WorldWideScience

Sample records for europium 157

  1. Fluorescent Europium Chelate Stain

    Science.gov (United States)

    Scaff, W. L.; Dyer, D. L.; Mori, K.

    1969-01-01

    The europium chelate of 4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione (thenoyl-trifluoroacetone; TTA) is firmly bound to microorganisms. It fluoresces brightly at 613 nm with activation at 340 nm. Cells may be stained with 10−3m chelate in 50% ethyl alcohol, followed by washing with 50% ethyl alcohol. Equal or better stains are produced with 10−3m aqueous europium salt, water wash, and 10−2m aqueous TTA. A noncomplexing buffer should be used to maintain the pH at 6.5 to 6.8. Images PMID:4181107

  2. Europium-155 in Debris from Nuclear Weapons

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Lippert, Jørgen Emil

    1967-01-01

    The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...... of europium-155 from weapons was estimated at 1400 atoms per 10$^{6}$ fissions, which is close to the yield of europium-155 from fast fission of uranium-238....

  3. The electrochemical synthesis of europium boride

    Directory of Open Access Journals (Sweden)

    Bukatova G.A.

    2003-01-01

    Full Text Available The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. % melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  4. The electrochemical synthesis of europium boride

    OpenAIRE

    Bukatova G.A.; Kuznetsov S.A.; Gaune-Escard M.

    2003-01-01

    The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. %) melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  5. Liposome Biodistribution via Europium Complexes.

    Science.gov (United States)

    Mignet, Nathalie; Scherman, Daniel

    2017-01-01

    The drug delivery field needs tools to follow vector biodistribution. Radioactive tracers and conventional fluorophores are widely used. We propose here to use europium complexes. Use of pulsed light source time-resolved fluorimetry takes into account the fluorescence decay time of the lanthanide chelates to gain sensitivity in biological media. The method was developed to follow liposome biodistribution. Octadecyl-DTPA.Eu compound has been prepared and incorporated into liposomes without alteration of its fluorescence signal. The method has been validated by comparison with fluorophore-labeled liposomes. The way to proceed to use this method for liposomes or other vectors is detailed.

  6. Resonance ionization scheme development for europium

    CERN Document Server

    Chrysalidis, K; Fedosseev, V N; Marsh, B A; Naubereit, P; Rothe, S; Seiffert, C; Kron, T; Wendt, K

    2017-01-01

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  7. Resonance ionization scheme development for europium

    Energy Technology Data Exchange (ETDEWEB)

    Chrysalidis, K., E-mail: katerina.chrysalidis@cern.ch; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)

    2017-11-15

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  8. Electronic state of europium atoms on surface of oxidized tungsten

    CERN Document Server

    Davydov, S Y

    2001-01-01

    The energy scheme of the europium atoms adsorption system on the tungsten surface, coated with the oxygen monolayer, is considered. The evaluations of the europium adatoms charged state on the oxidized tungsten surface are performed. It is established, that europium, adsorbed at the oxidized tungsten surface, is a positive ion with the charge close to the unit. The zonal scheme of the Eu-O/W adsorption system for the europium low and high concentrations is proposed

  9. Europium anomaly in plagioclase feldspar - Experimental results and semiquantitative model.

    Science.gov (United States)

    Weill, D. F.; Drake, M. J.

    1973-01-01

    The partition of europium between plagioclase feldspar and magmatic liquid is considered in terms of the distribution coefficients for divalent and trivalent europium. A model equation is derived giving the europium anomaly in plagioclase as a function of temperature and oxygen fugacity. The model explains europium anomalies in plagioclase synthesized under controlled laboratory conditions as well as the variations of the anomaly observed in natural terrestrial and extraterrestrial igneous rocks.

  10. Fermi Surface and Antiferromagnetism in Europium Metal

    DEFF Research Database (Denmark)

    Andersen, O. Krogh; Loucks, T. L.

    1968-01-01

    We have calculated the Fermi surface of europium in order to find those features which determine the wave vector of the helical moment arrangement below the Néel point. We find that there are two pieces of Fermi surface: an electron surface at the symmetry point H, which has the shape of rounded...... of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...

  11. Organophosphate Nerve Agent Detection with Europium Complexes

    Directory of Open Access Journals (Sweden)

    Jake R. Schwierking

    2004-01-01

    Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.

  12. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail: syamchand.ss@gmail.com; Sony, G., E-mail: emailtosony@gmail.com

    2015-09-15

    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  13. The Europium Oxybarometer: Power and Pitfalls

    Science.gov (United States)

    McKay, G.

    2004-01-01

    One of the most important characteristics of a planet is the oxidation state of its mantle, as reflected in primitive basalts. Petrologists have devised several methods to estimate the oxygen fugacity under which basalts crystallized. One method that has been the subject of recent interest involves the depth of the Eu anomaly in first-crystallizing minerals. A discussion detailing the experimental calibration of the Europium oxybarometer and the application of this device to Angrites and Martian basaltic meteorites are presented. The strengths and weaknesses of the instrument are also included.

  14. Europium Effect on the Electron Transport in Graphene Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Bobadilla, Alfredo D.; Ocola, Leonidas E.; Sumant, Anirudha V.; Kaminski, Michael; Kumar, Narendra; Seminario, Jorge M.

    2015-10-01

    We report in this complementary theoretical-experimental work the effect of gating on the election transport of grapheme ribbons when exposed to very low concentration of europium in an aqueous solution. We find a direct correlation between the level of concentration of europium ions in the solvent and the change in electron transport in graphene, observing a change of up to 3 orders of magnitude at the lowest level of concentration tested (0.1 mM), suggesting a possibility that graphene ribbons can be used for detecting very low concentrations of europium in liquid solutions.

  15. Paramagnetic Europium Salen Complex and Sickle-Cell Anemia

    Science.gov (United States)

    Wynter, Clive I.; Ryan, D. H.; May, Leopold; Oliver, F. W.; Brown, Eugene; Hoffman, Eugene J.; Bernstein, David

    2005-04-01

    A new europium salen complex, Eu(salen)2NH4, was synthesized, and its composition was confirmed by chemical analysis and infrared spectroscopy. Further characterization was carried out by 151 Eu Mössbauer spectroscopy and magnetic susceptibility measurements. Mössbauer spectroscopic measurements were made at varying temperatures between 9 K and room temperature and a value of Debye temperature of 133 ±5 K was computed. Both Mössbauer and magnetic susceptibility measurements confirmed the paramagnetic behavior of this complex and the trivalent state of the europium ion. In view of the fact that the "odd" paramagnetic molecule NO has been shown to reverse sickling of red blood cells in sickle cell anemia, the interaction between the paramagnetic europium salen complex and sickle cells was examined after incubation with this europium complex and shown to have similar effects.

  16. Europium polyoxometalates encapsulated in silica nanoparticles - characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)

    2013-06-15

    The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Spectral Properties of a bis-Azospiropyran Complexed with Europium

    Science.gov (United States)

    Nourmohammadian, F.; Ghahari, M.; Gholami, M. Davoudzadeh

    2015-09-01

    The complexation of recently synthesized symmetrical bifunctional bis-azospiropyran photochromic dye with europium nitrate and its effect on UV-vis absorption and fluorescent emission was studied. Upon addition of Eu 3+ to colorless spiropyran, a yellow merocyanine europium complex was obtained with an absorption band at 410 nm. Negatively charged phenolic oxygenin zwitterionic ring-open form provides an effective metal binding site for Eu 3+ . Meanwhile, the inherent fluorescence emission of the photochromic dye at 380 nm is switched off due to the Eu 3+ - induced drive of spiro-mero equilibrium to form mero form. The stoichiometry of dye-europium complexation was evaluated by fluorescence emission and UV-vis absorption spectroscopy and a 8:1 ratio was obtained in both cases. The binding constant (K) value of the dye-europium complex was 3 × 106 M -1 . In conclusion, the current molecular switch is a useful sensitive dual measuring tool for solutions containing europium or europium-like elements by evaluation of visible absorption or fluorescent emission spectroscopy.

  18. Metal plasmon enhanced europium complex luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Liu Feng [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Aldea, Gabriela [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Petru Poni Institute of Macromolecular Chemistry Iasi, Aleea Grigore Ghica Voda 41A, 700487 Iasi (Romania); Nunzi, Jean-Michel, E-mail: nunzijm@queensu.c [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada)

    2010-01-15

    The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod){sub 3}) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.

  19. Novel fluorescent probe for low density lipoprotein, based on the enhancement of Europium emission band

    OpenAIRE

    Courrol, Lilia Coronato; Monteiro, A.M.; SILVA, F.R.O.; L. Gomes; VIEIRA, N.D.; Gidlund, Magnus; Figueiredo Neto, A.M.

    2007-01-01

    We report here the observation of the enhancement of Europium-tetracycline complex emission in Low Density Lipoprotein (LDL) solutions. Europium emission band of tetracycline solution containing Europium (III) chloride hexahydrate was tested to obtain effective enhancement in the presence of native LDL and oxidized LDL. Europium emission lifetime in the presence of lipoproteins was measured, resulting in a simple method to measure the lipoproteins quantity in an aqueous solution at physiologi...

