonstrated that metal complexes of humic substances are solubilized in the presence of complexing anions such as OAc{sup {minus}}, C{sub 2}O{sup 2{minus}}{sub 4}, and EDTA{sup 2{minus}}. The solubilization is studied by the optical and radioactive tracer methods. The solubilization of europium fulvate increases parallel to the complexing power of anions. In the solid fulvate europium is bonded stronger than in the ethylenediaminetetraacetate complex. The solubilization is considered as a potential source for decomposition of the {open_quotes}absorbing soil complex,{close_quotes} resulting in mobile forms of a metal and humic component in soils and soil waters.

  13. Excess europium content in Precambrian sedimentary rocks and continental evolution (United States)

    Jakes, P.; Taylor, S. R.


    It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.

  14. Murine High Specificity/Sensitivity Competitive Europium Insulin Autoantibody Assay (United States)

    Babaya, Naru; Liu, Edwin; Miao, DongMei; Li, Marcella; Yu, Liping


    Abstract Background Most insulin autoantibody assays for both human and animal models are in a radioassay format utilizing 125I-insulin, but despite the radioassay format international workshops have documented difficulty in standardization between laboratories. There is thus a need for simpler assay formats that do not utilize radioactivity, yet retain the high specificity and sensitivity of radioassays. Methods To establish an easier enzyme-linked immunosorbent assay (ELISA) for insulin autoantibodies of non-obese diabetic (NOD) mice, we used an ELISA format, competition with unlabeled insulin, europium-avidin, and time-resolved fluorescence detection (competitive europium insulin autoantibody assay). Results The competitive europium assay of insulin autoantibodies when applied to sera from NOD mice had high sensitivity and specificity (92% sensitivity, 100% specificity) compared to our standard insulin autoantibody radioassay (72% sensitivity, 100% specificity) in analyzing blind workshop sera. It is noteworthy that though the assay has extremely high sensitivity for murine insulin autoantibodies and utilizes human insulin as target autoantigen, human sera with high levels of insulin autoantibodies are not detected. Conclusions Our results clearly indicate that low levels of insulin autoantibodies can be detected in an ELISA-like format. Combining a europium-based ELISA with competition with fluid-phase autoantigen can be applicable to many autoantigens to achieve high specificity and sensitivity in an ELISA format. PMID:19344197

  15. Tridentate benzimidazole-pyridine-tetrazolates as sensitizers of europium luminescence. (United States)

    Shavaleev, Nail M; Eliseeva, Svetlana V; Scopelliti, Rosario; Bünzli, Jean-Claude G


    We report on new anionic tridentate benzimidazole-pyridine-tetrazolate ligands that form neutral 3:1 complexes with trivalent lanthanides. The ligands are UV-absorbing chromophores that sensitize the red luminescence of europium with energy-transfer efficiency of 74-100%. The lifetime and quantum yield of the sensitized europium luminescence increase from 0.5 ms and 12-13% for the as-prepared solids to 2.8 ms and 41% for dichloromethane solution. From analysis of the data, the as-prepared solids can be described as aqua-complexes [Ln(κ(3)-ligand)2(κ(1)-ligand)(H2O)x] where the coordinated water molecules are responsible for the strong quenching of the europium luminescence. In solution, the coordinated water molecules are replaced by the nitrogen atoms of the κ(1)-ligand to give anhydrous complexes [Ln(κ(3)-ligand)3] that exhibit efficient europium luminescence. X-ray structures of the anhydrous complexes confirm that the lanthanide ion (La(III), Eu(III)) is nine-coordinate in a distorted tricapped trigonal prismatic environment and that coordination of the lanthanide ion by tetrazolate is weaker than by carboxylate.

  16. Europium 2-benzofuranoate: Synthesis and use for bioimaging (United States)

    Utochnikova, V. V.; Koshelev, D. S.; Medvedko, A. V.; Kalyakina, A. S.; Bushmarinov, I. S.; Grishko, A. Yu; Schepers, U.; Bräse, S.; Vatsadze, S. Z.


    Europium 2-benzofuranoate Eu(BFC)3(H2O)3 was successfully used for bioimaging in cellulo due to the combination of high solubility and high luminescence intensity in solution. It was possible due to the purposeful variation of the aromatic core of carboxylate anion.

  17. Dicty_cDB: VHB167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHB167 (Link to dictyBase) - - - Contig-U10801-1 | Contig-U12701-1 VHB...167P (Link to Original site) VHB167F 663 VHB167Z 719 VHB167P 1362 - - Show VHB167 Library VH (Link to library) Clone ID VHB...801-1 | Contig-U12701-1 Original site URL Representative seq. ID VHB167P (Link to Original site) Representative DNA sequence >VHB167 (VHB...167Q) /CSM/VH/VHB1-C/VHB167Q.Seq.d/ GTNNTCCTTACAATAATAAAATAATAATAAATAATGGATAATACAGNATTAGTTATTAAT

  18. 26 CFR 1.167(m)-1 - Class lives. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Class lives. 1.167(m)-1 Section 1.167(m)-1...) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(m)-1 Class lives. (a) For rules regarding the election to use the class life system authorized by section 167(m), see...


    Peppard, D.F.; Horwitz, E.P.; Mason, G.W.


    This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)

  20. 14 CFR 61.167 - Privileges. (United States)


    ... debriefings, an airline transport pilot may not instruct in aircraft, flight simulators, and flight training... CERTIFICATION: PILOTS, FLIGHT INSTRUCTORS, AND GROUND INSTRUCTORS Airline Transport Pilots § 61.167 Privileges. (a) A person who holds an airline transport pilot certificate is entitled to the same privileges as a...

  1. 14 CFR 406.167 - Initial decision. (United States)


    ... Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Transportation Adjudications § 406.167 Initial decision. (a) Contents. The administrative law judge must issue an... law judge must include findings of fact and conclusions of law, and the grounds supporting those...

  2. Distribution, elimination, and renal effects of single oral doses of europium in rats. (United States)

    Ohnishi, Keiko; Usuda, Kan; Nakayama, Shin; Sugiura, Yumiko; Kitamura, Yasuhiro; Kurita, Akihiro; Tsuda, Yuko; Kimura, Motoshi; Kono, Koichi


    Single doses of europium (III) chloride hexahydrate were orally administered to several groups of rats. Cumulative urine samples were taken at 0-24 h, and blood samples were drawn after 24-h administration. The europium concentration was determined in these samples by inductively coupled plasma atomic emission spectroscopy. The volume, creatinine, ß-2-microglobulin, and N-acetyl-ß-D-glucosaminidase were measured in the urine samples to evaluate possible europium-induced renal effects. The blood samples showed low europium distribution, with an average of 77.5 μg/L for all groups. Although the urinary concentration and excretion showed dose-dependent increases, the percentage of europium excreted showed a dose-dependent decrease, with an average of 0.31% in all groups. The administration of europium resulted in a significant decrease of creatinine and a significant increase of urinary volume, N-acetyl-ß-D-glucosaminidase, and ß-2-microglobulin. Rare earth elements, including europium, are believed to form colloidal conjugates that deposit in the reticuloendothelial system and glomeruli. This specific reaction may contribute to low europium bioavailability and renal function disturbances. Despite low bioavailability, the high performance of the analytical method for determination of europium makes the blood and urine sampling suitable tools for monitoring of exposure to this element. The results presented in this study will be of great importance in future studies on the health impacts of rare earth elements.

  3. [Synthesis and luminescence properties of reactive ternary europium complexes]. (United States)

    Guo, Dong-cai; Shu, Wan-gen; Zhang, Wei; Liu, You-nian; Zhou, Yue


    In this paper, five new reactive ternary europium complexes were synthesized with the first ligand of 1,10-phenanthroline and the reactive second ligands of maleic anhydride, acrylonitrile, undecenoic acid, oleic acid and linoleic acid, and also characterized by means of elemental analysis, EDTA titrimetric method, FTIR spectra and UV spectra. The fluorescence spectra show that the five new ternary complexes have much higher luminescence intensity than their corresponding binary complexes, and the synergy ability sequence of the five reactive ligands is as follows: linoleic acid > oleic acid > acrylonitrile > maleic anhydride > undecenoic acid. At the same time, the reactive ternary europium complexes coordinated with the reactive ligands, which can be copolymerized with other monomers, will provide a new way for the synthesis of bonding-type rare earth polymer functional materials with excellent luminescence properties.

  4. Solvent extraction of europium(III) to a fluorine-free ionic liquid phase with a diglycolamic acid extractant


    Rout, Alok; Souza, Ernesto Rezende; Binnemans, Koen


    Europium(III) was extracted by bis(2-ethylhexyl)diglycolamic acid (DEHDGA) dissolved in the non-fluorinated ionic liquid tetraoctylammonium dodecyl sulphate, [N8888][DS]. The extraction behaviour of europium(III) was investigated as a function of various parameters: pH, extractant concentration, concentration of the europium(III) ion in the aqueous feed and concentration of the salting-out agent. A comparison was made with extraction of europium(III) by the acidic extractants bis(2-ethylhexyl...

  5. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)


    Jul 25, 2017 ... Abstract. Europium (Eu3+) doped silver lead borate glasses with the composition of xEu2O3−(1 − x)Ag2. O−29PbO−70B2O3 (x = 0, 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional melt quenching method. Thermal, structural and luminescence properties have been studied ...

  6. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    Europium (Eu 3 + ) doped silver lead borate glasses with the composition of x Eu 2 O 3 −( 1 − x )Ag 2 O−29PbO−70B 2 O 3 ( x = 0 , 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional meltquenching method. Thermal, structural and luminescence properties have been studied using ...

  7. Synthesis and luminescence properties for europium oxide nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mo Zunli, E-mail: [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China) and State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Deng Zhepeng; Guo Ruibin [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China); Fu Qiangang [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Feng Chao; Liu Pengwei; Sun Yu [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China)


    Highlights: Black-Right-Pointing-Pointer A novel high temperature sensitive fluorescent CNTs/Eu{sub 2}O{sub 3} nanocomposite was fabricated. Black-Right-Pointing-Pointer The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 Degree-Sign C for 4 h. Black-Right-Pointing-Pointer The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. Black-Right-Pointing-Pointer We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 Degree-Sign C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the {sup 5}D{sub 0} {yields} {sup 7}F{sub j} (j = 0, 1) forced electric dipole transition of Eu{sup 3+} ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 Degree-Sign C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu{sup 3+} energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.

  8. Optical and magnetization studies on europium based iron pnictides

    Energy Technology Data Exchange (ETDEWEB)

    Zapf, Sina Maria Ute


    The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.

  9. Dicty_cDB: VFL167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFL167 (Link to dictyBase) - - - Contig-U12091-1 VFL167E (Link to Original site) VFL167F...(Link to library) Clone ID VFL167 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U12091-1 Original site URL Representative...Representative seq. ID VFL167E (Link to Original site) Representative DNA sequence >VFL167 (VFL167Q) /CSM/VF/VFL1-C/VFL167Q...AAACAATTATAAAAACAACAAATACAAAAATGATTAAGAATAGAAAATTAGATATTACTT CAACTAATGTTGCTGGTATTGGAACAGATTTAGATAAAA

  10. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength


    Vijayakumar, Balakrishnan; Velmurugan, Devadasan


    Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level.

  11. Enhancement in red emission at room temperature from europium doped ZnO nanowires by 1,10 phenanthroline-europium interface induced resonant excitations

    Directory of Open Access Journals (Sweden)

    Soumen Dhara


    Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.

  12. 46 CFR 167.05-35 - Public nautical school. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school. 167.05-35 Section 167.05-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Definitions § 167.05-35 Public nautical school. The term public nautical school means any school...

  13. 14 CFR 125.167 - Extinguishing agent container compartment temperature. (United States)


    ... temperature. 125.167 Section 125.167 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Requirements § 125.167 Extinguishing agent container compartment temperature. Precautions must be taken to ensure that the extinguishing agent containers are installed in places where reasonable temperatures can...

  14. 46 CFR 167.65-35 - Use of auto pilot. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use of auto pilot. 167.65-35 Section 167.65-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Special Operating Requirements § 167.65-35 Use of auto pilot. Except as provided in 33 CFR 164.15, when...

  15. 10 CFR 52.167 - Issuance of manufacturing license. (United States)


    ... 10 Energy 2 2010-01-01 2010-01-01 false Issuance of manufacturing license. 52.167 Section 52.167... POWER PLANTS Manufacturing Licenses § 52.167 Issuance of manufacturing license. (a) After completing any... manufacturing license if the Commission finds that: (1) Applicable standards and requirements of the Act and the...

  16. 46 CFR 167.65-25 - Steering gear tests. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Steering gear tests. 167.65-25 Section 167.65-25... SHIPS Special Operating Requirements § 167.65-25 Steering gear tests. On all nautical school ships making voyages of more than 48 hours' duration, the entire steering gear, the whistle, the means of...

  17. Dual doped graphene oxide for electrochemical sensing of europium ion (United States)

    Kumar, Sunil; Patra, Santanu; Madhuri, Rashmi; Sharma, Prashant K.


    This present work represents a single step hydrothermal method for the preparation of N, and N, S dual doped graphene oxide (GO). First time, a comparative electrochemical study between single dope and dual doped GO was carried out using potassium ferrocyanide as an electro-active probe molecule and found that the dual doped GO has the highest electrocatalytic activity than single doped, due to the presence of two heteroatoms as a doping material. Afterwards, the dual doped GO was successfully applied for the electrochemical detection of a rare earth element i.e. europium, with LOD value of 5.92 μg L-1.

  18. Crystal growth of nanoscaled europium selenide having characteristic crystal shapes

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Adachi, Taka-aki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Hasegawa, Yasuchika, E-mail: hasegawa@ms.naist.j [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Kawai, Tsuyoshi [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan)


    Tetrapod-shaped EuSe nanocrystals were prepared through the thermal reduction of europium chloride an organic selenide complex, n-hexadecylamine, and two additives oleic acid and oleylamine. The obtained EuSe nanoparticles were characterized by X-ray diffraction (XRD). The crystal grain size from the XRD spectrum was estimated to be 50 nm. In contrast, observation of the transmission electron microscope (TEM) gave larger sized EuSe (average size: 200 nm). Anisotropic crystal-growth of EuSe nanocrystals was achieved by addition of a small amount of oleic acid in the crystal growth process.

  19. Photoprotective properties of the fluorescent europium complex in UV-irradiated skin. (United States)

    Vogt, O; Lademann, J; Rancan, F; Meinke, M C; Schanzer, S; Stockfleth, E; Sterry, W; Lange-Asschenfeldt, B


    In this study, we compared the UV-protective abilities of the europium complex compared to titanium dioxide, which represents the most common physical filter for ultraviolet light in the broad-band spectral range. The UV absorption and light transformative capacities of the europium complex were evaluated using a spectrometer with a double-integrating sphere showing that the europium complex does not only absorb and reflect UV light, but transforms it into red and infrared light. It was found that the europium complex binds to the surface of Jurkat cells in vitro. Cells incubated with the europium complex showed a significantly higher viability after UVA and UVB irradiation as compared to untreated cells and cells incubated with titanium dioxide pointing out its photoprotective properties. The europium complex and titanium dioxide show similar penetration capacities into the stratum corneum as tested in human and porcine skin using tape stripping analysis. The europium complex has proved to be an efficient UV filter with a low cyto- and phototoxic profile and therefore represents a potential candidate for use in sunscreen formulations. Copyright © 2013 S. Karger AG, Basel.

  20. Neutroneneinfangsgammaspektrum und Niveauschema von Erbium167

    DEFF Research Database (Denmark)

    Koch, H.


    The (n, gamma)-spectrum of Er 167 was investigated by means of the Risø bent crystal spectrometer. The energies and intensities of 47 transitions were measured. 22 of them were fitted into a level scheme. The rotational bands of theK=7/2+[633],K=1/2–[521], andK=5/2–[512] states were found up to t...... to the spin valuesI=11/2+, 9/2–, and 7/2–. Gammavibrational states of these Nilsson orbitals were determined or proposed. The energy of theK=5/2–[523] state was suggested. Branching ratios of gamma transitions were compared with theoretical predictions....

  1. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.


    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  2. In Vivo Toxicity Studies of Europium Hydroxide Nanorods in Mice (United States)

    Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H; Mukhopadhyay, Debabrata


    Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence properties and pro-angiogenic to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [EuIII(OH)3] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mgKg−1day−1) and time dependent manner (8–60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice sacrificed on day 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods. PMID:19616569

  3. Temperature dependences in electron-stimulated desorption of neutral europium

    CERN Document Server

    Ageev, V N; Madey, T E


    The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...

  4. The Oxidation State of Europium in Halide Glasses (United States)

    Weber, J.K.R.; Vu, M.; Paßlick, C.; Schweizer, S.; Brown, D.E.; Johnson, C.E.; Johnson, J.A.


    The luminescent properties of divalent europium ions can be exploited to produce storage phosphors for x-ray imaging applications. The relatively high cost and limited availability of divalent europium halides makes it desirable to synthesize them from the readily available trivalent salts. In this work, samples of pure EuCl3 and fluoride glass melts doped with EuCl3 were processed at 700-800 °C in an inert atmosphere furnace. The Eu oxidation state in the resulting materials was determined using fluorescence and Mössbauer spectroscopy. Heat treatment of pure EuCl3 for 10 minutes at 710 °C resulted in a material comprising approximately equal amounts of Eu2+ and Eu3+. Glasses made using mixtures of EuCl2 and EuCl3 in the starting material contained both oxidation states. This paper describes the sample preparation and analysis and discusses the results in the context of chemical equilibria in the melts. PMID:22101252

  5. Innovative triboluminescence study of multivitamin doped europium tetrakis

    Energy Technology Data Exchange (ETDEWEB)

    Fontenot, R.S. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, K.N.; Aggarwal, M.D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); Hollerman, W.A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States)


    As the Space Shuttle program ends, NASA is developing the next generation of space vehicles. These new concept designs will require new and innovative structural health monitoring capabilities. One way to solve this problem is with smart impact sensors that use triboluminescent materials. In 2011, the authors reported an 82% increase in the triboluminescence yield of europium dibenzoylmethide triethylammonium (EuD{sub 4}TEA) by changing the starting material. It has been shown that introduction of dopants tends to enhance the triboluminescent light yield. Here we report the successful synthesis of a multivitamin doped europium tetrakis which appears to be spherical in shape. Inductively Coupled Plasma - Optical Emission Spectroscopy analysis showed the presence of 3.6% calcium, 0.62% magnesium, 0.1% iron, 0.01% copper and manganese. This new product has no shift in the triboluminescent or photoluminescent emission peaks, but only a change in the intensity. In addition, the doped EuD{sub 4}TEA powder statistically emits more triboluminescence while having the same decay time. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  6. Photoactive thin films of polycaprolactam doped with europium (III) complex using phenylalanine as ligand

    Energy Technology Data Exchange (ETDEWEB)

    Santos Garcia, Irene Teresinha, E-mail: [Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil); Velleda Ribeiro, Patricia; Silva Correa, Diogo; Neto da Cunha, Igor Michel; Lenin Villarreal Carreno, Neftali [Instituto de Quimica e Geociencias, Universidade Federal de Pelotas, Campus Capao do Leao, s/n. CEP 96010-900, Pelotas, RS (Brazil); Ceretta Moreira, Eduardo [PPGEE, Universidade Federal do Pampa, Campus Bage, Bage- RS (Brazil); Severo Rodembusch, Fabiano [Departamento de Quimica Organica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil)


    A photoactive complex based on europium(III) using the amino acid phenylalanine as ligand was prepared and characterized. The obtained europium(III)/phenylalanine complex presents an effective energy transfer from ligands to the rare earth center. The observed photoluminescent behavior for europium(III)/phenylalanine complex was similar to the well known europium(III)/ acetyl-{beta}-acetonate hydrate. New photoactive polyamide thin films were prepared using polycaprolactam as host of these complexes. The structural characterizations of the films were studied through Rutherford backscattering (RBS), Fourier transform infrared (FTIR) and Raman spectroscopies. The polyamide films doped with the amino acid and acetyl-{beta}-acetonate rare earth complexes maintain the original photoluminescent behavior, narrow emission bands corresponding to transitions {sup 5}D{sub 0} {yields} {sup 7}F{sub 0-4}, which indicates that this polymer is an excellent host to these complexes.

  7. Synthesis and luminescence properties of salicylaldehyde isonicotinoyl hydrazone derivatives and their europium complexes. (United States)

    Shan, Wenfei; Liu, Fen; Liu, Jiang; Chen, Yanwen; Yang, Zehui; Guo, Dongcai


    Four novel salicylaldehyde isonicotinoyl hydrazone derivatives and their corresponding europium ion complexes were synthesized and characterized, while the luminescence properties and the fluorescence quantum yields of the target complexes were investigated. The results indicated that the ligands favored energy transfers to the emitting energy level of europium ion, and four target europium complexes showed the characteristic luminescence of central europium ion. Besides the luminescence intensity of the complex with methoxy group, which possessed the highest fluorescence quantum yield (0.522), was stronger than that of other complexes. Furthermore, the electrochemical properties of the target complexes were further investigated by cyclic voltammetry, the results indicated that the highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO) energy levels and the oxidation potential of the complexes with electron donating group increased, however, that of the complexes with accepting electron group decreased. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. [Synthesis and luminescence properties of ternary complexes of europium with aromatic carboxylic acid and acrylonitrile]. (United States)

    Guo, Dong-cai; Yi, Li-ming; Shu, Wan-gen; Zhang, Zhen-zhen; Zeng, Zhao-rong; Zhang, Xi-qian


    Five ternary complexes were synthesized from europium with aromatic carboxylic acid (p-methylbenzoic acid, methoxybenzoic acid, m-chlorobenzoic acid and benzoic acid, p-hydroxylbenzoic acid) and acrylonitrile, and characterized by means of elemental analysis, thermal analysis, FTIR spectra and UV spectra. The fluorescence spectra show that five ternary complexes have good luminescence properties, and the sequence of the ability of the aromatic carboxylic acids to transfer light energy to europium ion is as follows: p-methylbenzoic acid>benzoic acid>m-chlorobenzoic acid>p-hydroxylbenzoic acid>methoxybenzoic acid. Meanwhile, the ternary europium complexes containing a reactive ligand acrylonitrile will possibly have a potential application to the fabrication of bonding-type europium polymer luminescent materials.

  9. Optical characterization of europium-doped indium hydroxide nanocubes obtained by Microwave-Assisted Hydrothermal method


    Motta, Fabiana Villela da; Marques,Ana Paula de Azevedo; Araújo,Vinícius Dantas de; Tavares, Mara Tatiane De Souza; Delmonte,Mauricio Roberto Bomio; Paskocimas, Carlos Alberto; Li, Máximo Siu; Nascimento, Rubens Maribondo do; Longo, Elson [UNESP


    Crystalline europium-doped indium hydroxide (In(OH)3:Eu) nanostructures were prepared by rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of europium-doped indium hydroxide (IH:xEu) samples under excitation (350.7 nm) present...

  10. Structural and optical properties of europium doped zirconia single crystals fibers grown by laser floating zone


    Soares, M.R.N.; Nico, C.; Peres, M.; Ferreira, N.; Fernandes, A.J.S.; Monteiro, T.; COSTA, F.M.


    Yttria stabilized zirconia single crystal fibers doped with europium ions were developed envisaging optical applications. The laser floating zone technique was used in order to grow millimetric high quality single crystal fibers. The as-grown fibers are completely transparent and inclusion free, exhibiting a cubic structure. Under ultraviolet (UV) excitation, a broad emission band appears at 551 nm. The europium doped fibers are translucent with a tetragonal structure and exhibit an intense r...

  11. A non-aqueous reduction process for purifying ¹⁵³Gd produced in natural europium targets. (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R


    Gadolinium-153 is a low-energy gamma-emitter used in nuclear medicine imaging quality assurance. Produced in nuclear reactors using natural Eu₂O₃ targets, ¹⁵³Gd is radiochemically separated from europium isotopes by europium reduction. However, conventional aqueous europium reduction produces hydrogen gas, a flammability hazard in radiological hot cells. We altered the traditional reduction method, using methanol as the process solvent to nearly eliminate hydrogen gas production. This new, non-aqueous reduction process demonstrates greater than 98% europium removal and gadolinium yields of 90%. © 2013 Elsevier Ltd. All rights reserved.

  12. Intercalated europium metal in epitaxial graphene on SiC (United States)

    Anderson, Nathaniel A.; Hupalo, Myron; Keavney, David; Tringides, Michael C.; Vaknin, David


    X-ray magnetic circular dichroism (XMCD) reveals the magnetic properties of intercalated europium metal under graphene on SiC(0001). The intercalation of Eu nanoclusters (average size 2.5 nm) between graphene and SiC substate are formed by deposition of Eu on epitaxially grown graphene that is subsequently annealed at various temperatures while keeping the integrity of the graphene layer. Using sum-rules analysis of the XMCD of Eu M4 ,5 edges at T =15 K, our samples show paramagnetic-like behavior with distinct anomaly at T ≈90 K, which may be related to the Nèel transition, TN=91 K, of bulk metal Eu. We find no evidence of ferromagnetism due to EuO or antiferromagnetism due to Eu2O3 , indicating that the graphene layer protects the intercalated metallic Eu against oxidation over months of exposure to atmospheric environment.

  13. 29 CFR 1952.167 - Changes to approved plans. (United States)


    ... 29 Labor 9 2010-07-01 2010-07-01 false Changes to approved plans. 1952.167 Section 1952.167 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR.... (a) Legislation. (1) On March 29, 1994, the Assistant Secretary approved Iowa's revised statutory...

  14. 26 CFR 1.167(a)-2 - Tangible property. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Tangible property. 1.167(a)-2 Section 1.167(a)-2... property. The depreciation allowance in the case of tangible property applies only to that part of the property which is subject to wear and tear, to decay or decline from natural causes, to exhaustion, and to...

  15. 26 CFR 1.167(a)-4 - Leased property. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Leased property. 1.167(a)-4 Section 1.167(a)-4... property. Capital expenditures made by a lessee for the erection of buildings or the construction of other permanent improvements on leased property are recoverable through allowances for depreciation or...

  16. Dicty_cDB: VSD167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSD167 (VSD167Q) /...25 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value N CB890904 |CB890904...Homology vs Protein Score E Sequences producing significant alignments: (bits) Value (Q54ST0) RecName: Full=NHP2-like

  17. 21 CFR 133.167 - Pasteurized blended cheese. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized blended cheese. 133.167 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.167 Pasteurized blended cheese. Pasteurized blended cheese conforms to...

  18. 46 CFR 167.40-1 - Electrical installations. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Electrical installations. 167.40-1 Section 167.40-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL... danger of fire, giving particular attention to wiring which is carried through wooden bulkheads...

  19. 40 CFR 98.167 - Records that must be retained. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.167... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Hydrogen Production § 98.167 Records that must be retained. In addition to the information required by § 98.3(g), you must retain the records specified in paragraphs (a...

  20. 26 CFR 1.167(a)-1 - Depreciation in general. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation in general. 1.167(a)-1 Section 1... Depreciation in general. (a) Reasonable allowance. Section 167(a) provides that a reasonable allowance for the... the taxpayer for the production of income shall be allowed as a depreciation deduction. The allowance...

  1. 26 CFR 1.167(g)-1 - Basis for depreciation. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167... for depreciation. The basis upon which the allowance for depreciation is to be computed with respect... property at that time, is the basis for computing depreciation. ...

  2. 49 CFR 572.167 - Test conditions and instrumentation. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Test conditions and instrumentation. 572.167... Hybrid III Six-Year-Old Weighted Child Test Dummy § 572.167 Test conditions and instrumentation. The test conditions and instrumentation are as specified in 49 CFR 572.127 (Subpart N). Pt. 572, Subpt. S, Figs...

  3. 40 CFR 721.9511 - Silicic acid (H6SiO2O7), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (United States)


    ..., strontium salt(1:1:2), dysprosium and europium-doped. 721.9511 Section 721.9511 Protection of Environment...), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (a) Chemical substance and significant new..., strontium salt(1:1:2), dysprosium and europium-doped. (PMN P-98-848; CAS No.181828-07-9) is subject to...

  4. Fluorescent lifetime imaging microscopy using Europium complexes improves atherosclerotic plaques discrimination. (United States)

    Sicchieri, Letícia Bonfante; de Andrade Natal, Rodrigo; Courrol, Lilia Coronato


    The objective of this study is to characterize arterial tissue with and without atherosclerosis by fluorescence lifetime imaging microscopy (FLIM) using Europium Chlortetracycline complex (EuCTc) as fluorescent marker. For this study, twelve rabbits were randomly divided into a control group (CG) and an experimental group (EG), where they were fed a normal and hypercholesterolemic diet, respectively, and were treated for 60 days. Cryosections of the aortic arch specimens were cut in a vertical plane, mounted on glass slides, and stained with Europium (Eu), Chlortetracycline (CTc), Europium Chlortetracycline (EuCTc), and Europium Chlortetracycline Magnesium (EuCTcMg) solutions. FLIM images were obtained with excitation at 405 nm. The average autofluorescence lifetime within plaque depositions was ~1.36 ns. Reduced plaque autofluorescence lifetimes of 0.23 and 0.31 ns were observed on incubation with EuCTc and EuCTcMg respectively. It was observed a quenching of collagen, cholesterol and TG emission spectra increasing EuCTc concentration. The drastic reduction in fluorescence lifetimes is due to a resonant energy transfer between collagen, triglycerides, cholesterol and europium complexes, quenching fluorescence.

  5. Visible-light sensitized luminescent europium(III)-β-diketonate complexes: bioprobes for cellular imaging. (United States)

    Reddy, M L P; Divya, V; Pavithran, Rani


    Visible-light sensitized luminescent europium(III) molecular materials are of considerable importance because their outstanding photophysical properties make them well suited as labels in fluorescence-based bioassays and low-voltage driven pure red-emitters in optoelectronic technology. One challenge in this field is development of visible-light sensitizing ligands that can form highly emissive europium(III) complexes with sufficient stability and aqueous solubility for practical applications. Indeed, some of the recent reports have demonstrated that the excitation-window can be shifted to longer-wavelengths in europium(III)-β-diketonate complexes by appropriate molecular engineering and suitably expanded π-conjugation in the complex molecules. In this review, attention is focused on the latest innovations in the syntheses and photophysical properties of visible-light sensitized europium(III)-β-diketonate complexes and their application as bioprobes for cellular imaging. Furthermore, luminescent nanomaterials derived from long-wavelength sensitized europium(III)-β-diketonate complexes and their application in life sciences are also highlighted.

  6. The electronic properties of mixed valence hydrated europium chloride thin film. (United States)

    Silly, M G; Charra, F; Lux, F; Lemercier, G; Sirotti, F


    We investigate the electronic properties of a model mixed-valence hydrated chloride europium salt by means of high resolution photoemission spectroscopy (HRPES) and resonant photoemission spectroscopy (RESPES) at the Eu 3d → 4f and 4d → 4f transitions. From the HRPES spectra, we have determined that the two europium oxidation states are homogeneously distributed in the bulk and that the hydrated salt film is exempt from surface mixed valence transition. From the RESPES spectra, the well separated resonant contributions characteristic of divalent and trivalent europium species (4f(6) and 4f(7) final states, respectively) are accurately extracted and quantitatively determined from the resonant features measured at the two edges. The partial absorption yield spectra, obtained by integrating the photoemission intensity in the valence-band region, can be well reproduced by atomic multiplet calculation at the M(4,5) (3d-4f) absorption edge and by an asymmetric Fano-like shape profile at the N(4,5) (4d-4f) absorption edge. The ratio of Eu(2+) and Eu(3+) species measured at the two absorption edges matches with the composition of the mixed valence europium salt as determined chemically. We have demonstrated that the observed spectroscopic features of the mixed valence salt are attributed to the mixed-valence ground state rather than surface valence transition. HRPES and RESPES spectra provide reference spectra for the study of europium salts and their derivatives.

  7. Europium-doped calcium titanate: Optical and structural evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)


    Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.

  8. RBS and RNRA studies on sorption of europium by apatite

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi


    The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)

  9. Spectrofluorimetric determination of heparin using doxycycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Li Jing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Liu Jinkai [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Zhu Xiaojing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Peng Qian [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan 250014 (China)]. E-mail:


    A new spectrofluorimetric method was developed for the determination of the trace amount of heparin (Hep). Using doxycycline (DC)-europium ion (Eu{sup 3+}) as a fluorescent probe, in the buffer solution of pH=8.9, Hep can remarkably enhance the fluorescence intensity of the DC-Eu{sup 3+} complex at {lambda}=612 nm and the enhanced fluorescence intensity of Eu{sup 3+} ion is in proportion to the concentration of Hep. Optimum conditions for the determination of Hep were also investigated. The linear range and detection limit for the determination of Hep are 0.04-0.8 {mu}g/mL and 19.7 ng/mL, respectively. This method is simple, practical, and relatively free of interference from coexisting substances and can be successfully applied to assess Hep in biological samples. By the Rosenthal graphic method, the association constant and binding numbers of Hep with the probe are 6.60x10{sup 4} L/mol and 33.9. Moreover, the enhancement mechanism of the fluorescence intensity in the DC-Eu{sup 3+} system and the DC-Eu{sup 3+}-Hep-CTMAB system have been also discussed.

  10. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    Energy Technology Data Exchange (ETDEWEB)

    Babain, V.A.; Alyapyshev, M.Yu.; Karavan, M.D. [V.G. Khlopin Radium Inst., St. Petersburg (Russian Federation); Boehmer, V.; Wang, L. [Johannes Guttenberg Univ., Mainz (Germany); Shokova, E.A.; Motornaya, A.E.; Vatsouro, I.M.; Kovalev, V.V. [M. V. Lomonosov Moscow State Univ., Moscow (Russian Federation)


    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH{sub 2}){sub n}-NH-C(O)-CH{sub 2-}P(O)Ph{sub 2}] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO{sub 3} solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient D{sub Am}/D{sub Eu} for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (D{sub Am}/D{sub Eu}). (orig.)

  11. Preparation of europium-labelled DNA probes and their properties. (United States)

    Hurskainen, P; Dahlén, P; Ylikoski, J; Kwiatkowski, M; Siitari, H; Lövgren, T


    A chemical method for labelling DNA with a europium chelate is presented. First, primary aliphatic amino groups are introduced onto DNA in a transamination reaction. The transamination reaction is altered by adjusting temperature and duration of the reaction. Subsequently, the modified DNA is reacted with an isothiocyanate derivative of a Eu chelate. The optimum amount of Eu chelates on a DNA probe is 4-8% of total nucleotides. There is a decrease of 0.7 degrees C in the melting temperature of DNA for each incorporated Eu chelate on 100 bases. Hybridization efficiency is lowered by the introduction of Eu chelates but this effect can be partly overcome by using high DNA probe concentrations. The detection limit of the Eu-labelled probe is 0.15 attomoles of target DNA in a mixed-phase hybridization assay on microtitration wells. In addition to high sensitivity the Eu-labelled probes offer convenience in use and results which are quantitative and easy to interpret. PMID:1826948

  12. Chloride, bromide and iodide scintillators with europium doping (United States)

    Zhuravleva, Mariya; Yang, Kan


    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  13. Spectrofluorimetric determination of lecithin using a tetracycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ting [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China)]. E-mail:


    Trace amount of lecithin (PC) was determined in the buffer solution of pH 5.7, using tetracycline (TC)-europium ion (Eu{sup 3+}) as a fluorescent probe. PC can remarkably enhance the fluorescence intensity of the TC-Eu{sup 3+} complex at {lambda} = 612 nm and the enhanced fluorescence intensity of Eu{sup 3+} is in proportion to the concentration of PC. Optimum conditions for the determination of PC were also investigated. The linear range and detection limit for the determination of PC are 4.0 x 10{sup -7} to 1.4 x 10{sup -5} mol/L and 3.9 x 10{sup -8} mol/L. This method is simple, practical and relatively free of interference from coexisting substances and can be successfully applied to assess PC in serum samples. Moreover, the enhancement mechanism of the fluorescence intensity in the TC-Eu{sup 3+} system, the TC-Eu{sup 3+}-PC system, and the TC-Eu{sup 3+}-PC-sodium dodecyl benzene sulfonate (SDS) system is also discussed.

  14. Artifacts in the determination of the binding of americium and europium to an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Lead, J.R.; Hamilton-Taylor, J.; Kelly, M. [Institute of Environmental and Biological Sciences, Lancaster University, Lancaster (United Kingdom)


    The binding of europium and americium by an aquatic fulvic acid was investigated using an equilibrium ion exchange technique (Schubert`s method). The results for europium were consistent with literature data. Americium gave anomalous results for both the D{sub o} values (partition coefficient of the metal between the resin and solution phases in the absence of the fulvic acid) and D values (partition coefficient of the metal between the resin and solution phases in the presence of the fulvic acid). The values for americium were unexpectedly low and, in the case of D values, only slightly pH dependent. The cause of the discrepancy was found to be the partial dissolution of the resin or the loss of small colloidal material from the resin. The effects on the europium results were minimal due to the use of lower resin weights and higher metal concentrations

  15. Synthesis and luminescence properties of 2-(benzylcarbamoyl)phenyl derivatives and their europium complexes. (United States)

    Guo, Dongcai; He, Wei; Liu, Bang; Gou, Lining; Li, Ruixia


    Six novel 2-(benzylcarbamoyl)phenyl derivatives were synthesized and characterized by (1) H-NMR, mass spectrometry, infrared spectra and elemental analysis. Their europium complexes were prepared and characterized by elemental analysis, EDTA titrimetric analysis, IR and UV spectra as well as molar conductivity measurements. The luminescence properties of these complexes were investigated and results show that 2-(benzylcarbamoyl)phenyl derivatives possess high selectivity and good coordination with the europium ion. Complex Eu-2-(benzylcarbamoyl)phenyl-2-phenylacetate showed green luminescence that was emitted by the ligand of 2-(benzylcarbamoyl)phenyl-2-phenylacetate, while other complexes showed the characteristic red luminescence of europium ion and also possessed high luminescence intensity. Copyright © 2012 John Wiley & Sons, Ltd.

  16. Induction of Circularly Polarized Luminescence from Europium by Amino Acid Based Ionic Liquids. (United States)

    Zercher, Ben; Hopkins, Todd A


    Materials that emit circularly polarized light have application in several important industries. Because they show large optical activity and emit sharp visible light transitions, europium complexes are often exploited in applications that require circularly polarized luminescence (CPL). Chiral and coordinating ionic liquids based on prolinate, valinate, and aspartate anions are used to induce CPL from a simple achiral europium triflate salt. The sign of the induced CPL is dependent on the handedness (l vs d) of the amino acid anion. Comparison of the CPL spectra in ionic liquid with proline and valine vs aspartate shows that the number of carboxylate groups in the amino acid anion influences the europium coordination environment. DFT calculations predict a chiral eight-coordinate Eu(Pro)4- structure in the prolinate ionic liquid and a chiral seven- or eight-coordinate Eu(Asp)33- structure in the aspartate ionic liquid.

  17. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dongwook, E-mail: [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)


    A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.

  19. Europium stearate additives delay oxidation of UHMWPE for orthopaedic applications: a pilot study. (United States)

    Gallardo, Luis A; Carpentieri, Ilenia; Laurent, Michel P; Costa, Luigi; Wimmer, Markus A


    Ultrahigh-molecular-weight polyethylene (UHMWPE) is used as an articulating surface in prosthetic devices. Its failure under various mechanisms after oxidation is of utmost concern. Free radicals formed during the sterilization process using high-energy irradiation result in oxidation. Europium, an element of the lanthanide family, has a unique electron configuration with an unusual lack of preference for directional bonding and notable bonding to oxygen. Because of this, it currently is used in studies for stabilization of polymers such as polyvinyl chloride. We asked whether europium stearate could enhance the oxidation resistance after irradiation in nitrogen of UHMWPE. Conventional nonirradiated and gamma-irradiated in nitrogen UHMWPE were compared with polyethylene doped with 375 ppm and 3750 ppm europium(III) stearate under the same treatment conditions. Chemical characterization was performed by Fourier transform infrared (FTIR) microspectroscopy using 200-μm thin films. The oxidation of doped samples with time was compared with that of conventional samples using accelerated oven aging. The types of oxidation products were identified by FTIR and quantified per material and treatment condition as indications of the oxidation level and mechanism. The generation rate of hydroperoxides and ketones was decelerated proportionally with concentration of europium stearates. The oxidative mechanism appeared similar to that of conventional polyethylene with the same types of measurable end products as ketones and hydroperoxides. Yet, the rate of generation of the latter appeared to be slowed down by the action of europium stearate. Europium stearate mixed in UHMWPE decelerated the oxidation reactions triggered by gamma irradiation in nitrogen, seemingly without major alteration of the oxidation mechanism.

  20. Temperature dependent luminescence of a europium complex incorporated in poly(methyl methacrylate). (United States)

    Liang, Hao; Xie, Fang; Ren, Xiaojun; Chen, Yifa; Chen, Biao; Guo, Fuquan


    An europium β-diketonate complex with a dipyrazolyltriazine derivative ligand, Eu(TTA)3DPBT, has been incorporated into poly(methyl methacryate) (PMMA). The influence of temperature on its luminescence properties has been investigated. The fluorescence emission spectra and luminescence lifetimes showed temperature sensitivity. The analysis of the relative intensity ratio (R) of (5)D0 → (7)F2 to (5)D0 → (7)F1 transition and Judd-Ofelt experimental intensity parameters Ω2 indicated that the local structure and asymmetry in the vicinity of europium ions show no obvious change when the temperature is increased. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Study of the europium behavior in aqueous media; Estudio sobre el comportamiento del europio en medios acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)


    Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.

  2. Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions

    Energy Technology Data Exchange (ETDEWEB)

    Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)


    Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)

  3. A novel biocompatible europium ligand for sensitive time-gated immunodetection. (United States)

    Sayyadi, Nima; Connally, Russell E; Try, Andrew


    We describe the synthesis of a novel hydrophilic derivative of a tetradentate β-diketone europium ligand that was used to prepare an immunoconjugate probe against Giardia lamblia cysts. We used a Gated Autosynchronous Luminescence Detector (GALD) to obtain high quality delayed luminescence images of cells 30-fold faster than ever previously reported.

  4. Europium-doped barium halide scintillators for x-ray and ?-ray detections

    NARCIS (Netherlands)

    Selling, J.; Birowosuto, M.D.; Dorenbos, P.; Schweizer, S.


    Single crystals of undoped or europium-doped barium chloride, bromide, and iodide were investigated under x-ray and ?-ray excitations. The Eu2+-related x-ray excited luminescence found in the Eu-doped barium halides occurs at 402, 404, and 425?nm for the chloride, bromide, and iodide, respectively.

  5. A europium luminescence assay of lactate and citrate in biological fluids† (United States)

    Pal, Robert; Costello, Leslie C.


    Ratiometric methods of analysis have been developed for the selective determination of lactate or citrate in microlitre samples of human serum, urine or prostate fluids following comparison of anion binding affinities for a family of nine luminescent europium(III) complexes. PMID:19343236

  6. Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)

    Energy Technology Data Exchange (ETDEWEB)

    Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)


    With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.

  7. Europium doped In(Zn)P/ZnS colloidal quantum dots

    NARCIS (Netherlands)

    Thuy, Ung Thi Dieu; Maurice, Axel; Liem, Nguyen Quang; Reiss, Peter


    Chemically synthesised In(Zn)P alloy nanocrystals are doped with Eu(3+) ions using europium oleate as a molecular precursor and are subsequently covered with a ZnS shell. The presence of zinc in the synthesis of the InP core nanocrystals leads to the formation of an In(Zn)P alloy structure, making

  8. NO fluorescence sensing by europium tetracyclines complexes in the presence of H2O2. (United States)

    Simões, Eliana F C; Leitão, João M M; Esteves da Silva, Joaquim C G


    The effect on the fluorescence of the europium:tetracycline (Eu:Tc), europium:oxytetracycline (Eu:OxyTc) and europium:chlortetracycline (Eu:ClTc) complexes in approximately 2:1 ratio of nitric oxide (NO), peroxynitrite (ONOO(-)), hydrogen peroxide (H2O2) and superoxide (O2 (·-)) was assessed at three ROS/RNS concentrations levels, 30 °C and pH 6.00, 7.00 and 8.00. Except for the NO, an enhancement of fluorescence intensity was observed at pH 7.00 for all the europium tetracyclines complexes-the high enhancement was observed for H2O2. The quenching of the fluorescence of the Tc complexes, without and with the presence of other ROS/RNS species, provoked by NO constituted the bases for an analytical strategy for NO detection. The quantification capability was evaluated in a NO donor and in a standard solution. Good quantification results were obtained with the Eu:Tc (3:1) and Eu:OxyTc (4:1) complexes in the presence of H2O2 200 μM with a detection limit of about 3 μM (Eu:OxyTc).

  9. Long-term tagging of elvers, Anguilla anguilla, with radioactive europium

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Fattah, A. T. A.


    -life of added europium of 1.6 .+-. 0.5 years. Thirteen hundred 155Eu-labelled elvers (50 Bq per eel), each weighing on average 0.21 g, were set out near Oskarshamn on the east coast of Sweden in June 1982. Three of these were caught nearby in May 1985 and one was caught in August 1985. They weighed...


    NARCIS (Netherlands)

    Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.


    High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.

  11. Optical and Morphological Characterization of Sonochemically Assisted Europium Doped Copper (I) Oxide Nanostructures (United States)

    Cosico, J. A. M.; Ruales, P. K.; Marquez, M. C.


    In the age where application of nanotechnology in our society has proven to be eminent, different routes of synthesizing nanoparticles have emerged. In this study nanoparticles of cuprous oxide (Cu2O) doped with different amounts of europium was prepared by using solution precursor route approach with the aid of ultrasonic sound. Copper sulphate and europium (III) nitrate pentahydrate was used as source for copper ions and europium ions respectively. X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR) were used to elucidate the cubic crystal structure and organic impurities present on Cu2Onanoparticles. UV-Vis spectroscopy was used to determine the absorption spectrum of the nanoparticles in the wavelength range of 400nm to 700nm. The bandgap of the undoped and doped Cu2O were found to fall between 2.1eV - 2.3eV. Scanning Electron Microscopy (SEM) coupled with energy dispersive x-ray was used to observe the dendritic and rodlike morphology and the presence of europium in the synthesized Cu2O nanoparticles. The observed effect on the absorbance of Cu2O upon adding Eu and a facile way of synthesizing Cu2O nanoparticles could bring a positive impact on the production of functional devices for optoelectronic and energy applications.

  12. High yield production of the medical radioisotope {sup 167}Tm by the {sup 167}Er(d,2n) reaction

    Energy Technology Data Exchange (ETDEWEB)

    Hermanne, A., E-mail: [Vrije Universiteit Brussel (VUB), Brussels (Belgium); Adam Rebeles, R. [Vrije Universiteit Brussel (VUB), Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), Debrecen (Hungary); Spahn, I. [Institut fuer Nuklearchemie, Forschungszentrum Juelich (Germany); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk (Russian Federation)


    As part of our systematic comparison of (p,n) and (d,2n) reactions, the excitation functions of the {sup 167}Er(d,2n){sup 167}Tm production reaction and reactions leading to Tm radio-impurities were investigated up to 20 MeV. A stacked foil irradiation technique and {gamma}-ray spectroscopy is used. The measured excitation functions are compared with results of ALICE-D, EMPIRE-D and TALYS reaction model codes and with data from our earlier investigations on natural Er. Thick target yields and contamination levels are discussed. A comparison with other charged particle production routes for {sup 167}Tm shows that deuteron induced reactions are not competitive.