  20. Europium ion as a probe for binding sites to carrageenans

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail: medzaniquelli@ffclrp.usp.br; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)

    2007-12-15

    Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.

  1. First-Principles Investigations on Europium Monoxide

    KAUST Repository

    Wang, Hao

    2011-05-01

    Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.

  2. Chloride, bromide and iodide scintillators with europium

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2016-09-27

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  3. Electrochemical extraction of europium from molten fluoride media

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Massot, L., E-mail: massot@chimie.ups-tlse.f [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Chamelot, P.; Cassayre, L.; Taxil, P. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France)

    2009-12-15

    This work concerns the extraction of europium from molten fluoride media. Two electrochemical ways have been examined: (i) the use of a reactive cathode made of copper and (ii) the co-deposition with aluminium on inert electrode, leading to the formation of europium-copper and europium-aluminium alloys, respectively, as identified by SEM-EDS analysis. Cyclic voltammetry and square wave voltammetry were used to identify the reduction pathway and to characterise the step of Cu-Eu and Al-Eu alloys formation. Then, electrochemical extractions using the two methodologies have been performed with extraction efficiency around 92% for copper electrode and 99.7% for co-reduction with aluminium ions.

  4. Solubilization of europium fulvate in aqueous solutions containing complexing agents

    Energy Technology Data Exchange (ETDEWEB)

    Legin, E.K.; Trifonov, Yu.I.; Khokhlov, M.L. [Khlopin Radium Inst., St. Petersburg (Russian Federation)] [and others

    1995-07-01

    The europium fulvate complex is synthesized and characterized by spectroscopic and chemical methods. By an example of this complex, it is demonstrated that metal complexes of humic substances are solubilized in the presence of complexing anions such as OAc{sup {minus}}, C{sub 2}O{sup 2{minus}}{sub 4}, and EDTA{sup 2{minus}}. The solubilization is studied by the optical and radioactive tracer methods. The solubilization of europium fulvate increases parallel to the complexing power of anions. In the solid fulvate europium is bonded stronger than in the ethylenediaminetetraacetate complex. The solubilization is considered as a potential source for decomposition of the {open_quotes}absorbing soil complex,{close_quotes} resulting in mobile forms of a metal and humic component in soils and soil waters.

  5. Excess europium content in Precambrian sedimentary rocks and continental evolution

    Science.gov (United States)

    Jakes, P.; Taylor, S. R.

    1974-01-01

    It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.

  6. Murine High Specificity/Sensitivity Competitive Europium Insulin Autoantibody Assay

    Science.gov (United States)

    Babaya, Naru; Liu, Edwin; Miao, DongMei; Li, Marcella; Yu, Liping

    2009-01-01

    Abstract Background Most insulin autoantibody assays for both human and animal models are in a radioassay format utilizing 125I-insulin, but despite the radioassay format international workshops have documented difficulty in standardization between laboratories. There is thus a need for simpler assay formats that do not utilize radioactivity, yet retain the high specificity and sensitivity of radioassays. Methods To establish an easier enzyme-linked immunosorbent assay (ELISA) for insulin autoantibodies of non-obese diabetic (NOD) mice, we used an ELISA format, competition with unlabeled insulin, europium-avidin, and time-resolved fluorescence detection (competitive europium insulin autoantibody assay). Results The competitive europium assay of insulin autoantibodies when applied to sera from NOD mice had high sensitivity and specificity (92% sensitivity, 100% specificity) compared to our standard insulin autoantibody radioassay (72% sensitivity, 100% specificity) in analyzing blind workshop sera. It is noteworthy that though the assay has extremely high sensitivity for murine insulin autoantibodies and utilizes human insulin as target autoantigen, human sera with high levels of insulin autoantibodies are not detected. Conclusions Our results clearly indicate that low levels of insulin autoantibodies can be detected in an ELISA-like format. Combining a europium-based ELISA with competition with fluid-phase autoantigen can be applicable to many autoantigens to achieve high specificity and sensitivity in an ELISA format. PMID:19344197

  7. Tridentate benzimidazole-pyridine-tetrazolates as sensitizers of europium luminescence.

    Science.gov (United States)

    Shavaleev, Nail M; Eliseeva, Svetlana V; Scopelliti, Rosario; Bünzli, Jean-Claude G

    2014-05-19

    We report on new anionic tridentate benzimidazole-pyridine-tetrazolate ligands that form neutral 3:1 complexes with trivalent lanthanides. The ligands are UV-absorbing chromophores that sensitize the red luminescence of europium with energy-transfer efficiency of 74-100%. The lifetime and quantum yield of the sensitized europium luminescence increase from 0.5 ms and 12-13% for the as-prepared solids to 2.8 ms and 41% for dichloromethane solution. From analysis of the data, the as-prepared solids can be described as aqua-complexes [Ln(κ(3)-ligand)2(κ(1)-ligand)(H2O)x] where the coordinated water molecules are responsible for the strong quenching of the europium luminescence. In solution, the coordinated water molecules are replaced by the nitrogen atoms of the κ(1)-ligand to give anhydrous complexes [Ln(κ(3)-ligand)3] that exhibit efficient europium luminescence. X-ray structures of the anhydrous complexes confirm that the lanthanide ion (La(III), Eu(III)) is nine-coordinate in a distorted tricapped trigonal prismatic environment and that coordination of the lanthanide ion by tetrazolate is weaker than by carboxylate.

  8. Europium 2-benzofuranoate: Synthesis and use for bioimaging

    Science.gov (United States)

    Utochnikova, V. V.; Koshelev, D. S.; Medvedko, A. V.; Kalyakina, A. S.; Bushmarinov, I. S.; Grishko, A. Yu; Schepers, U.; Bräse, S.; Vatsadze, S. Z.

    2017-12-01

    Europium 2-benzofuranoate Eu(BFC)3(H2O)3 was successfully used for bioimaging in cellulo due to the combination of high solubility and high luminescence intensity in solution. It was possible due to the purposeful variation of the aromatic core of carboxylate anion.

  9. SEPARATION OF EUROPIUM FROM OTHER LANTHANIDE RAE EARTHS BY SOLVENT EXTRACTION

    Science.gov (United States)

    Peppard, D.F.; Horwitz, E.P.; Mason, G.W.

    1963-02-12

    This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)

  10. Distribution, elimination, and renal effects of single oral doses of europium in rats.

    Science.gov (United States)

    Ohnishi, Keiko; Usuda, Kan; Nakayama, Shin; Sugiura, Yumiko; Kitamura, Yasuhiro; Kurita, Akihiro; Tsuda, Yuko; Kimura, Motoshi; Kono, Koichi

    2011-11-01

    Single doses of europium (III) chloride hexahydrate were orally administered to several groups of rats. Cumulative urine samples were taken at 0-24 h, and blood samples were drawn after 24-h administration. The europium concentration was determined in these samples by inductively coupled plasma atomic emission spectroscopy. The volume, creatinine, ß-2-microglobulin, and N-acetyl-ß-D-glucosaminidase were measured in the urine samples to evaluate possible europium-induced renal effects. The blood samples showed low europium distribution, with an average of 77.5 μg/L for all groups. Although the urinary concentration and excretion showed dose-dependent increases, the percentage of europium excreted showed a dose-dependent decrease, with an average of 0.31% in all groups. The administration of europium resulted in a significant decrease of creatinine and a significant increase of urinary volume, N-acetyl-ß-D-glucosaminidase, and ß-2-microglobulin. Rare earth elements, including europium, are believed to form colloidal conjugates that deposit in the reticuloendothelial system and glomeruli. This specific reaction may contribute to low europium bioavailability and renal function disturbances. Despite low bioavailability, the high performance of the analytical method for determination of europium makes the blood and urine sampling suitable tools for monitoring of exposure to this element. The results presented in this study will be of great importance in future studies on the health impacts of rare earth elements.

  11. [Synthesis and luminescence properties of reactive ternary europium complexes].

    Science.gov (United States)

    Guo, Dong-cai; Shu, Wan-gen; Zhang, Wei; Liu, You-nian; Zhou, Yue

    2004-09-01

    In this paper, five new reactive ternary europium complexes were synthesized with the first ligand of 1,10-phenanthroline and the reactive second ligands of maleic anhydride, acrylonitrile, undecenoic acid, oleic acid and linoleic acid, and also characterized by means of elemental analysis, EDTA titrimetric method, FTIR spectra and UV spectra. The fluorescence spectra show that the five new ternary complexes have much higher luminescence intensity than their corresponding binary complexes, and the synergy ability sequence of the five reactive ligands is as follows: linoleic acid > oleic acid > acrylonitrile > maleic anhydride > undecenoic acid. At the same time, the reactive ternary europium complexes coordinated with the reactive ligands, which can be copolymerized with other monomers, will provide a new way for the synthesis of bonding-type rare earth polymer functional materials with excellent luminescence properties.

  12. Solvent extraction of europium(III) to a fluorine-free ionic liquid phase with a diglycolamic acid extractant

    OpenAIRE

    Rout, Alok; Souza, Ernesto Rezende; Binnemans, Koen

    2014-01-01

    Europium(III) was extracted by bis(2-ethylhexyl)diglycolamic acid (DEHDGA) dissolved in the non-fluorinated ionic liquid tetraoctylammonium dodecyl sulphate, [N8888][DS]. The extraction behaviour of europium(III) was investigated as a function of various parameters: pH, extractant concentration, concentration of the europium(III) ion in the aqueous feed and concentration of the salting-out agent. A comparison was made with extraction of europium(III) by the acidic extractants bis(2-ethylhexyl...