  13. Phenotype abnormality: 167 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 167 decreased efficiency... in organ named whole plant during process named cell growth ... whole plant ... decreased efficiency ... cell growth ...

  14. 26 CFR 1.167(b)-2 - Declining balance method. (United States)


    ... straight line rate (without adjustment for salvage) is 5 percent, and the declining balance rate at twice... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Declining balance method. 1.167(b)-2 Section 1... Declining balance method. (a) Application of method. Under the declining balance method a uniform rate is...

  15. Occurrence of photoluminescence and onion like structures decorating graphene oxide with europium using sodium dodecyl sulfate surfactant (United States)

    Cedeño, V. J.; Rangel, R.; Cervantes, J. L.; Lara, J.; Alvarado, J. J.; Galván, D. H.


    Graphene oxide decoration with europium was carried out using SDS (sodium dodecyl sulfate) as the surfactant. The reaction was performed in a microwave oven and subsequently underwent thermal treatment under hydrogen flow. The results found in the present work demonstrate that through the use of SDS surfactant aggregates of hemi-cylindrical and onion-like structures could be obtained; which propitiate an enhanced synergistic photoluminescence located at the red wavelength. On the other hand, after thermal treatment the aggregates disappear providing a good dispersion of europium, however a decrease in the photoluminescence signal is observed. The graphene oxide decorated with europium was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier infrared transform spectroscopy (FTIR), RAMAN spectroscopy, x-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) techniques, showing the characteristic features of graphene oxide and europium.

  16. Synthesis, characterization, and properties of reduced europium molybdates and tungstates

    Energy Technology Data Exchange (ETDEWEB)

    Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)


    Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.

  17. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate. (United States)

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun


    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  18. The effect of two additional Eu3+ lumophors in two novel trinuclear europium complexes on their photoluminescent properties. (United States)

    Yang, Chaolong; Xu, Jing; Ma, Jianying; Zhu, Dongyu; Zhang, Yunfei; Liang, Liyan; Lu, Mangeng


    Two novel trinuclear europium complexes based on trisphen(1,3,5-tris{4-((1,10-phenanthroline-[5,6-d]imidazol-2yl)phenoxy)methyl}-2,4,6-trimethyl-benzene) as a second ligand were designed, synthesized, and characterized by FT-IR, (1)H NMR, UV-visible, photoluminescence (PL) spectroscopy, elemental analysis (EA) and ESI-MS. The geometries of these two trinuclear europium complexes were predicted using the Sparkle/PM3 model and suggested a chemical environment of very low symmetry around the lanthanide ions (C(1)), which is in agreement with the luminescent spectra. CV analysis demonstrated that the trinuclear complexes possessed excellent electro-injection abilities. The effects of two additional Eu(3+) lumophors in these trinuclear europium complexes on their photoluminescent properties were investigated in detail. The results indicated that these trinuclear europium complexes exhibited highly luminescent quantum efficiencies and experimental intensity parameters in the solid state. Especially, due to the contribution of the two additional Eu(3+) lumophors in the trinuclear europium complexes, the quantum efficiency of the trinuclear complex Eu(3)(TTA)(9)trisphen was higher (ca. 34%) than the mononuclear europium complex Eu(TTA)(3)imidazophen.

  19. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro


    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  20. Incorporation of europium III complex into nanoparticles and films obtained by the Sol-Gel methodology

    Directory of Open Access Journals (Sweden)

    Faley Jean de Sousa


    Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.

  1. A Simple and Sensitive Method to Quantify Biodegradable Nanoparticle Biodistribution using Europium Chelates. (United States)

    Crawford, Lindsey; Higgins, Jaclyn; Putnam, David


    The biodistribution of biodegradable nanoparticles can be difficult to quantify. We report a method using time resolved fluorescence (TRF) from a lanthanide chelate to minimize background autofluorescence and maximize the signal to noise ratio to detect biodegradable nanoparticle distribution in mice. Specifically, antenna chelates containing europium were entrapped within nanoparticles composed of polylactic acid-polyethylene glycol diblock copolymers. Tissue accumulation of nanoparticles following intravenous injection was quantified in mice. The TRF of the nanoparticles was found to diminish as a second order function in the presence of serum and tissue compositions interfered with the europium signal. Both phenomena were corrected by linearization of the signal function and calculation of tissue-specific interference, respectively. Overall, the method is simple and robust with a detection limit five times greater than standard fluorescent probes.

  2. A Comprehensive Strategy to Boost the Quantum Yield of Luminescence of Europium Complexes (United States)

    Lima, Nathalia B. D.; Gonçalves, Simone M. C.; Júnior, Severino A.; Simas, Alfredo M.


    Lanthanide luminescence has many important applications in anion sensing, protein recognition, nanosized phosphorescent devices, optoelectronic devices, immunoassays, etc. Luminescent europium complexes, in particular, act as light conversion molecular devices by absorbing ultraviolet (UV) light and by emitting light in the red visible spectral region. The quantum yield of luminescence is defined as the ratio of the number of photons emitted over the number of UV photons absorbed. The higher the quantum yield of luminescence, the higher the sensitivity of the application. Here we advance a conjecture that allows the design of europium complexes with higher values of quantum yields by simply increasing the diversity of good ligands coordinated to the lanthanide ion. Indeed, for the studied cases, the percent boost obtained on the quantum yield proved to be strong: of up to 81%, accompanied by faster radiative rate constants, since the emission becomes less forbidden. PMID:23928866

  3. Assembly of europium organic framework–gold nanoparticle composite thin films on silicon substrate

    Energy Technology Data Exchange (ETDEWEB)

    Deep, Akash, E-mail: [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kaur, Rajnish [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kumar, Parveen [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Kumar, Pawan; Paul, A.K. [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India)


    Metal organic frameworks are a sub-class of coordination polymers and rapidly generating huge research interests in several technological areas. One of the emerging areas of their potential applications is the photovoltaics. The present study proposes the assembly of europium organic framework–gold nanoparticle nanocomposite thin film on silicon substrate. Microscopic, X-ray diffraction, surface area measurement and thermal studies have indicated the formation of the desired thin film. Spectral studies have been used to highlight their solid state optical property. Current–voltage studies have established semiconducting property of the above thin films. - Highlights: • Thin film of europium organic framework/gold nanoparticles is prepared on silicon. • Fairly homogeneous films with a roughness factor of 5–10 nm are obtained. • Above thin films offer solid-state photoluminescence and semiconducting properties.

  4. Synthesis and optical features of an europium organic-inorganic silicate hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Franville, A.C.; Zambon, D.; Mahiou, R.; Chou, S.; Cousseins, J.C. [Universite Blaise Pascal, Aubiere (France). Lab. des Materiaux Inorganiques; Troin, Y. [Laboratoire de Chimie des Heterocycles et des Glucides, EA 987, Universite Blaise-Pascal and ENSCCF, F-63177 Aubiere Cedex (France)


    A europium organic-inorganic silicate hybrid was synthesized by grafting a coordinative group (dipicolinic acid) to a silicate network precursor (3-aminopropyltriethoxysilane) via a covalent bonding. Sol-gel process and complexation were performed using different experimental conditions. The hybrid materials, in particular the Eu{sup 3+} coordination mode, were characterized by infrared and luminescence spectroscopies. Morphology of the materials and TG analysis showed that grafted silica enhanced thermal and mechanical resistances of the organic part. (orig.) 7 refs.

  5. Development of a microchip Europium nanoparticle immunoassay for sensitive point-of-care HIV detection. (United States)

    Liu, Jikun; Du, Bingchen; Zhang, Panhe; Haleyurgirisetty, Mohan; Zhao, Jiangqin; Ragupathy, Viswanath; Lee, Sherwin; DeVoe, Don L; Hewlett, Indira K


    Rapid, sensitive and specific diagnostic assays play an indispensable role in determination of HIV infection stages and evaluation of efficacy of antiretroviral therapy. Recently, our laboratory developed a sensitive Europium nanoparticle-based microtiter-plate immunoassay capable of detecting target analytes at subpicogram per milliliter levels without the use of catalytic enzymes and signal amplification processes. Encouraged by its sensitivity and simplicity, we continued to miniaturize this assay to a microchip platform for the purpose of converting the benchtop assay technique to a point-of-care test. It was found that detection capability of the microchip platform could be readily improved using Europium nanoparticle probes. We were able to routinely detect 5 pg/mL (4.6 attomoles) of HIV-1 p24 antigen at a signal-to-blank ratio of 1.5, a sensitivity level reasonably close to that of microtiter-plate Europium nanoparticle assay. Meanwhile, use of the microchip platform effectively reduced sample/reagent consumption 4.5 fold and shortened total assay time 2 fold in comparison with microtiter plate assays. Complex matrix substance in plasma negatively affected the microchip assays and the effects could be minimized by diluting the samples before loading. With further improvements in sensitivity, reproducibility, usability, assay process simplification, and incorporation of portable time-resolved fluorescence reader, Europium nanoparticle immunoassay technology could be adapted to meet the challenges of point-of-care diagnosis of HIV or other health-threatening pathogens at bedside or in resource-limited settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Green Luminescence of Divalent Europium in the Hydride Chloride EuHCl

    NARCIS (Netherlands)

    Kunkel, Nathalie; Rudolph, Daniel; Meijerink, A; Rommel, Stefan; Weihrich, Richard; Kohlmann, Holger; Schleid, Thomas

    Luminescence properties of divalent europium in the mixed-anion hydride chloride EuHCl were studied for the first time. Olive-green single crystals of EuHCl (PbFCl-type structure: tetragonal, P4/nmm, a = 406.58(3) pm, c = 693.12(5) pm, c/a = 1.705, Z = 2) resulted from the reaction of elemental

  7. Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Stollenwerk, Tobias


    In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.

  8. Redox electrochemistry of europium fluoride complexes in an equimolar NaCl-KCl melt

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, S.A., E-mail: [Institute of Chemistry, Kola Science Centre RAS, 26 Akademgorodok., 184209 Apatity, Murmansk region (Russian Federation); Gaune-Escard, M. [Ecole Polytechnique, Mecanique Energetique, Technopole de Chateau Gombert, 5 rue Enrico Fermi, 13453 Marseille Cedex 13 (France)


    The electrochemical behavior of europium fluoride complexes was studied by different electrochemical methods at a glassy carbon electrode in the temperature range 973-1100 K in the NaCl-KCl melt. The diffusion coefficients of Eu(III) and Eu(II) were determined by linear sweep voltammetry. The standard rate constants of charge transfer for the Eu(III)/Eu(II) redox couple were found on the base cyclic voltammetry, impedance spectroscopy and chronoamperometry data. The formal standard redox potentials E{sub Eu(III)/Eu(II)}{sup *} were obtained by linear sweep and cyclic voltammetry. The electrochemical behavior of europium fluoride and europium chloride complexes in NaCl-KCl melt was compared and discussed in connection with the strength and stability of these complexes. It was shown that the formation of stronger fluoride complexes reduced values of diffusion coefficients, standard rate constants for charge transfer of the Eu(III)/Eu(II) redox couple and shifted the formal standard redox potentials to the more electronegative values.

  9. Lateral flow immunoassay using europium chelate-loaded silica nanoparticles as labels. (United States)

    Xia, Xiaohu; Xu, Ye; Zhao, Xilin; Li, Qingge


    Despite their ease of use, lateral flow immunoassays (LFIAs) often suffer from poor quantitative discrimination and low analytical sensitivity. We explored the use of a novel class of europium chelate-loaded silica nanoparticles as labels to overcome these limitations. Antibodies were covalently conjugated onto europium chelate-loaded silica nanoparticles with dextran as a linker. The resulting conjugates were used as labels in LFIA for detection of hepatitis B surface antigen (HBsAg). We performed quantification with a digital camera and Adobe Photoshop software. We also used 286 clinical samples to compare the proposed method with a quantitative ELISA. A detection limit of 0.03 microg/L was achieved, which was 100 times lower than the colloidal gold-based LFIAs and lower than ELISA. A precise quantitative dose-response curve was obtained, and the linear measurement range was 0.05-3.13 microg/L, within which the CVs were 2.3%-10.4%. Regression analysis of LFIA on ELISA results gave: log (LFIA) = -0.14 log (ELISA) + 1.03 microg/L with r = 0.99 for the quantification of HBsAg in 35 positive serum samples. Complete agreement was observed for the qualitative comparison of 286 clinical samples assayed with LFIA and ELISA. Europium chelate-loaded silica nanoparticle labels have great potential to improve LFIAs, making them useful not only for simple screening applications but also for more sensitive and quantitative immunoassays.

  10. Luminescent solutions and films of new europium complexes with chelating ligands (United States)

    Kharcheva, Anastasia V.; Ivanov, Alexey V.; Borisova, Nataliya E.; Kaminskaya, Tatiana P.; Patsaeva, Svetlana V.; Popov, Vladimir V.; Yuzhakov, Viktor I.


    The development of new complexes of rare earth elements (REE) with chelating organic ligands opens up the possibility of purposeful alteration in the composition and structure of the complexes, and therefore tuning their optical properties. New ligands possessing two pyridine rings in their structure were synthesized to improve coordination properties and photophysical characteristics of REE compounds. Complexes of trivalent europium with novel chelating ligands were investigated using luminescence and absorption spectroscopy, as well as atomic force microscopy. Luminescence properties of new compounds were studied both for solutions and films deposited on the solid support. All complexes exhibit the characteristic red luminescence of Eu (III) ion with the absolute lumenescence quantum yield in polar acetonitrile solution varying from 0.21 to 1.45 % and emission lifetime ranged from 0.1 to 1 ms. Excitation spectra of Eu coordination complexes correspond with absorption bands of chelating ligand. The energy levels of the triplet state of the new ligands were determined from the phosphorescence at 77 K of the corresponding Gd (III) complexes. The morphology of films of europium complexes with different substituents in the organic ligands was investigated by atomic force microscopy (AFM). It strongly depends both on the type of substituent in the organic ligand, and the rotation speed of the spin-coater. New europium complexes with chelating ligands containing additional pyridine fragments represent outstanding candidates for phosphors with improved luminescence properties.

  11. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength. (United States)

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan


    Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f'' = 11.17 e(-), at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules.

  12. Hydrothermal treatment for preparation of europium-lanthanum phosphates and exploration of their fluorescence properties

    Directory of Open Access Journals (Sweden)

    Hiroaki Onoda


    Full Text Available Europium-substituted lanthanum phosphates (Eu; 5 mol% were prepared from lanthanum nitrate, europium nitrate, and sodium polyphosphate solutions by a hydrothermal process at 120 and 160 °C up to 8 h. The obtained phosphates were studied using XRD, IR spectroscopy, TG–DTA, and SEM. UV–vis absorbance and reflectance, as well as fluorescence, were estimated as functional properties of these phosphate materials. We found that samples prepared without hydrothermal treatment were amorphous (as indicated by their XRD patterns, whereas those prepared by a hydrothermal treatment contained peaks corresponding to lanthanum orthophosphate, indicating that the hydrothermal process caused the polyphosphate(s to decompose into orthophosphate(s. The TG–DTA curves of the samples prepared by a hydrothermal treatment were different from those of the samples prepared without hydrothermal treatment. All samples reported herein had no specified shape despite using prolonged hydrothermal treatment times. Although the samples prepared without hydrothermal treatment showed only weak fluorescence peaks, those prepared by a hydrothermal treatment showed strong peaks at 556, 590, 615, and 690 nm. These peaks corresponded to transitions from 5D0 to 7F0, 7F1, 7F2, and 7F4, respectively. Collectively, these results indicate that the hydrothermal treatment is a useful method of obtaining europium-substituted lanthanum phosphates with fluorescence properties.

  13. Fabrication of coated graphite electrode for the selective determination of europium (III) ions. (United States)

    Upadhyay, Anjali; Singh, Ashok Kumar; Bandi, Koteswara Rao; Jain, A K


    Preliminary complexation study showed that two ligands (ionophores) (2-((2-phenyl-2-(pyridin-2-yl)hydazono)methyl)pyridine) [L1], (2-((2-phenyl-2-(pyridin-2-yl)hydazono) methyl)phenol) [L2] can act as europium selective electrode. Europium selective coated graphite electrodes (CGE) were prepared by using ligands [L1] and [L2] and their potentiometric characteristics were determined. Membranes having different compositions of poly(vinylchloride) (PVC), the different plasticizers, anionic additives and ionophores were coated onto the graphite surface. The potential response measurements showed that the best performance was exhibited by the proposed CGE. This electrode had the widest working concentration range, Nernstian slope and fast response times of 10s. The selectivity studies showed that this electrode have higher selectivity towards Eu(3+) over a large number of cations. Furthermore, the electrode generated constant potentials in the pH range 2.7-9.0. This electrode can be used to quantify europium in soil, binary mixtures and also used as an indicator electrode in the potentiometric titration of Eu(3+) with EDTA. The proposed electrode was also successfully applied to the determination of fluoride ions in real samples. © 2013 Elsevier B.V. All rights reserved.

  14. Fluorescent Sulfur-Tagged Europium(III) Coordination Polymers for Monitoring Reactive Oxygen Species. (United States)

    Wang, Huai-Song; Bao, Wen-Jing; Ren, Shi-Bin; Chen, Ming; Wang, Kang; Xia, Xing-Hua


    Oxidative stress caused by reactive oxygen species (ROS) is harmful to biological systems and implicated in various diseases. A variety of selective fluorescent probes have been developed for detecting ROS to uncover their biological functions. Generally, the preparation of the fluorescent probes usually undergoes multiple synthetic steps, and the successful fluorescent sensing usually relies on trial-and-error tests. Herein we present a simple way to prepare fluorescent ROS probes that can be used both in biological and environmental systems. The fluorescent europium(III) coordination polymers (CPs) are prepared by simply mixing the precursors [2,2'-thiodiacetic acid and Eu(NO3)3·6H2O] in ethanol. Interestingly, with the increase of reaction temperature, the product undergoes a morphological transformation from microcrystal to nanoparticle while the structure and fluorescent properties retain. The fluorescence of the sulfur-tagged europium(III) CPs can be selectively quenched by ROS, and thus, sensitive and selective monitoring of ROS in aerosols by the microcrystals and in live cells by the nanoparticles has been achieved. The results reveal that the sulfur-tagged europium(III) CPs provide a novel sensor for imaging ROS in biological and environmental systems.

  15. Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite (United States)

    Niño-Martínez, Nereyda; Patiño-Marín, Nuria


    The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1) in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours. PMID:27965525

  16. Real-time in situ monitoring via europium emission of the photo-release of antitumor cisplatin from a Eu-Pt complex. (United States)

    Li, Hongguang; Lan, Rongfeng; Chan, Chi-Fai; Jiang, Lijun; Dai, Lixiong; Kwong, Daniel W J; Lam, Michael Hon-Wah; Wong, Ka-Leung


    A water-soluble light-responsive antitumor agent, PtEuL, based on a cisplatin-linked europium-cyclen complex has been synthesized and evaluated for controlled cisplatin release by linear/two-photon excitation in vitro with concomitant turn-on and long-lived europium emission as a responsive traceable signal.

  17. Europium doping induced symmetry deviation and its impact on the second harmonic generation of doped ZnO nanowires (United States)

    Dhara, Soumen; Imakita, Kenji; Mizuhata, Minoru; Fujii, Minoru


    In this work, we investigated the effects of europium doping on the second harmonic generation (SHG) of ZnO nanowires (NWs). A non-monotonic enhancement in the SHG is observed with the increase of the europium concentration. Maximum SHG is observed from the 1 at.% europium doped ZnO NWs with an enhancement factor of 4.5. To understand the underlying mechanism, the effective second order non-linear coefficient (deff) is calculated from the theoretical fitting with consideration of the absorption effect. Microstructural characterization reveals the structural deformation of the ZnO NWs caused by europium doping. We estimated the deviation in the crystal site symmetry around the Eu3+ ions (defined as the asymmetric factor) from photoluminescence measurement and it is found to be strongly correlated with the calculated deff value. A strong linear dependence between the magnitudes of deff and the asymmetric factor suggests that deviation in the local site symmetry of the ZnO crystal by europium doping could be the most probable origin of the observed large second order non-linearity.

  18. 33 CFR 167.150 - Off New York Traffic Separation Scheme: General. (United States)


    ... Scheme: General. 167.150 Section 167.150 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.150 Off New York Traffic...

  19. 33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General. (United States)


    ... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...

  20. 33 CFR 167.200 - In the approaches to Chesapeake Bay Traffic Separation Scheme: General. (United States)


    ... Bay Traffic Separation Scheme: General. 167.200 Section 167.200 Navigation and Navigable Waters COAST... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.200 In the approaches to Chesapeake Bay Traffic Separation Scheme: General. (a) The traffic...

  1. 33 CFR 167.400 - Off San Francisco Traffic Separation Scheme: General. (United States)


    ... Separation Scheme: General. 167.400 Section 167.400 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.400 Off San...

  2. 33 CFR 167.450 - In the Santa Barbara Channel Traffic Separation Scheme: General. (United States)


    ... Traffic Separation Scheme: General. 167.450 Section 167.450 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.450 In the Santa...

  3. 33 CFR 167.1702 - In Prince William Sound: Prince William Sound Traffic Separation Scheme. (United States)


    ... William Sound Traffic Separation Scheme. 167.1702 Section 167.1702 Navigation and Navigable Waters COAST... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.1702 In Prince William Sound: Prince William Sound Traffic Separation Scheme. The Prince William Sound...

  4. 9 CFR 167.1 - Scope and applicability of rules of practice. (United States)


    ... HEALTH PROTECTION ACT General § 167.1 Scope and applicability of rules of practice. The Uniform Rules of... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Scope and applicability of rules of practice. 167.1 Section 167.1 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...

  5. 46 CFR 167.60-10 - Exhibition of certificate of inspection. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Exhibition of certificate of inspection. 167.60-10 Section 167.60-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Certificates of Inspection § 167.60-10 Exhibition of certificate of...

  6. 46 CFR 167.40-20 - Deep-sea sounding apparatus. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Deep-sea sounding apparatus. 167.40-20 Section 167.40-20... SHIPS Certain Equipment Requirements § 167.40-20 Deep-sea sounding apparatus. Nautical school ships shall be equipped with an efficient or electronic deep-sea sounding apparatus. The electronic deep-sea...

  7. 26 CFR 1.167(b)-0 - Methods of computing depreciation. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Methods of computing depreciation. 1.167(b)-0....167(b)-0 Methods of computing depreciation. (a) In general. Any reasonable and consistently applied method of computing depreciation may be used or continued in use under section 167. Regardless of the...

  8. 26 CFR 1.167(a)-6 - Depreciation in special cases. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation in special cases. 1.167(a)-6....167(a)-6 Depreciation in special cases. (a) Depreciation of patents or copyrights. The cost or other... unrecovered cost or other basis may be deducted in that year. See § 1.167(a)-14(c)(4) for depreciation of a...

  9. 26 CFR 1.167(d)-1 - Agreement as to useful life and rates of depreciation. (United States)


    ... depreciation. 1.167(d)-1 Section 1.167(d)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.167(d)-1 Agreement as to useful life and rates of depreciation. After August 16... respect to the estimated useful life, method and rate of depreciation and treatment of salvage of any...

  10. 9 CFR 381.167 - Other poultry dishes and specialty items. (United States)


    ... items. 381.167 Section 381.167 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION... Standards of Identity or Composition § 381.167 Other poultry dishes and specialty items. Poultry dishes and...

  11. 33 CFR 167.405 - Off San Francisco: Main ship channel. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Off San Francisco: Main ship channel. 167.405 Section 167.405 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Separation Schemes and Precautionary Areas Pacific West Coast § 167.405 Off San Francisco: Main ship channel...

  12. Charge growth, dispersion in europium manganite (EuMnO{sub 3-{delta}}) ceramics revealed using opto-impedance probe

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, S. [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India); Jagannathan, R., E-mail: [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India)


    Highlights: > In this study, using opto-, magneto-opto impedance techniques, experimental proof for charge growth in europium manganite (EuMnO{sub 3}) near the region of its Neel temperature is presented. > This study gives data related to dielectric properties of europium manganite. > This study may open-up new avenues for investigating the dielectric characteristics of many electronic-ceramics. - Abstract: In this preliminary report, we present the impedance characteristics of poly-crystalline europium manganite, a promising colossal magneto resistance (CMR) system investigated under optical ({approx}5 eV) and magnetic (0.1 T) perturbations yielding some clues on the charge build-up and dispersion processes. This may possibly be resulting from switching between ferromagnetic and anti-ferromagnetic phases through a charge transfer transition mediated process centering Mn{sup 3+/4+} 3d spins thereby meriting a more detailed study correlating with magnetic measurements.

  13. Rapid and accurate tumor-target bio-imaging through specific in vivo biosynthesis of a fluorescent europium complex. (United States)

    Ye, Jing; Wang, Jianling; Li, Qiwei; Dong, Xiawei; Ge, Wei; Chen, Yun; Jiang, Xuerui; Liu, Hongde; Jiang, Hui; Wang, Xuemei


    A new and facile method for rapidly and accurately achieving tumor targeting fluorescent images has been explored using a specifically biosynthesized europium (Eu) complex in vivo and in vitro. It demonstrated that a fluorescent Eu complex could be bio-synthesized through a spontaneous molecular process in cancerous cells and tumors, but not prepared in normal cells and tissues. In addition, the proteomics analyses show that some biological pathways of metabolism, especially for NADPH production and glutamine metabolism, are remarkably affected during the relevant biosynthesis process, where molecular precursors of europium ions are reduced to fluorescent europium complexes inside cancerous cells or tumor tissues. These results proved that the specific self-biosynthesis of a fluorescent Eu complex by cancer cells or tumor tissues can provide a new strategy for accurate diagnosis and treatment strategies in the early stages of cancers and thus is beneficial for realizing precise surgical intervention based on the relevant cheap and readily available agents.

  14. Polystyrene latex particles containing europium complexes prepared by miniemulsion polymerization using bovine serum albumin as a surfactant for biochemical diagnosis. (United States)

    Aikawa, Tatsuo; Mizuno, Akihiro; Kohri, Michinari; Taniguchi, Tatsuo; Kishikawa, Keiki; Nakahira, Takayuki


    Luminescent particles have been attracting significant attention because they can be used in biochemical applications, such as detecting and imaging biomolecules. In this study, luminescent polystyrene latex particles were prepared through miniemulsion polymerization of styrene with dissolved europium complexes in the presence of bovine serum albumin (BSA) and poly(ethylene glycol) monomethoxy methacrylate as surfactants. The solubility of the europium complex in styrene has a strong effect on the yield of the particle. Europium tris(2-thenoyl trifluoroacetonate) di(tri-n-octyl phosphine oxide), which has a high solubility in styrene, was sufficiently incorporated into the polystyrene particles compared to europium tris(2-thenoyl trifluoroacetonate), which has a low solubility in styrene. The luminescence property of the europium complex could remain intact even after its incorporation through the miniemulsion polymerization. In the aqueous dispersion, the resulting particles could emit strong luminescence, which is a characteristic of the europium complex. The antibody fragments were covalently attached to BSA-covered particles after a reaction with a bifunctional linker, N-(6-maleimidocaproyloxy)succinimide. The time-resolved fluoroimmunoassay technique showed that 3.3pg/mL of human α-fetoproteins (AFP) can be detected by using the resulting luminescent particles. An immunochromatographic assay using the resulting particles was also performed as a convenient method to qualitatively detect biomolecules. The detection limit of AFP measured by the immunochromatographic assay was determined to be 2000pg/mL. These results revealed that the luminescent particles obtained in this study can be utilized for the highly sensitive detection of biomolecules and in vitro biochemical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)


    The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.

  16. Electron-induced desorption of europium atoms from oxidized tungsten surface: concentration dependence of low-energy peak

    CERN Document Server

    Davydov, S Y


    One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms

  17. Optical properties of europium(III) {beta}-diketonate/polymer-doped systems using supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimova, V.I., E-mail: [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Antoshkov, A.A.; Zavorotny, Yu.S.; Rybaltovskii, A.O. [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Lemenovskii, D.A., E-mail: [Chemistry Department, Moscow State University, Leninskie Gory 1-3, GSP-1, 119991 Moscow (Russian Federation)


    The optical properties of fluoropolymers and polypropylene doped with europium(III) {beta}-diketonates Eu(L){sub 3}{center_dot}2H{sub 2}O and Eu(L){sub 3}phen (L: fod=6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato, bta=4,4,4-trifluoro-1-phenyl-1,3-butanedione, tta=4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione, and phen=1,10-phenanthroline) using supercritical carbon dioxide were investigated by absorption and emission spectra. A comparative analysis of the PL decay times of Eu{sup 3+} ions in the initial europium (III) {beta}-diketonates and impregnated fluoropolymers was carried out. The supercritical fluid (SCF) impregnation of polymer samples with europium(III) {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed differently depending on the type of ligand in the entire investigated impregnation temperature range (T{sub SCF}=50-90 Degree-Sign S). It is shown that from the variety of Eu(L){sub 3}phen only Eu(fod){sub 3}phen can be introduced into the polymer matrix by this method. - Highlights: Black-Right-Pointing-Pointer The optical properties of polymers doped with Eu{sup 3+} {beta}-diketonates using SC CO{sub 2} were investigated. Black-Right-Pointing-Pointer A comparative analysis of the PL decay times in the initial Eu{sup 3+} {beta}-diketonates and doped polymers was carried out. Black-Right-Pointing-Pointer The SC CO{sub 2} impregnation of polymers with Eu{sup 3+} {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed.

  18. Reverse lyotropic liquid crystals from europium nitrate and P123 with enhanced luminescence efficiency. (United States)

    Yi, Sijing; Li, Qintang; Liu, Hongguo; Chen, Xiao


    Fabrication of lyotropic aggregates containing the lanthanide ions is becoming a preferable way to prepare novel functional materials. Here, the lyotropic liquid crystals (LLCs) of reverse hexagonal, reverse bicontinuous cubic, and lamellar phases have been constructed in sequence directly from the mixtures of Eu(NO3)3·6H2O and Pluronic P123 amphiphilc block copolymer with increasing the salt proportion. Their phase types and structural characteristics were analyzed using polarized optical microscopy (POM) and small-angle X-ray scattering (SAXS) measurements. The driving forces of reverse LLC phase formation were investigated using Fourier-transformed infrared spectroscopy (FTIR) and rheological measurements. The hydrated europium salt was found to act not only as a solvent here, but also as the bridge to form hydrogen bonding between coordinated water molecules and PEO blocks, which played a key role in the reverse LLCs formation. Compared to those in aqueous solutions and solid state, the enhanced luminescence quantum yields and prolonged excited state lifetimes were observed in two europium containing reverse mesophases. The luminescence quenching effect of lanthanide ions was efficiently suppressed, probably due to the substitution of coordinated water molecules by oxyethyl groups of P123 and ordered phase structures of LLCs, where the coordinated europium ions were confined and isolated by PEO blocks. The optimum luminescence performance was then found to exist in the reverse hexagonal phase. The obtained results on such lanthanide-induced reverse LLCs should be referable for designing new luminescent soft materials construction to expand their application fields.

  19. How Do Radionuclides Accumulate in Marine Organisms? A Case Study of Europium with Aplysina cavernicola. (United States)

    Maloubier, Melody; Shuh, David K; Minasian, Stefan G; Pacold, Joseph I; Solari, Pier-Lorenzo; Michel, Hervé; Oberhaensli, François R; Bottein, Yasmine; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe


    In the ocean, complex interactions between natural and anthropogenic radionuclides, seawater, and diverse marine biota provide a unique window through which to examine ecosystem and trophic transfer mechanisms in cases of accidental dissemination. The nature of interaction between radionuclides, the marine environment, and marine species is therefore essential for better understanding transfer mechanisms from the hydrosphere to the biosphere. Although data pertaining to the rate of global transfer are often available, little is known regarding the mechanism of environmental transport and uptake of heavy radionuclides by marine species. Among marine species, sponges are immobile active filter feeders and have been identified as hyperaccumulators of several heavy metals. We have selected the Mediterranean sponge Aplysina cavernicola as a model species for this study. Actinide elements are not the only source of radioactive release in cases of civilian nuclear events; however, their physicochemical transfer mechanisms to marine species remain largely unknown. We have targeted europium(III) as a representative of the trivalent actinides such as americium or curium. To unravel biological uptake mechanisms of europium in A. cavernicola, we have combined radiometric (γ) measurements with spectroscopic (time-resolved laser-induced fluorescence spectroscopy, TRLIFS, and X-ray absorption near-edge structure, XANES) and imaging (transmission electron microscopy, TEM, and scanning transmission X-ray microscopy, STXM) techniques. We have observed that the colloids of NaEu(CO3)2·nH2O formed in seawater are taken up by A. cavernicola with no evidence that lethal dose has been reached in our working conditions. Spectroscopic results suggest that there is no change of speciation during uptake. Finally, TEM and STXM images recorded at different locations across a sponge cross section, together with differential cell separation, indicate the presence of europium particles (around

  20. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova


    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  1. Synergistic extraction of europium and americium into nitrobenzene by using hydrogen dicarbollylcobaltate and dodecaethylene glycol. (United States)

    Makrlík, Emanuel; Vaňura, Petr; Selucký, Pavel


    Extraction of microamounts of europium and americium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of dodecaethylene glycol (DDEG, L) has been investigated. The equilibrium data have been explained assuming that the species HL+, H2L2+, ML3+ and MH-1L2+ (M3+ = Eu3+, Am3+; L = DDEG) are extracted into the organic phase. The values of extraction and stability constants of the complex species in nitrobenzene saturated with water have been determined. It was found that in this nitrobenzene medium, the stability constant of the EuL3+ complex is comparable with that of AmL3+.

  2. Red/blue electroluminescence from europium-doped organic light emitting diodes (United States)

    Hagen, Joshua A.; Li, Wayne X.; Grote, James G.; Steckl, Andrew J.


    Red/Blue emitting organic light emitting diodes (OLED) devices have been obtained using a Europium-doped organic emitting layer (NPB:Eu). The Eu-doped OLEDs emit in 2 color ranges: a broad blue (~420-500nm) band due to NPB emission and a narrow red peak at 620nm due to Eu emission. The red/blue devices achieve a brightness ~13x more intense than a similarly structured green (Alq 3) emitting OLED. These NPB:Eu emitting structures also reach a maximum efficiency of 0.2 cd/A at brightnesses above 100 cd/m2.

  3. Test of zircon materials for sorption of europium; Pruebas de materiales circoniferos para sorcion de europio

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)

  4. Sol-Gel Synthesis, X-Ray Diffraction Studies, and Electric Conductivity of Sodium Europium Silicate

    Directory of Open Access Journals (Sweden)

    Ekaterina V. Borisova


    Full Text Available Sodium europium silicate, NaEu9(SiO46O2, with apatite structure has been obtained and studied using X-ray diffraction and SEM. It has been shown that sodium sublimation does not take place upon synthesis by the sol-gel method. Rietveld refinement has revealed that sodium atoms are ordered and occupy the 4f position. O(4 atoms not related to silicate ions are placed at the centers of Eu(2 triangles. DC and AC electric conductivity and activation energy have been determined for the compound studied.

  5. New Class of Bright and Highly Stable Chiral Cyclen Europium Complexes for Circularly Polarized Luminescence Applications. (United States)

    Dai, Lixiong; Lo, Wai-Sum; Coates, Ian D; Pal, Robert; Law, Ga-Lai


    High glum values of +0.30 (ΔJ = 1, 591 nm, in DMSO) and -0.23 (ΔJ = 1, 589 nm, in H2O) were recorded in our series of newly designed macrocyclic europium(III) complexes. A sterically locking approach involving a bidentate chromophore is adopted to control the formation of one stereoisomer, giving rise to extreme rigidity, high stability, and high emission intensity. The combination of a chiral substituent on a macrocyclic chelate for lanthanide ions opens up new perspectives for the further development of circulary polarized luminescent chiral tags in optical and bioapplications.

  6. A microemulsion preparation of nanoparticles of europium in silica with luminescence enhancement using silver (United States)

    Ma, Zhi Ya; Dosev, Dosi; Kennedy, Ian M


    A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core–silica shell (Ag@SiO2) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag@SiO2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability. PMID:19417456

  7. Metal Controlled Diastereoselective Self-assembly and Circularly Polarized Luminescence of a Chiral Heptanuclear Europium Wheel (United States)

    Bozoklu, Gülay; Gateau, Christelle; Imbert, Daniel; Pécaut, Jacques; Robeyns, Koen; Filinchuk, Yaroslav; Memon, Farah; Muller, Gilles


    The chiral dissymmetric tetradentate ligand SPhbipox (6’-(4-phenyloxazolin-2-yl)-2,2’-bipyridine-6-carboxylic acid) leads to the diastereoselective assembly of a homochiral Eu(III) triangle and of a highly emissive (QY=27%) heptanuclear wheel which is the largest example of chiral luminescent complex of Eu(III) reported to date. We show that the nuclearity of the assembly is controlled by the solvent and the europium cation. All the compounds show large circularly polarized luminescence with an activity which varies with the nature of the assembly (highest for the homochiral trimer). PMID:22548280

  8. A europium(III)-based PARACEST agent for sensing singlet oxygen by MRI (United States)

    Song, Bo; Wu, Yunkou; Yu, Mengxiao; Zhao, Piyu; Zhou, Cheng; Kiefer, Garry E.


    A europium (III) DOTA-tetraamide complex was designed as a MRI sensor of singlet oxygen (1O2). The water soluble, thermodynamically stable complex reacts rapidly with 1O2 to form an endoperoxide derivative that results in an ∼3 ppm shift in the position of the Eu(III)-bound water chemical exchange saturation transfer (CEST) peak. The potential of using this probe to detect accumulation of the endoperoxide derivative in biological media by ratiometric CEST imaging was demonstrated. PMID:23575743

  9. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  10. Colloidal europium nanoparticles via a solvated metal atom dispersion approach and their surface enhanced Raman scattering studies. (United States)

    Urumese, Ancila; Jenjeti, Ramesh Naidu; Sampath, S; Jagirdar, Balaji R


    Chemistry of lanthanide metals in their zerovalent state at the nanoscale remains unexplored due to the high chemical reactivity and difficulty in synthesizing nanoparticles by conventional reduction methods. In the present study, europium(0) nanoparticles, the most reactive of all the rare earth metals have been synthesized by solvated metal atom dispersion (SMAD) method using hexadecyl amine as the capping agent. The as-prepared europium nanoparticles show surface Plasmon resonance (SPR) band in the visible region of the electromagnetic spectrum. This lead to the investigation of its surface enhanced Raman scattering (SERS) using visible light excitation source. The SERS activity of europium nanoparticles has been followed using 4-aminothiophenol and biologically important molecules such as hemoglobin and Cyt-c as the analytes. This is the first example of lanthanide metal nanoparticles as SERS substrate which can possibly be extended to other rare-earth metals. Since hemoglobin absorbs in the visible region, the use of visible light excitation source leads to surface enhanced resonance Raman spectroscopy (SERRS). The interaction of biomolecules with Eu(0) has been followed using FT-IR and UV-visible spectroscopy techniques. The results indicate that there is no major irreversible change in the structure of biomolecules upon interaction with europium nanoparticles. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Rapid screening of oxytetracycline residue in catfish muscle by dispersive liquid-liquid microextraction and europium-sensitized luminescence (United States)

    Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...

  12. Luminescence variations in europium-doped silicon-substituted hydroxyapatite nanobiophosphor via three different methods

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Cao Xuan; Pham, Vuong-Hung, E-mail:


    Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.

  13. Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS

    CERN Document Server

    AUTHOR|(CDS)2099873; Marsh, Bruce Alan

    The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...

  14. Structural and electrical properties of the europium-doped indium zinc oxide thin film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Chu-Chi, E-mail: [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Advanced Institute for Manufacturing with High-Tech Innovations, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Li, Wei-Yang; Wang, Ching-Hua; Yong, Hua-En [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China)


    The EuInZnO (EIZO) thin film transistor (TFT) devices were fabricated by the sol–gel spin-coating technique. The EIZO TFT operates in the n-channel depletion mode and exhibits a well-defined pinch-off and saturation region. Because europium ion possesses lower electronegativity (1.2) and standard electrode potential (− 1.991 V), it can act as the carrier suppressor to reduce the carrier concentrations of the IZO (In:Zn = 1:1) thin film. Eu{sup 3+} (13 mol%)-doped IZO TFT possesses the optimum performance, and its field-effect mobility in the saturated regime, threshold voltage, on–off ratio, and S-factor are 1.23 cm{sup 2}/Vs, 3.28 V, 1.07 × 10{sup 6}, and 2.28 V/decade, respectively. - Highlights: • Europium ions can act as the carrier suppressor in the InZnO system. • The EuInZnO forms an n-channel material for the thin film transistor (TFT) device. • The optimum performance of the EuInZnO TFT is the sample with 13 mol% Eu{sup 3+} doping.

  15. Europium phosphomolybdate and osmium metallopolymer multi-functional LbL films: redox and electrocatalytic properties. (United States)

    Fernandes, Diana M; Vos, Johannes G; Freire, Cristina


    Hybrid multilayer films composed by osmium metallopolymer [Os(bpy)2(PVP)10Cl]Cl (Os-poly) and europium phosphomolybdate, K₁₁[Eu(III)(PMo₁₁O₃₉)₂] (Eu(PMo11)2), were prepared using the electrostatic layer-by-layer (LbL) self-assembly method. The film build-up, monitored by electronic spectroscopy, showed a regular stepwise growth indicating a strong interaction between layers. The XPS measurements corroborated the successful fabrication of the hybrid films with the Os-poly/Eu(PMo11)2 composition. SEM images revealed a completely covered surface with a highly roughened texture. Electrochemical characterisation of films by cyclic voltammetry revealed three Mo-based reduction processes (Mo(VI)→Mo(V)) in the potential range between -0.4 and 0.1 V and one Os reduction process (Os(III)→Os(II)) at ≈0.270 V. The cyclic voltammograms of two electroactive probes, [Fe(CN)₆](3-/4-) and [Ru(NH₃)₆](3+/2+) on {Os-poly/Eu(PMo11)2}n modified electrodes revealed redox mediation between film and the probes. Furthermore, the {Os-poly/Eu(PMo11)2}n multilayer films also showed excellent Mo-based electrocatalytic activity towards reduction of nitrite and iodate, confirming the multi-functional properties of the hybrid europium phosphomolybdate - osmium metallopolymer LbL films. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental


    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  17. pH-controlled delivery of luminescent europium coated nanoparticles into platelets (United States)

    Davies, Amy; Lewis, David J.; Watson, Stephen P.; Thomas, Steven G.; Pikramenou, Zoe


    Water soluble, luminescent gold nanoparticles are delivered into human platelets via a rapid, pH-controlled mechanism using a pH low insertion peptide, pHLIP. The approach introduces cocoating of gold nanoparticles with a europium luminescent complex, EuL and the pHLIP peptide to give pHLIP•EuL•Au. The 13-nm diameter gold nanoparticles act as a scaffold for the attachment of both the luminescent probe and the peptide to target delivery. Their size allows delivery of approximately 640 lanthanide probes per nanoparticle to be internalized in human platelets, which are not susceptible to transfection or microinjection. The internalization of pHLIP•EuL•Au in platelets, which takes just minutes, was studied with a variety of imaging modalities including luminescence, confocal reflection, and transmission electron microscopy. The results show that pHLIP•EuL•Au only enters the platelets in low pH conditions, pH 6.5, mediated by the pHLIP translocation across the membrane, and not at pH 7.4. Luminescence microscopy images of the treated platelets show clearly the red luminescence signal from the europium probe and confocal reflection microscopy confirms the presence of the gold particles. Furthermore, transmission electron microscopy gives a detailed insight of the internalization and spatial localization of the gold nanoparticles in the platelets. Thus, we demonstrate the potential of the design to translocate multimodal nanoparticle probes into cells in a pH dependent manner. PMID:22308346

  18. Analysis of metal surfaces coated with europium-doped titanium dioxide by laser induced breakdown spectroscopy. (United States)

    Głogocka, Daria; Noculak, Agnieszka; Pucińska, Joanna; Jopek, Wojciech; Podbielska, Halina; Langner, Marek; Przybyło, Magdalena


    The surface passivation with titanium sol-gel coatings is a frequently used technique to control the adsorption of selected biological macromolecules and to reduce the exposure of the bulk material to biological matter. Due to the increasing number of new coating-preparation methods and new gel compositions with various types of additives, the quality and homogeneity determination of the surface covering is a critical factor affecting performance of any implanted material. While coating thickness is easy to determine, the homogeneity of the surface distribution of coating materials requires more elaborate methodologies. In the paper, the laser induced breakdown spectroscopy (LIBS) based method, capable to quantitate the homogeneity and uniformity of the europium in titanium dioxide sol-gel coatings on stainless steel surfaces prepared with two different procedures: spin-coating and dip-coating, is presented. The emission intensity of titanium has been used to determine the coating thickness whereas the relative values of europium and titanium emission intensities provide data on the coating homogeneity. The obtained results show that the spin-coating technique provides better surface coverage with titanium dioxide. However, when the surface coating compositions were compared the dip-coating technique was more reliable.

  19. Europium(III) Macrocyclic Complexes with Alcohol Pendant Groups as Chemical Exchange Saturation Transfer Agents (United States)

    Woods, Mark; Woessner, Donald E.; Zhao, Piyu; Pasha, Azhar; Yang, Meng-Yin; Huang, Ching-Hui; Vasalitiy, Olga; Morrow, Janet R.; Sherry, A. Dean


    Paramagnetic lanthanide(III) complexes that contain hyperfine-shifted exchangeable protons offer considerable advantages over diamagnetic molecules as chemical exchange saturation transfer (CEST) agents for MRI. As part of a program to investigate avenues to improve the sensitivity of such agents, the CEST characteristics of europium(III) macrocyclic complexes having appended hydroxyethyl groups were investigated. The CEST spectrum of the asymmetrical complex, EuCNPHC3+, shows five distinct peaks for each magnetically nonequivalent exchangeable proton in the molecule. The CEST spectra of this complex were fitted to NMR Bloch theory to yield exchange rates between each of six exchanging proton pools (five on the agent plus bulk water). Exchange between the Eu3+-bound hydroxyl protons and bulk water protons was slow in dry acetonitrile but accelerated incrementally upon stepwise addition of water. In pure water, exchange was too fast to observe a CEST effect. The utility of this class of europium(III) complex for CEST imaging applications is ultimately limited by the small chemical shifts induced by the hydroxyl-appended ligands of this type and the resulting small Δω values for the exchangeable hydroxyl protons. PMID:16881645

  20. Red light emission from europium doped zinc sodium bismuth borate glasses (United States)

    Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.


    Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.