  13. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    2017-07-25

    Jul 25, 2017 ... Abstract. Europium (Eu3+) doped silver lead borate glasses with the composition of xEu2O3−(1 − x)Ag2. O−29PbO−70B2O3 (x = 0, 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional melt quenching method. Thermal, structural and luminescence properties have been studied ...

  14. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    Europium (Eu 3 + ) doped silver lead borate glasses with the composition of x Eu 2 O 3 −( 1 − x )Ag 2 O−29PbO−70B 2 O 3 ( x = 0 , 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional meltquenching method. Thermal, structural and luminescence properties have been studied using ...

  15. Synthesis and luminescence properties for europium oxide nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mo Zunli, E-mail: mozl@163.com [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China) and State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Deng Zhepeng; Guo Ruibin [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China); Fu Qiangang [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Feng Chao; Liu Pengwei; Sun Yu [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China)

    2012-01-25

    Highlights: Black-Right-Pointing-Pointer A novel high temperature sensitive fluorescent CNTs/Eu{sub 2}O{sub 3} nanocomposite was fabricated. Black-Right-Pointing-Pointer The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 Degree-Sign C for 4 h. Black-Right-Pointing-Pointer The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. Black-Right-Pointing-Pointer We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 Degree-Sign C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the {sup 5}D{sub 0} {yields} {sup 7}F{sub j} (j = 0, 1) forced electric dipole transition of Eu{sup 3+} ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 Degree-Sign C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu{sup 3+} energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.

  16. Optical and magnetization studies on europium based iron pnictides

    Energy Technology Data Exchange (ETDEWEB)

    Zapf, Sina Maria Ute

    2015-07-01

    The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.

  17. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength

    OpenAIRE

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2012-01-01

    Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level.

  18. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Science.gov (United States)

    2010-01-01

    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  19. Enhancement in red emission at room temperature from europium doped ZnO nanowires by 1,10 phenanthroline-europium interface induced resonant excitations

    Directory of Open Access Journals (Sweden)

    Soumen Dhara

    2017-02-01

    Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.

  20. Dual doped graphene oxide for electrochemical sensing of europium ion

    Science.gov (United States)

    Kumar, Sunil; Patra, Santanu; Madhuri, Rashmi; Sharma, Prashant K.

    2017-05-01

    This present work represents a single step hydrothermal method for the preparation of N, and N, S dual doped graphene oxide (GO). First time, a comparative electrochemical study between single dope and dual doped GO was carried out using potassium ferrocyanide as an electro-active probe molecule and found that the dual doped GO has the highest electrocatalytic activity than single doped, due to the presence of two heteroatoms as a doping material. Afterwards, the dual doped GO was successfully applied for the electrochemical detection of a rare earth element i.e. europium, with LOD value of 5.92 μg L-1.

  1. Crystal growth of nanoscaled europium selenide having characteristic crystal shapes

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Adachi, Taka-aki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Hasegawa, Yasuchika, E-mail: hasegawa@ms.naist.j [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Kawai, Tsuyoshi [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan)

    2009-12-04

    Tetrapod-shaped EuSe nanocrystals were prepared through the thermal reduction of europium chloride an organic selenide complex, n-hexadecylamine, and two additives oleic acid and oleylamine. The obtained EuSe nanoparticles were characterized by X-ray diffraction (XRD). The crystal grain size from the XRD spectrum was estimated to be 50 nm. In contrast, observation of the transmission electron microscope (TEM) gave larger sized EuSe (average size: 200 nm). Anisotropic crystal-growth of EuSe nanocrystals was achieved by addition of a small amount of oleic acid in the crystal growth process.

  2. 40 CFR 157.34 - Certification.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Certification. 157.34 Section 157.34... REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.34 Certification. (a) General. (1) The... that the package meets the standards of § 157.32. (2) Certification must be submitted with each...

  3. Photoprotective properties of the fluorescent europium complex in UV-irradiated skin.

    Science.gov (United States)

    Vogt, O; Lademann, J; Rancan, F; Meinke, M C; Schanzer, S; Stockfleth, E; Sterry, W; Lange-Asschenfeldt, B

    2013-01-01

    In this study, we compared the UV-protective abilities of the europium complex compared to titanium dioxide, which represents the most common physical filter for ultraviolet light in the broad-band spectral range. The UV absorption and light transformative capacities of the europium complex were evaluated using a spectrometer with a double-integrating sphere showing that the europium complex does not only absorb and reflect UV light, but transforms it into red and infrared light. It was found that the europium complex binds to the surface of Jurkat cells in vitro. Cells incubated with the europium complex showed a significantly higher viability after UVA and UVB irradiation as compared to untreated cells and cells incubated with titanium dioxide pointing out its photoprotective properties. The europium complex and titanium dioxide show similar penetration capacities into the stratum corneum as tested in human and porcine skin using tape stripping analysis. The europium complex has proved to be an efficient UV filter with a low cyto- and phototoxic profile and therefore represents a potential candidate for use in sunscreen formulations. Copyright © 2013 S. Karger AG, Basel.

  4. 33 CFR 157.128 - Stripping system.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Stripping system. 157.128 Section... Crude Oil Washing (COW) System on Tank Vessels Design, Equipment, and Installation § 157.128 Stripping system. (a) Each tank vessel having a COW system under § 157.10(e), § 157.10a(a)(2), or § 157.10c(b)(2...

  5. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.

    1995-03-01

    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  6. In Vivo Toxicity Studies of Europium Hydroxide Nanorods in Mice

    Science.gov (United States)

    Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H; Mukhopadhyay, Debabrata

    2009-01-01

    Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence properties and pro-angiogenic to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [EuIII(OH)3] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mgKg−1day−1) and time dependent manner (8–60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice sacrificed on day 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods. PMID:19616569

  7. Temperature dependences in electron-stimulated desorption of neutral europium

    CERN Document Server

    Ageev, V N; Madey, T E

    2003-01-01

    The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...

  8. The Oxidation State of Europium in Halide Glasses

    Science.gov (United States)

    Weber, J.K.R.; Vu, M.; Paßlick, C.; Schweizer, S.; Brown, D.E.; Johnson, C.E.; Johnson, J.A.

    2012-01-01

    The luminescent properties of divalent europium ions can be exploited to produce storage phosphors for x-ray imaging applications. The relatively high cost and limited availability of divalent europium halides makes it desirable to synthesize them from the readily available trivalent salts. In this work, samples of pure EuCl3 and fluoride glass melts doped with EuCl3 were processed at 700-800 °C in an inert atmosphere furnace. The Eu oxidation state in the resulting materials was determined using fluorescence and Mössbauer spectroscopy. Heat treatment of pure EuCl3 for 10 minutes at 710 °C resulted in a material comprising approximately equal amounts of Eu2+ and Eu3+. Glasses made using mixtures of EuCl2 and EuCl3 in the starting material contained both oxidation states. This paper describes the sample preparation and analysis and discusses the results in the context of chemical equilibria in the melts. PMID:22101252

  9. Innovative triboluminescence study of multivitamin doped europium tetrakis

    Energy Technology Data Exchange (ETDEWEB)

    Fontenot, R.S. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, K.N.; Aggarwal, M.D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); Hollerman, W.A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States)

    2012-05-15

    As the Space Shuttle program ends, NASA is developing the next generation of space vehicles. These new concept designs will require new and innovative structural health monitoring capabilities. One way to solve this problem is with smart impact sensors that use triboluminescent materials. In 2011, the authors reported an 82% increase in the triboluminescence yield of europium dibenzoylmethide triethylammonium (EuD{sub 4}TEA) by changing the starting material. It has been shown that introduction of dopants tends to enhance the triboluminescent light yield. Here we report the successful synthesis of a multivitamin doped europium tetrakis which appears to be spherical in shape. Inductively Coupled Plasma - Optical Emission Spectroscopy analysis showed the presence of 3.6% calcium, 0.62% magnesium, 0.1% iron, 0.01% copper and manganese. This new product has no shift in the triboluminescent or photoluminescent emission peaks, but only a change in the intensity. In addition, the doped EuD{sub 4}TEA powder statistically emits more triboluminescence while having the same decay time. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Photoactive thin films of polycaprolactam doped with europium (III) complex using phenylalanine as ligand

    Energy Technology Data Exchange (ETDEWEB)

    Santos Garcia, Irene Teresinha, E-mail: irene@iq.ufrgs.br [Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil); Velleda Ribeiro, Patricia; Silva Correa, Diogo; Neto da Cunha, Igor Michel; Lenin Villarreal Carreno, Neftali [Instituto de Quimica e Geociencias, Universidade Federal de Pelotas, Campus Capao do Leao, s/n. CEP 96010-900, Pelotas, RS (Brazil); Ceretta Moreira, Eduardo [PPGEE, Universidade Federal do Pampa, Campus Bage, Bage- RS (Brazil); Severo Rodembusch, Fabiano [Departamento de Quimica Organica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil)

    2011-12-01

    A photoactive complex based on europium(III) using the amino acid phenylalanine as ligand was prepared and characterized. The obtained europium(III)/phenylalanine complex presents an effective energy transfer from ligands to the rare earth center. The observed photoluminescent behavior for europium(III)/phenylalanine complex was similar to the well known europium(III)/ acetyl-{beta}-acetonate hydrate. New photoactive polyamide thin films were prepared using polycaprolactam as host of these complexes. The structural characterizations of the films were studied through Rutherford backscattering (RBS), Fourier transform infrared (FTIR) and Raman spectroscopies. The polyamide films doped with the amino acid and acetyl-{beta}-acetonate rare earth complexes maintain the original photoluminescent behavior, narrow emission bands corresponding to transitions {sup 5}D{sub 0} {yields} {sup 7}F{sub 0-4}, which indicates that this polymer is an excellent host to these complexes.