  1. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  2. Induced Europium Circularly Polarized Luminescence Monitors Reversible Drug Binding to Native α1 -Acid Glycoprotein. (United States)

    Jennings, Laura; Waters, Ryan S; Pal, Robert; Parker, David


    Alpha-1-acid glycoprotein (α1 -AGP) is an important blood plasma glycoprotein. Following an acute-phase reaction such as stress, inflammation, burn, or infection, the bloodstream concentration of α1 -AGP can increase up to 400 % of its normal concentration. A wide range of drugs is known to bind α1 -AGP. Increased binding of pharmacologically active compounds to α1 -AGP moderates their clinical effect by decreasing the amount of unbound drug in the bloodstream. This has important clinical ramifications for such applications as the duration of anesthesia and in determining dosage for drug therapy. In this study, the competitive binding to α1 -AGP of a dynamically racemic europium(III) complex with seven pharmacologically active drugs absorbing in the range λ 250-290 nm was monitored by following changes in europium total emission and in induced circularly polarized luminescence (CPL). Binding affinities corresponding to Kd values in the range 0.5-100 μm were measured, in good agreement with published data. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

    Directory of Open Access Journals (Sweden)

    Zhang Kui-Hua


    Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

  4. 26 CFR 1.167(l)-4 - Public utility property; election to use asset depreciation range system. (United States)


    ... depreciation range system. 1.167(l)-4 Section 1.167(l)-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Individuals and Corporations § 1.167(l)-4 Public utility property; election to use asset depreciation range system. (a) Application of section 167(l) to certain property subject to asset depreciation range system...

  5. 26 CFR 1.167(l)-2 - Public utility property; election as to post-1969 property representing growth in capacity. (United States)


    ...-1969 property representing growth in capacity. 1.167(l)-2 Section 1.167(l)-2 Internal Revenue INTERNAL...) Itemized Deductions for Individuals and Corporations § 1.167(l)-2 Public utility property; election as to post-1969 property representing growth in capacity. (a) In general. Section 167(l)(2) prescribes the...

  6. 26 CFR 1.167(l)-1 - Limitations on reasonable allowance in case of property of certain public utilities. (United States)


    ... property of certain public utilities. 1.167(l)-1 Section 1.167(l)-1 Internal Revenue INTERNAL REVENUE... Deductions for Individuals and Corporations § 1.167(l)-1 Limitations on reasonable allowance in case of property of certain public utilities. (a) In general—(1) Scope. Section 167(l) in general provides...

  7. Distinct transcriptional and processing regulations control miR167a level in tomato during stress. (United States)

    Jodder, Jayanti; Das, Rohit; Sarkar, Deepti; Bhattacharjee, Payel; Kundu, Pallob


    Besides their definite role in plant developmental processes miR167 also serve as mediator of stress response. Although differential expression of miR167 occurs during stresses, the regulatory-mechanism of biogenesis remained elusive. Therefore, using tomato as the model plant we have explored the mechanism of regulation of miR167a expression during stresses. Fungus or virus infections and exposure to cold stress raised the level of miR167a expression. Whereas, salt, drought and heat treatments resulted in the downregulation, indicating different stresses activated alternative mechanisms for miR167a regulation. Interestingly, the relative expression level of precursors in control versus temperature stressed plants differed from the pattern observed in the mature miR167a expression, suggesting that both transcriptional and processing regulation were important for biogenesis. The promoter-regulatory sequence of the major isoform MIR167a harbours several development and stress-related regulatory sites. Accordingly, promoter assays using transient transformation and transgenic tobacco plants proved stress-dependent regulation of the promoter. Further analyses corroborated the role of tomato DREB2A protein in the transcriptional regulation during temperature stress. Finally, in vitro assays established the importance of processing factors in cold-stress dependent efficient processing of MIR167a precursors. These data confirm distinct role of transcriptional and processing machinery in stress-influenced regulation of tomato miR167a biogenesis.

  8. "Rigid" Luminescent Soft Materials: Europium-Containing Lyotropic Liquid Crystals Based on Polyoxyethylene Phytosterols and Ionic Liquids. (United States)

    Yi, Sijing; Wang, Jiao; Feng, Zhenyu; Chen, Xiao


    Soft materials of europium β-diketonate complexes constructed in lyotropic liquid crystals (LLCs) mediated by ionic liquids (ILs) are impressive for their excellent luminescence performance and stability. For the aim to further improve their mechanical processability and luminescent tunablility, the polyoxyethylene phytosterols (BPS-n) were introduced here as structure directing agents to prepare relatively "rigid" lamellar luminescent LLCs in 1-butyl-3-methyl-imidazolium hexafluorophosphate by doping europium β-diketonate complexes with different imidazolium counterions. As a result of the solvophobic sterol ring structure of BPS-n, the more effective isolation and confinement effects of europium complexes could be achieved. The longest fluorescence lifetime and the highest quantum efficiency reported so far for europium containing lyotropic organized soft materials were thus obtained. Changing the molecular structures of BPS-n with different oxyethylene chains or doped complexes with imidazolium counterions of different alkyl chain lengths, the spacings of lamellar LLC matrixes and position of dispersed complexes became tunable. The measured luminescent and rheological properties for such composite LLCs showed a dependence on the rigidity and isolation capability afforded by sterol molecules. It was also found that the increase of counterion alkyl chain length would weaken the LLC matrix's confinement and isolation effects and therefore exhibit the deteriorated luminescence performance. The enhanced luminescence efficiency and stability of doped BPS-n LLCs reflected the excellent segregation of europium complexes from each other and therefore the reduced self-quenching process. The obtained results here present the designability of LLC matrixes and their great potential to promote achieving the luminescence tunability of soft materials.

  9. Preparation and photoluminescence of some europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dunjia, E-mail:; Pi, Yan; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Wei, Xianhong


    Highlights: •Preparation of europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands. •Photoluminescence behavior of europium (III) ternary complexes. •Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), the lifetime (τ) and the luminescent quantum yield (η). -- Abstract: Preparation and photoluminescence behavior of four new europium (III) ternary complexes with β-diketones (1-(6-methoxy-naphthalen-2-yl)-3-phenyl-propane-1,3-dione (MNPPD) and 1-(4-tert-butyl-phenyl)-3-(6-methoxy-naphthalen-2-yl)-propane-1,3-dione (BPMPD)) and 2,2-dipyridine (Bipy) or 1,10-phenanthroline (Phen) were reported, in the solid state. Complexes Eu(MPPD){sub 3}·Bipy, Eu(BMPD){sub 3}·Bipy, Eu(MPPD){sub 3}·Phen and Eu(BMPD){sub 3}·Phen were characterized by elemental analysis, FT-IR, {sup 1}H NMR, UV–vis absorption. The emission spectra show narrow emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion. Based on the emission spectra and luminescence decay curves in solid state, the intensity parameters (Ω{sub t}), lifetime (τ) and emission quantum efficiency (η) were determined. The Ω{sub 2} values indicate that the Eu(III) ion in these complexes is in a highly polarizable chemical environment. Complexes Eu(MPPD){sub 3}·Bipy and Eu(MPPD){sub 3}·Phen showed a longer lifetime (τ) and a higher luminescence quantum efficiency (η), which indicated that the energy transfer to the europium ion from MNPPD ligand is more efficient than that from BPMPD ligand.

  10. Health survey of 167 pet rabbits (Oryctolagus cuniculus) in Finland. (United States)

    Mäkitaipale, J; Harcourt-Brown, F M; Laitinen-Vapaavuori, O


    Only a limited amount of information is available about health status of pet rabbits. The aim of this study was to obtain data about the health status of pet rabbits considered healthy by the owners in Finland. Physical examination and lateral abdominal and lateral skull radiography were performed on 167 pet rabbits of which 118 (70.7 per cent) had abnormal findings in at least one examination. The most common findings were acquired dental disease (n=67, 40.1 per cent), vertebral column deformities and degenerative lesions (n=52, 31.1 per cent), skin disorders (n=28, 16.8 per cent) and eye disorders (n=12, 7.2 per cent). Vertebral column angulating deformities were significantly more common in dwarf lop rabbits (P≤0.001). The prevalence of health disorders was significantly higher in rabbits over three years of age of which 51 (82.3 per cent) had findings in at least one examination (PRabbits as prey animals hide their illness, which cause difficulties to owners to recognise health problems. Because of the high prevalence of clinical and radiological findings in apparently healthy pet rabbits, regular physical examinations are advised, especially for animals over three years old. British Veterinary Association.

  11. Burnable Absorbers with Enriched Er-167 in PWR Fuel Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jiwon; Kong, Chidong; Lee, Deokjung [Ulsan National Institute of Science and Technology, Ulsan (Korea, Republic of); Shin, Ho Cheol [KHNP-CRI, Daejeon (Korea, Republic of)


    Many advanced PWRs are required to have a 24-month operating cycle to improve plant economy, and to keep the boron concentration low to allow an adequately negative moderator feedback during any ATWS event through 100% core life. Unfortunately, longer cycles require higher uranium-235 enrichment and initial boron concentration in the reactor coolant. The amount of soluble boron is limited due to the requirement that the MTC must remain negative over the fuel cycle. Too much boron, typically greater than 1,300 ppm at full power, will make the MTC positive. The optimal design of burnable absorbers is key to the feasibility of this extended cycle and low boron core below the design limit of peak pin power. New concepts for burnable absorbers include changing the materials and geometry in the burnable absorber. k{sub inf}, peaking factor, MTC, and control rod worth of new BAs were compared with those of the conventional BA. A new enriched Er-167 based BA has been proposed and, from three test cases, it was shown that the Erbium burnable absorber is favorable to counterbalance the power peak and Gadolinium burnable absorber is favorable to flattening k{sub inf} trends over burnup.

  12. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  13. Syntheses and electroluminescent properties of two europium ternary complexes Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT)

    Energy Technology Data Exchange (ETDEWEB)

    Guan Min [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Gao Lihua [Department of Chemistry, Beijing Normal University, Beijing 100875 (China); Wang Shanshan [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Huang Chunhui [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China)], E-mail:; Wang Kezhi [Department of Chemistry, Beijing Normal University, Beijing 100875 (China)


    Two europium complexes, Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT) (DBM=dibenzoylmethanato, PBO=2-(2-pyridyl)benzoxazole, PBT=2-(2-pyridyl)benzothiazole), were prepared and used as emitting materials in organic electroluminescent (EL) devices. The devices with the structures ITO/TPD/Eu(DBM){sub 3}(PBO) (or Eu(DBM){sub 3}(PBT)/BCP/Alq{sub 3}/Mg:Ag/Ag emit red light originating from the europium complexes.

  14. 46 CFR 167.65-15 - Routing instructions; strict compliance with. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Routing instructions; strict compliance with. 167.65-15... PUBLIC NAUTICAL SCHOOL SHIPS Special Operating Requirements § 167.65-15 Routing instructions; strict... strictly comply with routing instructions issued by competent naval authority. ...

  15. 15 CFR 922.167 - Permits for access to the Tortugas Ecological Reserve. (United States)


    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Permits for access to the Tortugas Ecological Reserve. 922.167 Section 922.167 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE OCEAN AND COASTAL RESOURCE MANAGEMENT NATIONAL...


    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. The allenic ketone 8-methylnonane-1,6,7-trien-4-one and related allenes have been synthesized from simple commercially available materials. Since allenes analogous to 8-methylnonane-1,6,7-trien-4-one have previously been transformed to substituted bicyclo[3.3.0]octanones via corresponding ...

  17. 46 CFR 167.65-60 - Examination of boilers and machinery by engineer. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Examination of boilers and machinery by engineer. 167.65-60 Section 167.65-60 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL... machinery by engineer. It shall be the duty of an engineer when he assumes charge of the boilers and...

  18. 33 CFR 167.1703 - In Prince William Sound: Valdez Arm Traffic Separation Scheme. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false In Prince William Sound: Valdez Arm Traffic Separation Scheme. 167.1703 Section 167.1703 Navigation and Navigable Waters COAST GUARD... William Sound: Valdez Arm Traffic Separation Scheme. The Valdez Arm Traffic Separation Scheme consists of...

  19. 7 CFR 1789.167 - Terms and conditions of escrow agreement. (United States)


    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Terms and conditions of escrow agreement. 1789.167 Section 1789.167 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE (CONTINUED) USE OF CONSULTANTS FUNDED BY BORROWERS Escrow Account...

  20. 75 FR 51757 - Foreign-Trade Zone 167-Green Bay, WI; Site Renumbering Notice (United States)


    ... No: 2010-20899] DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 167--Green Bay, WI; Site Renumbering Notice Foreign-Trade Zone 167 was approved by the FTZ Board on August 23, 1990... Elizabeth Whiteman at [email protected] or (202) 482-0473. Dated: August 17, 2010. Andrew Mc...

  1. 46 CFR 167.15-33 - Underwater Survey in Lieu of Drydocking (UWILD). (United States)


    ... remotely operated vehicle's (ROV) location relative to the hull; (4) The means for examining all through... 46 Shipping 7 2010-10-01 2010-10-01 false Underwater Survey in Lieu of Drydocking (UWILD). 167.15... SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Inspections § 167.15-33 Underwater Survey in Lieu of Drydocking...

  2. 20 CFR 669.650 - How are MSFW youth funds allocated to section 167 youth grantees? (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false How are MSFW youth funds allocated to section 167 youth grantees? 669.650 Section 669.650 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... Youth Program § 669.650 How are MSFW youth funds allocated to section 167 youth grantees? The allocation...

  3. 26 CFR 1.167(a)-10 - When depreciation deduction is allowable. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false When depreciation deduction is allowable. 1.167... Corporations § 1.167(a)-10 When depreciation deduction is allowable. (a) A taxpayer should deduct the proper depreciation allowance each year and may not increase his depreciation allowances in later years by reason of...

  4. Stability constants of europium complexes with a nitrogen heterocycle substituted methane-1,1-diphosphonic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, M.P.; Rickert, P.G.; Schmidt, M.A.; Nash, K.L.


    Even in moderately acidic solutions ([H{sup +}] > 0.01 M), N-piperidinomethane-1,1-diphosphonic acid (H{sub 4}PMDPA) is a strong complexant of trivalent lanthanide ions that shows enhanced complex solubility over previously studied 1,1-diphosphonic acids. The protonation constants of PMDPA in 2.0 M H/NaClO{sub 4} were determined by potentiometric and NMR titrations, and the stability constants for formation of complexes with Eu{sup 3+} were determined by solvent extraction. Difference in protonation equilibria induced by addition of the nitrogen heterocycle results in an increase in the complexation strength of PMDPA. In solutions containing 0.1 M H{sup +} and ligand concentrations greater than 0.02 M, PMDPA is the most effective 1,1-diphosphonic acid for europium complexation studied thus far.

  5. Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio

    Energy Technology Data Exchange (ETDEWEB)

    Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)

  6. First principles description of the insulator-metal transition in europium monoxide

    KAUST Repository

    Wang, Hao


    Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.

  7. Development of europium doped BaSO4 TL OSL dual phosphor for radiation dosimetry applications (United States)

    Patle, Anita; Patil, R. R.; Kulkarni, M. S.; Bhatt, B. C.; Moharil, S. V.


    This paper presents the results on the preparation and characterization of Europium-doped Barium sulfate (BaSO4: Eu) TL /OSL dual phosphor. The OSL sensitivity was found to be 11% of the commercially available Al2O3: C, using area integration method. The sample also shows good TL sensitivity and the dosimetric peak appears around 190°C with a shoulder at 282°C. After OSL readout, No change in the TL glow curve is observed. Since the observed TL peaks are not responsible for the observed OSL, good OSL as well as TL sensitivity and low fading will make this phosphor suitable for applications in radiation dosimetry using OSL as well as TL.

  8. Chemiluminescence determination of tetracyclines using Fenton system in the presence europium(III) ions

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan, E-mail: [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)


    A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.

  9. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A., E-mail: [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803-1804 (United States)


    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  10. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics. (United States)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A


    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  11. Electrochemiluminescence Study of Europium (III Complex with Coumarin3-Carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Stefan Lis


    Full Text Available The europium (III complex of coumarin-3-carboxylic acid (C3CA has been prepared and characterized on the basis of elemental analysis, IR, and emission (photoluminescence and electrochemiluminescence spectroscopy. The synthesised complex having a formula Eu(C3CA2(NO3(H2O2 was photophysically characterized in solution and in the solid state. Electrochemiluminescence, ECL, of the system containing the Eu(III/C3CA complex was studied using an oxide-covered aluminium electrode. The goal of these studies was to show the possibility of the use of electrochemical excitation of the Eu(III ion in aqueous solution for emission generation. The generated ECL emission was very weak, and therefore its measurements and spectral analysis were carried out with the use of cut-off filters method. The studies proved a predominate role of the ligand-to-metal energy transfer (LMET in the generated ECL.

  12. Europium incorporated in silica matrix obtained by sol-gel: luminescent materials

    Directory of Open Access Journals (Sweden)

    Nassar Eduardo José


    Full Text Available In this work we report some aspects of the chemistry involved in the preparation of modified silicon oxide by the sol-gel process. Europium III compounds were used as luminescent probe. An organic-inorganic hybrid was obtained by hydrolysis of tetraethylorthosilicate (TEOS and 3-aminopropyltriethoxysilane (APTS. The Eu III compounds were added in different ways. In the first, silica was prepared in the presence of Eu III, and in the second, Eu III was added on the silica surface. These materials were studied by luminescence, infrared spectroscopy and termogravimetric analysis. The results obtained for the hybrid material show different behavior for Eu III emission, which could be excited by the antenna effect and the influence of the surrounding in the luminescence quenching. The thermogravimetric data present different mass loss in samples to range temperature 50 - 150 °C. Thermogravimetric and infrared spectra showed that inorganic polymers incorporated the organic part.

  13. Europium as an inhibitor of Amyloid-β(1-42) induced membrane permeation. (United States)

    Williams, Thomas L; Urbanc, Brigita; Marshall, Karen E; Vadukul, Devkee M; Jenkins, A Toby A; Serpell, Louise C


    Soluble Amyloid-beta (Aβ) oligomers are a source of cytotoxicity in Alzheimer's disease (AD). The toxicity of Aβ oligomers may arise from their ability to interact with and disrupt cellular membranes mediated by GM1 ganglioside receptors within these membranes. Therefore, inhibition of Aβ-membrane interactions could provide a means of preventing the toxicity associated with Aβ. Here, using Surface Plasmon field-enhanced Fluorescence Spectroscopy, we determine that the lanthanide, Europium III chloride (Eu(3+)), strongly binds to GM1 ganglioside-containing membranes and prevents the interaction with Aβ42 leading to a loss of the peptides ability to cause membrane permeation. Here we discuss the molecular mechanism by which Eu(3+) inhibits Aβ42-membrane interactions and this may lead to protection of membrane integrity against Aβ42 induced toxicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Radiation effects on beta /10.6/ of pure and europium doped KCl (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.


    Changes in the optical absorption coefficient as the result of X-ray and electron bombardment of pure monocrystalline and polycrystalline KCl and of divalent europium doped polycrystalline KCl were determined. A constant heat flow calorimetric method was used to measure the optical absorption coefficients. Both 300 kV X-ray irradiation and 2 MeV electron irradiation produced increases in the optical absorption coefficient at room temperature. X-ray irradiation produced more significant changes in pure monocrystalline KCl than equivalent amounts of electron irradiation. Electron irradiation of pure and Eu-doped polycrystalline KCl produced increases in the absorption by as much as a factor of 20 over untreated material. Bleaching of the electron-irradiated doped KCl with 649 millimicron light produced a further increase.

  15. Excitation functions for the formation of longer lived isotopes by deuteron irradiation of Europium

    Energy Technology Data Exchange (ETDEWEB)

    Takács, S., E-mail: [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Hermanne, A.; Adam-Rebeles, R. [Cyclotron Laboratory, Vrije Universiteit Brussel, Brussels 1090 (Belgium); Takács, M.P. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Institute of Physics, University of Debrecen, 4026 Debrecen (Hungary)


    Excitation functions for nuclear reactions induced on natural europium targets by energetic deuterons were studied up to 50 MeV. A standard stacked foil technique was used for irradiation and high resolution gamma spectrometry was applied for activity assessment. Direct or cumulative cross sections for reaction products with half-life longer than 2 h were determined. Reactions leading to the formation of the radionuclides {sup 147,149,151,153}Gd, {sup 147,148,149,150m,150g,152m,152g,154g}Eu, {sup 153}Sm and {sup 150}Pm were studied. In most cases no earlier data were available in the literature. The new experimental results were compared with values tabulated in the on-line TENDL2011 library.

  16. Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Klobes, B., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail:; Neumeier, S., E-mail: [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail:; Jafari, A., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)


    Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.

  17. Photoluminescent polymer electrolyte based on agar and containing europium picrate for electrochemical devices

    Energy Technology Data Exchange (ETDEWEB)

    Lima, E. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Raphael, E.; Sentanin, F. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil); Rodrigues, L.C. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Ferreira, R.A.S.; Carlos, L.D. [Departamento de Fisica, CICECO, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Silva, M.M., E-mail: [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Pawlicka, A. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil)


    Highlights: Black-Right-Pointing-Pointer We prepared ionic conducting membranes for the specific requirements of the device. Black-Right-Pointing-Pointer Luminescent reporter groups, with many applications in biotechnology. Black-Right-Pointing-Pointer Thermal and electrochemical stability of electrolytes is adequate for application. - Abstract: Dispersion of photoluminescent rare earth metal complexes in polymer matrices is of great interest due to the possibility of avoiding the saturation of the photoluminescent signal. The possibility of using a natural ionic conducting polymer matrix was investigated in this study. Samples of agar-based electrolytes containing europium picrate were prepared and characterized by physical and chemical analyses. The FTIR spectra indicated strong interaction of agar O-H and 3,6-anhydro-galactose C-O groups with glycerol and europium picrate. The DSC analyses revealed no glass transition temperature of the samples in the -60 to 250 Degree-Sign C range. From the thermogravimetry (TG), a thermal stability of the samples of up to 180 Degree-Sign C was stated. The membranes were subjected to ionic conductivity measurement, which provided the values of 2.6 Multiplication-Sign 10{sup -6} S/cm for the samples with acetic acid and 1.6 Multiplication-Sign 10{sup -5} S/cm for the samples without acetic acid. Moreover, the temperature-dependent ionic conductivity measurements revealed both Arrhenius and VTF models of the conductivity depending on the sample. Surface visualization through scanning electron microscopy (SEM) demonstrated good uniformity. The samples were also applied in small electrochromic devices and showed good electrochemical stability. The present work confirmed that these materials may perform as satisfactory multifunctional component layers in the field of electrochemical devices.

  18. Spectroscopic investigation on europium doped heavy metal borate glasses for red luminescent application

    Energy Technology Data Exchange (ETDEWEB)

    Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)


    The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)

  19. Europium nanoparticle-based high performing immunoassay for the screening of treponemal antibodies.

    Directory of Open Access Journals (Sweden)

    Sheikh M Talha

    Full Text Available Treponema pallidum subspecies pallidum (Tp is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co ratios obtained with the two immunoassays (p=0.06. Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood

  20. Visible-light-excited and europium-emissive nanoparticles for highly-luminescent bioimaging in vivo. (United States)

    Wu, Yongquan; Shi, Mei; Zhao, Lingzhi; Feng, Wei; Li, Fuyou; Huang, Chunhui


    Europium(III)-based material showing special milliseconds photoluminescence lifetime has been considered as an ideal time-gated luminescence probe for bioimaging, but is still limited in application in luminescent small-animal bioimaging in vivo. Here, a water-soluble, stable, highly-luminescent nanosystem, Ir-Eu-MSN (MSN = mesoporous silica nanoparticles, Ir-Eu = [Ir(dfppy)2(pic-OH)]3Eu·2H2O, dfppy = 2-(2,4-difluorophenyl)pyridine, pic-OH = 3-hydroxy-2-carboxypyridine), was developed by an in situ coordination reaction to form an insoluble dinuclear iridium(III) complex-sensitized-europium(III) emissive complex within mesoporous silica nanoparticles (MSNs) which had high loading efficiency. Compared with the usual approach of physical adsorption, this in-situ reaction strategy provided 20-fold the loading efficiency (43.2%) of the insoluble Ir-Eu complex in MSNs. These nanoparticles in solid state showed bright red luminescence with high quantum yield of 55.2%, and the excitation window extended up to 470 nm. These Ir-Eu-MSN nanoparticles were used for luminescence imaging in living cells under excitation at 458 nm with confocal microscopy, which was confirmed by flow cytometry. Furthermore, the Ir-Eu-MSN nanoparticles were successfully applied into high-contrast luminescent lymphatic imaging in vivo under low power density excitation of 5 mW cm(-2). This synthetic method provides a universal strategy of combining hydrophobic complexes with hydrophilic MSNs for in vivo bioimaging. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Europium Nanoparticle-Based High Performing Immunoassay for the Screening of Treponemal Antibodies (United States)

    Talha, Sheikh M.; Hytönen, Jukka; Westhorpe, Adam; Kumar, Sushil; Khanna, Navin; Pettersson, Kim


    Treponema pallidum subspecies pallidum (Tp) is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF) immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co) ratios obtained with the two immunoassays (p = 0.06). Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood-bank settings as a

  2. Semiconducting polymer encapsulated mesoporous silica particles with conjugated Europium complexes: toward enhanced luminescence under aqueous conditions. (United States)

    Zhang, Jixi; Prabhakar, Neeraj; Näreoja, Tuomas; Rosenholm, Jessica M


    Immobilization of lanthanide organic complexes in meso-organized hybrid materials for luminescence applications have attracted immense interest due to the possibility of controlled segregation at the nanoscopic level for novel optical properties. Aimed at enhancing the luminescence intensity and stability of the hybrid materials in aqueous media, we developed polyvinylpyrrolidone (PVP) stabilized, semiconducting polymer (poly(9-vinylcarbazole), PVK) encapsulated mesoporous silica hybrid particles grafted with Europium(III) complexes. Monosilylated β-diketonate ligands (1-(2-naphthoyl)-3,3,3-trifluoroacetonate, NTA) were first co-condensed in the mesoporous silica particles as pendent groups for bridging and anchoring the lanthanide complexes, resulting in particles with an mean diameter of ∼ 450 nm and a bimodal pore size distribution centered at 3.5 and 5.3 nm. PVK was encapsulated on the resulted particles by a solvent-induced surface precipitation process, in order to seal the mesopores and protect Europium ions from luminescence quenching by producing a hydrophobic environment. The obtained polymer encapsulated MSN-EuLC@PVK-PVP particles exhibit significantly higher intrinsic quantum yield (Φ(Ln) = 39%) and longer lifetime (τ(obs) = 0.51 ms), as compared with those without polymer encapsulation. Most importantly, a high luminescence stability was realized when MSN-EuLC@PVK-PVP particles were dispersed in various aqueous media, showing no noticeable quenching effect. The beneficial features and positive attributes of both mesoporous silica and semiconducting polymers as lanthanide-complex host were merged in a single hybrid carrier, opening up the possibility of using these hybrid luminescent materials under complex aqueous conditions such as biological/physiological environments.

  3. Surface-imprinted nanofilaments for europium-amplified luminescent detection of fluoroquinolone antibiotics. (United States)

    Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C


    The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Faster Synthesis of Beta-Diketonate Ternary Europium Complexes: Elapsed Times & Reaction Yields. (United States)

    Lima, Nathalia B D; Silva, Anderson I S; Gerson, P C; Gonçalves, Simone M C; Simas, Alfredo M


    β-diketonates are customary bidentate ligands in highly luminescent ternary europium complexes, such as Eu(β-diketonate)3(L)2, where L stands for a nonionic ligand. Usually, the syntheses of these complexes start by adding, to an europium salt such as EuCl3(H2O)6, three equivalents of β-diketonate ligands to form the complexes Eu(β-diketonate)3(H2O)2. The nonionic ligands are subsequently added to form the target complexes Eu(β-diketonate)3(L)2. However, the Eu(β-diketonate)3(H2O)2 intermediates are frequently both difficult and slow to purify by recrystallization, a step which usually takes a long time, varying from days to several weeks, depending on the chosen β-diketonate. In this article, we advance a novel synthetic technique which does not use Eu(β-diketonate)3(H2O)2 as an intermediate. Instead, we start by adding 4 equivalents of a monodentate nonionic ligand L straight to EuCl3(H2O)6 to form a new intermediate: EuCl3(L)4(H2O)n, with n being either 3 or 4. The advantage is that these intermediates can now be easily, quickly, and efficiently purified. The β-diketonates are then carefully added to this intermediate to form the target complexes Eu(β-diketonate)3(L)2. For the cases studied, the 20-day average elapsed time reduced to 10 days for the faster synthesis, together with an improvement in the overall yield from 42% to 69%.

  5. Modified magnetic and optical properties of manganese nanoparticles incorporated europium doped magnesium borotellurite glass

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, Siti Maisarah; Sahar, M.R., E-mail:; Ghoshal, S.K.


    This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)

  6. Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yu, E-mail: [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Wang, Yafei [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Li, Chun [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China); Huang, Ying; Dang, Dongfeng; Zhu, Meixiang [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Zhu, Weiguo, E-mail: [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Cao, Yong, E-mail: [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China)


    A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM){sub 3}(BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM){sub 3}(BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu{sup 3+} ion emission, based on the {sup 5}D{sub 0} → {sup 7}F{sub 2} transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE{sub ext}) of 1.26% at current density of 1.65 mA cm{sup −2}, with a maximum brightness of 568 cd m{sup −2} at 137.8 mA cm{sup −2} was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM){sub 3}(BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM){sub 3}(BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices.

  7. Electron paramagnetic resonance and photoluminescence investigation of europium local structure in oxyfluoride glass ceramics containing SrF2 nanocrystals (United States)

    Antuzevics, A.; Kemere, M.; Krieke, G.; Ignatans, R.


    Different compositions of europium doped aluminosilicate oxyfluoride glass ceramics prepared in air atmosphere have been studied by electron paramagnetic resonance (EPR) and optical spectroscopy methods. X-ray diffraction (XRD) and transmission electron microscopy (TEM) measurements show presence of homogenously distributed SrF2 nanocrystals after the heat treatment of the precursor glass. Efficient Eu3+ incorporation in the high symmetry environment of glass ceramics is observed from the photoluminescence spectra. EPR spectra indicate Eu3+ → Eu2+ reduction upon precipitation of crystalline phases in the glass matrix. For composition abundant with Eu2+ in the glassy state such behaviour is not detected. Local structure around europium ions is discussed based on differences in chemical compositions.

  8. Bright, highly water-soluble triazacyclononane europium complexes to detect ligand binding with time-resolved FRET microscopy. (United States)

    Delbianco, Martina; Sadovnikova, Victoria; Bourrier, Emmanuel; Mathis, Gérard; Lamarque, Laurent; Zwier, Jurriaan M; Parker, David


    Luminescent europium complexes are used in a broad range of applications as a result of their particular emissive properties. The synthesis and application of bright, highly water-soluble, and negatively charged sulfonic- or carboxylic acid derivatives of para-substituted aryl-alkynyl triazacyclononane complexes are described. Introduction of the charged solubilizing moieties suppresses cellular uptake or adsorption to living cells making them applicable for labeling and performing assays on membrane receptors. These europium complexes are applied to monitor fluorescent ligand binding on cell-surface proteins with time-resolved Förster resonance energy transfer (TR-FRET) assays in plate-based format and using TR-FRET microscopy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Optical and spectral studies on pure and europium doped olgite type Na(Sr,Ba)PO4 ceramics. (United States)

    Jawaher, K Rackesh; Jagannathan, R; Das, S Jerome; Krishnan, S


    Europium ion doped olgite type Na(Sr,Ba)PO4 ceramics, a new generation of light emitting bulb, was prepared by a high temperature solid-state reaction method. The synthesized materials were subjected to various characterizations such as X-ray powder diffraction, Scanning electron microscopy and FT-IR spectra measurements. The EPR spectrum of the sample exhibits a well-resolved hyperfine structure of 151Eu2+ and 153Eu2+ isotopes and the g value has been calculated. Fluorescence spectra revealed that europium ions were present in divalent as well as in the trivalent oxidation states. The critical distance for energy transfer between Eu2+ and Eu2+ ion is calculated as 20Å, which is in good agreement with that of experimental data. The FTIR analysis reveals all the vibrations of PO4(3-) ions. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. A highly sensitive europium nanoparticle-based immunoassay for detection of influenza A/B virus antigen in clinical specimens. (United States)

    Zhang, Panhe; Vemula, Sai Vikram; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L; Hewlett, Indira


    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  11. Semiconducting polymer dots doped with europium complexes showing ultranarrow emission and long luminescence lifetime for time-gated cellular imaging. (United States)

    Sun, Wei; Yu, Jiangbo; Deng, Ruiping; Rong, Yu; Fujimoto, Bryant; Wu, Changfeng; Zhang, Hongjie; Chiu, Daniel T


    Bright dots: Semiconducting polymer dots (Pdots) doped with europium complexes possess line-like fluorescence emission, high quantum yield, and long fluorescence lifetime. The Pdots successfully labeled receptors on cells. The long fluorescence lifetime of the Pdots was used to distinguish them from other red fluorescence emitting nanoparticles, and improve the signal-to-noise ratio for time-gated cellular imaging. PVK=poly(9-vinylcarbazole). Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Translocation and biokinetic behavior of nanoscaled europium oxide particles within 5 days following an acute inhalation in rats. (United States)

    Creutzenberg, Otto; Kock, Heiko; Schaudien, Dirk


    Nanoscaled europium oxide (Eu2O3) particles were inhaled by rats after acute exposure and the potential translocation of particles followed by chemical analysis and transmission electron microscopy (TEM) was investigated. An aqueous dispersion (phosphate buffer/bovine serum albumin) of a commercially available Eu2O3 particle fraction consisting partially of nanoscaled particles was aerosolized with pressurized air. After rapid evaporation, rats inhaled the dry aerosol for 6 h in a single exposure resulting in an alveolar calculated dose of approximately 39.5 μg Eu2O3. Using chemical analysis, 36.8 μg Eu2O3 was detected 1 h after lung inhalation. The amount declined slightly to 34.5 μg after 1 day and 35.0 μg after 5 days. The liver showed an increase of Eu2O3 from 32.3 ng 1 h up to 294 ng 5 days after inhalation. Additionally, lung-associated lymph nodes, thymus, kidneys, heart and testis exhibited an increase of europium over the period investigated. In the blood, the highest amount of europium was found 1 h after treatment whereas feces, urine and mesenteric lymph nodes revealed the highest amount 1 day after treatment. Using TEM analysis, particles could be detected only in lungs, and in the liver, no particles were detectable. In conclusion, the translocation of Eu2O3 within 5 days following inhalation could be determined very precisely by chemical analysis. A translocation of Eu2O3 particulate matter to liver was not detectable by TEM analysis; thus, the overproportional level of 0.8% of the lung load observed in the liver after 5 days suggests a filtering effect of dissolved europium with accumulation. Copyright © 2015 John Wiley & Sons, Ltd.

  13. A Highly Sensitive Europium Nanoparticle-Based Immunoassay for Detection of Influenza A/B Virus Antigen in Clinical Specimens (United States)

    Zhang, Panhe; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L.


    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. PMID:25297327

  14. Nature of the concentration thresholds of europium atom yield from the oxidized tungsten surface under electron stimulated desorption

    CERN Document Server

    Davydov, S Y


    The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level

  15. Ultrasmall Superparamagnetic Iron Oxide Nanoparticles with Europium(III) DO3A as a Bimodal Imaging Probe. (United States)

    Carron, Sophie; Bloemen, Maarten; Vander Elst, Luce; Laurent, Sophie; Verbiest, Thierry; Parac-Vogt, Tatjana N


    A new prototype consisting of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles decorated with europium(III) ions encapsulated in a DO3A organic scaffold was designed as a platform for further development of bimodal contrast agents for MRI and optical imaging. The USPIO nanoparticles act as negative MRI contrast agents, whereas the europium(III) ion is a luminophore that is suitable for use in optical imaging detection. The functionalized USPIO nanoparticles were characterized by TEM, DLS, XRD, FTIR, and TXRF analysis, and a full investigation of the relaxometric and optical properties was conducted. The typical luminescence emission of europium(III) was observed and the main red emission wavelength was found at 614 nm. The relaxometric study of these ultrasmall nanoparticles showed r2 values of 114.8 mM(-1) Fes(-1) at 60 MHz, which is nearly double the r2 relaxivity of Sinerem(®). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A lysosome targetable luminescent bioprobe based on a europium β-diketonate complex for cellular imaging applications. (United States)

    George, T M; Krishna, Mahesh S; Reddy, M L P


    Herein, we report a novel lysosome targetable luminescent bioprobe derived from a europium coordination compound, namely Eu(pfphOCH3IN)3(DDXPO) 4 [where HpfphOCH3IN = 4,4,5,5,5-pentafluoro-3-hydroxy-1-(1-(4-methoxyphenyl)-1H-indol-3-yl)pent-2-en-1-one and DDXPO = 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene oxide]. Notably, the newly designed europium complex exhibits significant quantum yield (Φoverall = 25 ± 3%) and 5D0 excited state lifetime (τ = 398 ± 3 μs) values under physiological pH (7.2) conditions when excited at 405 nm. Hence the developed europium complex has been evaluated for live cell imaging applications using mouse pre-adipocyte cell lines (3T3L1). Colocalization studies of the designed bio-probe with commercial Lysosome-GFP in 3T3L1 cells demonstrated the specific localization of the probe in the lysosome with a high colocalization coefficient (A = 0.83). Most importantly, the developed bioprobe exhibits good cell permeability, photostability and non-cytotoxicity.

  17. Mössbauer spectroscopy of europium-doped fluorochlorozirconate glasses and glass ceramics: optimization of storage phosphors in computed radiography. (United States)

    Pfau, C; Paßlick, C; Gray, S K; Johnson, J A; Johnson, C E; Schweizer, S


    Eu(2+)-doped fluorochlorozirconate (FCZ) glasses and glass ceramics, which are being developed for medical and photovoltaic applications, have been analysed by Mössbauer spectroscopy. The oxidation state and chemical environment of the europium ions, which are important for the performance of these materials, were investigated. Routes for maximizing the divalent europium content were also investigated. By using EuCl2 instead of EuF2 in the starting material a fraction of about 90% of the europium was maintained in the Eu(2+) state as opposed to about 70% when using EuF2. The glass ceramics produced by subsequent thermal processing contain BaCl2 nanocrystals in which Eu(2+) is incorporated, as shown by the narrower linewidth in the Mössbauer spectrum. Debye temperatures of 147 K and 186 K for Eu(2+) and Eu(3+), respectively, were determined from temperature dependent Mössbauer measurements. The f-factors were used to obtain the Eu(2+)/Eu(3+) ratio from the area ratio of the corresponding absorption lines.

  18. 26 CFR 1.167(c)-1 - Limitations on methods of computing depreciation under section 167(b) (2), (3), and (4). (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Limitations on methods of computing depreciation... Deductions for Individuals and Corporations § 1.167(c)-1 Limitations on methods of computing depreciation... other basis of such construction or erection qualifies for these methods of depreciation. In the case of...

  19. Transactivation of proto-oncogene c-Myc by hepatitis B virus transactivator MHBst167. (United States)

    Lun, Yong-Zhi; Cheng, Jun; Chi, Qing; Wang, Xue-Lei; Gao, Meng; Sun, Li-DA


    C-terminally truncated hepatitis B virus (HBV) middle size surface proteins (MHBst) has been shown to be a transcriptional activator and may be relevant to hepatocarcinogenesis by transactivating gene expression. In the present study, a pcDNA3.1(-)-MHBst167 vector coding for MHBst truncated at amino acid 167 (MHBst167) was constructed and transfected into the HepG2 hepatoma cell line. mRNA and protein expression of MHBst167 in the cells was detected by reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. A cDNA library of genes transactivated by the truncated protein in HepG2 cells was made in pGEM-T Easy using suppression subtractive hybridization. The cDNAs were sequenced and analyzed with BLAST searching against the sequences in GenBank. The results showed that certain sequences, such as that of human proto-oncogene c-Myc, may be involved in tumor development. An expression vector pCAT3/c-Myc containing the chloramphenicol acetyltransferase (CAT) gene under the control of a c-Myc promoter was generated, and the transcriptional transactivating effect of MHBst167 on the c-Myc promoter was investigated by RT-PCR and western blotting. MHBst167 was found to upregulate the transcriptional activity of the promoter, as well as transcription and translation of c-Myc. MHBst167 was also shown to transactivate SV40 immediate early promoter, and transcriptionally transactivate the expression of human c-Myc. These findings provide new directions for studying the biological functions of MHBst167, and for a better understanding of the tumor development mechanisms of HBV infection.

  20. 33 CFR 167.500 - In the approaches to Los Angeles-Long Beach Traffic Separation Scheme: General. (United States)


    ...-Long Beach Traffic Separation Scheme: General. 167.500 Section 167.500 Navigation and Navigable Waters... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.500 In the approaches to Los Angeles-Long Beach Traffic Separation Scheme: General. The Traffic...

  1. File list: NoD.CeL.10.AllAg.Kc167 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.CeL.10.AllAg.Kc167 dm3 No description Cell line Kc167 ERX402111,ERX402119,ERX40...RX402127,ERX402115,ERX402103,ERX402109 ...

  2. File list: NoD.CeL.50.AllAg.Kc167 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.CeL.50.AllAg.Kc167 dm3 No description Cell line Kc167 ERX402141,ERX402101,ERX40...RX402123,ERX402115,ERX402104,ERX402109 ...

  3. Fast and Selective Preconcentration of Europium from Wastewater and Coal Soil by Graphene Oxide/Silane@Fe3O4 Dendritic Nanostructure. (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K


    In this study, nanocomposite of graphene oxide and silane modified magnetic nanoparticles (silane@Fe3O4) were synthesized in a form of dendritic structure. For this, silane@Fe3O4 nanoparticle gets sandwiched between two layers of graphene oxide by chemical synthesis route. The synthesized dendritic structure was used as a monomer for synthesis of europium ion imprinted polymer. The synthesis of imprinted polymer was contemplated onto the surface of the vinyl group modified silica fiber by activated generated free radical atom-transfer radical polymerization, that is, AGET-ATRP technique. The synthesized dendritic monomer was characterized by XRD, FT-IR, VSM, FE-SEM, and TEM analyses. The imprinted polymer modified silica fiber was first validated in the aqueous and blood samples for successful extraction and detection of europium ion with limit of detection = 0.050 pg mL(-1) (signal/noise = 3). The imprinted polymer modified silica fiber was also used for preconcentration and separation of europium metal ion from various soil samples of coal mine areas. However, the same silica fiber was also used for wastewater treatment and shows 100% performance for europium removal. The findings herein suggested that dendritic nanocomposite could be potentially used as a highly effective material for the enrichment and preconcentration of europium or other trivalent lanthanides/actinides in nuclear waste management.

  4. Development of europium doped core-shell silica cobalt ferrite functionalized nanoparticles for magnetic resonance imaging. (United States)

    Kevadiya, Bhavesh D; Bade, Aditya N; Woldstad, Christopher; Edagwa, Benson J; McMillan, JoEllyn M; Sajja, Balasrinivasa R; Boska, Michael D; Gendelman, Howard E


    The size, shape and chemical composition of europium (Eu3+) cobalt ferrite (CFEu) nanoparticles were optimized for use as a "multimodal imaging nanoprobe" for combined fluorescence and magnetic resonance bioimaging. Doping Eu3+ ions into a CF structure imparts unique bioimaging and magnetic properties to the nanostructure that can be used for real-time screening of targeted nanoformulations for tissue biodistribution assessment. The CFEu nanoparticles (size ∼7.2nm) were prepared by solvothermal techniques and encapsulated into poloxamer 407-coated mesoporous silica (Si-P407) to form superparamagnetic monodisperse Si-CFEu nanoparticles with a size of ∼140nm. Folic acid (FA) nanoparticle decoration (FA-Si-CFEu, size ∼140nm) facilitated monocyte-derived macrophage (MDM) targeting. FA-Si-CFEu MDM uptake and retention was higher than seen with Si-CFEu nanoparticles. The transverse relaxivity of both Si-CFEu and FA-Si-CFEu particles were r2=433.42mM-1s-1 and r2=419.52mM-1s-1 (in saline) and r2=736.57mM-1s-1 and r2=814.41mM-1s-1 (in MDM), respectively. The results were greater than a log order-of-magnitude than what was observed at replicate iron concentrations for ultrasmall superparamagnetic iron oxide (USPIO) particles (r2=31.15mM-1s-1 in saline) and paralleled data sets obtained for T2 magnetic resonance imaging. We now provide a developmental opportunity to employ these novel particles for theranostic drug distribution and efficacy evaluations. A novel europium (Eu3+) doped cobalt ferrite (Si-CFEu) nanoparticle was produced for use as a bioimaging probe. Its notable multifunctional, fluorescence and imaging properties, allows rapid screening of future drug biodistribution. Decoration of the Si-CFEu particles with folic acid increased its sensitivity and specificity for magnetic resonance imaging over a more conventional ultrasmall superparamagnetic iron oxide particles. The future use of these particles in theranostic tests will serve as a platform for

  5. Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal, A., E-mail: [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)


    Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.

  6. Endothelin-1 stimulates catalase activity through the PKCδ mediated phosphorylation of Serine 167 (United States)

    Rafikov, Ruslan; Kumar, Sanjiv; Aggarwal, Saurabh; Hou, Yali; Kangath, Archana; Pardo, Daniel; Fineman, Jeffrey R.; Black, Stephen M.


    Our previous studies have shown that endothelin-1 (ET-1) stimulates catalase activity in endothelial cells and lambs with acute increases in pulmonary blood flow (PBF), without altering gene expression. The purpose of this study was to investigate the molecular mechanism by which this occurs. Exposing pulmonary arterial endothelial cells (PAEC) to ET-1 increased catalase activity and decreased cellular hydrogen peroxide (H2O2) levels. These changes correlated with an increase in serine phosphorylated catalase. Using the inhibitory peptide δV1.1, this phosphorylation was shown to be PKCδ dependent. Mass spectrometry identified serine167 as the phosphorylation site. Site-directed mutagenesis was used to generate a phospho-mimic (S167D) catalase. Activity assays using recombinant protein purified from E.coli or transiently transfected COS-7 cells, demonstrated that S167D-catalase had an increased ability to degrade H2O2 compared to the wildtype enzyme. Using a phospho-specific antibody, we were able to verify that pS167 catalase levels are modulated in lambs with acute increases in PBF in the presence and absence of the ET receptor antagonist, tezosentan. S167 is being located on the dimeric interface suggesting it could be involved in regulating the formation of catalase tetramers. To evaluate this possibility we utilized analytical gel-filtration to examine the multimeric structure of recombinant wildtype- and S167D-catalase. We found that recombinant wildtype catalase was present as a mixture of monomers and dimers while S167D catalase was primarily tetrameric. Further, the incubation of wildtype catalase with PKCδ was sufficient to convert wildtype catalase into a tetrameric structure. In conclusion, this is the first report indicating that the phosphorylation of catalase regulates its multimeric structure and activity. PMID:24211614

  7. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  8. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates (United States)

    Bicho, Rita C.; Soares, Amadeu M. V. M.; Nogueira, Helena I. S.; Amorim, Mónica J. B.


    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of "no effect" are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  9. Spectral Interferences Manganese (Mn) - Europium (Eu) Lines in X-Ray Fluorescence Spectrometry Spectrum (United States)

    Tanc, Beril; Kaya, Mustafa; Gumus, Lokman; Kumral, Mustafa


    X-ray fluorescence (XRF) spectrometry is widely used for quantitative and semi quantitative analysis of many major, minor and trace elements in geological samples. Some advantages of the XRF method are; non-destructive sample preparation, applicability for powder, solid, paste and liquid samples and simple spectrum that are independent from chemical state. On the other hand, there are some disadvantages of the XRF methods such as poor sensitivity for low atomic number elements, matrix effect (physical matrix effects, such as fine versus course grain materials, may impact XRF performance) and interference effect (the spectral lines of elements may overlap distorting results for one or more elements). Especially, spectral interferences are very significant factors for accurate results. In this study, semi-quantitative analyzed manganese (II) oxide (MnO, 99.99%) was examined. Samples were pelleted and analyzed with XRF spectrometry (Bruker S8 Tiger). Unexpected peaks were obtained at the side of the major Mn peaks. Although sample does not contain Eu element, in results 0,3% Eu2O3 was observed. These result can occur high concentration of MnO and proximity of Mn and Eu lines. It can be eliminated by using correction equation or Mn concentration can confirm with other methods (such as Atomic absorption spectroscopy). Keywords: Spectral Interferences; Manganese (Mn); Europium (Eu); X-Ray Fluorescence Spectrometry Spectrum.

  10. Performance of fluorescent europium(III) nanoparticles and colloidal gold reporters in lateral flow bioaffinity assay. (United States)

    Juntunen, Etvi; Myyryläinen, Tiina; Salminen, Teppo; Soukka, Tero; Pettersson, Kim


    Lateral flow (LF) immunoassays (i.e., immunochromatographic assays) have traditionally been applied to analytes that do not require very high analytical sensitivity or quantitative results. The selection of potential analytes is often limited by the performance characteristics of the assay technology. Analytes with more demanding sensitivity requirements call for reporter systems enabling high analytical sensitivity. In this study, we systematically compared the performance of fluorescent europium(III) [Eu(III)] chelate dyed polystyrene nanoparticles and colloidal gold particles in lateral flow assays. The effect of time-resolved measurement mode was also studied. Because binder molecules used in immunoassays might not behave similarly when conjugated to different reporter particles, two model assays were constructed to provide reliable technical comparison of the two reporter systems. The comparative experiment demonstrated that the fluorescent nanoparticles yielded 7- and 300-fold better sensitivity compared with colloidal gold in the two test systems, respectively. Although the two reporter particles may induce variable effects using individual binders, overall the high specific activity of Eu(III) nanoparticles has superior potential over colloidal gold particles for the development of robust high-sensitivity bioaffinity assays. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Carbon nanotube-loaded Nafion film electrochemical sensor for metal ions: europium. (United States)

    Wang, Tingting; Zhao, Daoli; Guo, Xuefei; Correa, Jaime; Riehl, Bill L; Heineman, William R


    A Nafion film loaded with novel catalyst-free multiwalled carbon nanotubes (MWCNTs) was used to modify a glassy carbon (GC) electrode to detect trace concentrations of metal ions, with europium ion (Eu(3+)) as a model. The interaction between the sidewalls of MWCNTs and the hydrophobic backbone of Nafion allows the MWCNTs to be dispersed in Nafion, which was then coated as a thin film on the GC electrode surface. The electrochemical response to Eu(3+) was found to be ∼10 times improved by MWCNT concentrations between 0.5 and 2 mg/mL, which effectively expanded the electrode surface into the Nafion film and thereby reduced the diffusion distance of Eu(3+) to the electrode surface. At low MWCNT concentrations of 0.25 and 0.5 mg/mL, no significant improvement in signal was obtained compared with Nafion alone. Scanning electron microscopy and electrochemical impedance spectroscopy were used to characterize the structure of the MWCNT-Nafion film, followed by electrochemical characterization with Eu(3+) via cyclic voltammetry and preconcentration voltammetry. Under the optimized conditions, a linear range of 1-100 nM with a calculated detection limit of 0.37 nM (signal/noise = 3) was obtained for determination of Eu(3+) by Osteryoung square-wave voltammetry after a preconcentration time of 480 s.

  12. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Energy Technology Data Exchange (ETDEWEB)

    Bicho, Rita C., E-mail:; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)


    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.


    Directory of Open Access Journals (Sweden)

    R. O. Pysh'ev


    Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.

  14. Nanoparticles in the zirconia-europium niobate system via hydrothermal route. (United States)

    Hirano, Masanori; Dozono, Hayato


    The effect of the composition on the hydrothermal formation, structure, and properties of nanocrystalline luminescent materials in the zirconia (ZrO2)-europium niobate 1/4(Eu3NbO7) system was investigated. In the composition range 40 particles with crystallite size 6.0-7.6 nm that were hydrothermally formed from the precursor solutions of NbCl5, ZrOCI2, and EuCl3 under weakly basic conditions at 240 degrees C showed cubic structure. The lattice parameter when estimated as a single cubic phase linearly decreased as the concentration of ZrO2 increased. The presence of zirconia component effectively promoted the formation of nanocrystals containing the niobate, Eu3NbO7 under hydrothermal condition. The nanocrystalline particles could be excited by ultraviolet light 395 nm (f-f transition) and emitted orange (590 nm) and red light (610 nm) corresponding to 5D0 --> 7F1 and 5D0 --> 7F2 transitions of Eu3+, respectively. The intensity of the electric dipole transition (5D0 --> 7F2) that was expressed in values relative to the magnetic dipole transition (5D0 --> 7F1) increased with increased heat-treatment temperature in the range from 950 to 1200 degrees C.

  15. Photoluminescence of monocrystalline and stain-etched porous silicon doped with high temperature annealed europium

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Lemus, R; Montesdeoca-Santana, A; Gonzalez-Diaz, B; Diaz-Herrera, B; Hernandez-Rodriguez, C; Jimenez-Rodriguez, E [Departamento de Fisica Basica, Universidad de La Laguna (ULL), Avenida AstrofIsico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain); Velazquez, J J, E-mail: [Departamento de Fisica Fundamental y Experimental, Electronica y Sistemas, Universidad de La Laguna (ULL), Avenida Astrofisico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain)


    In this work, for the first time, the photoluminescent emission and excitation spectra of non-textured layers and stain-etched porous silicon layers (PSLs) doped with high temperature annealed europium (Eu) are evaluated. The PSLs are evaluated as a host for rare earth ions and as an antireflection coating. The applied doping process, which consists in a simple impregnation method followed by a high-temperature annealing step, is compatible with the standard processes in the fabrication of solar cells. The results show down-shifting processes with a maximum photoluminescent intensity at 615 nm, related to the transition {sup 5}D{sub 0} {yields} {sup 7}F{sub 2}. Different initial concentrations of Eu(NO{sub 3}){sub 3} are evaluated to study the influence of the rare earth concentration on the photoluminescent intensity. The chemical composition and the morphology of Eu-doped PSLs are examined by means of x-ray dispersion spectroscopy, Fourier-transform infrared spectroscopy and scanning electron microscopy. These Eu-doped layers are considered to be applied as energy converters in silicon-based third generation solar cells.

  16. Europium (III) and Uranium (VI) complexation by natural organic matter (NOM): Effect of source. (United States)

    Kautenburger, Ralf; Sander, Jonas M; Hein, Christina


    For the safe long-term storage of high-level radioactive waste (HLW), detailed information about geo-chemical behavior of radioactive and toxic metal ions under environmental conditions is important. Natural organic matter (NOM) can play a crucial role in the immobilization or mobilization of these metal ions due to its complexation and colloid formation tendency. In this study, the complexation of europium (as chemical homologue of trivalent actinides such as americium) and uranium (as main component of HLW) by ten humic acids (HA) from different sources and Suwannee NOM river extract has been analyzed. Capillary electrophoresis in combination with inductively coupled plasma mass spectrometry has been used for the evaluation of complex stability constants log β. In order to determine the complex stability constants a conservative single site model was used in this study. In dependence of their source and thus of NOM structure the log β values for the analyzed humic acids are in the range of 6.1-7.0 for Eu(III) and 5.2-6.4 for U(VI) (UO 2 2+ ), respectively. In contrast to the results for HA the used Suwannee river NOM reveals log β values in the range of nearly two orders of magnitude lower (4.6 for Eu 3+ and 4.5 for UO 2 2+ ) under the geochemical conditions applied in this study. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Europium incorporated into titanium oxide by the sol-gel method

    Directory of Open Access Journals (Sweden)

    Lucas Alonso Rocha


    Full Text Available In this work titanium sol was prepared from tetraethylorthotitanate (TEOT in ethanol, stabilized with beta-diketonate 2,4 pentanedione in molar ratio 1:1 homogenized by magnetic stirring, europium ion was add as structural probe. The xerogels were heat treated at 500, 750 and 1000 °C and the characterization was realized by x-ray diffraction (XRD, transmission electron microscopy (TEM, thermogravimetric analysis (TGA/DSC and photoluminescence (PL. The excitation spectra of Eu (III ion present maximum in 394 nm correspondent to 5L6 level and emission spectra present bands characteristic transitions arising from the 5 D0 -> 7F J (J = 0, 1, 2, 3, 4 manifolds to samples treat at 500 and 750 °C. The Eu (III emission disappear, when heated at 1000 °C, probably due to phase transition anatase to rutile and migrations of ions to the external surface that was proved by x-ray diffraction, transmission electronic microscopy and the thermogravimetric analyses of xerogels.

  18. Luminescence studies on the europium doped strontium metasilicate phosphor prepared by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available Europium doped strontium meta-silicate (namely SrSiO3:Eu3+ phosphor was prepared by a high temperature solid state reaction method. The sintered SrSiO3:Eu3+ phosphor possesses a monoclinic structure by the XRD. Energy dispersive X-ray spectrum (EDS confirms the presence of elements in the desired sample. Thermoluminescence (TL kinetic parameters such as activation energy (E, order of kinetics (b, and frequency factor (s were calculated by the peak shape method. The orange–red emission was shown to originate from the 5D0–7FJ (J = 0, 1, 2, 3, 4 transitions of Eu3+ ions as the sample was excited at 396 nm. The SrSiO3:Eu3+ phosphor with almost pure orange-red color purity (99.62% shows the quantum efficiency of 10.2% (excited by 396 nm, which is higher than those of commercial red phosphors Y2O3:Eu3+ and Y2O2S:Eu3+ with quantum efficiencies of 9.6% (excited by 394 nm and 4.2% (excited by 395 nm, respectively. Mechanoluminescence (ML intensity of the SrSiO3:Eu3+ phosphor was also found to increase linearly with increasing the impact velocity of the moving piston, suggesting that the discussed phosphor can be used as a stress sensor.

  19. Europium Luminescence Used for Logic Gate and Ions Sensing with Enoxacin As the Antenna. (United States)

    Lu, Lixia; Chen, Chuanxia; Zhao, Dan; Sun, Jian; Yang, Xiurong


    Luminescent lanthanide ion complexes have received increasing attention because of their unique optical properties. Herein, we discovered that the luminescence of europium(III) (Eu(3+)) could be regulated by Ag(+) and SCN(-) in seconds with enoxacin (ENX) as the antenna. Under given conditions, only the simultaneous introduction of Ag(+) and SCN(-) could remarkably enhance the luminescence intensity of Eu(3+)-ENX complexes. This phenomenon has been exploited to design an "AND" logic gate and specific luminescence turn-on assays for sensitively sensing Ag(+) and SCN(-) for the first time. Furthermore, the addition of S(2-) resulted in efficient luminescence quenching of the Eu(3+)/ENX/Ag(+)/SCN(-) system due to the strong affinity between Ag(+) and S(2-). Thus, a new luminescent sensing platform for S(2-) was established, which exhibited excellent selectivity and high sensitivity. S(2-) could be detected within the concentration range of 100 nM to 12.5 μM with a detection limit of 60 nM. Such sensing system features simplicity, rapidity, and flexibility. Moreover, this proposed Eu(3+)-based luminescent assay could be successfully applied in the real environmental water sample analysis.

  20. Radiation effects on beta 10.6 of pure and europium doped KCl (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.


    Changes in the optical absorption coefficient as a result of X-ray and electron bombardment of pure KCl (monocrystalline and polycrystalline), and divalent europium doped polycrystalline KCl were determined. The optical absorption coefficients were measured by a constant heat flow calorimetric method. Both 300 KV X-irradiation and 2 MeV electron irradiation produced significant increases in beta 10.6, measured at room temperature. The X-irradiation of pure moncrystalline KCl increased beta 10.6 by 0.005/cm for a 113 MR dose. For an equivalent dose, 2 MeV electrons were found less efficient in changing beta 10.6. However, electron irradiation of pure and Eu-doped polycrystalline KCl produced marked increases in adsorption. Beta increased to over 0.25/cm in Eu-doped material for a 30 x 10 to the 14th power electrons/sq cm dose, a factor of 20 increase over unirradiated material. Moreover, bleaching the electron irradiated doped KCl with 649 m light produced and additional factor of 1.5 increase. These findings will be discussed in light of known defect-center properties in KCl.

  1. Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods. (United States)

    Wei, Peng-Fei; Zhang, Li; Nethi, Susheel Kumar; Barui, Ayan Kumar; Lin, Jun; Zhou, Wei; Shen, Yi; Man, Na; Zhang, Yun-Jiao; Xu, Jing; Patra, Chitta Ranjan; Wen, Long-Ping


    Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. High-resolution Thermal Micro-imaging Using Europium Chelate Luminescent Coatings. (United States)

    Benseman, Timothy M; Hao, Yang; Vlasko-Vlasov, Vitalii K; Welp, Ulrich; Koshelev, Alexei E; Kwok, Wai-Kwong; Divan, Ralu; Keiser, Courtney; Watanabe, Chiharu; Kadowaki, Kazuo


    Micro-electronic devices often undergo significant self-heating when biased to their typical operating conditions. This paper describes a convenient optical micro-imaging technique which can be used to map and quantify such behavior. Europium thenoyltrifluoroacetonate (EuTFC) has a 612 nm luminescence line whose activation efficiency drops strongly with increasing temperature, due to T-dependent interactions between the Eu3+ ion and the organic chelating compound. This material may be readily coated on to a sample surface by thermal sublimation in vacuum. When the coating is excited with ultraviolet light (337 nm) an optical micro-image of the 612 nm luminescent response can be converted directly into a map of the sample surface temperature. This technique offers spatial resolution limited only by the microscope optics (about 1 micron) and time resolution limited by the speed of the camera employed. It offers the additional advantages of only requiring comparatively simple and non-specialized equipment, and giving a quantitative probe of sample temperature.

  3. In vivo synthesis of europium selenide nanoparticles and related cytotoxicity evaluation of human cells. (United States)

    Kim, Eun Bee; Seo, Ji Min; Kim, Gi Wook; Lee, Sang Yup; Park, Tae Jung


    Nanotechnology strives to combine new materials for development of noble nanoparticles. As the nanoparticles exhibit unique optical, electronic, and magnetic properties depending on their composition, developing safe, cost-effective and environmentally friendly technologies for the synthesis have become an important issue. In this study, in vivo synthesis of europium selenide (EuSe) nanoparticles was performed using recombinant Escherichia coli cells expressing heavy-metal binding proteins, phytochelatin synthase and metallothionein. The formation of EuSe nanoparticles was confirmed by using UV-vis spectroscopy, spectrofluorometry, X-ray diffraction, energy dispersive X-ray and transmission electron microscopy. The synthesized EuSe nanoparticles exhibited high fluorescence intensities as well as strong magnetic properties. Furthermore, anti-cancer effect of EuSe nanoparticles against cancer cell lines was investigated. This strategy for the biogenic synthesis of nanoparticles has a great potential as bioimaging tools and drug carrying agents in biomedical fields due to its simplicity and nontoxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  5. Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes. (United States)

    Taha, Mohamed; Khan, Imran; Coutinho, João A P


    With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Luminescent single-walled carbon nanotube-sensitized europium nanoprobes for cellular imaging (United States)

    Avti, Pramod K; Sitharaman, Balaji


    Lanthanoid-based optical probes with excitation wavelengths in the ultra-violet (UV) range (300–325 nm) have been widely developed as imaging probes. Efficient cellular imaging requires that lanthanoid optical probes be excited at visible wavelengths, to avoid UV damage to cells. The efficacy of europium-catalyzed single-walled carbon nanotubes (Eu-SWCNTs), as visible nanoprobes for cellular imaging, is reported in this study. Confocal fluorescence microscopy images of breast cancer cells (SK-BR-3 and MCF-7) and normal cells (NIH 3T3), treated with Eu-SWCNT at 0.2 μg/mL concentration, showed bright red luminescence after excitation at 365 nm and 458 nm wavelengths. Cell viability analysis showed no cytotoxic effects after the incubation of cells with Eu-SWCNTs at this concentration. Eu-SWCNT uptake is via the endocytosis mechanism. Labeling efficiency, defined as the percentage of incubated cells that uptake Eu-SWCNT, was 95%–100% for all cell types. The average cellular uptake concentration was 6.68 ng Eu per cell. Intracellular localization was further corroborated by transmission electron microscopy and Raman microscopy. The results indicate that Eu-SWCNT shows potential as a novel cellular imaging probe, wherein SWCNT sensitizes Eu3+ ions to allow excitation at visible wavelengths, and stable time-resolved red emission. The ability to functionalize biomolecules on the exterior surface of Eu-SWCNT makes it an excellent candidate for targeted cellular imaging. PMID:22619533

  7. Europium(III) DOTA-derivatives having ketone donor pendant arms display dramatically slower water exchange (United States)

    Green, Kayla N.; Viswanathan, Subha; Rojas-Quijano, Federico A.; Kovacs, Zoltan; Sherry, A. Dean


    A series of new 1,4,7,10-tetraazacyclododecane-derivatives having a combination of amide and ketone donor groups as side-arms were prepared and their complexes with europium(III) studied in detail by high resolution NMR spectroscopy. The chemical shift of the Eu3+-bound water resonance, the chemical exchange saturation transfer (CEST) characteristics of the complexes, and the bound water residence lifetimes (τm) were found to vary dramatically with the chemical structure of the side-arms. Substitution of ketone oxygen donor atoms for amide oxygen donor atoms resulted in an increase in residence water lifetimes (τm) and a decrease in chemical shift of the Eu3+-bound water molecule (Δω). These experimental results along with density functional theory (DFT) calculations demonstrate that introduction of weakly donating oxygen atoms in these complexes results in a much weaker ligand field, more positive charge on the Eu3+ ion and an increased water residence lifetime as expected for a dissociative mechanism. These results provide new insights into the design of paramagnetic CEST agents with even slower water exchange kinetics that will make them more efficient for in vivo imaging applications. PMID:21306137

  8. Urinary monitoring of exposure to yttrium, scandium, and europium in male Wistar rats. (United States)

    Kitamura, Yasuhiro; Usuda, Kan; Shimizu, Hiroyasu; Fujimoto, Keiichi; Kono, Rei; Fujita, Aiko; Kono, Koichi


    On the assumption that rare earth elements (REEs) are nontoxic, they are being utilized as replacements of toxic heavy metals in novel technological applications. However, REEs are not entirely innocuous, and their impact on health is still uncertain. In the past decade, our laboratory has studied the urinary excretion of REEs in male Wistar rats given chlorides of europium, scandium, and yttrium solutions by one-shot intraperitoneal injection or oral dose. The present paper describes three experiments for the suitability and appropriateness of a method to use urine for biological monitoring of exposure to these REEs. The concentrations of REEs were determined in cumulative urine samples taken at 0-24 h by inductively coupled plasma atomic emission spectroscopy, showing that the urinary excretion of REEs is <2 %. Rare earth elements form colloidal conjugates in the bloodstream, which make high REEs accumulation in the reticuloendothelial system and glomeruli and low urinary excretion. The high sensitivity of inductively coupled plasma-argon emission spectrometry analytical methods, with detection limits of <2 μg/L, makes urine a comprehensive assessment tool that reflects REE exposure. The analytical method and animal experimental model described in this study will be of great importance and encourage further discussion for future studies.

  9. Europium Luminescence: Electronic Densities and Superdelocalizabilities for a Unique Adjustment of Theoretical Intensity Parameters (United States)

    Dutra, José Diogo L.; Lima, Nathalia B. D.; Freire, Ricardo O.; Simas, Alfredo M.


    We advance the concept that the charge factors of the simple overlap model and the polarizabilities of Judd-Ofelt theory for the luminescence of europium complexes can be effectively and uniquely modeled by perturbation theory on the semiempirical electronic wave function of the complex. With only three adjustable constants, we introduce expressions that relate: (i) the charge factors to electronic densities, and (ii) the polarizabilities to superdelocalizabilities that we derived specifically for this purpose. The three constants are then adjusted iteratively until the calculated intensity parameters, corresponding to the 5D0→7F2 and 5D0→7F4 transitions, converge to the experimentally determined ones. This adjustment yields a single unique set of only three constants per complex and semiempirical model used. From these constants, we then define a binary outcome acceptance attribute for the adjustment, and show that when the adjustment is acceptable, the predicted geometry is, in average, closer to the experimental one. An important consequence is that the terms of the intensity parameters related to dynamic coupling and electric dipole mechanisms will be unique. Hence, the important energy transfer rates will also be unique, leading to a single predicted intensity parameter for the 5D0→7F6 transition.

  10. Structural and spectroscopic analyses of europium doped yttrium oxyfluoride powders prepared by combustion synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Rakov, Nikifor [PG-Ciência dos Materiais, Universidade Federal do Vale do São Francisco, 48902-300 Juazeiro, BA (Brazil); Guimarães, R. B.; Maciel, Glauco S. [Instituto de Física, Universidade Federal Fluminense, 24210-346 Niterói, RJ (Brazil); Lozano B, W. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    A facile widely spread technique employed to produce low-cost high-yield oxide powders, combustion synthesis, was used to prepare yttrium oxyfluoride crystalline ceramic powders. The structure of the powders was analyzed by X-ray powder diffraction and Rietveld refinement. Samples heat treated at 700 °C had a predominance of vernier orthorhombic Y{sub 6}O{sub 5}F{sub 8} phase, while samples heat treated at 800 °C crystallized in stoichiometric rhombohedral YOF phase. The samples were doped with luminescent europium trivalent ions (Eu{sup 3+}) in different concentrations (1–15 wt.%) and Judd-Ofelt theory was used to probe the distortion from the inversion symmetry of the local crystal field and the degree of covalency between the rare-earth ion and the surrounding ligands. The luminescence lifetime was measured and the luminescence quantum efficiency (LQE) was estimated. We observed that Eu{sup 3+}:Y{sub 6}O{sub 5}F{sub 8} samples presented higher LQE in spite of the larger local crystal field anisotropy found for Eu{sup 3+}:YOF samples.

  11. Synthesis, photophysics, electrochemistry, thermal stability and electroluminescent performances of a new europium complex with bis(β-diketone) ligand containing carbazole group. (United States)

    Liu, Jian; Liang, Quan-Bin; Wu, Hong-Bin


    We synthesized a new europium complex [Eu(ecbpd)3 (Phen)] with bis(β-diketone) ligand containing a carbazole group, in which ecbpd and Phen are dehydro-3,3'-(9-ethyl-9H-carbazole-3,6-diyl)bis(1-phenylpropane-1,3-dione) and 1,10-phenanthroline, respectively. Its UV/vis and photoluminescent spectra, quantum yield, luminescence lifetime, electrochemistry, thermal stability and electroluminescent performances were studied. This europium complex showed low efficiency luminescence, which is probably due to the mismatching energy levels of its ligand and Eu3+ , as well as the double Eu3+ core resonance. Copyright © 2016 John Wiley & Sons, Ltd.

  12. Europium (III) PVC membrane sensor based on N-pyridine-2-carboxamido-8-aminoquinoline as a sensing material

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)


    Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.

  13. A novel tridentate bis(phosphinic acid)phosphine oxide based europium(III)-selective Nafion membrane luminescent sensor. (United States)

    Sainz-Gonzalo, F J; Popovici, C; Casimiro, M; Raya-Barón, A; López-Ortiz, F; Fernández, I; Fernández-Sánchez, J F; Fernández-Gutiérrez, A


    A new europium(III) membrane luminescent sensor based on a new tridentate bis(phosphinic acid)phosphine oxide (3) system has been developed. The synthesis of this new ligand is described and its full characterization by NMR, IR and elemental analyses is provided. The luminescent complex formed between europium(III) chloride and ligand 3 was evaluated in solution, observing that its spectroscopic and chemical characteristics are excellent for measuring in polymer inclusion membranes. Included in a Nafion membrane, all the parameters (ligand and ionic additives) that can affect the sensitivity and selectivity of the sensing membrane as well as the instrumental conditions were carefully optimized. The best luminescence signal (λexc = 229.06 nm and λem = 616.02 nm) was exhibited by the sensing film having a Nafion : ligand composition of 262.3 : 0.6 mg mL(-1). The membrane sensor showed a short response time (t95 = 5.0 ± 0.2 min) and an optimum working pH of 5.0 (25 mM acetate buffer solution). The membrane sensor manifested a good selectivity toward europium(III) ions with respect to other trivalent metals (iron, chromium and aluminium) and lanthanide(III) ions (lanthanum, samarium, terbium and ytterbium), although a small positive interference of terbium(III) ions was observed. It provided a linear range from 1.9 × 10(-8) to 5.0 × 10(-6) M with a very low detection limit (5.8 × 10(-9) M) and sensitivity (8.57 × 10(-7) a.u. per M). The applicability of this sensing film has been demonstrated by analyzing different kinds of spiked water samples obtaining recovery percentages of 95-97%.

  14. A Responsive Europium(III) Chelate that Provides a Direct Readout of pH by MRI (United States)

    Wu, Yunkou; Soesbe, Todd C.; Kiefer, Garry E.; Zhao, Piyu; Sherry, A. Dean


    A europium(III) DO3A-tris(amide) complex is reported for imaging pH by MRI using ratiometric CEST principles. Deprotonation of a single phenolic proton between pH 6 and 7.6 results in an ~5 ppm shift in the water exchange CEST peak that is easily detected by MRI. Collection of two CEST images at two slightly different activation frequencies provides a direct readout of solution pH without the need of a concentration marker. PMID:20853833

  15. Spectroscopic properties and luminescence behaviour of europium doped lithium borate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Anjaiah, J., E-mail: [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Department of Physics, Geethanjali College of Engineering and Technology, Keesara, RR Dist., Hyderabad 501 301 (India); Laxmikanth, C. [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Veeraiah, N. [Department of Physics, Acharya Nagarjuna University, Nagarjuna Nagar, Guntur 522 510, AP. (India)


    Li{sub 2}O–MO–B{sub 2}O{sub 3} (MO=ZnO, CaO and CdO) glasses doped with europium are prepared by using the melt quenching technique to study their absorption and luminescence properties to understand their lasing potentialities. The XRD pattern of the glasses confirmed the amorphous nature and the IR spectra reveal the presence of BO{sub 3} and BO{sub 4} units in the glass network. Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) are evaluated from the intensities of various absorption bands of optical absorption spectra. The J–O parameters have been used to calculate transition probabilities (A), lifetime (τ{sub R}), branching ratios (β{sub R}) and stimulated emission cross-section (σ{sub P}) for the {sup 5}D{sub 0}→{sup 7}F{sub J} (J=1–4) transitions of the Eu{sup 3+} ions. The decay from the {sup 5}D{sub 0} level of Eu{sup 3+} ions in these glasses has been measured and analysed. Branching ratios and stimulated emission cross-sections measured for all these glasses show that the {sup 5}D{sub 0}→{sup 7}F{sub 1} transition under investigation has the potential for laser applications. The high stimulated emission cross-section and branching ratios from the present glasses suggests their potential for infra red lasers. The study of the thermoluminescence is also carried out and the data suggests that the CdBEu glass is suitable for thermoluminescence emission output among the three Eu{sup 3+} doped glasses.

  16. Size-dependent cytotoxicity of europium doped NaYF{sub 4} nanoparticles in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang, E-mail:; Zhang, Jinchao, E-mail:


    Lanthanide-doped sodium yttrium fluoride (NaYF{sub 4}) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF{sub 4} (NaYF{sub 4}:Eu{sup 3+}) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF{sub 4}:Eu{sup 3+} nanoparticles with three diameters have been synthesized. • NaYF{sub 4}:Eu{sup 3+} nanoparticles could be uptaken by endothelial cells (ECs). • NaYF{sub 4}:Eu{sup 3+} nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF{sub 4}:Eu{sup 3+} nanoparticles may be important to their toxicology effect.

  17. Two-dimensional high spatial-resolution dosimeter using europium doped potassium chloride: a feasibility study (United States)

    Li, H. Harold; Driewer, Joseph P.; Han, Zhaohui; Low, Daniel A.; Yang, Deshan; Xiao, Zhiyan


    Recent research has shown that KCl:Eu2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had completed been incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl-) centers were the electron storage centers post×ray irradiation and that Eu2+ cations acted as luminescence centers in the photostimulation process. The 150-µm thick casted KCl:Eu2+ SPF showed sub-millimeter spatial resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu2+ and 80% low Z polymer binder exhibited almost no energy dependence in a 6 MV beam. KCl:Eu2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl’s intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu2+ based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. PMID:24651448

  18. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay (United States)

    Shen, Yifeng; Xu, Shaohan; He, Donghua


    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0) respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5μg/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145μg/L). We propose that it can fulfill clinical applications. PMID:26056826

  19. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay.

    Directory of Open Access Journals (Sweden)

    Yifeng Shen

    Full Text Available A novel europium ligand 2,2',2'',2'''-(4,7-diphenyl-1,10-phenanthroline-2,9-diyl bis (methylene bis (azanetriyl tetra acetic acid (BC-EDTA was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm. It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0 respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5 μg/L. It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA reagents (0.2-145 μg/L. We propose that it can fulfill clinical applications.

  20. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  1. Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)


    Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)

  2. Synthesis and characterization of barium titanate, doped with europium and neodymium; Sintese e caracterizacao de titanato de bario, dopados com europio e neodimio

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica


    This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.

  3. Stability constants of the Europium complexes with the chloride ions; Constantes de estabilidad de los complejos del europio con los iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)


    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  4. LA-ICP-MS Allows Quantitative Microscopy of Europium-Doped Iron Oxide Nanoparticles and is a Possible Alternative to Ambiguous Prussian Blue Iron Staining. (United States)

    Scharlach, Constantin; Müller, Larissa; Wagner, Susanne; Kobayashi, Yuske; Kratz, Harald; Ebert, Monika; Jakubowski, Norbert; Schellenberger, Eyk


    The development of iron oxide nanoparticles for biomedical applications requires accurate histological evaluation. Prussian blue iron staining is widely used but may be unspecific when tissues contain substantial endogenous iron. Here we tested whether microscopy by laser ablation coupled to inductively coupled plasma mass spectrometry (LA-ICP-MS) is sensitive enough to analyze accumulation of very small iron oxide particles (VSOP) doped with europium in tissue sections. For synthesis of VSOP, a fraction of Fe3+ (5 wt%) was replaced by Eu3+, resulting in particles with 0.66 mol% europium relative to iron (Eu-VSOP) but with otherwise similar properties as VSOP. Eu-VSOP or VSOP was intravenously injected into ApoE-/- mice on Western cholesterol diet and accumulated in atherosclerotic plaques of these animals. Prussian blue staining was positive for ApoE-/- mice with particle injection but also for controls. LA-ICP-MS microscopy resulted in sensitive and specific detection of the europium of Eu-VSOP in liver and atherosclerotic plaques. Furthermore, calibration with Eu-VSOP allowed calculation of iron and particle concentrations in tissue sections. The combination of europium-doped iron oxide particles and LA-ICP-MS microscopy provides a new tool for specific and quantitative analysis of particle distribution at the tissue level and allows correlation with other elements such as endogenous iron.

  5. Novel Time-Resolved Fluorescence Europium Nanoparticle Immunoassay for Detection of Human Immunodeficiency Virus-1 Group O Viruses Using Microplate and Microchip Platforms. (United States)

    Haleyur Giri Setty, Mohan Kumar; Liu, Jikun; Mahtani, Prerna; Zhang, Panhe; Du, Bingchen; Ragupathy, Viswanath; Devadas, Krishnakumar; Hewlett, Indira K


    Accurate detection and quantification of HIV-1 group O viruses have been challenging for currently available HIV assays. We have developed a novel time-resolved fluorescence (TRF) europium nanoparticle immunoassay for HIV-1 group O detection using a conventional microplate enzyme-linked immunosorbent assay (ELISA) and a microchip platform. We screened several antibodies for optimal reactivity with several HIV-1 group O strains and identified antibodies that can detect all the strains of HIV-1 group O that were available for testing. The antibodies were used to develop a conventional ELISA format assay and an in-house developed europium nanoparticle-based assay for sensitivity. The method was evaluated on both microwell plate and microchip platforms. We identified two specific and sensitive antibodies among the six we screened. The antibodies, C65691 and ANT-152, were able to quantify 15 and detect all 17 group O viruses, respectively, as they were broadly cross-reactive with all HIV-1 group O strains and yielded better signals compared with other antibodies. We have developed a sensitive assay that reflects the actual viral load in group O samples by using an appropriate combination of p24 antibodies that enhance group O detection and a highly sensitive TRF-based europium nanoparticle for detection. The combination of ANT-152 and C65690M in the ratio 3:1 was able to give significantly higher signals in our europium-based assay compared with using any single antibody.

  6. Lanthanide-to-lanthanide energy-transfer processes operating in discrete polynuclear complexes: can trivalent europium be used as a local structural probe? (United States)

    Zaïm, Amir; Eliseeva, Svetlana V; Guénée, Laure; Nozary, Homayoun; Petoud, Stéphane; Piguet, Claude


    This work, based on the synthesis and analysis of chemical compounds, describes a kinetic approach for identifying intramolecular intermetallic energy-transfer processes operating in discrete polynuclear lanthanide complexes, with a special emphasis on europium-containing entities. When all coordination sites are identical in a (supra)molecular complex, only heterometallic communications are experimentally accessible and a Tb → Eu energy transfer could be evidenced in [TbEu(L5)(hfac)6] (hfac = hexafluoroacetylacetonate), in which the intermetallic separation amounts to 12.6 Å. In the presence of different coordination sites, as found in the trinuclear complex [Eu3(L2)(hfac)9], homometallic communication can be induced by selective laser excitation and monitored with the help of high-resolution emission spectroscopy. The narrow and non-degenerated character of the Eu((5)D0 ↔ (7)F0) transition excludes significant spectral overlap between donor and acceptor europium cations. Intramolecular energy-transfer processes in discrete polynuclear europium complexes are therefore limited to short distances, in agreement with the Fermi golden rule and with the kinetic data collected for [Eu3(L2)(hfac)9] in the solid state and in solution. Consequently, trivalent europium can be considered as a valuable local structural probe in discrete polynuclear complexes displaying intermetallic separation in the sub-nanometric domain, a useful property for probing lanthanido-polymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide coordinated to europium(III) ions as reliable circularly polarized luminescence calibration standards† (United States)

    Bonsall, Steven D.; Houcheime, Mona; Straus, Daniel A.; Muller, Gilles


    The synthesis of two optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide and the constant circularly polarized luminescence (CPL) activity of their acetonitrile trivalent europium complex solutions over a long period of time open new perspectives for performing accurate routine CPL calibration tests at low cost. PMID:17728891

  8. Photoluminescence behavior of europium (III) complexes containing 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione ligand. (United States)

    Wang, Dunjia; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Zheng, Jing


    Three novel europium complexes with 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione (TNPD) and 2,2-dipyridine (Bipy) or 1,10-phenan-throline (Phen) were synthesized and confirmed by FT-IR, (1)H NMR, UV-vis absorption and elemental analysis. Photoluminescence behavior of complexes Eu(TNPD)3, Eu(TNPD)3·Bipy and Eu(TNPD)3·Phen were investigated in detail. Their emission spectra exhibited the characteristic emission bands that arise from the (5)D0→(7)FJ (J=0-4) transitions of the europium ion in solid state. Meanwhile, the results of their lifetime decay curves indicated that only one chemical environment existed around the europium ion. The intrinsic luminescence quantum efficiency (η) and the experimental intensity parameters (Ωt) of europium complexes were determined according to the emission spectra and luminescence decay curves in solid state. The complex Eu(TNPD)3·Phen showed much longer lifetime (τ) and higher luminescence quantum efficiency (η) than complexes Eu(TNPD)3 and Eu(TNPD)3·Bipy. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  10. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  11. Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles (United States)

    Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.


    The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

  12. A microwave-assisted solution combustion synthesis to produce europium-doped calcium phosphate nanowhiskers for bioimaging applications. (United States)

    Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B


    Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  13. Europium nanoparticle-based simple to perform dry-reagent immunoassay for the detection of hepatitis B surface antigen. (United States)

    Talha, Sheikh M; Salminen, Teppo; Juntunen, Etvi; Spangar, Anni; Gurramkonda, Chandrasekhar; Vuorinen, Tytti; Khanna, Navin; Pettersson, Kim


    Hepatitis B infection, caused by hepatitis B virus (HBV), presents a huge global health burden. Serological diagnosis of HBV mainly relies on the detection of hepatitis B surface antigen (HBsAg). Although there are high sensitivity commercial HBsAg enzyme immunoassays (EIAs) available, many low-resource laboratories lacking trained technicians continue to use rapid point-of-care assays with low sensitivities for HBsAg detection, due to their simplicity to operate. We developed a time-resolved fluorometric dry-reagent HBsAg immunoassay which meets the detection limit of high sensitivity EIAs but is simple to operate. To develop the assay, anti-HBsAg monoclonal antibody coated on europium nanoparticles was dried atop of biotinylated anti-HBsAg polyclonal antibody immobilized on streptavidin-coated microtiter wells. To test a sample in dry-reagent assay, serum sample and assay buffer were added to the wells, incubated, washed and europium signals were measured. The assay showed a detection limit of 0.25 ng/ml using HBsAg spiked in serum sample. When evaluated with 24 HBV positive and 37 negative serum samples, assay showed 100% sensitivity and specificity. Assay wells are stable for at least 26 weeks when stored at 4°C, and can tolerate elevated temperatures of up to 35°C for two weeks. The developed assay has high potential to be used in low-resource laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Bright mono-aqua europium complexes based on triazacyclononane that bind anions reversibly and permeate cells efficiently. (United States)

    Butler, Stephen J; McMahon, Brian K; Pal, Robert; Parker, David; Walton, James W


    A series of five europium(III) complexes has been prepared from heptadentate N5O2 ligands that possess a brightness of more than 10 mM(-1) cm(-1) in water, following excitation over the range λ=330-355 nm. Binding of several oxy anions has been assessed by emission spectral titrimetric analysis, with the binding of simple carboxylates, lactate and citrate involving a common ligation mode following displacement of the coordinated water. Selectivity for bicarbonate allows the rapid determination of this anion in human serum, with K(d)=37 mM (295 K). The complexes are internalised quickly into mammalian cells and exhibit a mitochondrial localisation at early time points, migrating after a few hours to reveal a predominant lysosomal distribution. Herein, we report the synthesis and complexation behaviour of strongly emissive europium (III) complexes that bind oxy-anions in aqueous media with an affinity and selectivity profile that is distinctively different from previously studied systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  16. Highly Sensitive Luminescence Assessment of Bile Acid Using a Balofloxacin-Europium(III) Probe in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong [Shihezi Univ., Shihezi (China)


    A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10{sup -9} - 7.0 Χ 10{sup -7} mol L{sup -1} with a detection limit of 1.3 Χ 10{sup -9} mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10{sup -8} mol L{sup -1} bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly.

  17. Investigation of the influence of silver and tin on the luminescence of trivalent europium ions in glass

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.A. [Department of Chemistry, University of Puerto Rico, Mayagueez, PR 00681 (United States); Lysenko, S. [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Liu, H., E-mail: hliu@uprm.ed [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Fachini, E.; Cabrera, C.R. [Center for Nanoscale Materials, University of Puerto Rico, Rio Piedras, PR 00931 (Puerto Rico)


    Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu{sup 3+} ions luminescence have been assessed. For the glass system containing only europium, Eu{sup 3+} PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu{sup 3+} PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag{sup +} ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu{sup 3+} PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu{sup 3+}->Eu{sup 2+} reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu{sup 3+} PL.

  18. 26 CFR 1.167(a)-14 - Treatment of certain intangible property excluded from section 197. (United States)


    ... include certain computer software and certain other separately acquired rights, such as rights to receive tangible property or services, patents and copyrights, certain mortgage servicing rights, and rights of... subject to the allowance for depreciation under section 167(a). (b) Computer software—(1) In general. The...

  19. Intrinsic gK factors of odd-mass 167− 179Lu isotopes

    Indian Academy of Sciences (India)

    In this paper, g K -factors of the intrinsic magnetic moments and effective spin gyromagnetic factors ( g s eff ) of the 167−179Lu isotopes have been studied within the Tamm–Dancoff approximation (TDA) (Kuliev et al, Sov. J. Nucl. Phys. 9, 185 (1969)) by using a realistic potential such as Woods–Saxon potential for the first ...

  20. Synthesis of (--Indolizidine 167B based on domino hydroformylation/cyclization reactions

    Directory of Open Access Journals (Sweden)

    Settambolo Roberta


    Full Text Available Abstract The synthesis of (--Indolizidine 167B has been achieved from optically active (R-3-(pyrrol-1-ylhex-1-ene. The key step is a highly regioselective hydroformylation reaction and a one-pot intramolecular cyclization providing a general approach to the indolizine nucleus.

  1. 26 CFR 1.167(i)-1 - Depreciation of improvements in the case of mines, etc. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation of improvements in the case of... and Corporations § 1.167(i)-1 Depreciation of improvements in the case of mines, etc. Property used in... depreciation provided in section 611 shall be treated for all purposes of the Code as if it were property...

  2. 46 CFR 167.45-45 - Carbon dioxide fire-extinguishing system requirements. (United States)


    ... SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Special Firefighting and Fire Prevention Requirements § 167.45-45... school ship propelled by internal combustion engines, the quantity of carbon dioxide required may be... arrangement of the piping shall be such as to give a general and fairly uniform distribution over the entire...

  3. 46 CFR 167.45-75 - Fire extinguishers for emergency powerplants. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Fire extinguishers for emergency powerplants. 167.45-75... extinguishers for emergency powerplants. In compartments where emergency lighting and wireless units are located, two fire extinguishers approved by the Coast Guard or the Navy, of either carbon dioxide or dry...

  4. 46 CFR 167.45-65 - Portable fire extinguishers in accommodation spaces. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable fire extinguishers in accommodation spaces. 167... Portable fire extinguishers in accommodation spaces. (a) All nautical school ships shall be provided with such number of good and efficient portable fire extinguishers approved by the Navy or Coast Guard as...

  5. 46 CFR 167.45-70 - Portable fire extinguishers, general requirements. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable fire extinguishers, general requirements. 167... Portable fire extinguishers, general requirements. (a) Extra charges shall be carried on board for 50 percent of each size and variety of fire extinguishers provided. If 50 percent of each size and variety of...

  6. 21 CFR 172.167 - Silver nitrate and hydrogen peroxide solution. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Silver nitrate and hydrogen peroxide solution. 172... FOOD FOR HUMAN CONSUMPTION Food Preservatives § 172.167 Silver nitrate and hydrogen peroxide solution. An aqueous solution containing a mixture of silver nitrate and hydrogen peroxide may be safely used...

  7. Behaviour of europium (III) and its hydroxo and carbonate complexes in a solvent extraction system with HDBM in 2 M NaCl at 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico); Solache-Rios, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Rojas-Hernandez, A. [Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico)


    The behaviour of europium in the solvent extraction system Eu{sup 3+}-water-2 M NaCl-HDBM-benzene was studied, taking into account the pC{sub H} and the carbonate ion concentration in the solutions. The stability constants for the hydrolysis and carbonate complexes of europium were determined at 303 K in the same medium by pH titration followed by a computational refinement. The obtained data were: log {beta}{sub Eu,H} = -8.29 {+-} 0.02, log {beta}{sub Eu,2H} = -16.37 {+-} 0.02, log {beta}{sub Eu,3H} = -24.54 {+-} 0.11, log {beta}{sub Eu,4H} = -34.91 {+-} 0.26, log {beta}{sub CO{sub 2}{sup 2-},H} = 9.30 {+-} 0.05, log {beta}{sub Eu,CO{sub 3}{sup 2-}} = 5.96 {+-} 0.03, log {beta}{sub Eu,CO{sub 3}{sup 2-},H} = -1.24 {+-} 0.05 and log {beta}{sub Eu,CO{sub 3}{sup 2-},2H} = -11.39 {+-} 0.11. Log K{sub W} was -13.78 {+-} 0.06. The behaviour of europium in this solvent extraction system was simulated, taking into account the hydrolysis and carbonate complexes plus the formation of Eu(DBM){sub 3}(OH){sup 1-} and Eu(DBM){sub 3}(CO{sub 3}){sup 2-} in the aqueous phase. The only europium species considered in the organic phase was Eu(DBM){sub 3}. The first hydrolysis constant of europium was also determined by using this solvent extraction system under the same conditions. A good conformity was found with the results obtained by both techniques. (orig.)

  8. Bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex a new apoptotic agent through Flk-1 down regulation, caspase-3 activation and oligonucleosomes DNA fragmentation. (United States)

    Azab, Hassan A; Hussein, Belal H M; El-Azab, Mona F; Gomaa, Mohamed; El-Falouji, Abdullah I


    New bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex was synthesized and characterized. In vivo anti-angiogenic activities of bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex against Ehrlich ascites carcinoma (EAC) cells are described. The newly synthesized complex resulted in inhibition of proliferation of EAC cells and ascites formation. The anti-tumor effect was found to be through anti-angiogenic activity as evident by the reduction of microvessel density in EAC solid tumors. The anti-angiogenic effect is mediated through down-regulation of VEGF receptor type-2 (Flk-1). The complex was also found to significantly increase the level of caspase-3 in laboratory animals compared to the acridine ligand and to the control group. This was also consistent with the DNA fragmentation detected by capillary electrophoresis that proved the apoptotic effect of the new complex. Our complex exhibited anti-angiogenic and apoptotic activity in vivo, a thing that makes it a potential effective chemotherapeutic agent. The interaction of calf thymus DNA (ct-DNA) with bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex has been investigated using fluorescence technique. A competitive experiment of the europium(III)-acridine complex with ethidium bromide (EB) to bind DNA revealed that interaction between the europium(III)-acridine and DNA was via intercalation. The interaction of the synthesized complex with tyrosine kinases was also studied using molecular docking simulation to further substantiate its mode of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Europium(III) reduction and speciation within a Wells-Dawson heteropolytungstate. (United States)

    Jing, Jing; Burton-Pye, Benjamin P; Francesconi, Lynn C; Antonio, Mark R


    The redox speciation of Eu(III) in the 1:1 stoichiometric complex with the alpha-1 isomer of the Wells-Dawson anion, [alpha-1-P 2W 17O 61] (10-), was studied by electrochemical techniques (cyclic voltammetry and bulk electrolysis), in situ XAFS (X-ray absorption fine structure) spectroelectrochemistry, NMR spectroscopy ( (31)P), and optical luminescence. Solutions of K 7[(H 2O) 4Eu(alpha-1-P 2W 17O 61)] in a 0.2 M Li 2SO 4 aqueous electrolyte (pH 3.0) show a pronounced concentration dependence to the voltammetric response. The fully oxidized anion and its reduced forms were probed by Eu L 3-edge XANES (X-ray absorption near edge structure) measurements in simultaneous combination with controlled potential electrolysis, demonstrating that Eu(III) in the original complex is reduced to Eu(II) in conjunction with the reduction of polyoxometalate (POM) ligand. After exhaustive reduction, the heteropoly blue species with Eu(II) is unstable with respect to cluster isomerization, fragmentation, and recombination to form three other Eu-POMs as well as the parent Wells-Dawson anion, alpha-[P 2W 18O 62] (6-). EXAFS data obtained for the reduced, metastable Eu(II)-POM before the onset of Eu(II) autoxidation provides an average Eu-O bond length of 2.55(4) A, which is 0.17 A longer than that for the oxidized anion, and consistent with the 0.184 A difference between the Eu(II) and Eu(III) ionic radii. The reduction of Eu(III) is unusual among POM complexes with Lindqvist and alpha-2 isomers of Wells-Dawson anions, that is, [Eu(W 5O 18) 2] (9-) and [Eu(alpha-2-As 2W 17O 61) 2] (17-), but not to the Preyssler complex anion, [EuP 5W 30O 110] (12-), and fundamental studies of materials based on coupling Eu and POM redox properties are still needed to address new avenues of research in europium hydrometallurgy, separations, and catalysis sciences.