  11. Synthesis and luminescence properties of salicylaldehyde isonicotinoyl hydrazone derivatives and their europium complexes.

    Science.gov (United States)

    Shan, Wenfei; Liu, Fen; Liu, Jiang; Chen, Yanwen; Yang, Zehui; Guo, Dongcai

    2015-09-01

    Four novel salicylaldehyde isonicotinoyl hydrazone derivatives and their corresponding europium ion complexes were synthesized and characterized, while the luminescence properties and the fluorescence quantum yields of the target complexes were investigated. The results indicated that the ligands favored energy transfers to the emitting energy level of europium ion, and four target europium complexes showed the characteristic luminescence of central europium ion. Besides the luminescence intensity of the complex with methoxy group, which possessed the highest fluorescence quantum yield (0.522), was stronger than that of other complexes. Furthermore, the electrochemical properties of the target complexes were further investigated by cyclic voltammetry, the results indicated that the highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO) energy levels and the oxidation potential of the complexes with electron donating group increased, however, that of the complexes with accepting electron group decreased. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. [Synthesis and luminescence properties of ternary complexes of europium with aromatic carboxylic acid and acrylonitrile].

    Science.gov (United States)

    Guo, Dong-cai; Yi, Li-ming; Shu, Wan-gen; Zhang, Zhen-zhen; Zeng, Zhao-rong; Zhang, Xi-qian

    2006-11-01

    Five ternary complexes were synthesized from europium with aromatic carboxylic acid (p-methylbenzoic acid, methoxybenzoic acid, m-chlorobenzoic acid and benzoic acid, p-hydroxylbenzoic acid) and acrylonitrile, and characterized by means of elemental analysis, thermal analysis, FTIR spectra and UV spectra. The fluorescence spectra show that five ternary complexes have good luminescence properties, and the sequence of the ability of the aromatic carboxylic acids to transfer light energy to europium ion is as follows: p-methylbenzoic acid>benzoic acid>m-chlorobenzoic acid>p-hydroxylbenzoic acid>methoxybenzoic acid. Meanwhile, the ternary europium complexes containing a reactive ligand acrylonitrile will possibly have a potential application to the fabrication of bonding-type europium polymer luminescent materials.

  13. Optical characterization of europium-doped indium hydroxide nanocubes obtained by Microwave-Assisted Hydrothermal method

    OpenAIRE

    Motta, Fabiana Villela da; Marques,Ana Paula de Azevedo; Araújo,Vinícius Dantas de; Tavares, Mara Tatiane De Souza; Delmonte,Mauricio Roberto Bomio; Paskocimas, Carlos Alberto; Li, Máximo Siu; Nascimento, Rubens Maribondo do; Longo, Elson [UNESP

    2014-01-01

    Crystalline europium-doped indium hydroxide (In(OH)3:Eu) nanostructures were prepared by rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of europium-doped indium hydroxide (IH:xEu) samples under excitation (350.7 nm) present...

  14. Structural and optical properties of europium doped zirconia single crystals fibers grown by laser floating zone

    OpenAIRE

    Soares, M.R.N.; Nico, C.; Peres, M.; Ferreira, N.; Fernandes, A.J.S.; Monteiro, T.; COSTA, F.M.

    2011-01-01

    Yttria stabilized zirconia single crystal fibers doped with europium ions were developed envisaging optical applications. The laser floating zone technique was used in order to grow millimetric high quality single crystal fibers. The as-grown fibers are completely transparent and inclusion free, exhibiting a cubic structure. Under ultraviolet (UV) excitation, a broad emission band appears at 551 nm. The europium doped fibers are translucent with a tetragonal structure and exhibit an intense r...

  15. A non-aqueous reduction process for purifying ¹⁵³Gd produced in natural europium targets.

    Science.gov (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2013-12-01

    Gadolinium-153 is a low-energy gamma-emitter used in nuclear medicine imaging quality assurance. Produced in nuclear reactors using natural Eu₂O₃ targets, ¹⁵³Gd is radiochemically separated from europium isotopes by europium reduction. However, conventional aqueous europium reduction produces hydrogen gas, a flammability hazard in radiological hot cells. We altered the traditional reduction method, using methanol as the process solvent to nearly eliminate hydrogen gas production. This new, non-aqueous reduction process demonstrates greater than 98% europium removal and gadolinium yields of 90%. © 2013 Elsevier Ltd. All rights reserved.

  16. Intercalated europium metal in epitaxial graphene on SiC

    Science.gov (United States)

    Anderson, Nathaniel A.; Hupalo, Myron; Keavney, David; Tringides, Michael C.; Vaknin, David

    2017-10-01

    X-ray magnetic circular dichroism (XMCD) reveals the magnetic properties of intercalated europium metal under graphene on SiC(0001). The intercalation of Eu nanoclusters (average size 2.5 nm) between graphene and SiC substate are formed by deposition of Eu on epitaxially grown graphene that is subsequently annealed at various temperatures while keeping the integrity of the graphene layer. Using sum-rules analysis of the XMCD of Eu M4 ,5 edges at T =15 K, our samples show paramagnetic-like behavior with distinct anomaly at T ≈90 K, which may be related to the Nèel transition, TN=91 K, of bulk metal Eu. We find no evidence of ferromagnetism due to EuO or antiferromagnetism due to Eu2O3 , indicating that the graphene layer protects the intercalated metallic Eu against oxidation over months of exposure to atmospheric environment.

  17. 36 CFR 1192.157 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Lighting. 1192.157 Section 1192.157 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS COMPLIANCE BOARD... Buses and Systems § 1192.157 Lighting. (a) Any stepwell or doorway immediately adjacent to the driver...

  18. 43 CFR 15.7 - Fishing.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Fishing. 15.7 Section 15.7 Public Lands: Interior Office of the Secretary of the Interior KEY LARGO CORAL REEF PRESERVE § 15.7 Fishing. (a) Spear fishing within the boundaries or confines of this Preserve is prohibited. (b) The use of poisons, electric...

  19. 33 CFR 157.166 - Hydrocarbon emissions.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Hydrocarbon emissions. 157.166... Crude Oil Washing (COW) System on Tank Vessels Cow Operations § 157.166 Hydrocarbon emissions. If the... ballasted in that port the hydrocarbon vapors in each tank are contained by a means under § 157.132. Note...

  20. 49 CFR 38.157 - Lighting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Lighting. 38.157 Section 38.157 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Over-the-Road Buses and Systems § 38.157 Lighting. (a) Any stepwell or...

  1. 40 CFR 205.157 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 205.157 Section 205.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.157 Requirements. ...

  2. 14 CFR 61.157 - Flight proficiency.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Flight proficiency. 61.157 Section 61.157... CERTIFICATION: PILOTS, FLIGHT INSTRUCTORS, AND GROUND INSTRUCTORS Airline Transport Pilots § 61.157 Flight... and log ground and flight training from an authorized instructor on the areas of operation under this...

  3. 40 CFR 721.9511 - Silicic acid (H6SiO2O7), magnesium, strontium salt(1:1:2), dysprosium and europium-doped.

    Science.gov (United States)

    2010-07-01

    ..., strontium salt(1:1:2), dysprosium and europium-doped. 721.9511 Section 721.9511 Protection of Environment...), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (a) Chemical substance and significant new..., strontium salt(1:1:2), dysprosium and europium-doped. (PMN P-98-848; CAS No.181828-07-9) is subject to...

  4. Fluorescent lifetime imaging microscopy using Europium complexes improves atherosclerotic plaques discrimination.

    Science.gov (United States)

    Sicchieri, Letícia Bonfante; de Andrade Natal, Rodrigo; Courrol, Lilia Coronato

    2016-10-01

    The objective of this study is to characterize arterial tissue with and without atherosclerosis by fluorescence lifetime imaging microscopy (FLIM) using Europium Chlortetracycline complex (EuCTc) as fluorescent marker. For this study, twelve rabbits were randomly divided into a control group (CG) and an experimental group (EG), where they were fed a normal and hypercholesterolemic diet, respectively, and were treated for 60 days. Cryosections of the aortic arch specimens were cut in a vertical plane, mounted on glass slides, and stained with Europium (Eu), Chlortetracycline (CTc), Europium Chlortetracycline (EuCTc), and Europium Chlortetracycline Magnesium (EuCTcMg) solutions. FLIM images were obtained with excitation at 405 nm. The average autofluorescence lifetime within plaque depositions was ~1.36 ns. Reduced plaque autofluorescence lifetimes of 0.23 and 0.31 ns were observed on incubation with EuCTc and EuCTcMg respectively. It was observed a quenching of collagen, cholesterol and TG emission spectra increasing EuCTc concentration. The drastic reduction in fluorescence lifetimes is due to a resonant energy transfer between collagen, triglycerides, cholesterol and europium complexes, quenching fluorescence.