  10. Structural, optical and electrical properties of europium picrate tetraethylene glycol complex as emissive material for OLED

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I.; Adnan, Rohana [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Sha Shiong, Ng; Fun, H.K. [School of Physics, Universiti Sains Malaysia, 11800 Penang (Malaysia); Adhha Abdullah, M.A.; Mamat, Mazidah [Department of Chemical Sciences, Faculty of Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu Darul Iman (Malaysia); Za' aba, N.K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)


    A new europium complex [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O was synthesized and used as the emission material for the single layer device structure of ITO/EO4-Eu-Pic/Al, using a spin-coating technique. Study on the optical properties of the [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O complex where EO4=tetraethylene glycol and Pic=picrate anion, had to be undertaken before being applicable to the study of an organic light emitting diode (OLED). The electrical property of an OLED using current-voltage (I-V) measurement was also studied. In complex, the Eu(III) ion was coordinated with the EO4 ligand as a pentadentate mode, one water molecule, and with two Pic anions as bidentate and monodentate modes, forming a nine-coordination number. The photoluminescence (PL) spectra of the crystalline complex in the solid state and its thin film showed a hypersensitive peak at 613.5-614.9 nm that assigned to the {sup 5}D{sub 0}{yields}{sup 7}F{sub 2} transition. A narrow band emission from the thin film EO4-Eu-Pic was obtained. The typical semiconductor I-V curve of device ITO/EO4-Eu-Pic/Al showed the threshold and turn on voltages at 1.08 and 4.6 V, respectively. The energy transfer process from the ligand to the Eu(III) ion was discussed by investigating the excitation and PL characteristics. Effect of the picrate anion on the device performance was also studied. - Highlights: > The [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75(H{sub 2}O) is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in single layer device structure of ITO/EO4-Eu-Pic/Al. > The complex displays a red luminescence in both the crystalline complex and its thin film state. > The low turn on voltage of the device (4.6 V), indicating that this material is suitable for OLED. > The roughness and morphology of the thin film affects luminance and electrical properties of OLED.

  11. Measurement of conversion coefficients in normal and triaxial strongly deformed bands in {sup 167}Lu.

    Energy Technology Data Exchange (ETDEWEB)

    Gurdal, G.; Beausang, C. W.; Brenner, D. S.; Ai, H.; Casten, R. F.; Crider, B.; Heinz, A.; Williams, E.; Hartley, D. J.; Carpenter, M. P.; Hecht, A. A.; Janssens, R. V. F.; Lauritsen, T.; Lister, C. J.; Raabe, R.; Seweryniak, D.; Zhu, S.; Saladin, J. X.; Physics; Yale Univ.; Clark Univ.; Univ. of Richmond; United States Naval Academy; Univ. of Maryland; Univ. of Pittsburgh


    Internal conversion coefficients have been measured for transitions in both normal deformed and triaxial strongly deformed bands in {sup 167}Lu using the Gammasphere and ICE Ball spectrometers. The results for all in-band transitions are consistent with E2 multipolarity. Upper limits are determined for the internal conversion coefficients for linking transitions between TSD Band 2 and TSD Band 1, the n{sub w} = 1 and n{sub w} = 0 wobbling bands, respectively.

  12. Synthesis of Luminescent Ink from Europium-Doped Y2O3 Dispersed in Polyvinyl Alcohol Solution

    Directory of Open Access Journals (Sweden)



    Full Text Available Luminescent ink from europium-doped Y2O3 ( Y2O3:Eu has been synthesized by two steps method: first, synthesis of luminescent powder of Y2O3:Eu by simple heating of metallic nitrates in a polymer solution and second, dispersing the powder in a polyvinyl alcohol (PVA solution. The stability of the ink (luminescent colloid was strongly affected by mixing process of the powder and the solution. Mixing process must be performed for a long time (about 8 hours at above room temperature to product stable colloids. We observed that mixing at 30–40∘C resulted in a stable and highly dispersed colloid. The writing test was performed on a white paper to show the potential use of the colloid for making security codes.

  13. Induced europium CPL for the selective signalling of phosphorylated amino-acids and O-phosphorylated hexapeptides. (United States)

    Neil, Emily R; Fox, Mark A; Pal, Robert; Parker, David


    Two bright, europium(iii) complexes based on an achiral heptadentate triazacyclononane ligand bearing two strongly absorbing chromophores have been evaluated for the selective emission and CPL signalling of various chiral O-phosphono-anions. Binding of O-phosphono-Ser and Thr gives rise to a strong induced CPL signature and a favoured Δ complex configuration is adopted. A similarly large induced CPL signal arises when [Eu·](2+) binds to lysophosphatidic acid (LPA), where the strong binding (log K 5.25 (295 K)) in methanol allowed its detection over the range 5 to 40 μM. Strong and chemoselective binding to the phosphorylated amino-acid residues was also observed with a set of four structurally related hexapeptides: in one case, the sign of the gem value in the ΔJ = 1 transition allowed differentiation between the binding to O-P-Ser and O-P-Tyr residues.

  14. A new europium(III)-β-diketonate complex based on diphenylethyne as red phosphors applied in LED

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guang, E-mail: [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Na; Lin, Duan [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Feng, Kenjun [Department of Chemical Engineering, Hui-Zhou University, Huizhou 516007 (China); Cao, Rihui, E-mail: [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Gong, Menglian [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China)


    A new europium(III) ternary complex based on a fluorinated β-diketonate ligand and 1,10-phenanthroline as an ancillary ligand has been prepared and evaluated as a candidate for light-emitting diode (LED). The complex exhibits a high decomposition temperature (316 °C). Photophysical properties such as FT-IR spectra, UV–vis absorption spectra, excitation and emission spectra, luminescence decay curve and quantum yield were investigated. The excitation band is well matched with the characteristic emission of 395 nm-emitting InGaN chips. The complex exhibits an efficient energy transfer pathway from the ligands to the central Eu{sup 3+} ion via a ligand-sensitized luminescence process. An intense red-emitting LED was fabricated by coating the complex onto a 395 nm-emitting InGaN chip, and its Commission International de I'Eclairage (CIE) chromaticity coordinate (x=0.6389, y=0.3255) is close to the National Television Standard Committee (NTSC) standard value for red color. Meanwhile, the energy transfer from the InGaN chip to the complex is very efficient. All the findings demonstrate the potential application of the Eu(III) complex as red-emitting phosphors for UV-based white LEDs. -- Highlights: ► A new europium(III)-β-diketonate complex was synthesized and characterized. ► Thermal stability and photophysical properties were investigated in detail. ► PL mechanism was proposed to involve a ligand-sensitized luminescence process. ► An intense red-emitting LED was fabricated by using the complex. ► CIE chromaticity coordinate is close to NTSC standard value for red color.

  15. Mitochondria Targetable Time-Gated Luminescence Probe for Singlet Oxygen Based on a β-Diketonate-Europium Complex. (United States)

    Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli


    Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.

  16. SjE16.7 activates macrophages and promotes Schistosoma japonicum egg-induced granuloma development. (United States)

    Fang, Yan; Wu, Chenyun; Chen, Qing; Wu, Jianhua; Yang, Yang; Guo, Xiaokui; Chen, Guangjie; Wang, Zhaojun


    SjE16.7 is an egg-specific protein from Schistosoma japonicum that recruits neutrophils and initiates an inflammatory granuloma response in host tissue. However, since macrophages are known to be important regulators of egg granuloma formation we investigated the effect of SjE16.7 on this cell type. Here we report that SjE16.7 is a potent macrophage activator, inducing macrophage chemotaxis and stimulating cytokine production. Treatment of murine primary macrophages with SjE16.7 resulted in upregulation of both pro- and anti-inflammatory cytokines (IL-10, IL-12, IL-6 and TNF-α), as well as phosphorylation of mitogen-activated protein kinases (MAPKs). Moreover, SjE16.7 treatment increased MHC Class II expression on the surface of macrophages. Importantly, in vivo blockade of SjE16.7 significantly reduced egg-induced pathology, as a result of decreased leucocyte infiltration and reduced granuloma size. Our results suggest that SjE16.7 is an important pathogenic factor and a potential treatment target for this disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Relation between outcomes and expression of estrogen receptor-α phosphorylated at Ser(167) in endometrioid endometrial cancer. (United States)

    Kato, Eiichi; Orisaka, Makoto; Kurokawa, Tetsuji; Chino, Yoko; Fujita, Yuko; Shinagawa, Akiko; Yoshida, Yoshio


    Both ligand-dependent and ligand-independent activation of estrogen receptor (ER)α is modulated by receptor phosphorylation and results in activation of the ERα-dependent pathways that are involved in endometrioid endometrial cancer (EEC) pathogenesis. It is also known that the mammalian target of rapamycin (mTOR)/p70 S6 kinase 1 (S6K1) and MAPK/p90 ribosomal S6 kinase (RSK) signaling pathways coordinately regulate phosphorylated-ERα at Ser(167) (p-Ser(167) -ERα). However, the expression of p-Ser(167) -ERα in EEC and its prognostic role in ECC is largely unexplored. The purpose of the present study was to investigate the expression of p-Ser(167) -ERα in ECC and its relationship with prognosis. Immunohistochemical staining of primary EEC surgical specimens (n = 103) was carried out using antibodies specific for p-Ser(167) -ERα and for p-mTOR/p-S6K1 and p-MAPK/p-RSK. The correlation of p-Ser(167) -ERα expression with clinicopathological features and survival of ECC was studied. Patients that were positive for nuclear p-Ser(167) -ERα had significantly shorter relapse-free survival, and although the result was not significant, levels of nuclear p-Ser(167) -ERα tended to be higher in advanced-stage ECC patients. Nuclear p-Ser(167) -ERα was significantly positively correlated with p-MAPK and p-S6K1, and with significantly shorter relapse-free survival in EEC. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  18. Excitation energy transfer in europium chelate with doxycycline in the presence of a second ligand in micellar solutions of nonionic surfactants (United States)

    Smirnova, T. D.; Shtykov, S. N.; Kochubei, V. I.; Khryachkova, E. S.


    The complexation of Eu3+ with doxycycline (DC) antibiotic in the presence of several second ligands and surfactant micelles of different types is studied by the spectrophotometric and luminescence methods. It is found that the efficiency of excitation energy transfer in Eu3+-DC chelate depends on the nature of the second ligand and surfactant micelles. Using thenoyltrifluoroacetone (TTA) as an example, it is shown that the second ligand additionally sensitizes the europium fluorescence, and the possibility of intermediate sensitization of DC and then of europium is shown by the example of 1,10-phenanthroline. In all cases, the excitation energy transfer efficiency was increased due to the so-called antenna effect. The decay kinetics of the sensitized fluorescence of the binary and mixed-ligand chelates in aqueous and micellar solutions of nonionic surfactants is studied and the relative quantum yields and lifetimes of fluorescence are determined.

  19. A Smart Europium-Ruthenium Complex as Anticancer Prodrug: Controllable Drug Release and Real-Time Monitoring under Different Light Excitations. (United States)

    Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung


    A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λirr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.

  20. Structural and optical analysis on europium doped AZrO{sub 3} (A=Ba, Ca, Sr) phosphor for display devices application

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, Vikas, E-mail: [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)


    Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.

  1. Metal-organic framework luminescence in the yellow gap by codoping of the homoleptic imidazolate ∞(3)[Ba(Im)2] with divalent europium. (United States)

    Rybak, Jens-Christoph; Hailmann, Michael; Matthes, Philipp R; Zurawski, Alexander; Nitsch, Jörn; Steffen, Andreas; Heck, Joachim G; Feldmann, Claus; Götzendörfer, Stefan; Meinhardt, Jürgen; Sextl, Gerhard; Kohlmann, Holger; Sedlmaier, Stefan J; Schnick, Wolfgang; Müller-Buschbaum, Klaus


    The rare case of a metal-triggered broad-band yellow emitter among inorganic-organic hybrid materials was achieved by in situ codoping of the novel imidazolate metal-organic framework ∞(3)[Ba(Im)2] with divalent europium. The emission maximum of this dense framework is in the center of the yellow gap of primary light-emitting diode phosphors. Up to 20% Eu2+ can be added to replace Ba2+ as connectivity centers without causing observable phase segregation. High-resolution energy-dispersive X-ray spectroscopy showed that incorporation of even 30% Eu2+ is possible on an atomic level, with 2-10% Eu2+ giving the peak quantum efficiency (QE = 0.32). The yellow emission can be triggered by two processes: direct excitation of Eu2+ and an antenna effect of the imidazolate linkers. The emission is fully europium-centered, involving 5d → 4f transitions, and depends on the imidazolate surroundings of the metal ions. The framework can be obtained by a solvent-free in situ approach starting from barium metal, europium metal, and a melt of imidazole in a redox reaction. Better homogeneity for the distribution of the luminescence centers was achieved by utilizing the hydrides BaH2 and EuH2 instead of the metals.

  2. α-Titanium phosphate intercalated with propylamine: An alternative pathway for efficient europium(III uptake into layered tetravalent metal phosphates

    Directory of Open Access Journals (Sweden)

    Jorge García-Glez


    Full Text Available α-Ti(HPO42·H2O (α-TiP and its propylamine intercalation product, Ti(HPO42·2C3H7NH2·H2O (α-TiPPr, have been synthesized and characterized. Later, their sorption capacity for europium(III was investigated, and this purpose was accomplished by treating α-TiP and α-TiPPr with europium(III nitrate solutions at different concentrations until the equilibrium is reached. All samples were characterized, among others, by powder X-ray diffraction (PXRD, scanning and transmission electron microscopies (SEM, TEM, STEM-EDX, SAED, thermogravimetric analysis (TGA, and photoluminescence (PL measurements. The results show that the Eu3+ uptake is limited to surface when α-TiP is used as sorbent. Nevertheless, the Eu-retention is considerably enhanced with α-TiPPr as a consequence of an ion-exchange process into the interlayer space of the layered titanium phosphate (involving propylammonium cations, C3H7NH3+, and hexahydrate europium(III species, [Eu(H2O6]3+, and the crystal structure of a hypothetical final product, α-[Eu(H2O6]2/3Ti(PO42·[(H2O6]1/3, has been proposed by using DFT calculations.

  3. 167 W, power scalable ytterbium-doped photonic bandgap fiber amplifier at 1178nm

    DEFF Research Database (Denmark)

    Olausson, Christina Bjarnal Thulin; Shirakawa, A.; Chen, M.


    An ytterbium-doped photonic bandgap fiber amplifier operating at the long wavelength edge of the ytterbium gain band is investigated for high power amplification. The spectral filtering effect of the photonic bandgap efficiently suppresses amplified spontaneous emission at the conventional...... ytterbium gain wavelengths and thus enables high power amplification at 1178 nm. A record output power of 167 W, a slope efficiency of 61% and 15 dB saturated gain at 1178 nm have been demonstrated using the ytterbium-doped photonic bandgap fiber....

  4. 42 CFR 137.167 - What cost principles must a Self-Governance Tribe follow when participating in self-governance... (United States)


    ... 42 Public Health 1 2010-10-01 2010-10-01 false What cost principles must a Self-Governance Tribe follow when participating in self-governance under Title V? 137.167 Section 137.167 Public Health PUBLIC... HUMAN SERVICES TRIBAL SELF-GOVERNANCE Operational Provisions Audits and Cost Principles § 137.167 What...

  5. 26 CFR 1.167(a)-11 - Depreciation based on class lives and asset depreciation ranges for property placed in service... (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation based on class lives and asset depreciation ranges for property placed in service after December 31, 1970. 1.167(a)-11 Section 1.167(a)-11...) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(a)-11 Depreciation...

  6. Electron tunneling transport across heterojunctions between europium sulfide and indium arsenide (United States)

    Kallaher, Raymond L.

    This dissertation presents research done on utilizing the ferromagnetic semiconductor europium sulfide (EuS) to inject spin polarized electrons into the non-magnetic semiconductor indium arsenide (InAs). There is great interest in expanding the functionality of modern day electronic circuits by creating devices that depend not only on the flow of charge in the device, but also on the transport of spin through the device. Within this mindset, there is a concerted effort to establish an efficient means of injecting and detecting spin polarized electrons in a two dimensional electron system (2DES) as the first step in developing a spin based field effect transistor. Thus, the research presented in this thesis has focused on the feasibility of using EuS, in direct electrical contact with InAs, as a spin injecting electrode into an InAs 2DES. Doped EuS is a concentrated ferromagnetic semiconductor, whose conduction band undergoes a giant Zeeman splitting when the material becomes ferromagnetic. The concomitant difference in energy between the spin-up and spin-down energy bands makes the itinerant electrons in EuS highly spin polarized. Thus, in principle, EuS is a good candidate to be used as an injector of spin polarized electrons into non-magnetic materials. In addition, the ability to adjust the conductivity of EuS by varying the doping level in the material makes EuS particularly suited for injecting spins into non-magnetic semiconductors and 2DES. For this research, thin films of EuS have been grown via e-beam evaporation of EuS powder. This growth technique produces EuS films that are sulfur deficient; these sulfur vacancies act as intrinsic electron donors and the resulting EuS films behave like heavily doped ferromagnetic semiconductors. The growth parameters and deposition procedures were varied and optimized in order to fabricate films that have minimal crystalline defects. Various properties and characteristics of these EuS films were measured and compared to

  7. Synthesis, Optical Investigation and Biological Properties of Europium(III) Complexes with 2-(4-Chlorophenyl)-1-(2-Hydroxy-4-Methoxyphenyl)Ethan-1-one and Ancillary Ligands. (United States)

    Nandal, Poonam; Khatkar, S P; Kumar, Rajesh; Khatkar, Avni; Taxak, V B


    Synthesis and photoluminescence behaviour of six novel europium complexes with novel β-hydroxyketone ligand, 2-(4-chlorophenyl)-1-(2-hydroxy-4-methoxyphenyl)ethan-1-one (CHME) and 2,2'-bipyridine (bipy) or neocuproine (neo) or 1,10-phenanthroline (phen) or 5,6-dimethyl-1,10-phenanthroline (dmphen) or bathophenanthroline (bathophen) were reported in solid state. The free ligand CHME and europium complexes, Eu(CHME)3.2H2O [1] Eu(CHME)3.bipy [2], Eu(CHME)3.neo [3], Eu(CHME)3.phen [4], Eu(CHME)3.dmphen [5] and Eu(CHME)3.bathophen [6]were characterized by elemental analysis, FT-IR and 1H-NMR. The photoluminescence emission spectra exhibited four characteristic peaks arising from the 5D0 → 7FJ (J = 1-4) transitions of the europium ion in the solid state on monitoring excitation at λex = 395 nm. The luminescence decay curves of these europium complexes possess single exponential behaviour indicating the presence of a single luminescent species and having only one site symmetry in the complexes. The luminescence quantum efficiency (η) and the experimental intensity parameters, Ω 2 and Ω 4 of europium complexes have also been calculated on the basis of emission spectra and luminescence decay curves. In addition, the antimicrobial and antioxidant activities were also studied of the investigated complexes.

  8. Highly luminescent pure-red-emitting fluorinated β-diketonate europium(III) complex for full solution-processed OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)


    Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.

  9. Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Kautenburger, R.; Nowotka, K.; Beck, H.P. [Institut fuer Anorganische und Analytische Chemie und Radiochemie, Universitaet des Saarlandes, P.O. Box 151150, 66041 Saarbruecken (Germany)


    Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu{sup 3+}) and gadolinium (Gd{sup 3+}) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 {mu}l nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for {sup 153}Eu and 125 ppt for {sup 158}Gd. With this optimized CE

  10. Temperature effects on the interaction mechanisms between the europium (III) and uranyl ions and zirconium diphosphate; Effets de la temperature sur les mecanismes d'interaction entre les ions europium (3) et uranyle et le diphosphate de zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Finck, N


    Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)

  11. Quantum dot based on tin/titanium mixed oxide doped with europium synthesized by protein sol-gel method

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f


    Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)

  12. 340nm UV LED excitation in time-resolved fluorescence system for europium-based immunoassays detection (United States)

    Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian


    In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.

  13. Interaction of europium and nickel with calcite studied by Rutherford Backscattering Spectrometry and Time-Resolved Laser Fluorescence Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sabau, A. [Agence Nationale pour la gestion des Déchets RAdioactifs, 1-7 rue J. Monnet, Parc de la Croix Blanche, 92298 Châtenay-Malabry Cedex (France); Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Pipon, Y., E-mail: [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Institut Universitaire de Technologie (IUT) Lyon-1, Université Claude Bernard Lyon 1, 69 622 Villeurbanne Cedex (France); Toulhoat, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); CEA/DEN, Saclay, 91191 Gif sur Yvette (France); Lomenech, C. [Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Jordan, N. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); Moncoffre, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Barkleit, A. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); and others


    This study aims at elucidating the mechanisms regulating the interaction of Eu and Ni with calcite (CaCO{sub 3}). Calcite powders or single crystals (some mm sized) were put into contact with Eu or Ni solutions at concentrations ranging from 10{sup −3} to 10{sup −5} mol L{sup −1} for Eu and 10{sup −3} mol L{sup −1} for Ni. The sorption durations ranged from 1 week to 1 month. Rutherford Backscattering Spectrometry (RBS) well adapted to discriminate incorporation processes such as: (i) adsorption or co precipitation at the mineral surfaces or, (ii) incorporation into the mineral structure (through diffusion for instance), has been carried out. Moreover, using the fluorescence properties of europium, the results have been compared to those obtained by Time-Resolved Laser Fluorescence Spectroscopy (TRLFS) on calcite powders. For the single crystals, complementary SEM observations of the mineral surfaces at low voltage were also performed. Results showed that Ni accumulates at the calcite surface whereas Eu is also incorporated at a greater depth. Eu seems therefore to be incorporated into two different states in calcite: (i) heterogeneous surface accumulation and (ii) incorporation at depth greater than 160 nm after 1 month of sorption. Ni was found to accumulate at the surface of calcite without incorporation.

  14. Orange-red emitting europium doped strontium ortho-silicate phosphor prepared by a solid state reaction method. (United States)

    Sahu, Ishwar Prasad


    In the present article we report europium-doped strontium ortho-silicates, namely Sr 2 SiO 4 :xEu 3+ (x = 1.0, 1.5, 2.0, 2.5 or 3.0 mol%) phosphors, prepared by solid state reaction method. The crystal structures of the sintered phosphors were consistent with orthorhombic crystallography with a Pmna space group. The chemical compositions of the sintered phosphors were confirmed by energy dispersive X-ray spectroscopy (EDS). Thermoluminescence (TL) kinetic parameters such as activation energy, order of kinetics and frequency factors were calculated by the peak shape method. Orange-red emission originating from the 5 D 0 - 7 F J (J = 0, 1, 2, 3) transitions of Eu 3+ ions could clearly be observed after samples were excited at 395 nm. The combination of these emissions constituted orange-red light as indicated on the Commission Internationale de l'Eclairage (CIE) chromaticity diagram. Mechanoluminescence (ML) intensity of the prepared phosphor increased linearly with increasing impact velocity of the moving piston that suggests that these phosphors can also be used as sensors to detect the stress of an object. Thus, the present investigation indicates that the piezo-electricity was responsible for producing ML in the prepared phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Application of Europium Multiwalled Carbon Nanotubes as Novel Luminophores in an Electrochemiluminescent Aptasensor for Thrombin Using Multiple Amplification Strategies. (United States)

    Wu, Dan; Xin, Xia; Pang, Xuehui; Pietraszkiewicz, Marek; Hozyst, Robert; Sun, Xian'ge; Wei, Qin


    A novel electrochemiluminescent (ECL) aptasensor was proposed for the determination of thrombin (TB) using exonuclease-catalyzed target recycling and hybridization chain reaction (HCR) to amplify the signal. The capture probe was immobilized on an Au-GS-modified electrode through a Au-S bond. Subsequently, the hybrid between the capture probe and the complementary thrombin binding aptamer (TBA) was aimed at obtaining double-stranded DNA (dsDNA). The interaction between TB and its aptamer led to the dissociation of dsDNA because TB has a higher affinity to TBA than the complementary strands. In the presence of exonuclease, aptamer was selectively digested and TB could be released for target recycling. Extended dsDNA was formed through HCR of the capture probe and two hairpin DNA strands (NH2-DNA1 and NH2-DNA1). Then, numerous europium multiwalled carbon nanotubes (Eu-MWCNTs) could be introduced through amidation reaction between NH2-terminated DNA strands and carboxyl groups on the Eu-MWCNTs, resulting in an increased ECL signal. The multiple amplification strategies, including the amplification of analyte recycling and HCR, and high ECL efficiency of Eu-MWCNTs lead to a wide linear range (1.0×10(-12)-5.0×10(-9) mol/L) and a low detection limit (0.23 pmol/L). The method was applied to serum sample analysis with satisfactory results.

  16. Spectrophotometric Determination and Removal of Unchelated Europium Ions from Solutions Containing Eu-Diethylenetriaminepentaacetic Acid Chelate-Peptide Conjugates1 (United States)

    Dayan Elshan, N. G. R.; Patek, Renata; Vagner, Josef; Mash, Eugene A.


    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination, as well as the success of metal ion removal upon attempted purification. We compared the use of Empore™ chelating disks and Chelex® 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore™ chelating disks were found to give much higher recoveries of the probes under the conditions utilized. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. PMID:25058927

  17. Reusable temperature-sensitive luminescent material based on vitrified film of europium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Lobkov, Vladimir S.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    We have proposed a novel temperature-sensitive luminescent material which is a 20 μm thick vitrified film (sandwiched between two quartz plates) fabricated from an amorphous powder of a mesogenic europium(III) β-diketonate complex through a melt-processing technique. The film photoexcited by a 337 nm pulsed nitrogen laser displays a typical Eu3+ ion luminescence bands with the strongest peak at 612 nm and with the decay time of 537 μs at 298 K. It is obtained that both the mean luminescence intensity and the luminescence decay time at 612 nm decrease significantly with temperature increasing from 298 to 348 K; the average values of the relative and absolute temperature sensitivities of the luminescence decay time in the range of 298-348 K are -1.2%·K-1 and -6.5 μs·K-1, respectively. The thermal quenching mechanism of the luminescent properties was analyzed and discussed. The experiments showed that, the luminescent properties of the film is insensitive to oxygen, the film is photostable under UV light, there is full reversibility of the temperature-dependent luminescence intensity and the decay time, and the high luminescence brightness of the film can be observed with violet light excitation. These factors indicated that the film is promising material for reusable luminescent thermometers, suitable for long-term monitoring in the range of 298-348 K.

  18. Differential ERK activation during autophagy induced by europium hydroxide nanorods and trehalose: Maximum clearance of huntingtin aggregates through combined treatment. (United States)

    Wei, Peng-Fei; Jin, Pei-Pei; Barui, Ayan Kumar; Hu, Yi; Zhang, Li; Zhang, Ji-Qian; Shi, Shan-Shan; Zhang, Hou-Rui; Lin, Jun; Zhou, Wei; Zhang, Yun-Jiao; Ruan, Ren-Quan; Patra, Chitta Ranjan; Wen, Long-Ping


    Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Synthesis of europium-doped VSOP, customized enhancer solution and improved microscopy fluorescence methodology for unambiguous histological detection. (United States)

    de Schellenberger, Angela Ariza; Hauptmann, Ralf; Millward, Jason M; Schellenberger, Eyk; Kobayashi, Yuske; Taupitz, Matthias; Infante-Duarte, Carmen; Schnorr, Jörg; Wagner, Susanne


    Intrinsic iron in biological tissues frequently precludes unambiguous the identification of iron oxide nanoparticles when iron-based detection methods are used. Here we report the full methodology for synthesizing very small iron oxide nanoparticles (VSOP) doped with europium (Eu) in their iron oxide core (Eu-VSOP) and their unambiguous qualitative and quantitative detection by fluorescence. The resulting Eu-VSOP contained 0.7 to 2.7% Eu relative to iron, which was sufficient for fluorescent detection while not altering other important particle parameters such as size, surface charge, or relaxivity. A customized enhancer solution with high buffer capacity and nearly neutral pH was developed to provide an antenna system that allowed fluorescent detection of Eu-VSOP in cells and histologic tissue slices as well as in solutions even under acidic conditions as frequently obtained from dissolved organic material. This enhancer solution allowed detection of Eu-VSOP using a standard fluorescence spectrophotometer and a fluorescence microscope equipped with a custom filter set with an excitation wavelength (λex) of 338 nm and an emission wavelength (λem) of 616 nm. The fluorescent detection of Eu-doped very small iron oxide nanoparticles (Eu-VSOP) provides a straightforward tool to unambiguously characterize VSOP biodistribution and toxicology at tissue, and cellular levels, providing a sensitive analytical tool to detect Eu-doped IONP in dissolved organ tissue and biological fluids with fluorescence instruments.

  20. Efficient solution-processed double-layer red OLEDs based on a new europium complex with a carbazole group. (United States)

    Liu, Jian; Miao, Jing-Sheng; Wu, Hong-Bin


    A new europium complex EuL3 (Phen) was used as guest dopant, and a blend of Polyvinylcarbazole and 2-(biphenyl-4-yl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole (PVK and PBD) as host matrix. Efficient red organic light-emitting devices (OLEDs) with double-layer structures were manufactured via a solution-processed technique. The guest-doped levels were 1, 3 and 5 wt% relative to the blend mass, respectively. For the 1 wt% doping-level device, the luminous efficiency and luminance were up to 2.96 cd/A and 635.78 cd/m(2) with emissions from both EuL3 (Phen) and from the host; for the 3 wt% doping-level device, the maximum luminous efficiency and luminance were 1.01 cd/A and 370.91 cd/m(2) for the single emission from EuL3 (Phen) only. Copyright © 2014 John Wiley & Sons, Ltd.

  1. Europium Nanospheres-Based Time-Resolved Fluorescence for Rapid and Ultrasensitive Determination of Total Aflatoxin in Feed. (United States)

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen


    Immunochromatographic (IC) assays are considered suitable diagnostic tools for the determination of mycotoxins. A europium nanospheres-based time-resolved fluorescence immunoassay (Eu-Nano-TRFIA), based on a monoclonal antibody and a portable TRFIA reader, was developed to determine total aflatoxin (including aflatoxins B1, B2, G1, and G2) levels in feed samples. Under optimized conditions, the Eu-Nano-TRFIA method detected total aflatoxin within 12 min. It showed good linearity (R(2) > 0.985), LOD of 0.16 μg/kg, a wide dynamic range of 0.48-30.0 μg/kg, recovery rates of 83.9-113.9%, and coefficients of variation (CVs) of 3.5-8.8%. In the 397 samples from company and livestock farms throughout China, the detection rate was 78.3%, concentrations were 0.50-145.30 μg/kg, the highest total aflatoxin content was found in cottonseed meal, and corn was found to be the most commonly contaminated feed. This method could be a powerful alternative for the rapid and ultrasensitive determination of total aflatoxin in quality control and meet the required Chinese maximum residue limits.

  2. Spectrophotometric determination and removal of unchelated europium ions from solutions containing Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. (United States)

    Elshan, N G R Dayan; Patek, Renata; Vagner, Josef; Mash, Eugene A


    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination as well as the success of metal ion removal on attempted purification. We compared the use of Empore chelating disks and Chelex 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore chelating disks were found to give much higher recoveries of the probes under the conditions used. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Formation and structural characterization of a europium(II mono(scorpionate complex and a sterically crowded pyrazabole

    Directory of Open Access Journals (Sweden)

    Phil Liebing


    Full Text Available The reaction of EuI2(THF2 with potassium hydrotris(3,5-diisopropylpyrazolylborate (K[HB(3,5-iPr2pz3] (= KTpiPr2, pz = pyrazolyl in a molar ratio of 1:1.5 resulted in extensive ligand fragmentation and formation of the europium(II mono(scorpionate complex bis(3,5-diisopropyl-1H-pyrazole[hydrotris(3,5-diisopropylpyrazolylborato]iodidoeuropium(II, [Eu(C27H46BN6I(C9H16N22] or (TpiPr2(3,5-iPr2pzH2EuIII, 1, in high yield (78%. As a typical by-product, small amounts of the sterically crowded pyrazabole derivative trans-4,8-bis(3,5-diisopropylpyrazol-1-yl-1,3,5,7-tetraisopropylpyrazabole, C36H62B2H8 or trans-{(3,5-iPr2pzHB(μ-3,5-iPr2pz}2, 2, were formed. Both title compounds have been structurally characterized through single-crystal X-ray diffraction. In 1, two isopropyl groups are each disordered over two orientations with occupancy ratios of 0.574 (10:0.426 (10 and 0.719 (16:0.281 (16. In 2, one isopropyl group is similarly disordered, occupancy ratio 0.649 (9:0.351 (9.

  4. Spectrofluorimetric study of the interaction between europium(III) and moxifloxacin in micellar solution and its analytical application (United States)

    Kamruzzaman, Mohammad; Alam, Al-Mahmnur; Lee, Sang Hak; Ragupathy, Dhanusuraman; Kim, Young Ho; Park, Sang-Ryoul; Kim, Sung Hong


    A sensitive spectrofluorimetric method has been developed for the determination of moxifloxacin (MOX) using europium(III)-MOX complex as a fluorescence probe in the presence of an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS). The fluorescence (FL) intensity of Eu 3+ was enhanced by complexation with MOX at 614 nm after excitation at 373 nm. The FL intensity of the Eu 3+-MOX complex was significantly intensified in the presence of SDBS. Under the optimum conditions, it was found that the enhanced FL intensity of the system showed a good linear relationship with the concentration of MOX over the range of 1.8 × 10 -11-7.3 × 10 -9 g mL -1 with a correlation coefficient of 0.9998. The limit of detection of MOX was found to be 2.8 × 10 -12 g mL -1 with relative standard deviation (RSD) of 1.25% for 5 replicate determination of 1.5 × 10 -8 g mL -1 MOX. The proposed method is simple, offers higher sensitivity with wide linear range and can be successfully applied to determine MOX in pharmaceutical and biological samples with good reproducibility. The luminescence mechanism is also discussed in detail with ultraviolet absorption spectra.

  5. Photoluminescence properties of europium doped di-strontium magnesium di-silicate phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available Europium doped di-strontium magnesium di-silicate phosphor namely (Sr2MgSi2O7:Eu3+ was prepared by the traditional high temperature solid state reaction method. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P42¯1m, this structure is a member of the melilite group and forms a layered compound. The EDX and FTIR spectra confirm the present elements in Sr2MgSi2O7:Eu3+ phosphor. Photoluminescence measurements showed that the phosphor exhibited strong emission peak with good intensity, corresponding to 5D0 → 7F2 (613 nm red emission and weak 5D0 → 7F1 (590 nm orange emission. The excitation spectra monitored at 613 nm show broad band from 220 to 300 nm ascribed to O–Eu charge-transfer band (CTB centered at about 269 nm, and the other peaks in the range of 300–400 nm originated from f–f transitions of Eu3+ ions. The strongest band at 395 nm can be assigned to 7F0 / 5L6 transition of Eu3+ ions due to the typical f–f transitions within Eu3+ of 4f6 configuration.

  6. Highly selective luminescent sensing of picric acid based on a water-stable europium metal-organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Tifeng; Zhu, Fengliang; Cui, Yuanjing, E-mail:; Yang, Yu; Wang, Zhiyu; Qian, Guodong, E-mail:


    A water-stable metal-organic framework (MOF) EuNDC has been synthesized for selective detection of the well-known contaminant and toxicant picric acid (PA) in aqueous solution. Due to the photo-induced electron transfer and self-absorption mechanism, EuNDC displayed rapid, selective and sensitive detection of PA with a detection limit of 37.6 ppb. Recyclability experiments revealed that EuNDC retains its initial luminescent intensity and same quenching efficiency in each cycle, suggesting high photostability and reusability for long-term sensing applications. The excellent detection performance of EuNDC makes it a promising PA sensing material for practical applications. - Graphical abstract: A water-stable europium-based metal-organic framework has been reported for highly selective sensing of picric acid (PA) with a detection limit of 37.6 ppb in aqueous solution. - Highlights: • A water-stable metal-organic framework (MOF) EuNDC was synthesized. • The highly selective detection of picric acid with a detection limit of 37.6 ppb was realized. • The detection mechanism were also presented and discussed.

  7. One-pot carbonization synthesis of europium-doped carbon quantum dots for highly selective detection of tetracycline (United States)

    Li Liu, Meng; Chen, Bin Bin; Yang, Tong; Wang, Jian; Liu, Xi Dong; Zhi Huang, Cheng


    The detection of tetracycline is of great significance because of its damaging effects on human health, such as renal toxicity and hemolytic anemia. Any release of tetracycline into the surrounding environment can produce bacterial drug resistance. We develop a new sensitive and selective detection approach for tetracycline in complex water samples by preparing europium-doped carbon quantum dots (Eu-CQDs) through a simple and rapid carbonization method operating at 200 °C for 5 min. The Eu-CQDs are characterized by blue photoluminescence, excitation-wavelength-dependent emission and excellent stability. Importantly, the fluorescence of the Eu-CQDs can be quenched efficiently by tetracycline, based on the strong inner filter effect mechanism between Eu-CQDs and tetracycline, making the fluorescence intensity ratio (I 0/I) of the Eu-CQDs at 465 nm correlate linearly with the concentration of tetracycline in the range of 0.5-200 μM, with a limit of detection of 0.3 μM. This shows the broad applicability of the Eu-CQDs in pursuing the concepts of simplicity and specificity for analytical purposes.

  8. Mesoporous Europium-Doped Titania Nanoparticles (Eu-MTNs) for Luminescence-Based Intracellular Bio-Imaging. (United States)

    Chen, Kuan-Chou; Dutta, Saikat; Yamauchi, Yusuke; Alshehri, Saad M; Nguyen, Mai Thanh; Yonezawa, Tetsu; Shen, Kun-Hung; Wu, Kevin C W


    Monodisperse and mesoporous europium (Eu)-doped titania nanoparticles (denoted as Eu-MTNs) were prepared by a co-synthesis method with the presence of a cationic surfactant (i.e., CTAB). A maximum loading amount of 8 mol% of Eu could be successfully incorporated into the framework of MTNs. The synthesized Eu-MTNs samples were characterized with X-ray diffraction (XRD) and scanning electron microscopy (SEM), with their luminescent property examined by photoluminescence (PL). Under ultraviolet irradiation, the Eu-MTNs samples exhibit several characteristic luminescence corresponding to 5D0-7F(j) for Eu+3 ions, which can be attributed to the energy transfer from titania nanocrystallite to Eu3+ ions dispersed in amorphous mesoporous titania region. The potential intracellular bio-imaging application of the synthesized Eu-MTN nanoparticles was demonstrated with a breast cancer cell line (i.e., BT-20). High biocompatibility and strong luminescence of the Eu-MTNs show great potential in biomedical applications.

  9. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans. (United States)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben


    Membrane reshaping resides at the core of many important cellular processes, and among its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3 (orf19.1861). We show that Rvs167-3 specifically interacts with Rvs162 to form a stable BAR heterodimer able to bind liposomes in vitro. A second, distinct heterodimer is formed by the canonical BAR proteins Rvs161 and Rvs167. Purified Rvs161/Rvs167 complex also binds liposomes, indicating that C. albicans expresses two functional BAR heterodimers. We used live-cell imaging to localize green fluorescent protein (GFP)-tagged Rvs167-3 and Rvs167 and show that both proteins concentrate in small cortical spots. However, while Rvs167 strictly colocalizes with the endocytic marker protein Abp1, we do not observe any colocalization of Rvs167-3 with sites of endocytosis marked by Abp1. Furthermore, the rvs167-3Δ/Δ mutant is not defective in endocytosis and strains lacking Rvs167-3 or its partner Rvs162 do not display increased sensitivity to high salt concentrations or decreased cell wall integrity, phenotypes which have been observed for rvs167Δ/Δ and rvs161Δ/Δ strains and which are linked to endocytosis defects. Taken together, our results indicate different roles for the two BAR heterodimers in C. albicans: the canonical Rvs161/Rvs167 heterodimer functions in endocytosis, whereas the novel Rvs162/Rvs167-3 heterodimer seems not to be involved in this process. Nevertheless, despite their different roles, our phenotypic analysis revealed a genetic interaction between the two BAR heterodimers, suggesting that they may have related but distinct membrane-associated functions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. The europium and praseodymium hydrolysis in a 2M NaCl environment; La hidrolisis del europio y del praseodimio en un medio 2M de NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)


    It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)

  11. Specific chiral sensing of amino acids using induced circularly polarized luminescence of bis(diimine)dicarboxylic acid europium(III) complexes. (United States)

    Okutani, Kazuhiro; Nozaki, Koichi; Iwamura, Munetaka


    The circularly polarized luminescence (CPL) from [Eu(pda)2](-) (pda = 1,10-phenanthroline-2,9-dicarboxylic acid) and [Eu(bda)2](-) (bda = 2,2'-bipyridine-6,6'-dicarboxylic acid) in aqueous solutions containing various amino acids was investigated. The europium(III) complexes exhibited bright-red luminescence assignable to the f-f transition of the Eu(III) ion when irradiated with UV light. Although the luminescence was not circularly polarized in the solid state or in aqueous solutions, in accordance with the achiral crystal structure, the complexes exhibited detectable induced CPL (iCPL) in aqueous solutions containing chiral amino acids. In the presence of L-pyrrolidonecarboxylic acid, both [Eu(pda)2](-) and [Eu(bda)2](-) showed similar iCPL intensity (glum ∼ 0.03 for the (5)D0 → (7)F1 transition at 1 mol·dm(-3) of the amino acid). On the other hand, in the presence of L-histidine or L-arginine, [Eu(pda)2](-) exhibited intense CPL (glum ∼ 0.08 for the (5)D0 → (7)F1 transition at 0.10 mol·dm(-3) of the amino acid), whereas quite weak CPL was observed for [Eu(bda)2](-) under the same conditions (glum europium(III) complexes possess coordination structures similar to that in the crystal with slight distortion to form a chiral structure due to specific interaction with two zwitterionic amino acids. This mechanism was in stark contrast to that of the europium(III) complex-pyrrolidonecarboxylic acid system in which one amino acid coordinates to the Eu(III) ion to yield an achiral coordination structure.

  12. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays. (United States)

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun


    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  13. Europium-activated phosphors containing oxides of rare-earth and group-IIIB metals and method of making the same (United States)

    Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan


    Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.

  14. Synthesis and pharmacological characterization of a europium-labelled single-chain antagonist for binding studies of the relaxin-3 receptor RXFP3. (United States)

    Haugaard-Kedström, Linda M; Wong, Lilian L L; Bathgate, Ross A D; Rosengren, K Johan


    Relaxin-3 and its endogenous receptor RXFP3 are involved in fundamental neurological signalling pathways, such as learning and memory, stress, feeding and addictive behaviour. Consequently, this signalling system has emerged as an attractive drug target. Development of leads targeting RXFP3 relies on assays for screening and ligand optimization. Here, we present the synthesis and in vitro characterization of a fluorescent europium-labelled antagonist of RXFP3. This ligand represents a cheap and safe but powerful tool for future mechanistic and cell-based receptor-ligand interaction studies of the RXFP3 receptor.

  15. Bis{[6-methoxy-2-(4-methylphenyliminiomethyl]phenolate-κ2O,O′}tris(nitrato-κ2O,O′europium(III

    Directory of Open Access Journals (Sweden)

    Hang-Ming Guo


    Full Text Available The crystal structure of title compound, [Eu(NO33(C15H15NO22], contains two Schiff base 6-methoxy-2-[(4-methylphenyliminomethyl]phenolate (L ligands and three independent nitrate ions that chelate to the europium(III ion via the O atoms. The coordination number of the EuIII ion is ten. The L ligands chelate with a strong Eu—O(deprotonated phenolate bond and a weak Eu—O(methoxy contact, the latter can be interpreted as the apices of the bicapped square-antiprismatic EuIII polyhedron. Intramolecular N—H...O hydrogen bonds occur.

  16. 46 CFR 167.15-15 - Application for inspection of a new nautical school ship or a conversion of a vessel to a... (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Application for inspection of a new nautical school ship or a conversion of a vessel to a nautical school ship. 167.15-15 Section 167.15-15 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Inspections § 167.15-15 Application for inspection of...

  17. Carbon footprint assessment of recycling technologies for rare earth elements: A case study of recycling yttrium and europium from phosphor. (United States)

    Hu, Allen H; Kuo, Chien-Hung; Huang, Lance H; Su, Chao-Chin


    Rare earth elements are key raw materials in high-technology industries. Mining activities and manufacturing processes of such industries have caused considerable environmental impacts, such as soil erosion, vegetation destruction, and various forms of pollution. Sustaining the long-term supply of rare earth elements is difficult because of the global shortage of rare earth resources. The diminishing supply of rare earth elements has attracted considerable concern because many industrialized countries regarded such elements as important strategic resources for economic growth. This study aims to explore the carbon footprints of yttrium and europium recovery techniques from phosphor. Two extraction recovery methods, namely, acid extraction and solvent extraction, were selected for the analysis and comparison of carbon footprints. The two following functional units were used: (1) the same phosphor amounts for specific Y and Eu recovery concentrations, and (2) the same phosphor amounts for extraction. For acid extraction method, two acidic solutions (H2SO4 and HCl) were used at two different temperatures (60 and 90°C). For solvent extraction method, acid leaching was performed followed by ionic liquid extraction. Carbon footprints from acid and solvent extraction methods were estimated to be 10.1 and 10.6kgCO2eq, respectively. Comparison of the carbon emissions of the two extraction methods shows that the solvent extraction method has significantly higher extraction efficiency, even though acid extraction method has a lower carbon footprint. These results may be used to develop strategies for life cycle management of rare earth resources to realize sustainable usage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Europium doped di-calcium magnesium di-silicate orange–red emitting phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available A new orange–red europium doped di-calcium magnesium di-silicate (Ca2MgSi2O7:Eu3+ phosphor was prepared by the traditional high temperature solid state reaction method. The prepared Ca2MgSi2O7:Eu3+ phosphor was characterized by X-ray diffractometer (XRD, transmission electron microscopy (TEM, field emission scanning electron microscopy (FESEM with energy dispersive x-ray spectroscopy (EDX, fourier transform infrared spectra (FTIR, photoluminescence (PL and decay characteristics. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P4¯21m, this structure is a member of the melilite group and forms a layered compound. The chemical composition of the sintered Ca2MgSi2O7:Eu3+ phosphor was confirmed by EDX spectra. The PL spectra indicate that Ca2MgSi2O7:Eu3+ can be excited effectively by near ultraviolet (NUV light and exhibit bright orange–red emission with excellent color stability. The fluorescence lifetime of Ca2MgSi2O7:Eu3+ phosphor was found to be 28.47 ms. CIE color coordinates of Ca2MgSi2O7:Eu3+ phosphor is suitable as orange-red light emitting phosphor with a CIE value of (X = 0.5554, Y = 0.4397. Therefore, it is considered to be a new promising orange–red emitting phosphor for white light emitting diode (LED application.