  5. Visible-light sensitized luminescent europium(III)-β-diketonate complexes: bioprobes for cellular imaging.

    Science.gov (United States)

    Reddy, M L P; Divya, V; Pavithran, Rani

    2013-11-21

    Visible-light sensitized luminescent europium(III) molecular materials are of considerable importance because their outstanding photophysical properties make them well suited as labels in fluorescence-based bioassays and low-voltage driven pure red-emitters in optoelectronic technology. One challenge in this field is development of visible-light sensitizing ligands that can form highly emissive europium(III) complexes with sufficient stability and aqueous solubility for practical applications. Indeed, some of the recent reports have demonstrated that the excitation-window can be shifted to longer-wavelengths in europium(III)-β-diketonate complexes by appropriate molecular engineering and suitably expanded π-conjugation in the complex molecules. In this review, attention is focused on the latest innovations in the syntheses and photophysical properties of visible-light sensitized europium(III)-β-diketonate complexes and their application as bioprobes for cellular imaging. Furthermore, luminescent nanomaterials derived from long-wavelength sensitized europium(III)-β-diketonate complexes and their application in life sciences are also highlighted.

  6. The electronic properties of mixed valence hydrated europium chloride thin film.

    Science.gov (United States)

    Silly, M G; Charra, F; Lux, F; Lemercier, G; Sirotti, F

    2015-07-28

    We investigate the electronic properties of a model mixed-valence hydrated chloride europium salt by means of high resolution photoemission spectroscopy (HRPES) and resonant photoemission spectroscopy (RESPES) at the Eu 3d → 4f and 4d → 4f transitions. From the HRPES spectra, we have determined that the two europium oxidation states are homogeneously distributed in the bulk and that the hydrated salt film is exempt from surface mixed valence transition. From the RESPES spectra, the well separated resonant contributions characteristic of divalent and trivalent europium species (4f(6) and 4f(7) final states, respectively) are accurately extracted and quantitatively determined from the resonant features measured at the two edges. The partial absorption yield spectra, obtained by integrating the photoemission intensity in the valence-band region, can be well reproduced by atomic multiplet calculation at the M(4,5) (3d-4f) absorption edge and by an asymmetric Fano-like shape profile at the N(4,5) (4d-4f) absorption edge. The ratio of Eu(2+) and Eu(3+) species measured at the two absorption edges matches with the composition of the mixed valence europium salt as determined chemically. We have demonstrated that the observed spectroscopic features of the mixed valence salt are attributed to the mixed-valence ground state rather than surface valence transition. HRPES and RESPES spectra provide reference spectra for the study of europium salts and their derivatives.

  7. Europium-doped calcium titanate: Optical and structural evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: ilvrosa@ufscar.br [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)

    2014-02-05

    Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.

  8. Dicty_cDB: VHP157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP157 (Link to dictyBase) - - - Contig-U16260-1 VHP157P (Link to Original site) VHP...157F 617 VHP157Z 723 VHP157P 1320 - - Show VHP157 Library VH (Link to library) Clone ID VHP...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-C/VHP157Q.Seq.d/ Representative seq. ID VHP...157P (Link to Original site) Representative DNA sequence >VHP157 (VHP157Q) /CSM/VH/VHP1-C/VHP...h*r--- ---prmg*k*chehlvfrsrr*rcqsprqchqrcsife*n*rffrwcfpmghqrrccl** kherypfqsl*chpph*chpqrwwsnhpncssctlcc*in

  9. Dicty_cDB: SLB157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB157 (Link to dictyBase) - - - - SLB157Z (Link to Original site) - - SLB...157Z 700 - - - - Show SLB157 Library SL (Link to library) Clone ID SLB157 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-C/SLB...157Q.Seq.d/ Representative seq. ID SLB157Z (Link to Original site) R...epresentative DNA sequence >SLB157 (SLB157Q) /CSM/SL/SLB1-C/SLB157Q.Seq.d/ XXXXXXXXXXCGTGATCTTACTGATTACATGAT

  10. RBS and RNRA studies on sorption of europium by apatite

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi

    1997-03-01

    The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)

  11. Spectrofluorimetric determination of heparin using doxycycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Li Jing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Liu Jinkai [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Zhu Xiaojing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Peng Qian [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2005-06-15

    A new spectrofluorimetric method was developed for the determination of the trace amount of heparin (Hep). Using doxycycline (DC)-europium ion (Eu{sup 3+}) as a fluorescent probe, in the buffer solution of pH=8.9, Hep can remarkably enhance the fluorescence intensity of the DC-Eu{sup 3+} complex at {lambda}=612 nm and the enhanced fluorescence intensity of Eu{sup 3+} ion is in proportion to the concentration of Hep. Optimum conditions for the determination of Hep were also investigated. The linear range and detection limit for the determination of Hep are 0.04-0.8 {mu}g/mL and 19.7 ng/mL, respectively. This method is simple, practical, and relatively free of interference from coexisting substances and can be successfully applied to assess Hep in biological samples. By the Rosenthal graphic method, the association constant and binding numbers of Hep with the probe are 6.60x10{sup 4} L/mol and 33.9. Moreover, the enhancement mechanism of the fluorescence intensity in the DC-Eu{sup 3+} system and the DC-Eu{sup 3+}-Hep-CTMAB system have been also discussed.

  12. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    Energy Technology Data Exchange (ETDEWEB)

    Babain, V.A.; Alyapyshev, M.Yu.; Karavan, M.D. [V.G. Khlopin Radium Inst., St. Petersburg (Russian Federation); Boehmer, V.; Wang, L. [Johannes Guttenberg Univ., Mainz (Germany); Shokova, E.A.; Motornaya, A.E.; Vatsouro, I.M.; Kovalev, V.V. [M. V. Lomonosov Moscow State Univ., Moscow (Russian Federation)

    2005-07-01

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH{sub 2}){sub n}-NH-C(O)-CH{sub 2-}P(O)Ph{sub 2}] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO{sub 3} solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient D{sub Am}/D{sub Eu} for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (D{sub Am}/D{sub Eu}). (orig.)

  13. Preparation of europium-labelled DNA probes and their properties.

    Science.gov (United States)

    Hurskainen, P; Dahlén, P; Ylikoski, J; Kwiatkowski, M; Siitari, H; Lövgren, T

    1991-01-01

    A chemical method for labelling DNA with a europium chelate is presented. First, primary aliphatic amino groups are introduced onto DNA in a transamination reaction. The transamination reaction is altered by adjusting temperature and duration of the reaction. Subsequently, the modified DNA is reacted with an isothiocyanate derivative of a Eu chelate. The optimum amount of Eu chelates on a DNA probe is 4-8% of total nucleotides. There is a decrease of 0.7 degrees C in the melting temperature of DNA for each incorporated Eu chelate on 100 bases. Hybridization efficiency is lowered by the introduction of Eu chelates but this effect can be partly overcome by using high DNA probe concentrations. The detection limit of the Eu-labelled probe is 0.15 attomoles of target DNA in a mixed-phase hybridization assay on microtitration wells. In addition to high sensitivity the Eu-labelled probes offer convenience in use and results which are quantitative and easy to interpret. PMID:1826948

  14. Chloride, bromide and iodide scintillators with europium doping

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2014-08-26

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  15. Spectrofluorimetric determination of lecithin using a tetracycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ting [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2006-03-02

    Trace amount of lecithin (PC) was determined in the buffer solution of pH 5.7, using tetracycline (TC)-europium ion (Eu{sup 3+}) as a fluorescent probe. PC can remarkably enhance the fluorescence intensity of the TC-Eu{sup 3+} complex at {lambda} = 612 nm and the enhanced fluorescence intensity of Eu{sup 3+} is in proportion to the concentration of PC. Optimum conditions for the determination of PC were also investigated. The linear range and detection limit for the determination of PC are 4.0 x 10{sup -7} to 1.4 x 10{sup -5} mol/L and 3.9 x 10{sup -8} mol/L. This method is simple, practical and relatively free of interference from coexisting substances and can be successfully applied to assess PC in serum samples. Moreover, the enhancement mechanism of the fluorescence intensity in the TC-Eu{sup 3+} system, the TC-Eu{sup 3+}-PC system, and the TC-Eu{sup 3+}-PC-sodium dodecyl benzene sulfonate (SDS) system is also discussed.