  19. Evaluation of in vivo cytogenetic toxicity of europium hydroxide nanorods (EHNs) in male and female Swiss albino mice. (United States)

    Bollu, Vishnu Sravan; Nethi, Susheel Kumar; Dasari, Rama Krishna; Rao, Soma Shiva Nageshwara; Misra, Sunil; Patra, Chitta Ranjan


    Our group already demonstrated that europium hydroxide nanorods (EHNs) show none or mild toxicity in C57BL/6 mice even at high dose and exhibited excellent pro-angiogenic activity towards in vitro and in vivo models. In the present study, we evaluated the in vivo cytogenetic toxicity of intraperitoneally administered EHNs (12.5-250 mg/kg/b.w.) in male and female Swiss albino mice by analyzing chromosomal aberrations (CAs), mitotic index (MI), micronucleus (MN) from bone marrow and peripheral blood. Furthermore, we performed the cytogenetic toxicity study of EHNs towards Chinese hamster ovary (CHO) cells, in order to compare with the in vivo results. The results of CA assay of mice treated with EHNs (12.5-125 mg/kg/b.w.) showed no significant change in the formation of aberrant metaphases compared to the control group. Also, there was no significant difference in the number of dividing cells between the control group and EHNs-treated groups observed by MI study, suggesting the non-cytotoxicity of EHNs. Additionally, FACS study revealed that EHNs do not arrest cells at any phase of cell cycle in the mouse model. Furthermore, MN test of both bone marrow and peripheral blood showed no significant differences in the induction of MNs when compared with the control group. In vitro results from CHO cells also support our in vivo observations. Considering the role of angiogenesis by EHNs and the absence of its genotoxicity in mouse model, we strongly believe the future application of EHNs in treating various diseases, where angiogenesis plays an important role such as cardiovascular diseases, ischemic diseases and wound healing.

  20. 78 FR 44600 - 167th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... Benefits Security Administration 167th Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be... Segments, (2), Locating Missing and Lost Participants, and (3) Private Sector Pension De-risking and...

  1. 20 CFR 669.560 - Are there regulatory and/or statutory waiver provisions that apply to WIA section 167? (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are there regulatory and/or statutory waiver provisions that apply to WIA section 167? 669.560 Section 669.560 Employees' Benefits EMPLOYMENT AND TRAINING..., allocation of funds, procedures for review and approval of plans; and (3) Not related to the key reform...

  2. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline (United States)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir


    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  3. Investigation on the co-luminescence effect of europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system and its application. (United States)

    Si, Hailin; Zhao, Fang; Cai, Huan


    A novel luminescence, enhancement phenomenon in the europium(III)-dopamine-sodium dodecylbenzene sulfonate system was observed when lanthanum(III) was added. Based on this, a sensitive co-luminescence method was established for the determination of dopamine. The luminescence signal for the europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system was monitored at λ(ex) = 300 nm, λ(em) = 618 nm and pH 8.3. Under optimized conditions, the enhanced luminescence signal responded linearly to the concentration of dopamine in the range 1.0 × 10(-10)-5.0 × 10(-7) mol/L with a correlation coefficient of 0.9993 (n = 11). The detection limit (3σ) was 2.7 × 10(-11) mol/L and the relative standard deviation for 11 parallel measurements of 3.0 × 10(-8) mol/L dopamine was 1.9%. The presented method was successfully applied for the estimation of dopamine in samples of pharmaceutical preparations, human serum and urine. The possible luminescence enhancement mechanism of the system is discussed briefly. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Europium-phenolic network coated BaGdF5 nanocomposites for tri-modal computed tomography/magnetic resonance/luminescence imaging. (United States)

    Zhu, Wei; Liang, Shuang; Wang, Jing; Yang, Zhe; Zhang, Li; Yuan, Tianmeng; Xu, Zushun; Xu, Haibo; Li, Penghui


    Multifunctional nanocomposites based on BaGdF5 nanoparticles (NPs) and metal phenolic network (MPN) have been engineered as novel contrast agents for potential applications in X-ray computed tomography, magnetic resonance and luminescence imaging. The BaGdF5@MPN nanocomposites were synthesized at room temperature by coating BaGdF5 NPs with europium-phenolic network, which was obtained by the coordination of europium (III) with tannic acid (TA). The in vitro cytotoxicity assays against HepG2 cells revealed that the BaGdF5@MPN nanocomposites presented better cytocompatibility and lower cytotoxity than pure BaGdF5 NPs. In addition, vivid red and green luminescence can be observed by confocal laser scanning microscope (CLSM) from the BaGdF5@MPN nanocomposites laden HepG2 cells under the excitation of UV (390 nm) and visible light (440 nm), respectively. The longitudinal relaxivity value (r1) of the nanocomposites was 2.457 mM-1s-1. Moreover, the nanocomoposites exhibited X-ray computed tomography (CT) and T1-weighted magnetic resonance (MR) imaging capacities, and the intensities of the enhanced signals of in vitro CT and MR images were proportional to the concentrations of the nanocomposites. These results indicated that the as-prepared BaGdF5@MPN nanocomposites are promising contrast agents for CT/MR/luminescence imaging.

  5. Effective visible light-active boron and europium co-doped BiVO4 synthesized by sol-gel method for photodegradion of methyl orange. (United States)

    Wang, Min; Che, Yinsheng; Niu, Chao; Dang, Mingyan; Dong, Duo


    Eu-B co-doped BiVO4 visible-light-driven photocatalysts have been synthesized using the sol-gel method. The resulting materials were characterized by a series of joint techniques, including XPS, XRD, SEM, BET, and UV-vis DRS analyses. Compared with BiVO4 and B-BiVO4 photocatalysts, the Eu-B-BiVO4 photocatalysts exhibited much higher photocatalytic activity for methyl orange (MO) degradation under visible light irradiation. The optimal Eu doping content is 0.8 mol%. It was revealed that boron and europium were doped into the lattice of BiVO4 and this led to more surface oxygen vacancies, high specific surface areas, small crystallite size, a narrower band gap and intense light absorbance in the visible region. The doped Eu(III) cations can help in the separation of photogenerated electrons. The synergistic effects of boron and europium in doped BiVO4 were the main reason for improving visible light photocatalytic activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Emission tunability and local environment in europium-doped OH{sup −}-free calcium aluminosilicate glasses for artificial lighting applications

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others


    The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.

  7. Adenomas da hipófise: estudo imuno-histoquímico de 167 casos

    Directory of Open Access Journals (Sweden)

    Lígia M. Barbosa-Coutinho


    Full Text Available Foram analisados 167 casos de adenomas da hipófise pelo método imuno-histo-químico utilizando o Complexo da Avidina Biotina (ABC descrito por Hsu e col. (1981. Foram usados 6 anti-hormônios hipofisários: anti-prolactina (aPRL, na diluição de 1:1.500, anti-hormônio do crescimento (aHGH, na diluição de 1:4.000, anti-hormônio adrenocortico-trófico (aACTH, na diluição de 1:3.000, anti-hormônio tireotrófico (aTSH, na diluição de 1:3.000, anti-hormônio luteinizante (aLH, na diluição de 1:1.000, anti-hormônio folículo estimulante (aFSH, na diluição de 1:300. O período de incubação foi de 14 a 16 horas a 4ºC. Foi realizada também a coloração pelo Orange G-PAS. O levantamento dos dados clínicos, laboratoriais, e radiológicos dos casos de adenomas da hipófise foi realizado após a leitura das lâminas pelo método imuno-histoquímico. Dos 167 casos de adenomas da hipófise, 136 (81,4% mostraram imuno-reação positiva a um ou mais anti-hormônios, variando o índice de positividade entre 1 e 90% das células neoplásicas. A imuno-reação foi positiva exclusivamente a um anti-hormônio em 80 casos (58,8% e para dois ou mais anti-hormônios nos 56 casos restantes (41,2%, sendo a associação mais freqüentemente encontrada aquela em aue a positividade ocorreu para o aPRL e o aHGH. A positividade à reação imuno-his-toquímica distribuiu-se da seguinte forma: 100 casos foram positivos para o aPRL, em 49 pacientes de forma isolada; 65 casos foram positivos para o aHGH, em 22 pacientes de forma isolada; 31 casos foram positivos para o aACTH, em 8 pacientes de forma isolada; 5 casos foram positivos ao aTSH, em um paciente de forma isolada; um paciente apresentou adenoma positivo ao aLH; um caso foi positivo ao aFSH.

  8. Three-phase 16.7 Hz system for the transmission of offshore wind power. Pt. 1. System and components; Dreiphasiges 16,7-Hz-System fuer die Uebertragung von Offshore-Windenergie. T. 1. System und Komponenten

    Energy Technology Data Exchange (ETDEWEB)

    Braun, Rainer [DB Energie GmbH, Frankfurt am Main (Germany). Anlagen- und Projektmanagement; Erlich, Istvan [Duisburg-Essen Univ., Duisburg (Germany). Fachgebiet Elektrische Anlagen und Netze; Brakelmann, Heinrich [CCB Cable Consulting, Rheinberg (Germany); Meng, Xing [Duisburg-Essen Univ., Duisburg (Germany); Fischer, Wilfried


    The current transmission in a three-phase power cable is limited to a frequency of 50 Hz due to the length of the charging current. If the frequency is reduced, then the cable may be longer. In the first part of this contribution the system and components are presented for the use of 16.7 Hz technology in offshore wind farms. In the second part, to be published in the next issue, the authors examine the technical opportunities of a 16.7 Hz system on the basis of load flow calculations for a hypothetical wind grid system in the North Sea. The results demonstrate the technical feasibility. It is shown that a three-phase 245 kV submarine cable may transfer nearly 600 MW - with cable lengths of more than 500 km.

  9. Determination of the hydrolysis constants of Europium (III), in ion strength media 4, 5 and 6 M NaClO{sub 4} at 303 K; Determinacion de las constantes de hidrolisis del Europio (III), en medios de fuerza ionica 4, 5 y 6 M de NaClO{sub 4} a 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado B, A.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)


    This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC{sub H} values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)

  10. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  11. Europium-Labeled Synthetic C3a Protein as a Novel Fluorescent Probe for Human Complement C3a Receptor. (United States)

    Dantas de Araujo, Aline; Wu, Chongyang; Wu, Kai-Chen; Reid, Robert C; Durek, Thomas; Lim, Junxian; Fairlie, David P


    Measuring ligand affinity for a G protein-coupled receptor is often a crucial step in drug discovery. It has been traditionally determined by binding putative new ligands in competition with native ligand labeled with a radioisotope of finite lifetime. Competing instead with a lanthanide-based fluorescent ligand is more attractive due to greater longevity, stability, and safety. Here, we have chemically synthesized the 77 residue human C3a protein and conjugated its N-terminus to europium diethylenetriaminepentaacetate to produce a novel fluorescent protein (Eu-DTPA-hC3a). Time-resolved fluorescence analysis has demonstrated that Eu-DTPA-hC3a binds selectively to its cognate G protein-coupled receptor C3aR with full agonist activity and similar potency and selectivity as native C3a in inducing calcium mobilization and phosphorylation of extracellular signal-regulated kinases in HEK293 cells that stably expressed C3aR. Time-resolved fluorescence analysis for saturation and competitive binding gave a dissociation constant (Kd) of 8.7 ± 1.4 nM for Eu-DTPA-hC3a and binding affinities for hC3a (pKi of 8.6 ± 0.2 and Ki of 2.5 nM) and C3aR ligands TR16 (pKi of 6.8 ± 0.1 and Ki of 138 nM), BR103 (pKi of 6.7 ± 0.1 and Ki of 185 nM), BR111 (pKi of 6.3 ± 0.2 and Ki of 544 nM) and SB290157 (pKi of 6.3 ± 0.1 and Ki of 517 nM) via displacement of Eu-DTPA-hC3a from hC3aR. The macromolecular conjugate Eu-DTPA-hC3a is a novel nonradioactive probe suitable for studying ligand-C3aR interactions with potential value in accelerating drug development for human C3aR in physiology and disease.

  12. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  13. Stationary and coherent spectroscopy of 167Er3+ in waveguides in 7LiYF4 crystal

    Directory of Open Access Journals (Sweden)

    Minnegaliev Mansur


    Full Text Available We have conducted a spectroscopic investigation of 167Er3+ ions in optical waveguides on an optical transition between the hyperfine sublevels of 4I15/2 and 4I9/2 multiplets. Waveguides with diameters ranging from 20 to 100 µm were produced in the crystal by a femtosecond laser using the depressed-cladding approach. The spectroscopy results of 167Er3+ ions inside the waveguides show additional broadening and an overall shifts of the spectra compared to the bulk spectrum of ions. The sign of the observed frequency shift depends on the diameter of the specific waveguide. We have also observed a two-pulse photon echo in several waveguides. The acquired results show the possibility for integrated quantum schemes in rare-earth ions doped crystals.

  14. A refined Panax ginseng karyotype based on an ultra-high copy 167-bp tandem repeat and ribosomal DNAs

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal


    Conclusion: Identification of individual P. ginseng chromosomes was achieved using Pg167TR-FISH. Chromosome identification is important in understanding the P. ginseng genome structure, and our method will be useful for future integration of genetic linkage maps and genome scaffold anchoring. Additionally, it is a good tool for comparative studies with related species in efforts to understand the evolution of P. ginseng.

  15. Superconductivity and valence state in layered single-crystal HfAs1.67Te0.12 (United States)

    Peng, Jian; Yu, Jia; Zhang, Shuai; Chen, Genfu


    We report a detailed study on single crystals of HfAs1.67Te0.12 within a PbFCl-type layered structure. The single crystals of the title compound were successfully grown using a chemical transport reaction. The temperature dependence of electrical resistivity ρ (T), AC magnetic susceptibility {χ }{AC}(T) and specific heat C(T) show a bulk superconductivity with transition temperature T c = 1.67 K. The jump of C/T at T c is comparable to the traditional BCS weak-coupling model. A full H–T phase diagram is established using the results of ρ (T,H) and C(T) under fields, suggesting a rather weak anisotropy [({H}c2\\parallel {ab}(0)/{H}c2\\parallel c(0)] of 1.8 in orbital limit dominated three-dimension-like superconducting system. The mixed-valence states of Hf and As observed in the binding energy from x-ray photoelectron spectroscopy are consistent with the single-crystal x-ray diffraction analysis, indicating that the As–Te disorder prefers to occur in the [HfAs] layer and a large amount of vacancies are present in tetragonal As layer. As compared to HfAs1.7Se0.2 (T c = 0.52 K), a positive-like vacancy effect on T c has been confirmed in HfAs1.67Te0.12. The analysis of the Hall coefficient implies that the hole-type carriers dominate the transport properties, which is in good agreement with the hole pockets at Fermi surface obtained in a band structure calculation. The detailed study of single-crystal HfAs1.67Te0.12 provides a possible candidate to discuss the non-magnetic Kondo effect.

  16. Association between cotinine-verified smoking status and hypertension in 167,868 Korean adults. (United States)

    Kim, Byung Jin; Han, Ji Min; Kang, Jung Gyu; Kim, Bum Soo; Kang, Jin Ho


    Previous studies showed inconsistent results concerning the relationship between chronic smoking and blood pressure. Most of the studies involved self-reported smoking status. This study was performed to evaluate the association of urinary cotinine or self-reported smoking status with hypertension and blood pressure in Korean adults. Among individuals enrolled in the Kangbuk Samsung Health Study and Kangbuk Samsung Cohort Study, 167,868 participants (men, 55.7%; age, 37.5 ± 6.9 years) between 2011 and 2013 who had urinary cotinine measurements were included. Individuals with urinary cotinine levels ≥50 ng/mL were defined as cotinine-verified current smokers. The prevalence of hypertension and cotinine-verified current smokers in the overall population was 6.8% and 22.7%, respectively (10.0% in men and 2.8% in women for hypertension: 37.7% in men and 3.9% in women for cotinine-verified current smokers). In a multivariate regression analysis adjusted for age, sex, body mass index, waist circumference, alcohol drinking, vigorous exercise, and diabetes, cotinine-verified current smoking was associated with lower prevalence of hypertension compared with cotinine-verified never smoking (OR[95% CI], 0.79 [0.75, 0.84]). Log-transformed cotinine levels and unobserved smoking were negatively associated with hypertension, respectively (0.96 [0.96, 0.97] and 0.55 [0.39, 0.79]). In a multivariate linear regression analysis, the cotinine-verified current smoking was inversely associated with systolic and diastolic blood pressure (BP) (regression coefficient[95% CI], -1.23[-1.39, -1.07] for systolic BP and -0.71 [-0.84, -0.58] for diastolic BP). In subgroup analyses according to sex, the inverse associations between cotinine-verified current smoking and hypertension were observed only in men. This large observational study showed that cotinine-verified current smoking and unobserved smoking were inversely associated with hypertension in Korean adults, especially only in

  17. Tank 241-AN-103, cores 166 and 167 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Steen, F.H.


    This document is the analytical laboratory report for tank 241-AN-103 [Hydrogen Watch Listed] push mode core segments collected between September 13, 1996 and September 23, 1996. The segments were subsampled and analyzed in accordance with the Tank 241-AN-103 Push Mode Core Sampling and Analysis Plan (TSAP), the Safety Screening Data Quality Objective (DQO) and the Flammable Gas Data Quality Objective (DQO). The analytical results are included in the data summary table. The raw data are included in this document. None of the samples submitted for Total Alpha Activity (AT), Total Organic Carbon (TOC) and Plutonium analyses exceeded notification limits as stated in the TSAP. One sample submitted for Differential Scanning Calorimetry (DSC) analysis exceeded the notification limit of 480 Joules/g (dry weight basis) as stated in the Safety Screening DQO. Appropriate notifications were made. Statistical evaluation of results by calculating the 95% upper confidence limit is not performed by the 222-S Laboratory and is not considered in this report. Appearance and Sample Handling Attachment 1 is a cross reference to relate the tank farm identification numbers to the 222-S Laboratory LabCore/LIMS sample numbers. The subsamples generated in the laboratory for analyses are identified in these diagrams with their sources shown. The diagrams identifying the core composites are also included. Core 166 Nineteen push mode core segments were removed from tank 241-AN-103 riser 12A between September 13, 1996 and September 17, 1996. Segments were received by the 222-S Laboratory between September 20, 1996 and September 30, 1996. Table 2 summarizes the extrusion information. Selected segments (2, 5 and 14) were sampled using the Retained Gas Sampler (RGS) and extruded by the Process Chemistry and Statistical Analysis Group. Core 167 Eighteen push mode core segments were removed from tank 241-AN-103 riser 21A between September 18, 1996 and September 23, 1996. Tank Farm Operations were

  18. Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

    Energy Technology Data Exchange (ETDEWEB)

    Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee


    This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

  19. Complexation of lactate with neodymium(III) and europium(III) at variable temperatures: studies by potentiometry, microcalorimetry, optical absorption, and luminescence spectroscopy. (United States)

    Tian, Guoxin; Martin, Leigh R; Rao, Linfeng


    The complexation of neodymium(III) and europium(III) with lactate was studied at variable temperatures by potentiometry, absorption spectrophotometry, luminescence spectroscopy, and microcalorimetry. The stability constants of three successive lactate complexes (ML(2+), ML(2)(+), and ML(3)(aq), where M stands for Nd and Eu and L stands for lactate) at 10, 25, 40, 55, and 70 °C were determined. The enthalpies of complexation at 25 °C were determined by microcalorimetry. Thermodynamic data show that the complexation of trivalent lanthanides (Nd(3+) and Eu(3+)) with lactate is exothermic and the complexation becomes weaker at higher temperatures. Results from optical absorption and luminescence spectroscopy suggest that the complexes are inner-sphere chelate complexes in which the protonated α-hydroxyl group of lactate participates in the complexation.

  20. Selective separation of americium from europium using 2,9-bis(triazine)-1,10-phenanthrolines in ionic liquids: a new twist on an old story. (United States)

    Williams, Neil J; Dehaudt, Jérémy; Bryantsev, Vyacheslav S; Luo, Huimin; Abney, Carter W; Dai, Sheng


    Bis-triazine phenanthrolines have shown great promise for f-block metal separations, attributable to their highly preorganized structure, nitrogen donors, and more enhanced covalent bonding with actinides over lanthanides. However, their limited solubility in traditional solvents remains a technological bottleneck. Herein we report our recent work using a simple 2,9-bis(triazine)-1,10-phenanthroline (Me-BTPhen) dissolved in an ionic liquid (IL), demonstrating the efficacy of IL extraction systems for the selective separation of americium from europium, achieving separation factors in excess of 7500 and selectively removing up to 99% of the americium. Characterization of the coordination environment was performed using a combination of X-ray absorption fine structure spectroscopy (XAFS) and density functional theory (DFT) calculations.

  1. Experimental and Theoretical Studies on the Structure and Photoluminescent Properties of New Mononuclear and Homodinuclear Europium(III β-Diketonate Complexes

    Directory of Open Access Journals (Sweden)

    João P. Martins


    Full Text Available Two novel europium(III complexes, a monomer and a homodimer, with 1-(4-chlorophenyl-4,4,4-trifluoro-1,3-butanedione (Hcbtfa and 5-chloro-1,10-phenanthroline (cphen ligands, formulated as [Eu(cbtfa3(cphen] and [Eu2(cbtfa4(cphen2(CH3O2], have been synthesized. Their structures have been elucidated by X-ray diffraction and their absorption and emission properties have been studied in the solid state. The experimental data has then been used to test the recently released LUMPAC software, a promising tool which can facilitate the design of more efficient lanthanide light-conversion molecular devices by combining ground state geometry, excited state energy, and luminescent properties calculations.

  2. Optical Temperature Probe Based on the Fluorescence Decay Time of Tris-(dibenzoylmethane mono (5-amino-1,10-phenanthroline-europium(III

    Directory of Open Access Journals (Sweden)

    Hung T. LAM


    Full Text Available The measurement of temperature is essential in defining the physical and chemical properties of any system. This is particularly true in dynamic systems where the temperature may fluctuate during the process. In this paper we investigated the potential of tris-(dibenzoylmethane mono (5-amino-1, 10-phenanthroline-europium(III ( Eu[tdap] as an optical temperature probe. The principle of the measurement is based on the temperature dependence of the fluorescence decay time of Eu(tdap embedded in polystyrene. Within the investigated temperature range between 3 and 70°C a linear correlation between temperature and decay time was found. The probe is accurate and repeatable and there is no cross-sensitivity to pH changes. Continuous measurement for more than 2.5 hours at which the temperature is switched between two different temperatures shows no signal drift. The relative standard deviation is less than 0.65 percent.

  3. Crystal structure and luminescence of a europium coordination polymer {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞ (United States)

    Li, X.; Zheng, X.; Jin, L.; Lu, S.; Qin, W.


    The structure of the complex [Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy) ( m-MOBA: m-methoxybenzoate, 4,4'-bpy: 4,4'-bipyridine) was determined by single crystal X-ray diffraction. The bonding around each europium consists of two oxygen atoms of the chelated carboxyl group, two oxygen atoms of two water molecules and four oxygen atoms of the bidentate bridging carboxylate groups, forming an infinite polymeric chain structure. The luminescence behaviour of Eu 3+ in {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞ was observed at 77 K. The emission spectra of 5D 1→ 7F J ( J=1-3) and 5D 0→ 7F J ( J=0-4) transitions were recorded. The complex displays intense luminescence which may be related to the m-MOBA ligand and the polymeric coordination.

  4. Synthesis and luminescence properties of two novel europium (III) perchlorate complexes with bis(benzylsulfinyl)methane and 1,10-phenanthroline

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail: [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Guo, Feng [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-Fang; Feng, Shu-Yan; Bai, Juan; Xin, Xiao-Dong [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)


    Two novel binary and ternary Europium (III) perchlorate complexes were synthesized. The binary complex was prepared with bis(benzylsulfinyl)methane as ligand, and the ternary complex was with bis(benzylsulfinyl)methane as first ligand and 1,10-Phenanthroline as second ligand. They were characterized by element analysis, molar conductivity, coordination titration analysis, IR, TG-DSC, {sup 1}HNMR and UV spectra. The results indicated that the composition of binary and ternary complexes was EuL{sub 2.5}·(ClO{sub 4}){sub 3}·3H{sub 2}O and Eu{sub 2}L{sub 4}·phen·(ClO{sub 4}){sub 6}·12H{sub 2}O (L=C{sub 6}H{sub 5}CH{sub 2}SOCH{sub 2}SOCH{sub 2}C{sub 6}H{sub 5}), respectively. The fluorescent spectra illustrated that the complexes displayed characteristic Europium (III) ion fluorescence in solid state, indicating the ligands favored energy transfer to the excitation state energy level of it. The strongest characteristic fluorescence emission intensity of the ternary system was 1.87 times as strong as that of the binary system. The fluorescent quantum yields of the Eu (III) ternary and binary complexes were also calculated. Additionally, the phosphorescence spectra and the luminescence mechanisms of the complexes were studied and explained. - Highlights: • Two rare earth complexes are new. And they are stabilized. • The intensities of the two rare earth complexes were all stronger and the lifetimes were longer. • The introduction of the second organic ligand1,10-Phenanthroline enhanced the fluorescence intensity. • The fluorescent quantum yields of two complexes being calculated are both very high.

  5. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  6. Application of a room temperature ionic liquid for nuclear spent fuel reprocessing: speciation of trivalent europium and solvatation effects; Application d'un liquide ionique basse temperature pour les procedes de separation: speciation de l'europium trivalent et effets solvatation

    Energy Technology Data Exchange (ETDEWEB)

    Moutiers, G.; Mekki, S. [CEA Saclay, Dept. de Physico-Chimie, Service de Chimie Physique, 91 - Gif sur Yvette (France); Billard, I. [IN2P3/CNRS, 69 - Villeurbanne (France)


    One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf{sub 2}N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf{sub 2}N for the whole thesis and start with

  7. Public access defibrillation: Suppression of 16.7 Hz interference generated by the power supply of the railway systems

    Directory of Open Access Journals (Sweden)

    Iliev Georgi L


    Full Text Available Abstract Background A specific problem using the public access defibrillators (PADs arises at the railway stations. Some countries as Germany, Austria, Switzerland, Norway and Sweden are using AC railroad net power-supply system with rated 16.7 Hz frequency modulated from 15.69 Hz to 17.36 Hz. The power supply frequency contaminates the electrocardiogram (ECG. It is difficult to be suppressed or eliminated due to the fact that it considerably overlaps the frequency spectra of the ECG. The interference impedes the automated decision of the PADs whether a patient should be (or should not be shocked. The aim of this study is the suppression of the 16.7 Hz interference generated by the power supply of the railway systems. Methods Software solution using adaptive filtering method was proposed for 16.7 Hz interference suppression. The optimal performance of the filter is achieved, embedding a reference channel in the PADs to record the interference. The method was tested with ECGs from AHA database. Results The method was tested with patients of normal sinus rhythms, symptoms of tachycardia and ventricular fibrillation. Simulated interference with frequency modulation from 15.69 Hz to 17.36 Hz changing at a rate of 2% per second was added to the ECGs, and then processed by the suggested adaptive filtering. The method totally suppresses the noise with no visible distortions of the original signals. Conclusion The proposed adaptive filter for noise suppression generated by the power supply of the railway systems has a simple structure requiring a low level of computational resources, but a good reference signal as well.

  8. Genetic risk of TNFSF4 and FAM167A-BLK polymorphisms in children with asthma and allergic rhinitis in a Han Chinese population. (United States)

    Liu, Yun; Ke, Xia; Kang, Hou-Yong; Wang, Xiao-Qiang; Shen, Yang; Hong, Su-Ling


    Asthma and allergic rhinitis (AR) frequently occur as comorbid diseases of the upper airways. Single-nucleotide polymorphisms (SNPs) in the TNFSF4 and FAM167A-BLK genes have recently been shown to be associated with various immune-related disorders. Our aim was to determine whether TNFSF4 or FAM167A-BLK polymorphisms confer genetic susceptibility to asthma and AR in a Han Chinese population. We performed a case-control study of 290 asthmatic children and 252 healthy controls. Nine SNPs in the TNFSF4 region (rs1234313, rs1234314, rs1234315, rsl 2039904, rs844648 and rsl 0912580) and the FAM167A-BLK region (rs2254546, rs13277113 and rs1600249) were detected using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. This study revealed that three SNPs in TNFSF4 (rsl 234313, rsl 234314 and rsl 234315) and two SNPs in FAM167A-BLK (rs2254546 and rsl 600249) were significantly correlated with asthma and AR, while SNP rsl600249 was associated with asthma without allergic rhinitis as a risk factor. Further, we demonstrated synergistic effects between the TNFSF4 and FAM167A-BLK SNPs. This study supports that the SNPs in TNFSF4 and FAM167A-BLK may be involved in asthma and AR gene risk in the Han Chinese cohort.

  9. The K167I variant of DNA polymerase β that is found in Esophageal Carcinoma patients impairs polymerase activity and BER. (United States)

    Wang, Yuanyuan; Zang, Wenqiao; Du, Yuwen; Chen, Xiaonan; Zhao, Guoqiang


    DNA polymerase β (pol β) is a key enzyme in DNA base excision repair, and an important factor for maintaining genomic integrity and stability. Esophageal carcinoma (EC) patients who have been identified as carrying the K167I variant of pol β have been shown to have decreased life expectancy. However, it is unknown if the variant affects pol β's functions and/or how it contributes to the initiation and progression of cancer. In this study, we expressed and purified the K167I variant. Moreover, we found that K167I significantly reduced polymerase activity. As a result, the K167I substitution reduced base excision repair (BER) efficiency when assayed in a reconstitution assay or when using cellular extracts. Finally, we observed EC cells expressing the K167I variant to be sensitive to DNA damaging agents. These results suggest the K167I variant affected pol β biochemical activity resulting in impaired BER function, which might subsequently contribute to genomic instability and cancer development.

  10. Benzimidazole -Resistance in Haemonchus Contortus: New PCR-RFLP Method for the Detection of Point Mutation at Codon 167 of Isotype 1 Β-Tubulin Gene

    Directory of Open Access Journals (Sweden)

    A Eslami


    Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubu­lin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleo­tide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the posi­tion 443 was substituted through a nucleotide A creating a restriction site for restriction endonuc­lease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achiev­ing a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respec­tively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.

  11. Crystal structure of a sodium, zinc and iron(III-based non-stoichiometric phosphate with an alluaudite-like structure: Na1.67Zn1.67Fe1.33(PO43

    Directory of Open Access Journals (Sweden)

    Jamal Khmiyas


    Full Text Available The new title compound, disodium dizinc iron(III tris(phosphate, Na1.67Zn1.67Fe1.33(PO43, which belongs to the alluaudite family, has been synthesized by solid-state reactions. In this structure, all atoms are in general positions except for four, which are located on special positions of the C2/c space group. This structure is characterized by cation substitutional disorder at two sites, one situated on the special position 4e (2 and the other on the general position 8f. The 4e site is partially occupied by Na+ [0.332 (3], whereas the 8f site is entirely filled by a mixture of Fe and Zn. The full-occupancy sodium and zinc atoms are located at the Wyckoff positions on the inversion center 4a (-1 and on the twofold rotation axis 4e, respectively. Refinement of the occupancy ratios, bond-valence analysis and the electrical neutrality requirement of the structure lead to the given composition for the title compound. The three-dimensional framework of this structure consists of kinked chains of edge-sharing octahedra stacked parallel to [10-1]. The chains are formed by a succession of trimers based on [ZnO6] octahedra and the mixed-cation FeIII/ZnII [(Fe/ZnO6] octahedra [FeIII:ZnIII ratio 0.668 (3/0.332 (3]. Continuous chains are held together by PO4 phosphate groups, forming polyhedral sheets perpendicular to [010]. The stacked sheets delimit two types of tunnels parallel to the c axis in which the sodium cations are located. Each Na+ cation is coordinated by eight O atoms. The disorder of Na in the tunnel might presage ionic mobility for this material.

  12. Synthesis, characterization and luminescence of europium perchlorate with MABA-Si complex and coating structure SiO2@Eu(MABA-Si) luminescence nanoparticles. (United States)

    Fu, Zhi-Fang; Li, Wen-Xian; Bai, Juan; Bao, Jin-Rong; Cao, Xiao-Fang; Zheng, Yu-Shan


    This article reports a novel category of coating structure SiO 2 @Eu(MABA-Si) luminescence nanoparticles (NPs) consisting of a unique organic shell, composed of perchlorate europium(III) complex, and an inorganic core, composed of silica. The binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O was synthesized using HOOCC 6 H 4 N(CONH(CH 2 ) 3 Si(OCH 2 CH 3 ) 3 ) 2 (MABA-Si) and was used as a ligand. Furthermore, the as-prepared silica NPs were successfully coated with the -Si(OCH 2 CH 3 ) 3 group of MABA-Si to form Si-O-Si chemical bonds by means of the hydrolyzation of MABA-Si. The binary complexes were characterized by elemental analysis, molar conductivity and coordination titration analysis. The results indicated that the composition of the binary complex was Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O. Coating structure SiO 2 @Eu(MABA-Si) NPs were characterized using transmission electron microscopy (TEM), scanning electron microscopy (SEM) and infrared (IR) spectra. Based on the SEM and TEM measurements, the diameter of core-SiO 2 particles was ~400 and 600 nm, and the thickness of the cladding layer Eu(MABA-Si) was ~20 nm. In the binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O, the fluorescence spectra illustrated that the energy of the ligand MABA-Si transferred to the energy level for the excitation state of europium(III) ion. Coating structure SiO 2 @Eu(MABA-Si) NPs exhibited intense red luminescence compared with the binary complex. The fluorescence lifetime and fluorescence quantum efficiency of the binary complex and of the coating structure NPs were also calculated. The way in which the size of core-SiO 2 spheres influences the luminescence was also studied. Moreover, the luminescent mechanisms of the complex were studied and explained. Copyright © 2016 John Wiley & Sons, Ltd.

  13. The structures of CyMe4-BTBP complexes of americium(iii) and europium(iii) in solvents used in solvent extraction, explaining their separation properties. (United States)

    Ekberg, Christian; Löfström-Engdahl, Elin; Aneheim, Emma; Foreman, Mark R StJ; Geist, Andreas; Lundberg, Daniel; Denecke, Melissa; Persson, Ingmar


    Separation of trivalent actinoid (An(iii)) and lanthanoid (Ln(iii)) ions is extremely challenging due to their similar ionic radii and chemical properties. Poly-aromatic nitrogen compounds acting as tetradentate chelating ligands to the metal ions in the extraction, have the ability to sufficiently separate An(iii) from Ln(iii). One of these compounds, 6,6'-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-benzol[1,2,4]triazin-3-yl)[2,2]bipyridine, CyMe4-BTBP, has proven to be resistant towards acidic environments and strong radiation from radioactive decomposition. EXAFS studies of the dicomplexes of CyMe4-BTBP with americium(iii) and europium(iii) in nitrobenzene, cyclohexanone, 1-hexanol, 1-octanol and malonamide (DMDOHEMA) in 1-octanol have been carried out to get a deeper understanding of the parameters responsible for the separation. The predominating complexes independent of solvent used are [Am(CyMe4-BTBP)2(NO3)](2+) and [Eu(CyMe4-BTBP)2](3+), respectively, which are present as outer-sphere ion-pairs with nitrate ions in the studied solvents with low relative permittivity. The presence of a nitrate ion in the first coordination sphere of the americium(iii) complex compensates the charge density of the complex considerably in comparison when only outer-sphere ion-pairs are formed as for the [Eu(CyMe4-BTBP)2](3+) complex. The stability and solubility of a complex in a solvent with low relative permittivity increase with decreasing charge density. The [Am(CyMe4-BTBP)2(NO3)](2+) complex will therefore be increasingly soluble and stabilized over the [Eu(CyMe4-BTBP)2](3+) complex in solvents with decreasing relative permittivity of the solvent. The separation of americium(iii) from europium(iii) with CyMe4-BTBP as extraction agent will increase with decreasing relative permittivity of the solvent, and thereby also with decreasing solubility of CyMe4-BTBP. The choice of solvent is therefore a balance of a high separation factor and sufficient solubility of the CyMe4-BTBP

  14. Europium-decorated graphene quantum dots as a fluorescent probe for label-free, rapid and sensitive detection of Cu{sup 2+} and L-cysteine

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Liping [College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, 350002 (China); Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); Zhao, Li; Zhao, Tingting [Xiamen Huaxia College, Xiamen, 361024 (China); Chen, Xi, E-mail: [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, 361005 (China)


    In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel “off-on” fluorescent probe for the label-free determination of Cu{sup 2+} and L-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu{sup 2+} owing to the coordination reaction between Cu{sup 2+} and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu{sup 2+} to L-Cys via the Cu–S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1–10 μM for Cu{sup 2+} and 0.5–50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu{sup 2+} and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu{sup 2+} and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. - Highlights: • The europium-decorated graphene quantum dots (Eu-GQDs) have been successfully prepared. • Various characterizations results proved that Eu atoms were successfully introduced into graphene quantum dots. • The introduced Eu atoms changed the electron density and surface chemical activities of Eu-GQDs. • Eu-GQDs were used as an “off-on” fluorescent probe for Cu{sup 2+} and L-cysteine detection

  15. Synthesis, structural characterization and luminescent properties of a novel europium ternary complex Eu(2-A-4-CBA){sub 3}phen

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yongjie, E-mail:; Wu, Shengnan; Xing, Zhenfang; Cao, Shuang; Geng, Xiujuan; Yang, Ying; Xiao, Linjiu


    The preparation of a novel europium ternary complex with the formula of Eu(2-A-4-CBA){sub 3}phen (where, 2-A-4-CBA = 2-amino-4-chlorobenzoic acid, phen = 1,10-phenanthroline) under solvothermal condition is described. The composition and structure of the resulting complex were investigated by elemental analysis, Fourier transform infrared (FT-IR) spectroscopy. The complex is polycrystalline, and the morphology is clean and regular as revealed by scanning electron microscope (SEM). The luminescent and thermal properties of the complex were researched by fluorescence spectroscopy and thermogravimetric analysis, respectively. Of importance here is that, the room-temperature luminescence spectra of the complex show strong characteristic emission of the corresponding Eu{sup 3+}, which is attributed to the energy transfer from ligands to Eu{sup 3+} via an Antenna effect. It is also found that the complex exhibits pure red light and high color purity. In addition, the complex does not decompose until 300 °C, so it exhibits good thermal stability. - Highlights: • A novel Eu(III) complex was synthesized by solvothermal synthesis method. • The structure and properties of complex were studied. • The complex can emits pure red light and has a high color purity. • The complex does not decompose until 300 °C and it has a good thermal stability.

  16. Size- and dimensionality-dependent optical, magnetic and magneto-optical properties of binary europium-based nanocrystals: EuX (X = O, S, Se, Te). (United States)

    Zhou, Xingzhi; Zhang, Kelvin H L; Xiong, Jie; Park, Ju-Hyun; Dickerson, James H; He, Weidong


    Europium chalcogenides (EuX, X = O, S, Se, Te), a class of prototypical Heisenberg magnetic semiconductors, exhibit intriguing properties in optics, magnetism, and magneto-optics at the nanoscale, and have broad application potential in optical/magnetic sensors, spintronics, optical isolators, etc. EuX nanocrystals (NCs) exhibit enhanced properties, such as high saturation magnetization, a strong magneto-optic effect (Faraday rotation), and high magneto resistance, which are all unanimously dependent on the NC's size, shape, and surface information. In this report, we give an overview of the fundamental properties of bulk EuX, and illustrate the quantum confinement effects on the optical, magnetic and magneto-optical properties of EuX nanostructures. We then focus on doping and self-assembly-two efficient methods that enhance magnetic properties by manipulating magnetic coupling in EuX nanostructures. In particular, we look towards future research on Eu(2+) NCs, which along with the overview provides an up-to-date platform for evaluating the fundamental properties and application potential of Eu-based semiconductors.

  17. Crystal structure and luminescence properties of the first hydride oxide chloride with divalent europium. LiEu{sub 2}HOCl{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Rudolph, Daniel; Schleid, Thomas [Institute for Inorganic Chemistry, University of Stuttgart (Germany); Enseling, David; Juestel, Thomas [Department of Chemical Engineering, Muenster University of Applied Sciences, Steinfurt (Germany)


    The mixed-anionic hydride oxide chloride LiEu{sub 2}HOCl{sub 2} with divalent europium was synthesized by the reduction of Eu{sub 2}O{sub 3} with LiH in a LiCl flux at 750 C for 4 d in silica-jacketed niobium capsules. According to structure determination by single-crystal X-ray diffraction the yellow compound crystallizes in the orthorhombic space group Cmcm (a = 1492.30(11) pm, b = 570.12(4) pm, c = 1143.71(8) pm, Z = 8) with a crystal structure closely related to that one of the quaternary hydride oxide LiLa{sub 2}HO{sub 3} and the hydride nitride LiSr{sub 2}H{sub 2}N. On the other hand it can also be derived from the PbFCl-type structure of EuHCl showing astonishingly short Eu{sup 2+}..Eu{sup 2+} contacts of 326 and 329 pm. Both crystallographically different Eu{sup 2+} cations have nine anionic neighbors, while all other ions (Li{sup +}, H{sup -}, O{sup 2-} and Cl{sup -}) reside in six-membered coordination spheres. LiEu{sub 2}OCl{sub 2}H exhibits a bright yellow luminescence with an emission maximum at 581 nm upon excitation at 440 nm. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Highly sensitive and novel point-of-care system, aQcare Chlamydia TRF kit for detecting Chlamydia trachomatis by using europium (Eu) (III) chelated nanoparticles. (United States)

    Ham, Ji Yeon; Jung, Jaean; Hwang, Byung-Gap; Kim, Won-Jung; Kim, Young-Seop; Kim, Eun-Ju; Cho, Mi-Yeon; Hwang, Mi-Sun; Won, Dong Il; Suh, Jang Soo


    The bacterium Chlamydia trachomatis is one of the leading causes of sexually transmitted diseases worldwide. Since no simple and effective tool exists to diagnose C. trachomatis infections, we evaluated a novel point-of-care (POC) test, aQcare Chlamydia TRF kit, which uses europium-chelated nanoparticles and a time-resolved fluorescence reader. The test performance was evaluated by comparing the results obtained using the novel POC testing kit with those obtained using a nucleic acid amplification test (NAAT), using 114 NAAT-positive and 327 NAAT-negative samples. The cut-off value of the novel test was 20.8 with a detection limit of 0.27 ng/mL. No interference or cross-reactivity was observed. Diagnostic accuracy showed an overall sensitivity of 93.0% (106/114), specificity of 96.3% (315/327), positive predictive value (PPV) of 89.8% (106/118), and negative predictive value (NPV) of 97.5% (315/323). The sensitivity of the novel test was much higher than that of currently available POC tests. Furthermore, the relative ease and short turnaround time (30 min) of this assay enables C. trachomatis-infected individuals to be treated without a diagnostic delay. This simple and novel test is a potential tool to screen a larger population, especially those in areas with limited resources.

  19. Fluorescence enhancement of europium (III) perchlorate by 1,10-phenanthroline on the 1-(naphthalen-2-yl)-2-(phenylsulthio)ethanone complex and luminescence mechanism. (United States)

    Li, Wen-Xian; Xin, Xiao-Dong; Feng, Shu-Yan; Liu, Yu; Zhang, Jing; Ao, Bo-Yang; Li, Ying-Jie


    A novel ligand, 1-(naphthalen-2-yl)-2-(phenylsulthio)ethanone was synthesized using a new method and its two europium (Eu) (III) complexes were synthesized. The compounds were characterized by elemental analysis, coordination titration analysis, molar conductivity, infrared, thermo gravimetric analyzer-differential scanning calorimetry (TGA-DSC), (1)H NMR and UV spectra. The composition was suggested as EuL5 · (ClO4)3 · 2H2O and EuL4 · phen(ClO4)3 · 2H2O (L = C(10)H(7)COCH(2)SOC(6)H(5)). The fluorescence spectra showed that the Eu(III) displayed strong characteristic metal-centered fluorescence in the solid state. The ternary rare earth complex showed stronger fluorescence intensity than the binary rare earth complex in such material. The strongest characteristic fluorescence emission intensity of the ternary system was 1.49 times as strong as that of the binary system. The phosphorescence spectra were also discussed. Copyright © 2014 John Wiley & Sons, Ltd.

  20. Matrix-Assisted Ionization-Ion Mobility Spectrometry-Mass Spectrometry: Selective Analysis of a Europium-PEG Complex in a Crude Mixture. (United States)

    Fischer, Joshua L; Lutomski, Corinne A; El-Baba, Tarick J; Siriwardena-Mahanama, Buddhima N; Weidner, Steffen M; Falkenhagen, Jana; Allen, Matthew J; Trimpin, Sarah


    The analytical utility of a new and simple to use ionization method, matrix-assisted ionization (MAI), coupled with ion mobility spectrometry (IMS) and mass spectrometry (MS) is used to characterize a 2-armed europium(III)-containing poly(ethylene glycol) (Eu-PEG) complex directly from a crude sample. MAI was used with the matrix 1,2-dicyanobenzene, which affords low chemical background relative to matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI). MAI provides high ion abundance of desired products in comparison to ESI and MALDI. Inductively coupled plasma-MS measurements were used to estimate a maximum of 10% of the crude sample by mass was the 2-arm Eu-PEG complex, supporting evidence of selective ionization of Eu-PEG complexes using the new MAI matrix, 1,2-dicyanobenzene. Multiply charged ions formed in MAI enhance the IMS gas-phase separation, especially relative to the singly charged ions observed with MALDI. Individual components are cleanly separated and readily identified, allowing characterization of the 2-arm Eu-PEG conjugate from a mixture of the 1-arm Eu-PEG complex and unreacted starting materials. Size-exclusion chromatography, liquid chromatography at critical conditions, MALDI-MS, ESI-MS, and ESI-IMS-MS had difficulties with this analysis, or failed. Graphical Abstract ᅟ.