  16. Artifacts in the determination of the binding of americium and europium to an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Lead, J.R.; Hamilton-Taylor, J.; Kelly, M. [Institute of Environmental and Biological Sciences, Lancaster University, Lancaster (United Kingdom)

    1995-11-23

    The binding of europium and americium by an aquatic fulvic acid was investigated using an equilibrium ion exchange technique (Schubert`s method). The results for europium were consistent with literature data. Americium gave anomalous results for both the D{sub o} values (partition coefficient of the metal between the resin and solution phases in the absence of the fulvic acid) and D values (partition coefficient of the metal between the resin and solution phases in the presence of the fulvic acid). The values for americium were unexpectedly low and, in the case of D values, only slightly pH dependent. The cause of the discrepancy was found to be the partial dissolution of the resin or the loss of small colloidal material from the resin. The effects on the europium results were minimal due to the use of lower resin weights and higher metal concentrations

  17. Synthesis and luminescence properties of 2-(benzylcarbamoyl)phenyl derivatives and their europium complexes.

    Science.gov (United States)

    Guo, Dongcai; He, Wei; Liu, Bang; Gou, Lining; Li, Ruixia

    2013-01-01

    Six novel 2-(benzylcarbamoyl)phenyl derivatives were synthesized and characterized by (1) H-NMR, mass spectrometry, infrared spectra and elemental analysis. Their europium complexes were prepared and characterized by elemental analysis, EDTA titrimetric analysis, IR and UV spectra as well as molar conductivity measurements. The luminescence properties of these complexes were investigated and results show that 2-(benzylcarbamoyl)phenyl derivatives possess high selectivity and good coordination with the europium ion. Complex Eu-2-(benzylcarbamoyl)phenyl-2-phenylacetate showed green luminescence that was emitted by the ligand of 2-(benzylcarbamoyl)phenyl-2-phenylacetate, while other complexes showed the characteristic red luminescence of europium ion and also possessed high luminescence intensity. Copyright © 2012 John Wiley & Sons, Ltd.

  18. Induction of Circularly Polarized Luminescence from Europium by Amino Acid Based Ionic Liquids.

    Science.gov (United States)

    Zercher, Ben; Hopkins, Todd A

    2016-11-07

    Materials that emit circularly polarized light have application in several important industries. Because they show large optical activity and emit sharp visible light transitions, europium complexes are often exploited in applications that require circularly polarized luminescence (CPL). Chiral and coordinating ionic liquids based on prolinate, valinate, and aspartate anions are used to induce CPL from a simple achiral europium triflate salt. The sign of the induced CPL is dependent on the handedness (l vs d) of the amino acid anion. Comparison of the CPL spectra in ionic liquid with proline and valine vs aspartate shows that the number of carboxylate groups in the amino acid anion influences the europium coordination environment. DFT calculations predict a chiral eight-coordinate Eu(Pro)4- structure in the prolinate ionic liquid and a chiral seven- or eight-coordinate Eu(Asp)33- structure in the aspartate ionic liquid.

  19. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium.

    Science.gov (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier

    2014-07-07

    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dongwook, E-mail: dongwookleedl324@gmail.com [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: jiwonseo@yonsei.ac.kr [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)

    2015-08-15

    A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.

  1. Europium stearate additives delay oxidation of UHMWPE for orthopaedic applications: a pilot study.

    Science.gov (United States)

    Gallardo, Luis A; Carpentieri, Ilenia; Laurent, Michel P; Costa, Luigi; Wimmer, Markus A

    2011-08-01

    Ultrahigh-molecular-weight polyethylene (UHMWPE) is used as an articulating surface in prosthetic devices. Its failure under various mechanisms after oxidation is of utmost concern. Free radicals formed during the sterilization process using high-energy irradiation result in oxidation. Europium, an element of the lanthanide family, has a unique electron configuration with an unusual lack of preference for directional bonding and notable bonding to oxygen. Because of this, it currently is used in studies for stabilization of polymers such as polyvinyl chloride. We asked whether europium stearate could enhance the oxidation resistance after irradiation in nitrogen of UHMWPE. Conventional nonirradiated and gamma-irradiated in nitrogen UHMWPE were compared with polyethylene doped with 375 ppm and 3750 ppm europium(III) stearate under the same treatment conditions. Chemical characterization was performed by Fourier transform infrared (FTIR) microspectroscopy using 200-μm thin films. The oxidation of doped samples with time was compared with that of conventional samples using accelerated oven aging. The types of oxidation products were identified by FTIR and quantified per material and treatment condition as indications of the oxidation level and mechanism. The generation rate of hydroperoxides and ketones was decelerated proportionally with concentration of europium stearates. The oxidative mechanism appeared similar to that of conventional polyethylene with the same types of measurable end products as ketones and hydroperoxides. Yet, the rate of generation of the latter appeared to be slowed down by the action of europium stearate. Europium stearate mixed in UHMWPE decelerated the oxidation reactions triggered by gamma irradiation in nitrogen, seemingly without major alteration of the oxidation mechanism.

  2. BPC 157 and blood vessels.

    Science.gov (United States)

    Seiwerth, Sven; Brcic, Luka; Vuletic, Lovorka Batelja; Kolenc, Danijela; Aralica, Gorana; Misic, Marija; Zenko, Anita; Drmic, Domagoj; Rucman, Rudolf; Sikiric, Predrag

    2014-01-01

    This review focuses on the described effects of BPC 157 on blood vessels after different types of damage, and elucidate by investigating different aspects of vascular response to injury (endothelium damage, clotting, thrombosis, vasoconstriction, vasodilatation, vasculoneogenesis and edema formation) especially in connection to the healing processes. In this respect, BPC 157 was concluded to be the most potent angiomodulatory agent, acting through different vasoactive pathways and systems (e.g. NO, VEGF, FAK) and leading to optimization of the vascular response followed, as it has to be expected, by optimization of the healing process. Formation of new blood vessels involves two main, partly overlapping mechanisms, angiogenesis and vasculogenesis. The additional mechanism of arteriogenesis is involved in the formation of collaterals. In conjunction with blood vessel function, we at least have to consider leakage of fluid/proteins/plasma, resulting in edema/exudate formation as well as thrombogenesis. Blood vessels are also strongly involved in tumor biology. In this aspect, we have neoangiogenesis resulting in pathological vascularization, vascular invasion resulting in release of metastatic cells and the phenomenon of homing resulting in formation of secondary tumors--metastases.

  3. Temperature dependent luminescence of a europium complex incorporated in poly(methyl methacrylate).

    Science.gov (United States)

    Liang, Hao; Xie, Fang; Ren, Xiaojun; Chen, Yifa; Chen, Biao; Guo, Fuquan

    2013-12-01

    An europium β-diketonate complex with a dipyrazolyltriazine derivative ligand, Eu(TTA)3DPBT, has been incorporated into poly(methyl methacryate) (PMMA). The influence of temperature on its luminescence properties has been investigated. The fluorescence emission spectra and luminescence lifetimes showed temperature sensitivity. The analysis of the relative intensity ratio (R) of (5)D0 → (7)F2 to (5)D0 → (7)F1 transition and Judd-Ofelt experimental intensity parameters Ω2 indicated that the local structure and asymmetry in the vicinity of europium ions show no obvious change when the temperature is increased. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Dicty_cDB: CHF157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF157 (Link to dictyBase) - - - Contig-U15817-1 CHF157P (Link to Original site) CHF1...57F 676 CHF157Z 644 CHF157P 1300 - - Show CHF157 Library CH (Link to library) Clone ID CHF1...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-C/CHF157Q.Seq.d/ Representative seq. ID CHF1...57P (Link to Original site) Representative DNA sequence >CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF1...s producing significant alignments: (bits) Value CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF157Q.Seq.d/ 2272 0.0 VHC

  5. 18 CFR 157.53 - Testing.

    Science.gov (United States)

    2010-04-01

    ... 157.53 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES OF PUBLIC CONVENIENCE AND... Exemption of Natural Gas Service for Drilling, Testing, or Purging from Certificate Requirements § 157.53...

  6. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming bids...

  7. 42 CFR 422.157 - Accreditation organizations.

    Science.gov (United States)

    2010-10-01

    ... (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Quality Improvement § 422.157 Accreditation... accreditation no longer provides assurance that the Medicare requirements are met or exceeded. (3) Onsite... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 422.157 Section 422...

  8. Prevalence of Escherichia coli O157

    NARCIS (Netherlands)

    Abdissa, Rosa; Haile, Woynshet; Fite, Akafete Teklu; Beyi, Ashenafi Feyisa; Agga, Getahun E.; Edao, Bedaso Mammo; Tadesse, Fanos; Korsa, Mesula Geloye; Beyene, Takele; Beyene, Tariku Jibat; Zutter, De Lieven; Cox, Eric; Goddeeris, Bruno Maria

    2017-01-01

    Background: There is paucity of information regarding the epidemiology of Escherichia coli O157: H7 in developing countries. In this study, we investigated the occurrence of E. coli O157: H7 associated with beef cattle at processing plants and at retail shops in Ethiopia. Methods: Various samples

  9. Study of the europium behavior in aqueous media; Estudio sobre el comportamiento del europio en medios acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.

  10. Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions

    Energy Technology Data Exchange (ETDEWEB)

    Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)

    2008-07-01

    Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)

  11. A novel biocompatible europium ligand for sensitive time-gated immunodetection.

    Science.gov (United States)

    Sayyadi, Nima; Connally, Russell E; Try, Andrew

    2016-01-21

    We describe the synthesis of a novel hydrophilic derivative of a tetradentate β-diketone europium ligand that was used to prepare an immunoconjugate probe against Giardia lamblia cysts. We used a Gated Autosynchronous Luminescence Detector (GALD) to obtain high quality delayed luminescence images of cells 30-fold faster than ever previously reported.

  12. Europium-doped barium halide scintillators for x-ray and ?-ray detections

    NARCIS (Netherlands)

    Selling, J.; Birowosuto, M.D.; Dorenbos, P.; Schweizer, S.

    2007-01-01

    Single crystals of undoped or europium-doped barium chloride, bromide, and iodide were investigated under x-ray and ?-ray excitations. The Eu2+-related x-ray excited luminescence found in the Eu-doped barium halides occurs at 402, 404, and 425?nm for the chloride, bromide, and iodide, respectively.

  13. A europium luminescence assay of lactate and citrate in biological fluids†

    Science.gov (United States)

    Pal, Robert; Costello, Leslie C.

    2013-01-01

    Ratiometric methods of analysis have been developed for the selective determination of lactate or citrate in microlitre samples of human serum, urine or prostate fluids following comparison of anion binding affinities for a family of nine luminescent europium(III) complexes. PMID:19343236

  14. Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)

    Energy Technology Data Exchange (ETDEWEB)

    Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)

    2017-06-01

    With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.

  15. Europium doped In(Zn)P/ZnS colloidal quantum dots

    NARCIS (Netherlands)

    Thuy, Ung Thi Dieu; Maurice, Axel; Liem, Nguyen Quang; Reiss, Peter

    2013-01-01

    Chemically synthesised In(Zn)P alloy nanocrystals are doped with Eu(3+) ions using europium oleate as a molecular precursor and are subsequently covered with a ZnS shell. The presence of zinc in the synthesis of the InP core nanocrystals leads to the formation of an In(Zn)P alloy structure, making

  16. NO fluorescence sensing by europium tetracyclines complexes in the presence of H2O2.

    Science.gov (United States)

    Simões, Eliana F C; Leitão, João M M; Esteves da Silva, Joaquim C G

    2013-07-01

    The effect on the fluorescence of the europium:tetracycline (Eu:Tc), europium:oxytetracycline (Eu:OxyTc) and europium:chlortetracycline (Eu:ClTc) complexes in approximately 2:1 ratio of nitric oxide (NO), peroxynitrite (ONOO(-)), hydrogen peroxide (H2O2) and superoxide (O2 (·-)) was assessed at three ROS/RNS concentrations levels, 30 °C and pH 6.00, 7.00 and 8.00. Except for the NO, an enhancement of fluorescence intensity was observed at pH 7.00 for all the europium tetracyclines complexes-the high enhancement was observed for H2O2. The quenching of the fluorescence of the Tc complexes, without and with the presence of other ROS/RNS species, provoked by NO constituted the bases for an analytical strategy for NO detection. The quantification capability was evaluated in a NO donor and in a standard solution. Good quantification results were obtained with the Eu:Tc (3:1) and Eu:OxyTc (4:1) complexes in the presence of H2O2 200 μM with a detection limit of about 3 μM (Eu:OxyTc).

  17. Long-term tagging of elvers, Anguilla anguilla, with radioactive europium

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Fattah, A. T. A.

    1986-01-01

    -life of added europium of 1.6 .+-. 0.5 years. Thirteen hundred 155Eu-labelled elvers (50 Bq per eel), each weighing on average 0.21 g, were set out near Oskarshamn on the east coast of Sweden in June 1982. Three of these were caught nearby in May 1985 and one was caught in August 1985. They weighed...

  18. ULTRAVIOLET TRANSITIONS IN EUROPIUM STUDIED WITH A FREQUENCY-DOUBLED CW RING DYE-LASER

    NARCIS (Netherlands)

    Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.

    1981-01-01

    High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.

  19. Optical and Morphological Characterization of Sonochemically Assisted Europium Doped Copper (I) Oxide Nanostructures

    Science.gov (United States)

    Cosico, J. A. M.; Ruales, P. K.; Marquez, M. C.

    2017-06-01

    In the age where application of nanotechnology in our society has proven to be eminent, different routes of synthesizing nanoparticles have emerged. In this study nanoparticles of cuprous oxide (Cu2O) doped with different amounts of europium was prepared by using solution precursor route approach with the aid of ultrasonic sound. Copper sulphate and europium (III) nitrate pentahydrate was used as source for copper ions and europium ions respectively. X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR) were used to elucidate the cubic crystal structure and organic impurities present on Cu2Onanoparticles. UV-Vis spectroscopy was used to determine the absorption spectrum of the nanoparticles in the wavelength range of 400nm to 700nm. The bandgap of the undoped and doped Cu2O were found to fall between 2.1eV - 2.3eV. Scanning Electron Microscopy (SEM) coupled with energy dispersive x-ray was used to observe the dendritic and rodlike morphology and the presence of europium in the synthesized Cu2O nanoparticles. The observed effect on the absorbance of Cu2O upon adding Eu and a facile way of synthesizing Cu2O nanoparticles could bring a positive impact on the production of functional devices for optoelectronic and energy applications.

  20. Occurrence of photoluminescence and onion like structures decorating graphene oxide with europium using sodium dodecyl sulfate surfactant

    Science.gov (United States)

    Cedeño, V. J.; Rangel, R.; Cervantes, J. L.; Lara, J.; Alvarado, J. J.; Galván, D. H.

    2017-07-01

    Graphene oxide decoration with europium was carried out using SDS (sodium dodecyl sulfate) as the surfactant. The reaction was performed in a microwave oven and subsequently underwent thermal treatment under hydrogen flow. The results found in the present work demonstrate that through the use of SDS surfactant aggregates of hemi-cylindrical and onion-like structures could be obtained; which propitiate an enhanced synergistic photoluminescence located at the red wavelength. On the other hand, after thermal treatment the aggregates disappear providing a good dispersion of europium, however a decrease in the photoluminescence signal is observed. The graphene oxide decorated with europium was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier infrared transform spectroscopy (FTIR), RAMAN spectroscopy, x-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) techniques, showing the characteristic features of graphene oxide and europium.

  1. Synthesis, characterization, and properties of reduced europium molybdates and tungstates

    Energy Technology Data Exchange (ETDEWEB)

    Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: zurloye@mailbox.sc.edu [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)

    2015-09-15

    Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.

  2. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate.

    Science.gov (United States)

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun

    2014-07-07

    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  3. Dicty_cDB: VHB157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available to library) VHB157 (Link to dictyBase) - - - Contig-U11741-1 - (Link to Original site) VHB157F 687 - -...- - - - - Show VHB157 Library VH (Link to library) Clone ID VHB157 (Link to dictyBase) Atlas ID - NBRP...URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHB1-C/VHB157Q.Seq.d/ Representative seq. ID - (Link to Original...site) Representative DNA sequence >VHB157 (VHB157Q) /CSM/VH/VHB1-C/VHB157Q.Seq.d/ CCAAGTACCACTCATTACCAA...significant alignments: (bits) Value VHB157 (VHB157Q) /CSM/VH/VHB1-C/VHB157Q.Seq.d/ 1342 0.0 VHE292 (VHE292Q)

  4. The effect of two additional Eu3+ lumophors in two novel trinuclear europium complexes on their photoluminescent properties.

    Science.gov (United States)

    Yang, Chaolong; Xu, Jing; Ma, Jianying; Zhu, Dongyu; Zhang, Yunfei; Liang, Liyan; Lu, Mangeng

    2013-02-01

    Two novel trinuclear europium complexes based on trisphen(1,3,5-tris{4-((1,10-phenanthroline-[5,6-d]imidazol-2yl)phenoxy)methyl}-2,4,6-trimethyl-benzene) as a second ligand were designed, synthesized, and characterized by FT-IR, (1)H NMR, UV-visible, photoluminescence (PL) spectroscopy, elemental analysis (EA) and ESI-MS. The geometries of these two trinuclear europium complexes were predicted using the Sparkle/PM3 model and suggested a chemical environment of very low symmetry around the lanthanide ions (C(1)), which is in agreement with the luminescent spectra. CV analysis demonstrated that the trinuclear complexes possessed excellent electro-injection abilities. The effects of two additional Eu(3+) lumophors in these trinuclear europium complexes on their photoluminescent properties were investigated in detail. The results indicated that these trinuclear europium complexes exhibited highly luminescent quantum efficiencies and experimental intensity parameters in the solid state. Especially, due to the contribution of the two additional Eu(3+) lumophors in the trinuclear europium complexes, the quantum efficiency of the trinuclear complex Eu(3)(TTA)(9)trisphen was higher (ca. 34%) than the mononuclear europium complex Eu(TTA)(3)imidazophen.