  1. Synthesis, characterization and luminescent properties of europium complexes with 2,4,6-tris-(2-pyridyl)-s-triazine as highly efficient sensitizers. (United States)

    Kang, Jie; Chen, Ying-Nan; Wang, Ai-Ling; Li, Hai-Yan; Qu, Yan-Rong; Zhang, Hai-Xia; Chu, Hai-Bin; Zhao, Yong-Liang


    Using 2,4,6-tris-(2-pyridyl)-s-triazine (TPTZ) as a neutral ligand, and p-hydroxybenzoic acid, terephthalic acid and nitrate as anion ligands, five novel europium complexes have been synthesized. These complexes were characterized using elemental analysis, rare earth coordination titrations, UV/vis absorption spectroscopy and infrared spectroscopy. Luminescence spectra, luminescence lifetime and quantum efficiency were investigated and the mechanism discussed in depth. The results show that the complexes have excellent emission intensities, long emission lifetimes and high quantum efficiencies. The superior luminescent properties of the complexes may be because the triplet energy level of the ligands matches well with the lowest excitation state energy level of Eu(3+). Moreover, changing the ratio of the ligands and metal ions leads to different luminescent properties. Among the complexes, Eu2(TPTZ)2(C8H4O4)(NO3)4(C2H5OH)·H2O shows the strongest luminescence intensity, longest emission lifetime and highest quantum efficiency. Copyright © 2015 John Wiley & Sons, Ltd.

  2. Photo-catalytic inactivation of an Enterococcus biofilm: the anti-microbial effect of sulphated and europium-doped titanium dioxide nanopowders. (United States)

    Dworniczek, Ewa; Plesch, Gustav; Seniuk, Alicja; Adamski, Ryszard; Michal, Róbert; Čaplovičová, Mária


    The control and prevention of biofilm-related infections is an important public healthcare issue. Given the increasing antibiotic resistance among bacteria and fungi that cause serious infections in humans, promotion of new strategies combating microorganisms has been essential. One attractive approach to inactivate microorganisms is the use of semiconductor photo-catalysis, which has become the subject of extensive research. In this study, the bactericidal properties of four photo-catalysts, TiO₂, TiO₂-S, TiO₂-Eu and TiO₂-Eu-S, were investigated against established 24, 48, 72 and 96 h biofilms of Enterococcus The exposure of biofilms to the catalysts induced the production of superoxide radical anions. The best photo-catalytic inactivation was achieved with the TiO₂-Eu-S and TiO₂-S nanopowders and 24 h biofilms. Transmission electron microscopy images showed significant changes in the structure of the biofilm cells following photo-inactivation. The results suggest that doping with europium and modifying the surface with sulphate groups enhanced the bactericidal activity of the TiO₂ nanoparticles against enterococcal biofilms. © FEMS 2016. All rights reserved. For permissions, please e-mail:

  3. Reversible modulation in luminescence intensity of a single vesicle composed of diblock azo-copolymer and tris(dibenzoylmethanate)(phenanthroline)europium(III) (United States)

    Yan, Qing; Su, Wei; Chen, Yilong; Luo, Yanhua; Zhang, Qijin


    Tris(dibenzoylmethanate)(phenanthroline)europium(III)[Eu(DBM) 3Phen]-doped amphiphilic vesicles were obtained by self-assembling of poly( N-isopropylacrylamide)- b-poly{6-[4-(4-methylphenyl-azo) phenoxy] hexylacrylate} (PNIPAM 83- b-PAzoM 20) in presence of Eu(DBM) 3Phen in the mixed solvent of THF/H 2O (50/50 vol.%). Their optical properties were studied by UV-vis and fluorescence spectroscopies. The UV-vis spectrum showed that the electronic transition bands of azobenzene and Eu(DBM) 3Phen were overlapped at about 365 nm and the main peak of fluorescence emission band appeared at 612 nm. So the vesicles showed obvious red luminescence. It was found that the fluorescence intensity of a single Eu(DBM) 3Phen-doped vesicle could be modulated by irradiation with UV and visible light due to the reversible trans- cis- trans photoisomerization reaction of azobenzene moiety. Possible energy allocation process for this property was discussed in details.

  4. Size- and dimensionality-dependent optical, magnetic and magneto-optical properties of binary europium-based nanocrystals: EuX (X = O, S, Se, Te) (United States)

    Zhou, Xingzhi; Zhang, Kelvin HL; Xiong, Jie; Park, Ju-Hyun; Dickerson, James H.; He, Weidong


    Europium chalcogenides (EuX, X = O, S, Se, Te), a class of prototypical Heisenberg magnetic semiconductors, exhibit intriguing properties in optics, magnetism, and magneto-optics at the nanoscale, and have broad application potential in optical/magnetic sensors, spintronics, optical isolators, etc. EuX nanocrystals (NCs) exhibit enhanced properties, such as high saturation magnetization, a strong magneto-optic effect (Faraday rotation), and high magneto resistance, which are all unanimously dependent on the NC’s size, shape, and surface information. In this report, we give an overview of the fundamental properties of bulk EuX, and illustrate the quantum confinement effects on the optical, magnetic and magneto-optical properties of EuX nanostructures. We then focus on doping and self-assembly—two efficient methods that enhance magnetic properties by manipulating magnetic coupling in EuX nanostructures. In particular, we look towards future research on Eu2+ NCs, which along with the overview provides an up-to-date platform for evaluating the fundamental properties and application potential of Eu-based semiconductors.

  5. A novel near monochromatic red emissive europium(III) metal-organic framework based on 1,2,4,5-benzenetetracarboxylate: From synthesis to photoluminescence studies (United States)

    Lahoud, Marcelo G.; Frem, Regina C. G.; Marques, Lippy F.; Arroyos, Guilherme; Brandão, Paula; Ferreira, Rute A. S.; Carlos, Luís D.


    This work presents the synthesis, solid state characterization (infrared spectroscopy, thermal analysis (TGA/DTA), powder and single crystal X-ray diffraction) and photoluminescence studies of a new europium metal-organic framework (MOF), [Eu2(Btec)1,5(H2O)]n (Btec4-=1,2,4,5-benzenetetracarboxylate anion). Single crystal X-ray diffraction analysis reveals that the material has a three-dimensional network, with two crystallographically independent Eu(III) ions adopting different coordination geometries. This structure presents one of the Btec4- anions acting as a μ8-bridging linker, with the carboxylate groups in distinct connection to Eu(III) ions, culminating into an unknown coordination mode for the linker. The results of thermogravimetric analyses indicate that the MOF has high thermal stability, with this characteristic being of great interest for the application of these compounds in several fields such as catalysis and photonics. The luminescent properties showed that the Eu(III) ions are a local-spectroscopic probe, with the compound presenting a red emission when excited in the UV spectral region with absolute emission quantum yield values of 0.48 ± 0.05. The thermal dependence on the intensity of the transitions originating from the 7F1 level, especially the 7F1 → 5D1 transition, was studied. These results opens the possibility to test this MOF [Eu2(Btec)1.5(H2O)]n in the field of molecular thermometry.

  6. Study of sorption mechanisms of europium(3) and uranium(6) ions on clays : impact of silicates; Etude des mecanismes de retention des ions U(6) et Eu(3) sur les argiles: influence des silicates

    Energy Technology Data Exchange (ETDEWEB)

    Kowal-Fouchard, A


    Bentonite clay has been selected as a potential buffer or backfill material in a number of disposal programmes for high level waste. In order to enhance the thermodynamic database of sorption phenomena at the solid-water interface, we have investigated sorption mechanisms of europium(III) and uranium(VI) ions onto montmorillonite and bentonite. Thermodynamic data were obtained for different ions concentrations, different background electrolytes and different ionic strengths. The structural identification of the surface complexes and sorption sites was carried out using two spectroscopies, XPS and TRLIFS, while sorption edges were performed using batch experiments. However, clays are complex minerals and in order to understand these sorption mechanisms we have studied europium(III) and uranium(VI) retention on a silica and an alumina because these solids are often considered as basic components of clays. The comparison of structural results shows that europium ions are significantly sorbed on permanently charged sites of clay until pH 7. But this ion is also sorbed on {identical_to}SiOH and {identical_to}AlOH sites of montmorillonite at pH higher than 6. Uranyl ions sorption on montmorillonite is mainly explained by retention of three complexes on {identical_to}SiOH sites. Moreover, we have shown that nitrate ions and dissolved silicates affect on uranium(VI) sorption mechanisms onto alumina. Nevertheless, uranyl ions sorption on montmorillonite and bentonite only decreases with increasing carbonate concentration. Finally, all the sorption edges were then modeled using these results and a surface complexation model (2 pK and constant capacitance models). (author)

  7. Distribution of micro-amounts of europium in the two-phase water–HCl–nitrobenzene–N,N’-dimethyl-N,N’-diphenyl-2,6-di-picolinamide–hydrogen dicarbollylcobaltate extraction system

    Directory of Open Access Journals (Sweden)



    Full Text Available Extraction of micro-amounts of europium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B- in the presence of N,N’-dimethyl-N,N’-diphenyl-2,6-dipicolinamide (MePhDPA, L was investigated. The equilibrium data were explained assuming that the species HL+, HL+2, HL3+2 and HL3+3 are extracted into the organic phase. The values of the extraction and stability constants of the species in nitrobenzene saturated with water were determined.

  8. 26 CFR 1.167(a)-12 - Depreciation based on class lives for property first placed in service before January 1, 1971. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation based on class lives for property... (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(a)-12 Depreciation based on class... section provides an elective class life system for determining the reasonable allowance for depreciation...

  9. 20 CFR 1002.167 - What actions may a plan administrator take if the employee does not elect or pay for continuing... (United States)


    ... the employee does not elect or pay for continuing coverage in a timely manner? 1002.167 Section 1002... employee does not elect or pay for continuing coverage in a timely manner? The actions a plan administrator... have developed reasonable rules regarding the period within which an employee may elect continuing...

  10. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans

    NARCIS (Netherlands)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben

    Membrane reshaping resides at the core of many important cellular processes and amongst its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3

  11. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans

    NARCIS (Netherlands)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben


    Membrane reshaping resides at the core of many important cellular processes, and among its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3

  12. Different collectivity in the two signatures of the i13/2 stemming band in 167Yb (United States)

    Petkov, P.; Gladnishki, K. A.; Dewald, A.; Möller, O.; Deloncle, I.; Reese, M.; Fransen, C.; Hackstein, M.; Jolie, J.; Pissulla, Th; Rother, W.; Zell, K. O.


    Six lifetimes have been determined in the 5/2+ [642] band from vi13/2 parentage in 167Yb by means of Recoil distance Doppler-shift (RDDS) measurements carried out at the Cologne FN tandem. The deduced transition strengths and the level scheme are reasonably described by Particle plus triaxial rotor model (PTRM) calculations except for the behavior of the quadrupole collectivity in the two signatures of the 5/2+[642] band. In that band, the quadrupole collectivity of the favored signature is appreciably larger than this of the unfavored signature. The effect increases with increasing the spin. Naturally, the rigid PTRM cannot explain these features, but the structure of its wave functions suggests a possible solution. It is associated with the enhanced contribution of low-Ω orbitals from vi13/2 parentage in the favored signature compared to the unfavored one. This could selectively increase the deformation of the favored signature band members and give rise to a dynamic shape coexistence taking place between the two signatures which needs quantitative explanation by future theoretical work.

  13. Atomistic modeling of crystal structure of Ca{sub 1.67}SiH{sub x}

    Energy Technology Data Exchange (ETDEWEB)

    Kovačević, Goran; Persson, Björn [Theoretical Chemistry, P.O.B. 124, Lund University, Lund 22100 (Sweden); Nicoleau, Luc [BASF Construction Solutions GmbH, Advanced Materials and Systems Research, Albert Frank Straße 32, 83304 Trostberg (Germany); Nonat, André [Laboratoire Interdisciplinaire Carnot de Bourgogne, UMR 6303 CNRS-Université de Bourgogne, BP 47870, F-21078 Dijon Cedex (France); Veryazov, Valera, E-mail: [Theoretical Chemistry, P.O.B. 124, Lund University, Lund 22100 (Sweden)


    The atomic structure of calcium-silicate-hydrate (C{sub 1.67}-S-H{sub x}) has been investigated by theoretical methods in order to establish a better insight into its structure. Three models for C-S-H all derived from tobermorite are proposed and a large number of structures were created within each model by making a random distribution of silica oligomers of different size within each structure. These structures were subjected to structural relaxation by geometry optimization and molecular dynamics steps. That resulted in a set of energies within each model. Despite an energy distribution between individual structures within each model, significant energy differences are observed between the three models. The C-S-H model related to the lowest energy is considered as the most probable. It turns out to be characterized by the distribution of dimeric and pentameric silicates and the absence of monomers. This model has mass density which is closest to the experimental one.

  14. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress

    KAUST Repository

    Kinoshita, Natsuko


    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance. © 2012 American Society of Plant Biologists. All rights reserved.

  15. Europium-doped Gd2O3 nanotubes cause the necrosis of primary mouse bone marrow stromal cells through lysosome and mitochondrion damage. (United States)

    Jin, Yi; Chen, Shizhu; Duan, Jianlei; Jia, Guang; Zhang, Jinchao


    With the wide applications of europium-doped Gd2O3 nanoparticles (Gd2O3:Eu(3+) NPs) in biomedical fields, it will inevitably increase the chance of human exposure. It was reported that Gd2O3:Eu(3+) NPs could accumulate in bone. However, there have been few reports about the potential effect of Gd2O3:Eu(3+) NPs on bone marrow stromal cells (BMSCs). In this study, the Gd2O3:Eu(3+) nanotubes were prepared and characterized by powder X-ray diffraction (XRD), photoluminescence (PL) excitation and emission spectra, scanning electron microscope (SEM), and transmission electron microscopy (TEM). The cytotoxicity of Gd2O3:Eu(3+) nanotubes on BMSCs and the associated mechanisms were further studied. The results indicated that they could be uptaken into BMSCs by an energy-dependent and macropinocytosis-mediated endocytosis process, and primarily localized in lysosome. Gd2O3:Eu(3+) nanotubes effectively inhibited the viability of BMSCs in concentration and time-dependent manners. A significant increase in the percentage of late apoptotic/necrotic cells, lactate dehydrogenase (LDH) leakage and the number of PI-stained cells was found after BMSCs were treated by 10, 20, and 40μg/mL of Gd2O3:Eu(3+) nanotubes for 12h. No obvious DNA ladders were detected, but a dispersed band was observed. The above results revealed that Gd2O3:Eu(3+) nanotubes could trigger cell death by necrosis instead of apoptosis. Two mechanisms were involved in Gd2O3:Eu(3+) nanotube-induced BMSCs necrosis: lysosomal rupture and release of cathepsins B; and the overproduction of reactive oxygen species (ROS) injury to the mitochondria and DNA. The study provides novel evidence to elucidate the toxicity mechanisms and may be beneficial to more rational applications of these nanomaterials in the future. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Europium-decorated graphene quantum dots as a fluorescent probe for label-free, rapid and sensitive detection of Cu(2+) and L-cysteine. (United States)

    Lin, Liping; Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru; Zhao, Li; Zhao, Tingting; Chen, Xi


    In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel "off-on" fluorescent probe for the label-free determination of Cu(2+) and l-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu(2+) owing to the coordination reaction between Cu(2+) and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu(2+) to L-Cys via the Cu-S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1-10 μM for Cu(2+) and 0.5-50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu(2+) and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu(2+) and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Sensitive detection of influenza viruses with Europium nanoparticles on an epoxy silica sol-gel functionalized polycarbonate-polydimethylsiloxane hybrid microchip. (United States)

    Liu, Jikun; Zhao, Jiangqin; Petrochenko, Peter; Zheng, Jiwen; Hewlett, Indira


    In an effort to develop new tools for diagnosing influenza in resource-limited settings, we fabricated a polycarbonate (PC)-polydimethylsiloxane (PDMS) hybrid microchip using a simple epoxy silica sol-gel coating/bonding method and employed it in sensitive detection of influenza virus with Europium nanoparticles (EuNPs). The incorporation of sol-gel material in device fabrication provided functionalized channel surfaces ready for covalent immobilization of primary antibodies and a strong bonding between PDMS substrates and PC supports without increasing background fluorescence. In microchip EuNP immunoassay (µENIA) of inactivated influenza viruses, replacing native PDMS microchips with hybrid microchips allowed the achievement of a 6-fold increase in signal-to-background ratio, a 12-fold and a 6-fold decreases in limit-of-detection (LOD) in influenza A and B tests respectively. Using influenza A samples with known titers, the LOD of influenza µENIA on hybrid microchips was determined to be ~10(4) TCID50 titer/mL and 10(3)-10(4) EID50 titer/mL. A comparison test indicated that the sensitivity of influenza µENIA enhanced using the hybrid microchips even surpassed that of a commercial laboratory influenza ELISA test. In addition to the sensitivity improvement, assay variation was clearly reduced when hybrid microchips instead of native PDMS microchips were used in the µENIA tests. Finally, infectious reference viruses and nasopharyngeal swab patient specimens were successfully tested using μENIA on hybrid microchip platforms, demonstrating the potential of this unique microchip nanoparticle assay in clinical diagnosis of influenza. Meanwhile, the tests showed the necessity of using nucleic acid confirmatory tests to clarify ambiguous test results obtained from prototype or developed point-of-care testing devices for influenza diagnosis. Published by Elsevier B.V.

  18. A visible-light-excited europium(III) complex-based luminescent probe for visualizing copper ions and hydrogen sulfide in living cells (United States)

    Wang, Yiren; Wang, Huan; Yang, Mei; Yuan, Jingli; Wu, Jing


    Development of visible-light-excited lanthanide (III) complex-based luminescent probes is highly appealing due to their superiority of less damage to the living biosystems over the conventional UV-light-excited ones. In this work, a visible-light-excited europium (III) complex-based luminescent probe, BPED-BHHCT-Eu3+-BPT, has been designed and synthesized by conjugating the Cu2+-binding N,N-bis(2-pyridylmethyl)ethanediamine (BPED) to a tetradentate β-diketone ligand 4,4‧-bis(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedione-6″-yl)chlorosulfo-o-terphenyl (BHHCT) and coordinating with a coligand 2-(N,N-diethylanilin-4-yl)-4,6-bis(pyrazol-1-yl)-1,3,5-triazine) (BPT) for the time-gated luminescence detection of Cu2+ ions and hydrogen sulfide (H2S) in living cells. BPED-BHHCT-Eu3+-BPT exhibited a sharp excitation peak at 407 nm and a wide excitation window extending to beyond 460 nm. Upon its reaction with Cu2+ ions, the luminescence of BPED-BHHCT-Eu3+-BPT was efficiently quenched, which could be reversibly restored by the addition of H2S due to the strong affinity between Cu2+ ions and H2S. The "on-off-on" type luminescence behavior of BPED-BHHCT-Eu3+-BPT towards Cu2+ ions and H2S enabled the sensing of the two species with high sensitivity and selectivity. The performances of BPED-BHHCT-Eu3+-BPT for visualizing intracellular Cu2+ ions and H2S were investigated, and the results have demonstrated the practical applicability of the probe for molecular imaging of cells.

  19. Chemical species of europium (III) in ionic force media 0.02M, 0.1M, and 0.7M NaClO{sub 4} at 298 K; Especies quimicas del europio (III) en medios de fuerza ionica 0.02M, 0.1M y 0.7M NaClO{sub 4} a 298 K

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)


    In order to know the effects of the controlled or accidental liberation of the europium in the environment, it is necessary to know its chemical behavior in found conditions in oceans, ground and surface water. The behavior of this element in these environments can be controlled mainly by the hydrolysis and its interaction with inorganic and organic ions. (Author)

  20. Synthesis, single-crystal structure determination, and vibrational spectroscopy of the europium borate Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Ortner, Teresa S.; Wurst, Klaus; Huppertz, Hubert [Institut fuer Allgemeine, Anorganische und Theoretische Chemie, Leopold-Franzens-Universitaet Innsbruck (Austria); Seibald, Markus [OSRAM GmbH, Corporate Innovation, Schwabmuenchen (Germany); Joachim, Bastian [Institut fuer Mineralogie und Petrographie, Leopold-Franzens-Universitaet Innsbruck (Austria)


    The new europium borate Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} was obtained by hydrothermal synthesis from europium nitrate hydrate and boric acid. The compound crystallizes in the triclinic space group P1 (no. 2) with the lattice parameters a = 681.59(3), b = 714.17(3), c = 1271.88(6) pm, α = 96.02(1), β = 98.60(1), γ = 101.73(1) (Z = 2). The structure of Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} is isotypic to that of the samarium borate Sm[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} and is built up from tetrahedral BO{sub 4} and trigonal-planar BO{sub 3} units, both of which are protonated at terminal and bridging oxygen positions. Boric acid molecules reside between the borate layers. Through hydrogen bonding, the structure forms a three-dimensional network. In channels down [110], the Eu{sup 3+} cations are eightfold coordinated by oxygen ions. The compound was also characterized by IR and Raman spectroscopy, and it shows typical Eu{sup 3+} line emission. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  1. Genetic variation in codons 167, 198 and 200 of the beta-tubulin gene in whipworms (Trichuris spp.) from a range of domestic animals and wildlife

    DEFF Research Database (Denmark)

    Hansen, Tina Vicky Alstrup; Nejsum, Peter; Olsen, Annette


    and used to amplify a ~476 bp fragment of the beta-tubulin gene. The PCR products were sequenced, analysed and evaluated. We did not identify SNPs in codons 167, 198 or 200 that led to amino acid substitutions in any of the studied Trichuris spp., but genetic variation expected to be related to species......A recurrent problem in the control of whipworm (Trichuris spp.) infections in many animal species and man is the relatively low efficacy of treatment with a single application of benzimidazoles (BZs). The presence of single nucleotide polymorphisms (SNPs) in codons 167, 198 and 200 in the beta...... to investigate the presence of these SNPs in the beta-tubulin gene of Trichuris spp. obtained from a range of animals. DNA was extracted from a total of 121 Trichuris spp. adult whipworm specimens obtained from 6 different host species. The number of worms from each host was pig: 31, deer: 21, sheep: 18, mouse...

  2. 1060nm FDML laser with centimeter coherence length and 1.67 MHz sweep rate for full eye length and retinal ultra-widefield OCT (United States)

    Kolb, Jan Philip; Klee, Julian; Pfeiffer, Tom; Huber, Robert


    We present a new design of a 1060nm Fourier Domain Mode Locked-Laser (FDML-Laser) that combines 1.67 MHz A-scan rate with a centimeter scale coherence length. The extended coherence length is achieved by synchronizing the cavity roundtrip time over the 75 nm sweep with a relative accuracy of 10-7. We will show that this requires careful combination of multiple fiber types in the cavity with a gradient heated chirped Fiber Bragg grating.

  3. WASP-167b/KELT-13b : joint discovery of a hot Jupiter transiting a rapidly rotating F1V star


    Temple, L. Y.; Hellier, C.; Albrow, M. D.; Anderson, D. R.; Bayliss, D.; Beatty, T. G.; Bieryla, A.; Brown, D. J. A.; Cargile, P. A.; Collier Cameron, A.; Collins, K. A.; Colón, K. D.; Curtis, I. A.; D'Ago, G.; Delrez, L.


    We report the joint WASP/KELT discovery of WASP-167b/KELT-13b, a transiting hot Jupiter with a 2.02-d orbit around a $V$ = 10.5, F1V star with [Fe/H] = 0.1 $\\pm$ 0.1. The 1.5 R$_{\\rm Jup}$ planet was confirmed by Doppler tomography of the stellar line profiles during transit. We place a limit of $

  4. Rapid and sensitive lateral flow immunoassay method for determining alpha fetoprotein in serum using europium (III) chelate microparticles-based lateral flow test strips

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Rong-Liang; Xu, Xu-Ping; Liu, Tian-Cai; Zhou, Jian-Wei; Wang, Xian-Guo; Ren, Zhi-Qi [Institute of Antibody Engineering, School of Biotechnology, Southern Medical University, Guangzhou 510515, Guangdong (China); Hao, Fen [DaAn Gene Co. Ltd. of Sun Yat-sen University, 19 Xiangshan Road, Guangzhou 510515 (China); Wu, Ying-Song, E-mail: [Institute of Antibody Engineering, School of Biotechnology, Southern Medical University, Guangzhou 510515, Guangdong (China)


    Alpha-fetoprotein (AFP), a primary marker for many diseases including various cancers, is important in clinical tumor diagnosis and antenatal screening. Most immunoassays provide high sensitivity and accuracy for determining AFP, but they are expensive, often complex, time-consuming procedures. A simple and rapid point-of-care system that integrates Eu (III) chelate microparticles with lateral flow immunoassay (LFIA) has been developed to determine AFP in serum with an assay time of 15 min. The approach is based on a sandwich immunoassay performed on lateral flow test strips. A fluorescence strip reader was used to measure the fluorescence peak heights of the test line (H{sub T}) and the control line (H{sub C}); the H{sub T}/H{sub C} ratio was used for quantitation. The Eu (III) chelate microparticles-based LFIA assay exhibited a wide linear range (1.0–1000 IU mL{sup −1}) for AFP with a low limit of detection (0.1 IU mL{sup −1}) based on 5ul of serum. Satisfactory specificity and accuracy were demonstrated and the intra- and inter-assay coefficients of variation (CV) for AFP were both <10%. Furthermore, in the analysis of human serum samples, excellent correlation (n = 284, r = 0.9860, p < 0.0001) was obtained between the proposed method and a commercially available CLIA kit. Results indicated that the Eu (III) chelate microparticles-based LFIA system provided a rapid, sensitive and reliable method for determining AFP in serum, indicating that it would be suitable for development in point-of-care testing. - Highlights: • Europium (III) chelate microparticles was used as a label for LIFA. • Quantitative detection by using H{sub T}/H{sub C} ratio was achieved. • LIFA for simple and rapid AFP detection in human serum. • The sensitivity and linearity was more excellent compared with QD-based ICTS. • This method could be developed for rapid point-of-care screening.

  5. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  6. The adsorption of europium to colloidal iron oxyhydroxides and quartz - the impact of pH and an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Ledin, A. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Karlsson, S. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Dueker, A. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Allard, B. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden)


    The adsorption of europium to colloidal Fe{sub 2}O{sub 3}, FeOOH, Fe(OH){sub 3} and SiO{sub 2} was investigated as a function of pH and the presence of an aquatic fulvic acid (FA). The colloids were present at concentrations repressentative of the upper levels of natural waters (50-500 mg/l). Measurements with Photon Correlation Spectroscopy showed size distribution typically within the ranges 200-700 nm, 40-400 nm and 50-300 nm for Fe{sub 2}O{sub 3}, FeOOH and SiO{sub 2}, respectively, while the amorphous Fe(OH){sub 3} formed relatively large particles (>1000 nm; outside the range of the method for measurements of size distribution). Total concentrations of Eu and the fulvic acid were 10{sup -8} mol l{sup -1} and 2 mg l{sup -1}, respectively. The adsorption was affected by pH, the composition of the colloidal phase as well as the presence of fulvic acid. The uptake was almost quantitative in the Fe-systems at pH>5.5-6, with 50% uptake at pH of 4.5-5.5 (4-5 units below pH{sub zpc}). For quartz, the maximum adsorption was around 90% (at pH 9), with 50% adsorption at pH 7 (4 pH units above pH{sub zpc}). The adsorption can not be related to coulombic attraction between the surfaces and the metal species alone, but rather to a specific chemical adsorption, where the pH-dependence would be related to the distribution of Eu between different species (on the surface and in solution). The presence of FA slightly increased the absorption in the lower pH range, corresponding to an adsorption of Eu-fulvate complexes. The adsorption was reaching 100% at higher pH values in the Fe(OH){sub 3} system, while it was decreased in the other three systems compared to the experiments without FA. The decrease could be attributed to competition between inorganic Eu species and the FA-molecules about sites on the surfaces, an effect not obvious in the Fe(OH){sub 3}-systems due to the much larger surface area available. (orig./MBS)

  7. Effect of the ion force on the hydrolysis constants and of the solubility product of Europium; Efecto de la fuerza ionica sobre las constantes de hidrolisis y del producto de solubilidad del europio

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Ramirez G, J.J.; Solache R, M.; Rojas H, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    A study on the behavior of the first hydrolysis constant {beta}{sub Eu,H}{sup l-0} and the constant of the solubility product Kps of the europium in front of the changes of the ion force: 0. 02 M, 0.1 M, 0.7M, 2M, 3M and 4M of sodium perchlorate, at 303 K. Experimentally the potentiometry and also radioactivity measures its were used. The specific interaction of ions theory (SIT) of Bronsted-Guggenheim-Scatchard allows the extrapolation of the values to infinite dilution and the results were: log {beta}{sub Eu,H}{sup l-0} = -7 36 and log K{sub sp}{sup l-0} = -24. 68. A discussion of the group of results with the data of the literature is presented. (Author)

  8. C-Terminal Substitution of HBV Core Proteins with Those from DHBV Reveals That Arginine-Rich 167RRRSQSPRR175 Domain Is Critical for HBV Replication (United States)

    Kim, Taeyeung; Shin, Bo-Hye; Park, Gil-Soon; Park, Sun; Chwae, Yong-Joon; Shin, Ho-Joon; Kim, Kyongmin


    To investigate the contributions of carboxyl-terminal nucleic acid binding domain of HBV core (C) protein for hepatitis B virus (HBV) replication, chimeric HBV C proteins were generated by substituting varying lengths of the carboxyl-terminus of duck hepatitis B virus (DHBV) C protein for the corresponding regions of HBV C protein. All chimeric C proteins formed core particles. A chimeric C protein with 221–262 amino acids of DHBV C protein, in place of 146–185 amino acids of the HBV C protein, supported HBV pregenomic RNA (pgRNA) encapsidation and DNA synthesis: 40% amino acid sequence identity or 45% homology in the nucleic-acid binding domain of HBV C protein was sufficient for pgRNA encapsidation and DNA synthesis, although we predominantly detected spliced DNA. A chimeric C protein with 221–241 and 251–262 amino acids of DHBV C, in place of HBV C 146–166 and 176–185 amino acids, respectively, could rescue full-length DNA synthesis. However, a reciprocal C chimera with 242–250 of DHBV C (242RAGSPLPRS250) introduced in place of 167–175 of HBV C (167RRRSQSPRR175) significantly decreased pgRNA encapsidation and DNA synthesis, and full-length DNA was not detected, demonstrating that the arginine-rich 167RRRSQSPRR175 domain may be critical for efficient viral replication. Five amino acids differing between viral species (underlined above) were tested for replication rescue; R169 and R175 were found to be important. PMID:22911745

  9. First identification of coexistence of blaNDM-1 and blaCMY-42 among Escherichia coli ST167 clinical isolates. (United States)

    Zhang, Xueqing; Lou, Danping; Xu, Yuanyuan; Shang, Yongpeng; Li, Dan; Huang, Xiaoying; Li, Yuping; Hu, Longhua; Wang, Liangxing; Yu, Fangyou


    Emergence of multidrug resistance in Enterobacteriaceae limits the selection of antimicrobials for treatment of infectious diseases. Identification of NDM-1 makes more difficulty in treating multidrug-resistant Enterobacteriaceae infections. Carbapenem-resistant Escherichia coli clinical isolates from a tertiary hospital in Wenzhou, east China, were investigated for NDM-1 production. The two tested isolates were negative for modified Hodge test, but positive for a double-disc synergy test used for detecting metallo-β-lactamase production. E. coli WZ33 and WZ51 exhibited discrepant-level resistance to most clinically frequent used antimicrobials, but still susceptible to trimethoprim/sulfamethoxazole, amikacin, fosfomycin, tigecycline and polymyxin B. E. coli WZ33 and WZ51 were positive for bla(NDM-1) determined by PCR and DNA sequencing. Other than bla(NDM-1), E. coli WZ33 also harbored bla(CTX-M-14) and bla(CMY-42), while E. coli WZ51 simultaneously harbored blaSHV-12,bla(CTX-M-14) and bla(CMY-42). Carbapenem resistance for E. coli WZ51 and WZ33 could not be transferred to E. coli recipients through conjugation, but could be transferred to E. coli recipients by chemical transformation. The EcoR1-digested DNA pattern of plasmids from the transformant of E. coli WZ51 was different from that of E. coli WZ51. MLST showed that E. coli WZ33 and WZ51 belonged to an animal-associated clone (ST167). The present study is the first report of bla(NDM-1) carriage in E. coli ST167 isolates and coexistence of bla(NDM-1) and bla(CMY-42) in same isolate. Systemic surveillance should focus on the dissemination of bla(NDM-1) among Enterobacteriaceae, especially E. coli ST167 clone associated with animal infection.

  10. Left ventricular remodeling leads to heart failure in mice with cardiac-specific overexpression of VEGF-B167: echocardiography and magnetic resonance imaging study. (United States)

    Lottonen-Raikaslehto, Line; Rissanen, Riina; Gurzeler, Erika; Merentie, Mari; Huusko, Jenni; Schneider, Jurgen E; Liimatainen, Timo; Ylä-Herttuala, Seppo


    Cardiac-specific overexpression of vascular endothelial growth factor (VEGF)-B 167 is known to induce left ventricular hypertrophy due to altered lipid metabolism, in which ceramides accumulate to the heart and cause mitochondrial damage. The aim of this study was to evaluate and compare different imaging methods to find the most sensitive way to diagnose at early stage the progressive left ventricular remodeling leading to heart failure. Echocardiography and cardiovascular magnetic resonance imaging were compared for imaging the hearts of transgenic mice with cardiac-specific overexpression of VEGF-B 167 and wild-type mice from 5 to 14 months of age at several time points. Disease progression was verified by molecular biology methods and histology. We showed that left ventricular remodeling is already ongoing at the age of 5 months in transgenic mice leading to heart failure by the age of 14 months. Measurements from echocardiography and cardiovascular magnetic resonance imaging revealed similar changes in cardiac structure and function in the transgenic mice. Changes in histology, gene expressions, and electrocardiography supported the progression of left ventricular hypertrophy. Longitudinal relaxation time in rotating frame (T 1 ρ ) in cardiovascular magnetic resonance imaging could be suitable for detecting severe fibrosis in the heart. We conclude that cardiac-specific overexpression of VEGF-B 167 leads to left ventricular remodeling at early age and is a suitable model to study heart failure development with different imaging methods. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  11. Hb Matera (HBB: c.167 T > A): A Second Case Detected in a Pregnant Chinese Woman by the Capillary Electrophoresis Method. (United States)

    Li, You-qiong; Ye, Li-Hua; Mo, Yun


    Hb Matera (HBB: c.167 T > A) is an unstable β-globin gene variant with an ATG > AAG substitution at codon 55. Its coelution with Hb A2 on high performance liquid chromatography (HPLC) makes it difficult to discriminate between Hb Matera and Hb E (HBB: c.79 G > A) that also coelutes with Hb A2 in this method. However, we found that capillary electrophoresis (CE) was able to detect Hb Matera and discriminate it from Hb E, based on the quantification of the peaks and on hematological parameters.

  12. WASP-167b/KELT-13b: joint discovery of a hot Jupiter transiting a rapidly rotating F1V star (United States)

    Temple, L. Y.; Hellier, C.; Albrow, M. D.; Anderson, D. R.; Bayliss, D.; Beatty, T. G.; Bieryla, A.; Brown, D. J. A.; Cargile, P. A.; Collier Cameron, A.; Collins, K. A.; Colón, K. D.; Curtis, I. A.; D'Ago, G.; Delrez, L.; Eastman, J.; Gaudi, B. S.; Gillon, M.; Gregorio, J.; James, D.; Jehin, E.; Joner, M. D.; Kielkopf, J. F.; Kuhn, R. B.; Labadie-Bartz, J.; Latham, D. W.; Lendl, M.; Lund, M. B.; Malpas, A. L.; Maxted, P. F. L.; Myers, G.; Oberst, T. E.; Pepe, F.; Pepper, J.; Pollacco, D.; Queloz, D.; Rodriguez, J. E.; Ségransan, D.; Siverd, R. J.; Smalley, B.; Stassun, K. G.; Stevens, D. J.; Stockdale, C.; Tan, T. G.; Triaud, A. H. M. J.; Udry, S.; Villanueva, S.; West, R. G.; Zhou, G.


    We report the joint WASP/KELT discovery of WASP-167b/KELT-13b, a transiting hot Jupiter with a 2.02-d orbit around a V = 10.5, F1V star with [Fe/H] = 0.1 ± 0.1. The 1.5 RJup planet was confirmed by Doppler tomography of the stellar line profiles during transit. We place a limit of <8 MJup on its mass. The planet is in a retrograde orbit with a sky-projected spin-orbit angle of λ = -165° ± 5°. This is in agreement with the known tendency for orbits around hotter stars to be more likely to be misaligned. WASP-167/KELT-13 is one of the few systems where the stellar rotation period is less than the planetary orbital period. We find evidence of non-radial stellar pulsations in the host star, making it a δ-Scuti or γ-Dor variable. The similarity to WASP-33, a previously known hot-Jupiter host with pulsations, adds to the suggestion that close-in planets might be able to excite stellar pulsations.

  13. 16.7 W 885 nm diode-side-pumped actively Q-switched Nd:YAG/YVO4 intracavity Raman laser at 1176 nm (United States)

    Jiang, Pengbo; Zhang, Guizhong; Liu, Jian; Ding, Xin; Sheng, Quan; Yu, Xuanyi; Sun, Bing; Shi, Rui; Wu, Liang; Wang, Rui; Yao, Jianquan


    We proposed and experimentally demonstrated the generation of high-power 1176 nm Stokes wave by frequency shifting of a 885 nm diode-side-pumped Nd:YAG laser using a YVO4 crystal in a Z-shaped cavity configuration. Employing the 885 nm diode-side-pumped scheme and the Z-shaped cavity, for the first time to our knowledge, we realized the thermal management effectively, achieving excellent 1176 nm Stokes wave consequently. With an incident pump power of ~190.0 W, a maximum average output power of 16.7 W was obtained at the pulse repetition frequency of 10 kHz. The pulse duration and spectrum linewidth of the Stokes wave at the maximum output power were 20.3 ns and ~0.08 nm, respectively.

  14. Photoluminescent study of Polycarbonate (PC) and Poly(9-vinylcarbazole) (PVK) doped films with europium complex; Estudo fotoluminescente de filmes de Policarbonato (PC) e Poli(9-vinilcarbazol) (PVK) dopados com complexo de europio

    Energy Technology Data Exchange (ETDEWEB)

    Forster, Pedro Lima


    Polymers doped with rare earth complexes are advantaged in film production for many applications in the luminescent field. In this study luminescent polymer obtained from polycarbonate (PC) and poly(9-vinylcarbazole) films doped with diaquatris(thenoyltrifluoroacetonate)europium(III) complex [Eu(tta){sub 3}(H{sub 2}0){sub 2}] were prepared and their calorimetric and luminescent properties in the solid state are reported. The thermal behavior was investigated by differential scanning calorimetry (OSC) and thermogravimetry analysis (TGA). Due of the addition of rare earth Eu(tta){sub 3}(H{sub 2}0){sub 2}] into PC and PVK matrices, changes were observed in the thermal behavior concerning the glass transition and thermal stability. Characteristic broadened narrow bands arising from the {sup 5}D{sub 0} -{yields} {sup 7}F{sub J} transitions (J = 0-4) of Eu{sup 3+} ion indicate the incorporation of the Eu{sup 3+} ions into those polymers. The luminescent films show enhancement emission intensity with an increase in the rare earth concentration in polymeric matrix accompanied by decrease in thermal stability. (author)

  15. Chemiluminescence Determination of Balofloxacin Based on Europium (III)-Sensitized KBrO{sub 3}-Na{sub 2}S{sub 2}O{sub 4} Reaction in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fang; Qi, Yu; Xiong, Wei [Shihezi University, Shihezi (China)


    A novel chemiluminescence (CL) flow injection method for the determination of balofloxacin is described. The method is based on the weak CL signal arising from the reaction of KBrO{sub 3} with Na{sub 2}S{sub 2}O{sub 4} in acidic medium being significantly enhanced by balofloxacin in the presence of europium (III) ion and sodium dodecyl benzene sulfonate (SDBS). The experimental conditions that affected CL intensity were carefully optimized and the CL reaction mechanism was briefly discussed. Under the optimum conditions, the relative CL intensity was proportional to the concentration of balofloxacin in the range of 7.0 c 10{sup -11} to 3.0 x 10{sup -7} g mL{sup -1}. The detection limit was 2.7 x 10{sup -11} g mL{sup -1} and the relative standard deviation was 2.1% for 7.0 x 10{sup -10} g mL{sup -1} balofloxacin (n = 13). The proposed method was successfully applied to the determination of balofloxacin in pharmaceutical formulations and biological fluids.

  16. Gold nanoparticle core-europium(iii) chelate fluorophore-doped silica shell hybrid nanocomposites for the lateral flow immunoassay of human thyroid stimulating hormone with a dual signal readout. (United States)

    Preechakasedkit, Pattarachaya; Osada, Kota; Katayama, Yuta; Ruecha, Nipapan; Suzuki, Koji; Chailapakul, Orawon; Citterio, Daniel


    Hybrid nanocomposite particles composed of a gold core coated with a europium(iii)-chelate fluorophore-doped silica shell (AuNPs@SiO 2 -Eu 3+ ) have been synthesized and applied as antibody labels in lateral flow immunoassay (LFIA) devices for the determination of human thyroid stimulating hormone (hTSH). Labeling of monoclonal anti-hTSH antibodies with AuNPs@SiO 2 -Eu 3+ nanocomposites allows for both colorimetric and fluorometric observation of assay results on LFIA devices, relying on visible light absorption due to the localized surface plasmon resonance of the Au-core and the fluorescence emission of the Eu(iii)-chelate-modified shell under UV hand lamp irradiation (365 nm), respectively. The possibility for a dual signal readout provides an attractive alternative for LFIAs: instantaneous naked eye observation of the AuNP colorimetric signal as in conventional LFIAs for hypothyroidism detection, and more sensitive fluorescence detection to assess hyperthyroidism. The limits of detection (LOD) for naked eye observation of LFIA devices are 5 μIU mL -1 and 0.1 μIU mL -1 for the colorimetric and fluorimetric detection, respectively. Using the fluorescence detection scheme in combination with a smartphone and digital color analysis, a quantitative linear relationship between the red intensity and the logarithmic concentration of hTSH was observed (R 2 = 0.988) with an LOD of 0.02 μIU mL -1 . Finally, LFIA devices were effectively applied for detecting hTSH in spiked diluted human serum with recovery values between 100-116%.

  17. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Association study of 167 candidate genes for schizophrenia selected by a multi-domain evidence-based prioritization algorithm and neurodevelopmental hypothesis.

    Directory of Open Access Journals (Sweden)

    Zhongming Zhao

    Full Text Available Integrating evidence from multiple domains is useful in prioritizing disease candidate genes for subsequent testing. We ranked all known human genes (n=3819 under linkage peaks in the Irish Study of High-Density Schizophrenia Families using three different evidence domains: 1 a meta-analysis of microarray gene expression results using the Stanley Brain collection, 2 a schizophrenia protein-protein interaction network, and 3 a systematic literature search. Each gene was assigned a domain-specific p-value and ranked after evaluating the evidence within each domain. For comparison to this ranking process, a large-scale candidate gene hypothesis was also tested by including genes with Gene Ontology terms related to neurodevelopment. Subsequently, genotypes of 3725 SNPs in 167 genes from a custom Illumina iSelect array were used to evaluate the top ranked vs. hypothesis selected genes. Seventy-three genes were both highly ranked and involved in neurodevelopment (category 1 while 42 and 52 genes were exclusive to neurodevelopment (category 2 or highly ranked (category 3, respectively. The most significant associations were observed in genes PRKG1, PRKCE, and CNTN4 but no individual SNPs were significant after correction for multiple testing. Comparison of the approaches showed an excess of significant tests using the hypothesis-driven neurodevelopment category. Random selection of similar sized genes from two independent genome-wide association studies (GWAS of schizophrenia showed the excess was unlikely by chance. In a further meta-analysis of three GWAS datasets, four candidate SNPs reached nominal significance. Although gene ranking using integrated sources of prior information did not enrich for significant results in the current experiment, gene selection using an a priori hypothesis (neurodevelopment was superior to random selection. As such, further development of gene ranking strategies using more carefully selected sources of information is

  19. Influence of Europium Doping on Various Electrical Properties of Low-Temperature Sintered 0.5Ba0.90Ca0.10TiO3-0.5BaTi0.88Zr0.12O3-0.1%CuO- xEu Lead-Free Ceramics (United States)

    Tian, Yongshang; Li, Shuiyun; Sun, Shulin; Gong, Yansheng; Li, Tiantian; Yu, Yongshang; Jing, Qiangshan


    0.5Ba0.90Ca0.10TiO3-0.5BaTi0.88Zr0.12O3-0.1%CuO- xEu (BCT-BZT-Cu- xEu; x = 0-0.90%) lead-free ceramics were sintered at 1220°C with as-synthesized nanoparticles by a modified Pechini method. The structural characteristics and electrical properties of the ceramics that were influenced by varying europium-doping were investigated. All the ceramics featured high densification (relative density: ˜ 96%). X-ray powder diffraction results indicated the samples possessed pure orthorhombic phase. The maximum relative permittivity ( ɛ r, 10869) was found at x around 0.30%. Europium ions could dope on different substitution sites in the ABO3 lattice, which evidently influenced electrical properties with various volumes of oxygen vacancy. Moreover, the formation mechanisms of oxygen vacancy and defect electron complexes were stated. The piezoelectric properties were impacted by defect electron complexes, internal stress, ionic electronegativity, etc. The optimal electrical properties, i.e., d 33 = 384 pC/N, Q m = 92, and k p = 0.36, were detected at x = 0.45%.

  20. Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions; Determinacion de las constantes de estabilidad de los complejos de lantano, praseodimio, europio, erbio y lutecio con iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    The stability constants of La{sup 3+}, Pr{sup 3+}, Eu{sup 3+}, Er{sup 3+} and Lu{sup 3+} chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl{sup 2+}) or two chemical species (LnCl{sup 2+} and LnCl{sub 2}{sup +}). The Specific Ion Interaction Theory was applied to the values of log {beta}{sup I}{sub Ln},{sub Cl} and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log {beta}{sup I}{sub Ln},{sub 2Cl}, due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log {beta}{sup I}{sub Ln},{sub CI}, log {beta}{sup I}{sub Ln},{sub 2CI} values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log {beta}{sup I}{sub Ln},{sub Cl} data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

  1. Electrochemistry of Europium(III) Chloride in 3 LiCl – NaCl, 3 LiCl – 2 KCl, LiCl – RbCl, and 3 LiCl – 2 CsCl Eutectics at Various Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Schroll, Cynthia A.; Chatterjee, Sayandev; Levitskaia, Tatiana G.; Heineman, William R.; Bryan, Samuel A.


    Here we report the effect of changing the eutectic melt composition on the electrochemical properties of europium(III) chloride under pyroprocessing conditions. The number of electrons transferred, redox potentials and diffusion coefficients were determined using various electrochemical and spectroelectrochemical techniques in four different eutectic mixtures (3 LiCl - NaCl, 3 LiCl - 2 KCl, 3 LiCl - RbCl, and 3 LiCl - 2 CsCl) while varying the temperature of the melt. It was determined that Eu3+ undergoes a one electron reduction to Eu2+ in each melt at all temperatures evaluated. Within all the melts a positive shift in the redox potential as well as an increase in the diffusion coefficient for Eu3+ was observed as the temperature increased. Also observed was a positive shift in the redox potential and increase in the diffusion coefficient for Eu3+ as the weighted average of the cationic radii for the melt decreased.

  2. The English Language Amendment. Hearing before the Subcommittee on the Constitution of the Committee on the Judiciary. Senate, Ninety-Eighth Congress, Second Session on S.J. Res. 167, a Joint Resolution Proposing an Amendment to the Constitution of the United States with Respect to the English Language. (United States)

    Congress of the U.S., Washington, DC. Senate Committee on the Judiciary.

    The transcripts of the hearings on Senate Joint Resolution 167, proposing an amendment to the United States Constitution with regard to establishment of English as the country's official language includes: the statements of three committee members (Senators Orrin G. Hatch, Jeremiah Denton, and Dennis DeConcini); the text of the proposed…

  3. Ultra-low thermal conductivity of TlIn5Se8 and structure of the new complex chalcogenide Tl0.98In13.12Se16.7Te2.3 (United States)

    Lefèvre, Robin; Berthebaud, David; Pérez, Olivier; Pelloquin, Denis; Boudin, Sophie; Gascoin, Franck


    TlIn5Se8 has been synthesized by means of solid-state reaction and densified by Spark Plasma Sintering. The compound is a semiconductor with a band gap of 1.62 eV estimated from reflectance measurements. Its thermal conductivity is about 0.45 W m-1. K-1 in the temperature range 300-673 K, an extremely low value attributed to its complex pseudo-1D structure reminiscent of the pseudo-hollandite. While attempting to dope TlIn5Se8 with Te, a new complex chalcogenide was discovered and characterized by the combination of TEM and XRD diffraction. It belongs to the A2In12X19 family, crystallizing in the R 3 ̅:H space group. Single crystal X-ray diffraction study led to a refined composition of Tl0.98In13.12Se16.7Te2.3 with cell parameters: a=13.839(5) Å and c=35.18(3) Å. A static disorder is found on one indium site situated in an octahedral environment. The single crystal XRD study is in agreement with TEM analyses in STEM-HAADF image mode that do not show any extended defects or disorder at atomic scale.

  4. Publications | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Woody and non-woody biomass utilisation for fuel and implications on plant nutrients availability in the Mukehantuta watershed in Ethiopia (open access). Scarcity of fuel wood has huge implications for agricultural productivity and food security. Due to the increasing scarcity of traditional fuel wood resources, rural ...


    African Journals Online (AJOL)

    satellite television stations operating in the country, real sex programmes beamed uncontrolled and unedited from satellite televisions into many Nigerian homes. Foreign and local pornographic ..... new materialism, inequity and social injustice, dropout from educational institutions, looseness and carelessness of parent ...

  6. Environmental Radiation Data (ERD) Journal Report 167 (United States)

    RadNet Environmental Radiation Data (ERD) journal report for the period of July – September 2016. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  7. Publications | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Water-related disaster management and adaptation to climate change : bridges and challenges? (restricted access) ... Openness and quality in Asian distance education : sub-project 3; distance learning mode for youth of Angkaol village, Damnark Chang Eur district, Kep province, Cambodia (restricted access). The project ...

  8. Reference: 167 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 3% plastoquinone. Photooxidation of P700 of PSI in the abc4 mutant was not observed, and reduced-versus-oxidized difference spectros...copy indicated that the abc4 mutant had no P700. The maximum quantum yield of photo

  9. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  10. Metal ion displacements in noncentrosymmetric chalcogenides La3Ga1.67S7, La3Ag0.6GaCh7 (Ch=S, Se), and La3MGaSe7 (M=Zn, Cd) (United States)

    Iyer, Abishek K.; Yin, Wenlong; Rudyk, Brent W.; Lin, Xinsong; Nilges, Tom; Mar, Arthur


    The quaternary Ga-containing chalcogenides La3Ag0.6GaS7, La3Ag0.6GaSe7, La3ZnGaSe7, and La3CdGaSe7, as well as the related ternary chalcogenide La3Ga1.67S7, were prepared by reactions of the elements at 950 °C. They adopt noncentrosymmetric hexagonal structures (space group P63, Z=2) with cell parameters (a=10.2 Å, c=6.1 Å for the sulfides; a=10.6 Å, c=6.4 Å for the selenides) that are largely controlled by the geometrical requirements of one-dimensional stacks of Ga-centered tetrahedra separated by the La atoms. Among these compounds, which share the common formulation La3M1-xGaCh7 (M=Ga, Ag, Zn, Cd; Ch=S, Se), the M atoms occupy sites within a stacking of trigonal antiprisms formed by Ch atoms. The location of the M site varies between extremes with trigonal antiprismatic (CN6) and trigonal planar (CN3) geometry. Partial occupation of these sites and intermediate ones accounts for the considerable versatility of these structures and the occurrence of large metal displacement parameters. The site occupations can be understood in a simple way as being driven by the need to satisfy appropriate bond valence sums for both the M and Ch atoms. Band structure calculations rationalize the substoichiometry observed in the Ag-containing compounds (La3Ag0.6GaS7, La3Ag0.6GaSe7) as a response to overbonding. X-ray photoelectron spectroscopy supports the presence of monovalent Ag atoms in these compounds, which are not charge-balanced.

  11. Study of the chelating capacity of nucleobase analogs with biological interest: XRD structural study and ab initio molecular orbital calculations on 1-methyl and 1,6,7-trimethyllumazine (United States)

    Acuña-Cueva, Esther R.; Faure, René; Jiménez-Pulido, Sonia B.; Moreno-Carretero, Miguel N.; Peña-Ruiz, Tomás


    The molecular and crystal structures of 1-methyllumazine (MLM) and 1,6,7-trimethyllumazine (MLMD) (lumazine=pteridine-2,4( 1H,3H)-dione) have been XRD determined. The compound MLM crystallizes in the monoclinic system (space group P2 1/c ) with cell dimensions: a=4.8200(2), b=9.7820(5), c=15.3230(9) Å, β=93.407(2)°. The structure was solved from 1947 reflections with I>2 σ( I). The final R[ I>2 σ( I)] was 0.0756 for 136 parameters. The compound MLMD crystallizes in the monoclinic system (space group C2) with cell dimensions: a=16.1360(4), b=6.5850(2), c=10.5380(4) Å, β=125.150(1)°. The structure was solved from 1800 reflections with I>4 σ( I). The final R[ I>4 σ( I)] was 0.0547 for 165 parameters. In both structures, the pteridine derivatives are H-bond dimerized (N-H⋯O), but whereas MLM shows a N3-H3⋯O2 H-bond, MLMD displays a N3-H3⋯O4 one, which is in accordance with the different sequence found for the carbonyl lengths. Ab initio molecular orbital calculations at the RHF/6-31G ∗ and B3LYP/6-31G ∗ levels using the GAUSSIAN94 program package have allowed us to simulate the molecular structures. The geometrical data are in good agreement with those calculated. The contribution of the atomic orbitals of the potential donor atoms to the higher occupied molecular orbitals allows us to propose theoretical arguments to justify the well-known N5-O4-bidentate coordinative behaviour found for these compounds in several metal complexes.

  12. Differences in Arctic and Antarctic PSC occurrence as observed by lidar in Ny-Ålesund (79° N, 12° E and McMurdo (78° S, 167° E

    Directory of Open Access Journals (Sweden)

    M. Maturilli


    Full Text Available The extent of springtime Arctic ozone loss does not reach Antarctic ``ozone hole'' dimensions because of the generally higher temperatures in the northern hemisphere vortex and consequent less polar stratospheric cloud (PSC particle surface for heterogeneous chlorine activation. Yet, with increasing greenhouse gases stratospheric temperatures are expected to further decrease. To infer if present Antarctic PSC occurrence can be applied to predict future Arctic PSC occurrence, lidar observations from McMurdo station (78° S, 167° E and NyÅlesund (79° N, 12° E have been analysed for the 9 winters between 1995 (1995/1996 and 2003 (2003/2004. Although the statistics may not completely cover the overall hemispheric PSC occurrence, the observations are considered to represent the main synoptic cloud features as both stations are mostly situated in the centre or at the inner edge of the vortex. Since the focus is set on the occurrence frequency of solid and liquid particles, the analysis has been restricted to volcanic aerosol free conditions. In McMurdo, by far the largest part of PSC observations is associated with NAT PSCs. The observed persistent background of NAT particles and their potential ability to cause denoxification and irreversible denitrification is presumably more important to Antarctic ozone chemistry than the scarcely observed ice PSCs. Meanwhile in Ny-Ålesund, ice PSCs have never been observed, while solid NAT and liquid STS clouds both occur in large fraction. Although they are also found solely, the majority of observations reveals solid and liquid particle layers in the same profile. For the Ny-Ålesund measurements, the frequent occurrence of liquid PSC particles yields major significance in terms of ozone chemistry, as their chlorine activation rates are more efficient. The relationship between temperature, PSC formation, and denitrification is nonlinear and the McMurdo and Ny-Ålesund PSC observations imply that for

  13. Saúde autorreferida e qualidade de vida em praticantes de caminhada do programa academia das cidades, Petrolina – PE, Brasil - doi: 10.5020/18061230.2012.p167

    Directory of Open Access Journals (Sweden)

    Jéssica Thayani Santos Brandão


    Full Text Available Avaliar a saúde autorreferida (SAR e qualidade de vida (QV em praticantes de caminhada no Programa Academia das Cidades (PAC. Métodos: Estudo transversal descritivo, conduzido com 300 praticantes de caminhada no PAC, em Petrolina-PE, Brasil. Realizou-se entrevista com questões distribuídas em quatro partes: sociodemográficas/ hábitos de vida (idade, sexo, situação conjugal, renda, ocupação e hábitos de vida; saúde autorreferida (escala de 5 pontos sobre a percepção de saúde; qualidade de vida (WHOQOLOMS e informações sobre o PAC e benefícios da caminhada. Resultados: Observou-se idade média de 40,75 (±14,72 e 99 (33,0% sujeitos tinham idade entre 41-60 anos, 208 (69,3% eram mulheres, 166 (55,3% eram casados, 167 (55,7% tinham mais de 12 anos de escolaridade, 106 (35,3% recebiam entre 2-3 salários mínimos, 234 (78,0% trabalhavam e 153 (51,0% praticavam caminhada 3 vezes por semana. A televisão (37,3% foi a principal fonte de informação sobre os benefícios da caminhada e as redes sociais (55,0% forneceram as principais informações sobre a existência do programa que influenciou a maioria (63,7% a iniciar a atividade. Não houve diferença estatisticamente significante nos escores de QV e na SAR, de acordo com a idade, entretanto observou-se que, à medida que aumenta a frequência da caminhada semanal, aumentam os escores de QV e SAR. Conclusão: A caminhada foi importante determinante da promoção da saúde e qualidade de vida, à medida que aumentava a frequência semanal da atividade, cujos benefícios e existência de locais para sua prática foram disseminados pela televisão e pelas redes sociais, respectivamente.

  14. A inconstitucionalidade da (DRU sob a luz do inciso XI do artigo 167 da Constituição Social e a falsa idéia do déficit previdenciário

    Directory of Open Access Journals (Sweden)

    Karen Costa Braga


    Full Text Available O presente estudo científico tem o nítido propósito de realizar um estudo científico sobre a desvinculação das receitas públicas, no ordenamento jurídico brasileiro, que extirpa do orçamento da Seguridade Social uma parcela de toda a sua arrecadação. Longe de querer esgotar o tema, esta pesquisa faz uma abordagem do constitucionalismo moderno e a figura dos princípios como fonte de interpretação das normas jurídicas além de realizar uma análise dos critérios jurídicos e temporais da instituição da DRU e a sua inconstitucionalidade sob o enfoque do artigo 167 inciso XI do texto constitucional que veda a utilização dos recursos provenientes das contribuições sociais previstas no artigo 195 para pagamento de outras despesas que não os benefícios previdenciários. A tendência seguida no presente artigo científico é a de que, apesar de já decidido pelo Supremo Tribunal Federal a constitucionalidade da DRU, esta questão foi analisada sob o enfoque tributário e não sob o enfoque constitucional-social. É vezo da cultura legislativa-tributária brasileira ignorar a supremacia da Constituição Federal e há, atualmente, recordes de receitas desvinculadas dos cofres do Regime Geral da Previdência Social. Por derradeiro, faz-se uma análise integrativa dos mecanismos utilizados, indevidamente para operacionalizar a atividade estatal e ainda o debate entre o possível engessamento da prática orçamentária rígida e a defasagem dos direitos prestacionais que garantiriam, sob o enfoque dos direitos sociais, o mínimo existencial e a completude da dignidade da pessoa humana.

  15. Progress on the europium neutron capture study using DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Agvaanluvsan, U. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States)]. E-mail:; Becker, J.A. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Macri, R.A. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Parker, W. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Wilk, P. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Wu, C.Y. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Bredeweg, T.A.; Esch, E.; Haight, R.C.; O' Donnell, J.M.; Reifarth, R.; Rundberg, R.S.; Schwantes, J.M.; Ullmann, J.L.; Vieira, D.J.; Wilhelmy, J.B.; Wouters, J.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Mitchell, G.E.; Sheets, S. [North Carolina State University, Raleigh, NC 27695 (United States)]|[Triangle Universities Nuclear Laboratory, Durham, NC 27708 (United States); Becvar, F.; Krticka, M. [Charles University in Prague, CZ 180 00 Prague 8 (Czech Republic)


    The accurate measurement of neutron capture cross sections of the Eu isotopes is important for many reasons including nuclear astrophysics and nuclear diagnostics. Neutron capture excitation functions of {sup 151,153}Eu targets were measured recently using a 4{pi} {gamma}-ray calorimeter array DANCE located at the Los Alamos Neutron Science Center for E {sub n} = 0.1-100 keV. The progress on the data analysis efforts is given in the present paper. The {gamma}-ray multiplicity distributions for the Eu targets and Be backing are significantly different. The {gamma}-ray multiplicity distribution is found to be the same for different neutron energies for both {sup 151}Eu and {sup 153}Eu. The statistical simulation to model the {gamma}-ray decay cascade is summarized.

  16. Progress on the Europium Neutron-Capture Study using DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Agvaanluvsan, U; Becker, J A; Macri, R A; Parker, W; Wilk, P; Wu, C Y; Bredeweg, T A; Esch, E; Haight, R C; O' Donnell, J M; Reifarth, R; Rundberg, R S; Schwantes, J M; Ullmann, J L; Vieira, D J; Wilhelmy, J B; Wouters, J M; Mitchell, G E; Sheets, S A; Becvar, F; Krticka, M


    The accurate measurement of neutron-capture cross sections of the Eu isotopes is important for many reasons including nuclear astrophysics and nuclear diagnostics. Neutron capture excitation functions of {sup 151,153}Eu targets were measured recently using a 4{pi} {gamma}-ray calorimeter array DANCE located at the Los Alamos Neutron Science Center for E{sub n} = 0.1-100 keV. The progress on the data analysis efforts is given in the present paper. The {gamma}-ray multiplicity distributions for the Eu targets and Be backing are significantly different. The {gamma}-ray multiplicity distribution is found to be the same for different neutron energies for both {sup 151}Eu and {sup 153}Eu. The statistical simulation to model the {gamma}-ray decay cascade is summarized.

  17. Functionalization of sol-gel zirconia composites with europium complexes

    Energy Technology Data Exchange (ETDEWEB)

    Danchova, Nina; Gutzov, Stoyan [Sofia Univ. ' St Kliment Ohridski' (Bulgaria). Dept. of Physical Chemistry


    Different sol-gel strategies based on functionalization of ZrO{sub 2}:Eu microparticles with 1,10-phenanthroline (phen) and incorporation of colloidal Eu(phen){sub 2}(NO{sub 3}){sub 3} into zirconia have been used to obtain hybrid sol-gel composites with controlled optical properties. The process leads to materials with quantum yields of about 48 % monitoring the 615 nm emission line at 350 nm excitation. Excitation/luminescence spectroscopy, diffuse reflectance spectroscopy and X-ray diffraction have been used to characterize the hybrid zirconia composites. (orig.)

  18. Interaction of europium and curium with alpha-amylase

    Energy Technology Data Exchange (ETDEWEB)

    Barkleit, Astrid [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Div. Chemistry of the F-Elements; Heller, Anne [Technische Univ. Dresden (Germany). Inst. for Zoology, Molecular Cell Physiology and Endocrinology; Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Div. Biogeochemistry


    Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed that Eu(III) and Cm(III) form two dominant species with the protein α-amylase (Amy): one with the coordination of a single carboxylate group of the protein and the other with three coordinating carboxylate groups.

  19. Synthesis, characterization, and properties of reduced europium molybdates and tungstates (United States)

    Abeysinghe, Dileka; Gerke, Birgit; Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D.; Pöttgen, Rainer; Makris, Thomas M.; zur Loye, Hans-Conrad


    Single crystals of K0.094Eu0.906MoO4, K0.097Eu0.903WO4, EuWO4, and EuMoO4 were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu3+ to Eu2+ was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I41/a and adopt the scheelite (CaWO4) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. 151Eu Mössbauer spectroscopy was used to analyze the relative Eu2+ and Eu3+ content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy.

  20. Single crystal growth of europium and ytterbium based intermetallic ...

    Indian Academy of Sciences (India)

    to dissolve the excess metal flux. Due to its low melting temperature of 156.6. ◦. C, indium is an ideal metal for use as a reactive flux (self- flux condition). It has widely been used for the synthe- sis and crystal growth of indium-rich binary and ternary indides. In many cases, a slight excess of indium sig- nificantly increases the ...

  1. Electrical and magnetic transport in Strontium doped Europium Ferrimanganites

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Latif, I.A. [Physics Department, College of Science & Arts, Najran University, P. O. 1988, Najran (Saudi Arabia); Reactor Physics Department, NRC, Atomic Energy Authority, Abou Zabaal P.O. 13759, Cairo (Egypt); Ahmed, Mahrous R. [Physics Department, Faculty of Science, Sohag University, Sohag 82524 (Egypt); Physics Department, Aljamoum University College, Um-Elqura University, Makka (Saudi Arabia); Al-Omari, I.A.; Sellai, A. [Physics Department, Faculty of Science, Soltan Qaboos University, P.O. Box 36, PC 123, Muscatt (Oman)


    Eu{sub 0.65}Sr{sub 0.35}Fe{sub x}Mn{sub 1−x}O{sub 3} (x=0.1, 0.3 and 0.5) has been prepared using a standard solid state reaction method. The under-investigation compounds is found to crystallize in a single-phase orthorhombic structure in the P{sub bnm} space group (62). The adiabatic polaron electronic transfer was obtained for all samples and the activation energy of x=0.1 sample is equal to 1.013 meV and slightly increase at x=0.3 (1.289 meV) while is doubled for x=0.5 to be 2.1065 meV. The magnetization–temperature dependence measurements of Eu{sub 0.65}Sr{sub 0.35}Fe{sub x}Mn{sub 1−x}O{sub 3} show the ferromagnetic ordering at low iron concentration x=0.1 and when iron concentration increase to x=0.5 the noncollinear magnetic ordering (the canted antiferromagnetic) is obtained. The magnetic phase transition (paramagnetic-ferromagnetic transition) in the Eu{sub 0.65}Sr{sub 0.35}Fe{sub 0.1}Mn{sub 0.9}O{sub 3} is observed at T{sub c} of 150 K. For Eu{sub 0.65}Sr{sub 0.35}Fe{sub 0.5}Mn{sub 0.5}O{sub 3} the multi-magnetic phase transition is observed at T{sub c} of 200K and T{sub N} of 430 K. The resistivity at low temperature is measured. Theoretical Calculations using Monte Carlo code have been done. The magnetization as function of temperature has been calculated using Monte Carlo simulations for Eu{sub 0.65}Sr{sub 0.35}Fe{sub x}Mn{sub 1−x}O{sub 3} (x=0.0, 0.1, 0,2, 0.3, 0.4 and 0.5). Ising model is a suitable model to study the magnetization for our compounds. The internal energy for x=0 is the highest value compared with the other x values which have nearly a ground state value equal to 2.7 J. - Highlights: • The distortion parameter in the crystal structure of Eu{sub 0.65}Sr{sub 0.35}Fe{sub x}Mn{sub 1−x}O{sub 3} increase with increasing concentration of iron and affected both electrical and magnetic transport. • The density of electrons over the unit cell decrease with increasing the iron concentration and thus give rise to the decrease in electrical conductivity and the change of the magnetic ordering. • The transition from thermal activation mechanism at temperature higher than room temperature into adiabatic polaron mechanism at temperature lower than room temperature in all samples. • The transition from the soft FM ordering at low iron concentration x=0.1 into the harder canted FM ordering with x>0.3. • The internal energy calculation showed the highest value of x=0, compared with the other x values, which have nearly a ground state value equal to 2.7 J.

  2. Synthesis and characterization of europium doped LiF phosphor

    Energy Technology Data Exchange (ETDEWEB)

    Villalobos, M. L.; Vallejo, M. A.; Sosa A, M. [Universidad de Guanajuato, Division de Ciencias e Ingenierias, Loma del Bosque No. 103, Lomas del Campestre, 37150 Leon, Guanajuato (Mexico); Diaz T, L. A., E-mail: [Centro de Investigaciones en Optica, A. C., Loma del Bosque No. 115, Lomas del Campestre, 37150 Leon, Guanajuato (Mexico)


    LiF with different dopants has been one of the most investigated materials to use as thermoluminescent dosimeter. In this paper, we present the preparation method, the characterization and the thermoluminescent response of Eu doped LiF irradiated with X-rays. Pure and Eu doped LiF samples with different dopant concentration (0, 0.25, 0.5, 0.75 and 1 % mol) were synthesized using the precipitation method. The samples were structurally characterized by X-ray diffraction (XRD), the diffraction patterns showed a main cubic crystalline structure and a secondary hexagonal structure. The photoluminescence spectrum exhibited four well defined peaks characteristic of the Eu{sup 3+} ion. Thermoluminescent (Tl) glow curves of x-ray irradiated samples showed a well-defined single peak around 200 degrees C, except for the pure and 0.25% Eu doped samples. (Author)

  3. Effect of pressure on the phonon properties of europium ...

    Indian Academy of Sciences (India)


    phonon density of states and compared them with the first order Raman scattering results. The calculation of ... raman et al 1974). The structural phase transition pre- ssures for EuO, EuS, EuSe and EuTe are 30–40 GPa,. 22 GPa, 15 GPa and 10 GPa, respectively. ... †Paper presented at the 5th IUMRS ICA98, October 1998,.

  4. High pressure annealing of Europium implanted GaN

    KAUST Repository

    Lorenz, K.


    GaN epilayers were implanted with Eu to fluences of 1×10^13 Eu/cm2 and 1×10^15 Eu/cm2. Post-implant thermal annealing was performed in ultra-high nitrogen pressures at temperatures up to 1450 ºC. For the lower fluence effective structural recovery of the crystal was observed for annealing at 1000 ºC while optical activation could be further improved at higher annealing temperatures. The higher fluence samples also reveal good optical activation; however, some residual implantation damage remains even for annealing at 1450 ºC which leads to a reduced incorporation of Eu on substitutional sites, a broadening of the Eu luminescence lines and to a strongly reduced fraction of optically active Eu ions. Possibilities for further optimization of implantation and annealing conditions are discussed.© (2012) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE). Downloading of the abstract is permitted for personal use only.

  5. Hyperfine interactions at europium sites in oxide glasses (United States)

    Concas, G.; Congiu, F.; Muntoni, C.; Bettinelli, M.; Speghini, A.


    The shape of the γ resonance absorption peak of the Eu3+ ion in a disordered structure was investigated in some phosphate, borate, and silicate glasses by using 151Eu Mössbauer spectroscopy. The quality of the fits was tested by using the Durbin-Watson d statistics. The observed full width at half maximum of the peak was resolved in a contribution of the broadening and a contribution of the quadrupole splitting, due to the distortion of the Eu site compared to a cubic symmetry. The Eu-O bond was found to have a covalent admixture with 6s character. The axial component of the electric-field gradient at the Eu site was found to be correlated with the optical basicity of the glass.

  6. Interaction of europium and curium with alpha-amylase. (United States)

    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert


    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  7. On the abundance of Europium. [in Ap and Am stars (United States)

    Hartoog, M. R.; Cowley, C. R.; Adelman, S. J.


    The inclusion of the effects of hyperfine splitting can significantly lower the abundance estimate of Eu from singly ionized lines which lie on the flat portion of the curve of growth. In the 21 cool Ap stars studied by Adelman and the five Am stars studied by Smith, the Eu abundance was reduced by 0.4 dex on the average. In individual cases, the reductions were as great as 0.9 dex. This makes the Eu abundance comparable to that of its neighboring rare earths Sm and Gd in the Ap stars and less than Sm and Gd in the Am stars, but still substantially overabundant with respect to solar values.

  8. Europium (III) and americium (III) stability constants with humic acid

    Energy Technology Data Exchange (ETDEWEB)

    Torres, R.A.; Choppin, G.R.


    The stability constants for tracer concentrations of Eu(III) and Am(III) complexes with a humic acid extracted from a lake-bottom sediment were measured using a solvent extraction system. The organic extractant was di(2-ethylhexyl)-phosphoric acid in toluene while the humate aqueous phase had a constant ionic strength of 0.1 M (NaClO/sub 4/). Aqueous humic acid concentrations were monitored by measuring uv-visible absorbances at approx.= 380 nm. The total carboxylate capacity of the humic acid was determined by direct potentiometric titration to be 3.86 +- 0.03 meq/g. The humic acid displayed typical characteristics of a polyelectrolyte - the apparent pKsub(a), as well as the calculated metal ion stability constants increased as the degree of ionization (..cap alpha..) increased. The binding data required a fit of two stability constants, ..beta../sub 1/ and ..beta../sub 2/, such that for Eu, log ..beta../sub 1/ = 8.86 ..cap alpha.. + 4.39, log ..beta../sub 2/ = 3.55 ..cap alpha.. + 11.06 while for Am, log ..beta../sub 1/ = 10.58 ..cap alpha.. + 3.84, log ..beta../sub 2/ = 5.32 ..cap alpha.. + 10.42. With hydroxide, carbonate, and humate as competing ligands, the humate complex associated with the ..beta../sub 1/ constant is calculated to be the dominant species for the trivalent actinides and lanthanides under conditions present in natural waters.

  9. Dicty_cDB: CFI167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ideum chromoso... 294 1e-78 AY533208_1( AY533208 |pid:none) Sus scrofa type III iodo...thyronine ... 79 9e-14 AY656759_1( AY656759 |pid:none) Ovis aries type 3 iodothyronine de... 79 1e-13 AY8...58552_1( AY858552 |pid:none) Bos taurus type III iodothyronine ... 79 1e-13 (Q6DN07) RecName: Full=Type III iodo...thyronine deiodinase; ... 79 1e-13 (Q2QEI3) RecName: Full=Type I iodothyronin...e deiodinase; ... 78 2e-13 ( P55073 ) RecName: Full=Type III iodothyronine deiodinase; ... 78 2e-13 DQ098656

  10. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Building Capacity for Feminist Research in Africa : Gender, Sexuality and Politics. Over the past decade, there has been increasing interest in African scholarship on the importance of understanding sexualities and on connecting this understanding to more relevant policy prescriptions so that African women can enjoy their ...

  11. 167 ORIGINAL ARTICLE Auteur correspondant : adesola.ajayi ...

    African Journals Online (AJOL)


    R. G. and Peralta, R.M. 2008. Production of tanna by Aspergillus tamarii in submerged cultures. Archives of Bio. and Tech. 51(2): 399-404. 3. Natarajan, K. and A. Rajendran, 2009. Effect. Fermentation Parameters on Extracellular Tanna. Production by Lactobacillus plantarum MTCC 1407. of Chem. 6(4): 979-984. 4. Yaoa J.

  12. People’s Republic of China Scientific Abstracts, Number 167. (United States)


    are analyzed. The bacteriostatic action of one of the three herbs, Thymus serpyl- lum L. var. vulgaris , Benth. was also tested in vitro. Injectio...100$ Thymus (made of whole plants) was judged to be definitely effective for bacterial pneumonia. Vitro experiment of a compound containing


    African Journals Online (AJOL)

    Fr. Ikenga

    as a non-monetary award. The scope of this paper is non-monetary awards. There are three enforcement systems for domestic awards under the Nigerian legal system. A domestic award is enforceable by action upon the award, by application under section 31(1) of the Arbitration and Conciliation Act and by the summary ...

  14. 40 CFR 161.167 - Discussion of formation of impurities. (United States)


    ... produce other products or substances. (viii) The process control, purification and quality control...) Technical grade active ingredients and products produced by an integrated system. (1) Each impurity associated with the active ingredient which was found to be present in any analysis of the product conducted...

  15. Publications | Page 167 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Water Hyacinth in Africa and the Middle East : A Survey of Problems and Solutions. L'infestation des eaux douces par la jacinthe d'eau a atteint des proportions critiques dans beaucoup de régions de l'Afrique et du Moyen-Orient. On estime que les dommages environnementaux, économiques et sociaux cumulatifs ...

  16. 167 History, Land and Conflict in Nigeria: The Aguleri- Umuleri ...

    African Journals Online (AJOL)


    over Otuocha land as the sole cause of the conflict, neglecting the aspect on ... religious and inter-personal, among other forms of conflicts. ... relationship. This led to the distortion in the reconstruction of their history, as Umuleri community changed their name to. Umueri, to substantiate their claim of being the direct descent.

  17. All projects related to | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Region: Bangladesh, Japan. Program: Employment and Growth. Total Funding: CA$ 584,200.00. Changing Labour Markets in Bangladesh: The Dynamics Between Growth and Inclusion in a Low-Income Economy. Project. With its growing economy and population, Bangladesh's job creation success has primarily taken ...

  18. Dicty_cDB: CHF167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 0 length of query: 180 length of database: 80,480,566 effective... HSP length: 17 effective length of query: 163 effective le...ngth of database: 78,821,179 effective search space: 12847852177 effective search space used: 12847852177 T:...0 length of query: 180 length of database: Z,951,760,654 effective HSP length: 22 effective length of query: 158 effective... length of database: Z,096,903,420 effective search space: 6651310740360 effective

  19. Publications | Page 167 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and State Sovereignty. L'enjeu le plus critique auquel fait face actuellement la collectivité internationale porte sur la façon de protéger les personnes captives de nouvelles crises humanitaires d'envergure — l'intervention humanitaire a suscité des controverses à la fois lorsqu'elle s'est produite, comme au Kosovo,.

  20. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Telecentres across French-speaking West Africa are struggling to attain financial sustainability while remaining relevant to their communities. ... The Centro de Tecnologia e Sociedade (CTS - Center for Technology and Society) is part of the Fundação Getulio Vargas Law School in Rio de Janeiro and is the only institution in ...

  1. Dicty_cDB: SFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available cppkhecrinhfgeeccv ksrndcltcedlncerkglhcamktvpmikkivxksss Translated Amino Acid sequence (All Frames) Frame ...hgkeccvvahrpppkcslrcppkhecrinhfgeeccv ksrndcltcedlncerkglhcamktvpmikkivxksss Frame C: fiiqfyf*siqikkkxixn*vk

  2. 27 CFR 40.167 - Prepayment tax return. (United States)


    ..., DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE PAPERS AND TUBES... consumption or sale by completing the return and filing it with TTB, in accordance with the instructions on...

  3. Dicty_cDB: SSK167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 8e-08 2 AY022565 |AY022565.1 Oryza sativa microsatellite MRG4890 containing (ATT)X12, genomic sequence...3e-07 2 AY023400 |AY023400.1 Oryza sativa microsatellite MRG5725 containing (TAT)X13, closest to marker...3e-07 2 AY022503 |AY022503.1 Oryza sativa microsatellite MRG4828 containing (ATA)X13, genomic sequence...3e-07 2 AY022351 |AY022351.1 Oryza sativa microsatellite MRG4676 containing (AAT)X13, genomic sequence...3e-07 2 AY022570 |AY022570.1 Oryza sativa microsatellite MRG4895 containing (ATT)X14, genomic sequence

  4. Dicty_cDB: CFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |BU495005.1 PfESToab82g05.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BU496632.1 PfESToab52g07.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI670607.1 PfESToaa02a07.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI816321.1 PfESToaa39a10.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI815601.1 PfESToaa30e06.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to

  5. Dicty_cDB: VFJ167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sequence (All Frames) Frame A: *kv*y*klknvc*ck*skillw*klhw*ii*iqqr*nckiqqw**me**ihvmfgwfkc* m*hlga**...*lcckwkc ll*ilpnnw--- ---enkfqk*kv*y*klknvc*ck*skillw*klhw*ii*iqqr*nckiqqw**me**ih vmfgwfkc*m*hlga**

  6. Dicty_cDB: SLE167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available qlkekqvnlmqmkn*ikrelknllerd*pimvsv*vple*knlklvemmfvhavvernik nvvqnk*LNNIYIY--- ---NIIII*iittsiinnnnnnnnnn...qlkekqvnlmqmkn*ikrelknllerd*pimvsv*vple*knlklvemmfvhavvernik nvvqnk*LNNIYIY--- ---*ynnninnnnihhkqqqqqqqqq

  7. Dicty_cDB: AFO167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ces characterized by their enhanced expression in good prognostic human neuroblas...toma upon comparison between good prognostic human neuroblastoma and poor prognostic human neuroblastoma. 36... 0.23 3 BD083746 |BD083746.1 Nucleic acid sequence characterized in that expression is potentiated in human neuroblastoma with good... prognosis, in comparion between human neuroblastoma with good prognosis and human ne

  8. MO-A-BRC-02: TG167 Report - Detailed Description

    Energy Technology Data Exchange (ETDEWEB)

    Rivard, M.


    Although a multicenter, Phase III, prospective, randomized trial is the gold standard for evidence-based medicine, it is rarely used to evaluate innovative radiotherapy devices because of many practical and ethical reasons. It is usually sufficient to compare the dose distributions and dose rates for determining equivalence of the innovative device to an existing one. Thus, quantitative evaluation of the dosimetric characteristics of an innovative brachytherapy device or application is a critical part in which physicists are actively involved. The physicist’s role, along with physician colleagues, in this process is highlighted for innovative products or applications and includes evaluation of 1) dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use, 2) risks and benefits from regulatory and safety perspectives, and 3) resource assessment and preparedness. Further, calibration methods should be traceable to a primary standards dosimetry laboratory such as NIST in the U.S. or to other primary standards dosimetry laboratory located elsewhere. Clinical users should follow standards as approved by their country’s regulatory agencies that approved such a brachytherapy device. Integration of this system into the medical source calibration infrastructure of secondary standard dosimetry laboratories such as the ADCLs is encouraged before a source is introduced into widespread routine clinical use. The AAPM and GEC-ESTRO have developed guidelines for the safe and consistent application of brachytherapy using innovative brachytherapy devices and applications. The current report covers regulatory approvals, calibration, dose calculations, radiobiological issues, and overall safety concerns that should be addressed during the commissioning stage preceding clinical use. These guidelines are based on review of requirements of the U.S. NRC, FDA, Department of Transportation, International Electrotechnical Commission Medical Electrical Equipment Standard 60601, European Commission for CE Marking, and institutional review boards and radiation safety committees. Learning Objectives: Understand the necessary dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use. Evaluate risks and benefits from regulatory and safety perspectives. Identify necessary resources and create a plan for clinical introduction of innovative brachytherapy device or applications. Consultant for Theragenics Corp.; R. Nath, Consultant to Theragenics Corp.

  9. MO-A-BRC-01: TG167 Report - Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Nath, R. [Yale University School of Medicine (United States)


    Although a multicenter, Phase III, prospective, randomized trial is the gold standard for evidence-based medicine, it is rarely used to evaluate innovative radiotherapy devices because of many practical and ethical reasons. It is usually sufficient to compare the dose distributions and dose rates for determining equivalence of the innovative device to an existing one. Thus, quantitative evaluation of the dosimetric characteristics of an innovative brachytherapy device or application is a critical part in which physicists are actively involved. The physicist’s role, along with physician colleagues, in this process is highlighted for innovative products or applications and includes evaluation of 1) dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use, 2) risks and benefits from regulatory and safety perspectives, and 3) resource assessment and preparedness. Further, calibration methods should be traceable to a primary standards dosimetry laboratory such as NIST in the U.S. or to other primary standards dosimetry laboratory located elsewhere. Clinical users should follow standards as approved by their country’s regulatory agencies that approved such a brachytherapy device. Integration of this system into the medical source calibration infrastructure of secondary standard dosimetry laboratories such as the ADCLs is encouraged before a source is introduced into widespread routine clinical use. The AAPM and GEC-ESTRO have developed guidelines for the safe and consistent application of brachytherapy using innovative brachytherapy devices and applications. The current report covers regulatory approvals, calibration, dose calculations, radiobiological issues, and overall safety concerns that should be addressed during the commissioning stage preceding clinical use. These guidelines are based on review of requirements of the U.S. NRC, FDA, Department of Transportation, International Electrotechnical Commission Medical Electrical Equipment Standard 60601, European Commission for CE Marking, and institutional review boards and radiation safety committees. Learning Objectives: Understand the necessary dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use. Evaluate risks and benefits from regulatory and safety perspectives. Identify necessary resources and create a plan for clinical introduction of innovative brachytherapy device or applications. Consultant for Theragenics Corp.; R. Nath, Consultant to Theragenics Corp.

  10. Page 1 New Strategies for separations through reactions 167 Table ...

    Indian Academy of Sciences (India)

    1981b); Jagirdar & Sharma (1981b); d Gaikar. & Sharma (1985). 2.5 Dissociation leaching. New strategies have been also developed for solid-liquid systems through dissociation leaching; it involves equilibrating the solid mixture with aqueous.

  11. 167 Biologie de reproduction du cerf de Barbarie (Cervus elaphus ...

    African Journals Online (AJOL)


    Résumé. La biologie de reproduction des cerfs de Barbarie (Cervus elaphus barabrus) a été étudiée dans le parc d'El Feidja et la réserve de Mhebès sur des populations qui vivent respectivement en état de captivité et semi captivité. Il ressort de cette étude que la période de rut débute en fin août-début septembre.

  12. 15 CFR 16.7 - Participation in program. (United States)


    ... participant in the event that he does not appeal such notification by the end of the thirty (30) day period...) Participants may reproduce the Department of Commerce Label and Mark in advertising: Provided, That the entire...

  13. Dicty_cDB: VFO167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available mRNA for AL... 74 3e-12 (Q9WU78) RecName: Full=Programmed cell death 6-interacting prote... 71 1e-11 BC051123_1(...BC051123_1( BC051123 |pid:none) Mus musculus programmed cell death... 71 2e-11 AF119955_1( AF119955 |pid:none)...2e-11 BC026823_1( BC026823 |pid:none) Mus musculus programmed cell death... 71 2e-11 AC007591_7( AC007591

  14. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The Centro de Tecnologia e Sociedade (CTS - Center for Technology and Society) is part of the Fundação Getulio Vargas Law School in Rio de Janeiro and is the only institution in Brazil that specifically deals with the interplay of law, technology and society. Brazil, South America, Nigeria, North Of Sahara, South Of Sahara, ...

  15. 26 CFR 1.167(a)-9 - Obsolescence. (United States)


    .... The depreciation allowance includes an allowance for normal obsolescence which should be taken into.... Obsolescence may render an asset economically useless to the taxpayer regardless of its physical condition... governing the allowance of a loss when the usefulness of depreciable property is suddenly terminated, see...

  16. Dicty_cDB: VHQ167 [Dicty_cDB

    Lifescience Database Archive (English)


  17. Synthesis and characterization of titania-based monodisperse fluorescent europium nanoparticles for biolabeling

    Energy Technology Data Exchange (ETDEWEB)

    Tan Mingqian [Department of Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Dalian 116023 (China); Wang Guilan [Department of Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Dalian 116023 (China); Ye Zhiqiang [Department of Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Dalian 116023 (China); Yuan Jingli [Department of Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Dalian 116023 (China)]. E-mail:


    Inorganic-organic hybrid titania-based nanoparticles covalently bound to a fluorescent Eu{sup 3+} chelate of 4,4'-bis(1'',1'',1'',2'',2'',3'',3''-heptafluoro-4'',6''-hexanedion-6''-yl) chlorosulfo-o-terphenyl (BHHCT-Eu{sup 3+}) were synthesized by a sol-gel technique. A conjugate of BHHCT with 3-[2-(2-aminoethylamino) ethylamino]propyl-trimethoxysilane (APTS) was used as a precursor for the nanoparticle preparation and monodisperse nanoparticles consisting of titania network and silica sub-network covalently bound to the Eu{sup 3+} chelate were prepared by the copolymerization of APTS-BHHCT conjugate, titanium tetraisopropoxide (TTIP) and free APTS in EuCl{sub 3} water-alcohol solution. The effects of reaction conditions on size and fluorescence lifetime of the nanoparticles were investigated. The characterizations by transmission electron microscopy and fluorometric methods indicate that the nanoparticles are near spherical and strongly fluorescent having a fluorescence quantum yield of 11.6% and a long fluorescence lifetime of {approx}0.4 ms. The direct-introduced amino groups on the nanoparticle's surface by using free APTS in nanoparticle preparation facilitated the biolabeling process of the nanoparticles. The nanoparticle-labeled streptavidin (SA) was prepared and used in a sandwich-type time-resolved fluoroimmunoassay (TR-FIA) of human prostate-specific antigen (PSA) by using a 96-well microtiter plate as the solid phase carrier. The method gives a detection limit of 66 pg/ml for the PSA assay.

  18. Photoactive europium(III) centered mesoporous hybrids with 2-thenoyltrifluoroacetone functionalized SBA-16 and organic polymers. (United States)

    Li, Yajuan; Yan, Bing


    A series of novel ternary organic-inorganic mesoporous polymeric hybrids TTFA-S16-Eu-PMMA, TTFA-S16-Eu-PMAA, and TTFA-S16-Eu-PVP (TTFA = 2-Thenoyltrifluoroacetone; PMMA = polymethyl methacrylate; PMAA = polymethacrylic acid; PVP = polyvinylpyrrolidone) have been assembled by the Eu(3+) complex covalently attaching to the TTFA directly functionalized ordered mesoporous SBA-16 and organic polymer. FTIR, UV, XRD, TEM, N(2) adsorption measurements, photoluminescent spectra, and TG plots were characterized, and the results reveal that they all have high surface area, uniformity in the mesostructure, and good crystallinity. In addition, the ternary rare earth mesoporous polymeric hybrids show an overall increase in luminescent lifetime and quantum efficiency compared to binary rare earth mesoporous hybrid TTFA-S16-Eu, especially the mesoporous hybrid with PVP exhibits the highest luminescence quantum efficiency and longest lifetime.

  19. Electroluminescence of a device based on europium {beta}-diketonate with phosphine oxide complex

    Energy Technology Data Exchange (ETDEWEB)

    Quirino, W.G. [LOEM - Department of Physics - Pontificia Universidade Catolica do Rio de Janeiro, PUC-Rio - P.O.Box 38071, Rio de Janeiro, RJ, CEP 22453-970 (Brazil); Adati, R.D. [Institute of Chemistry, Sao Paulo State OYiversity - UNESP, P.O.Box. 355, Araraquara, SP, CEP 14801-970 (Brazil); Lima, S.A.M. [Institute of Chemistry, Sao Paulo State OYiversity - UNESP, P.O.Box. 355, Araraquara, SP, CEP 14801-970 (Brazil); Legnani, C. [LOEM - Department of Physics - Pontificia Universidade Catolica do Rio de Janeiro, PUC-Rio - P.O.Box 38071, Rio de Janeiro, RJ, CEP 22453-970 (Brazil); Jafelicci, M. [Institute of Chemistry, Sao Paulo State OYiversity - UNESP, P.O.Box. 355, Araraquara, SP, CEP 14801-970 (Brazil); Davolos, M.R. [Institute of Chemistry, Sao Paulo State OYiversity - UNESP, P.O.Box. 355, Araraquara, SP, CEP 14801-970 (Brazil); Cremona, M. [LOEM - Department of Physics - Pontificia Universidade Catolica do Rio de Janeiro, PUC-Rio - P.O.Box 38071, Rio de Janeiro, RJ, CEP 22453-970 (Brazil)]. E-mail:


    Rare earth (RE) ions have spectroscopic characteristics to emit light in narrow lines, which makes RE complexes with organic ligands candidates for full color OLED (Organic Light Emitting Diode) applications. In particular, {beta}-diketone rare earth (RE{sup 3+}) complexes show high fluorescence emission efficiency due to the high absorption coefficient of the {beta}-diketone and energy transfer to the central ion. In this work, the fabrication and the electroluminescent properties of devices containing a double and triple-layer OLED using a new {beta}-diketone complex, [Eu(bmdm){sub 3}(tppo){sub 2}], as transporting and emitting layers are compared and discussed. The double and triple-layer devices based on this complex present the following configurations respectively: device 1: ITO/TPD (40 nm)/[Eu(bmdm){sub 3}(tppo){sub 2}] (40 nm)/Al (150 nm); device 2: ITO/TPD (40 nm)/[Eu(bmdm){sub 3}(tppo){sub 2}] (40 nm)/Alq{sub 3} (20 nm)/Al (150 nm) and device 3: ITO/TPD (40 nm)/bmdm-ligand (40 nm)/Al (150 nm), were TPD is (N,N'-diphenyl-N,N'-bis(3-methylphenyl)-1,1-biphenil-4,4-diamine) and bmdm is butyl methoxy-dibenzoyl-methane. All the films were deposited by thermal evaporation carried out in a high vacuum system. These devices exhibit high intensity photo- (PL) and electro-luminescent (EL) emission. Electroluminescence spectra show emission from Eu{sup 3+} ions attributed to the {sup 5}D{sub 0} to {sup 7}F {sub J} (J = 0, 1, 2, 3 and 4) transitions with the hypersensitive {sup 5}D{sub 0} {sup {yields}} {sup 7}F{sub 2} transition (around 612 nm) as the most prominent one. Moreover, a transition from {sup 5}D{sub 1} to {sup 7}F{sub 1} is also observed around 538 nm. The OLED light emission was almost linear with the current density. The EL CIE chromaticity coordinates (X = 0.66 and Y = 0.33) show the dominant wavelength, {lambda} {sub d} = 609 nm, and the color gamut achieved by this device is 0.99 in the CIE color space.

  20. Self-assembly of a helical zinc-europium complex: speciation in aqueous solution and luminescence

    Directory of Open Access Journals (Sweden)

    Emmanuel eDeiters


    Full Text Available Two new tridentate(NNO-bidentate(NN compartmental ligands, HL5 and HL6, are synthesized from pyridine and benzimidazole synthons. They react in aqueous solution under physiological conditions with ZnII, LnIII, or a mixture thereof, to yield complexes of different stoichiometries, 1:3, 2:2, 2:3, 1:1:3, the speciation of which is established by UV-visible titrations and ESI mass spectrometry. Photophysical studies of the EuIII-containing solutions in Tris-HCl 0.1 M (pH = 7.4 show that lanthanide luminescence arises from a unique N6O3 coordination site with pseudo D3 symmetry. Relevant parameters such as crystal field splitting, lifetime, radiative lifetime and intrinsic quantum yield perfectly match those reported for dinuclear 4f-4f helicates in which the EuIII ion has the same coordination environment.