  5. Stable gastric pentadecapeptide BPC 157 and bupivacaine.

    Science.gov (United States)

    Zivanovic-Posilovic, Gordana; Balenovic, Diana; Barisic, Ivan; Strinic, Dean; Stambolija, Vasilije; Udovicic, Mario; Uzun, Sandra; Drmic, Domagoj; Vlainic, Josipa; Bencic, Martina Lovric; Sindic, Aleksandra; Seiwerth, Sven; Sikiric, Predrag

    2016-12-15

    Bupivacaine toxicity following accidental overdose still lacks therapeutic solution. However, there are major arguments for testing BPC 157 against bupivacaine toxicity in vivo in rats, in particular, and then finally, in vitro. These are: the lack of any known BPC 157 toxicity, a lifesaving effect via the mitigation of arrhythmias in rats underwent hyperkalemia or digitalis toxicity, the elimination of hyperkalemia and arrhythmias in rats underwent succinylcholine toxicity and finally, the reduction of potassium-induced depolarization in vitro (in HEK293 cells) in severe hyperkalemia. Most importantly, BPC 157 successfully prevents and counteracts bupivacaine cardiotoxicity; BPC 157 is effective even against the worst outcomes such as a severely prolonged QRS complex. Here, rats injected with bupivacaine (100mg/kg IP) exhibited bradycardia, AV-block, ventricular ectopies, ventricular tachycardia, T-wave elevation and asystole. All of the fatalities had developed T-wave elevation, high-degree AV-block, respiratory arrest and asystole. These were largely counteracted by BPC 157 administration (50µg/kg, 10µg/kg, 10ng/kg, or 10pg/kg IP) given 30min before or 1min after the bupivacaine injection. When BPC 157 was given 6min after bupivacaine administration, and after the development of prolonged QRS intervals (20ms), the fatal outcome was markedly postponed. Additionally, the effect of bupivacaine on cell membrane depolarization was explored by measuring membrane voltages (Vm) in HEK293 cells. Bupivacaine (1mM) alone caused depolarization of the cells, while in combination with BPC 157 (1µm), the bupivacaine-induced depolarization was inhibited. Together, these findings suggest that the stable gastric pentadecapeptide BPC 157 should be a potential antidote for bupivacaine cardiotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. E.coli O157:H7

    Directory of Open Access Journals (Sweden)

    Treor Francis Fernandez

    2008-06-01

    Full Text Available The serious nature of the symptoms of haemorrhagic colitis and HUS and the apparent low infectious dose (<100 cells of E.coli O157:H7 places this food borne pathogen a most serious of known food borne pathogens. Persuasive evidence suggests that healthy cattle are a reservoir of O157 and they can enter the food chain to provide a source of exposure for humans. A possible route of transmission of O157 VTEC may involve infections initially in calves that shed their organism into faecal slurry that may be used on grazing grass. This provides potential for infection of other animals from which the organism may contaminate milk or carcasses at slaughter. Possible sources of VTEC in healthy animals other E.coli O157:H7 than cattle and a wider range of foodstuffs require further investigation. Many features of E.coli O157:H7 strains remain poorly understood. It includes: (i Role of virulent genes in the animal, (ii Mechanism of evolution of the organism, (iii The progress of individual cases of E.coli O157:H7 infection, and (iv The difference in incidence of infection in different geographical areas. [Veterinary World 2008; 1(3.000: 83-87

  7. Isolation and genomic characterization of Escherichia coli O157:NM ...

    African Journals Online (AJOL)

    Human diseases caused by Escherichia coli O157:NM and E. coli O157:H7 strains have been reported throughout the world. In developed countries, serotype O157:H7 represents the major cause of human diseases; however, there have been increasing reports of non-O157 Shiga toxin (Stx)-producing E. coli strains ...

  8. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  9. Incorporation of europium III complex into nanoparticles and films obtained by the Sol-Gel methodology

    Directory of Open Access Journals (Sweden)

    Faley Jean de Sousa

    2010-03-01

    Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.

  10. A Simple and Sensitive Method to Quantify Biodegradable Nanoparticle Biodistribution using Europium Chelates.

    Science.gov (United States)

    Crawford, Lindsey; Higgins, Jaclyn; Putnam, David

    2015-09-08

    The biodistribution of biodegradable nanoparticles can be difficult to quantify. We report a method using time resolved fluorescence (TRF) from a lanthanide chelate to minimize background autofluorescence and maximize the signal to noise ratio to detect biodegradable nanoparticle distribution in mice. Specifically, antenna chelates containing europium were entrapped within nanoparticles composed of polylactic acid-polyethylene glycol diblock copolymers. Tissue accumulation of nanoparticles following intravenous injection was quantified in mice. The TRF of the nanoparticles was found to diminish as a second order function in the presence of serum and tissue compositions interfered with the europium signal. Both phenomena were corrected by linearization of the signal function and calculation of tissue-specific interference, respectively. Overall, the method is simple and robust with a detection limit five times greater than standard fluorescent probes.

  11. A Comprehensive Strategy to Boost the Quantum Yield of Luminescence of Europium Complexes

    Science.gov (United States)

    Lima, Nathalia B. D.; Gonçalves, Simone M. C.; Júnior, Severino A.; Simas, Alfredo M.

    2013-01-01

    Lanthanide luminescence has many important applications in anion sensing, protein recognition, nanosized phosphorescent devices, optoelectronic devices, immunoassays, etc. Luminescent europium complexes, in particular, act as light conversion molecular devices by absorbing ultraviolet (UV) light and by emitting light in the red visible spectral region. The quantum yield of luminescence is defined as the ratio of the number of photons emitted over the number of UV photons absorbed. The higher the quantum yield of luminescence, the higher the sensitivity of the application. Here we advance a conjecture that allows the design of europium complexes with higher values of quantum yields by simply increasing the diversity of good ligands coordinated to the lanthanide ion. Indeed, for the studied cases, the percent boost obtained on the quantum yield proved to be strong: of up to 81%, accompanied by faster radiative rate constants, since the emission becomes less forbidden. PMID:23928866

  12. Assembly of europium organic framework–gold nanoparticle composite thin films on silicon substrate

    Energy Technology Data Exchange (ETDEWEB)

    Deep, Akash, E-mail: dr.akashdeep@gmail.com [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kaur, Rajnish [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kumar, Parveen [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Kumar, Pawan; Paul, A.K. [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India)

    2014-08-28

    Metal organic frameworks are a sub-class of coordination polymers and rapidly generating huge research interests in several technological areas. One of the emerging areas of their potential applications is the photovoltaics. The present study proposes the assembly of europium organic framework–gold nanoparticle nanocomposite thin film on silicon substrate. Microscopic, X-ray diffraction, surface area measurement and thermal studies have indicated the formation of the desired thin film. Spectral studies have been used to highlight their solid state optical property. Current–voltage studies have established semiconducting property of the above thin films. - Highlights: • Thin film of europium organic framework/gold nanoparticles is prepared on silicon. • Fairly homogeneous films with a roughness factor of 5–10 nm are obtained. • Above thin films offer solid-state photoluminescence and semiconducting properties.

  13. Synthesis and optical features of an europium organic-inorganic silicate hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Franville, A.C.; Zambon, D.; Mahiou, R.; Chou, S.; Cousseins, J.C. [Universite Blaise Pascal, Aubiere (France). Lab. des Materiaux Inorganiques; Troin, Y. [Laboratoire de Chimie des Heterocycles et des Glucides, EA 987, Universite Blaise-Pascal and ENSCCF, F-63177 Aubiere Cedex (France)

    1998-07-24

    A europium organic-inorganic silicate hybrid was synthesized by grafting a coordinative group (dipicolinic acid) to a silicate network precursor (3-aminopropyltriethoxysilane) via a covalent bonding. Sol-gel process and complexation were performed using different experimental conditions. The hybrid materials, in particular the Eu{sup 3+} coordination mode, were characterized by infrared and luminescence spectroscopies. Morphology of the materials and TG analysis showed that grafted silica enhanced thermal and mechanical resistances of the organic part. (orig.) 7 refs.

  14. Development of a microchip Europium nanoparticle immunoassay for sensitive point-of-care HIV detection.

    Science.gov (United States)

    Liu, Jikun; Du, Bingchen; Zhang, Panhe; Haleyurgirisetty, Mohan; Zhao, Jiangqin; Ragupathy, Viswanath; Lee, Sherwin; DeVoe, Don L; Hewlett, Indira K

    2014-11-15

    Rapid, sensitive and specific diagnostic assays play an indispensable role in determination of HIV infection stages and evaluation of efficacy of antiretroviral therapy. Recently, our laboratory developed a sensitive Europium nanoparticle-based microtiter-plate immunoassay capable of detecting target analytes at subpicogram per milliliter levels without the use of catalytic enzymes and signal amplification processes. Encouraged by its sensitivity and simplicity, we continued to miniaturize this assay to a microchip platform for the purpose of converting the benchtop assay technique to a point-of-care test. It was found that detection capability of the microchip platform could be readily improved using Europium nanoparticle probes. We were able to routinely detect 5 pg/mL (4.6 attomoles) of HIV-1 p24 antigen at a signal-to-blank ratio of 1.5, a sensitivity level reasonably close to that of microtiter-plate Europium nanoparticle assay. Meanwhile, use of the microchip platform effectively reduced sample/reagent consumption 4.5 fold and shortened total assay time 2 fold in comparison with microtiter plate assays. Complex matrix substance in plasma negatively affected the microchip assays and the effects could be minimized by diluting the samples before loading. With further improvements in sensitivity, reproducibility, usability, assay process simplification, and incorporation of portable time-resolved fluorescence reader, Europium nanoparticle immunoassay technology could be adapted to meet the challenges of point-of-care diagnosis of HIV or other health-threatening pathogens at bedside or in resource-limited settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Green Luminescence of Divalent Europium in the Hydride Chloride EuHCl

    NARCIS (Netherlands)

    Kunkel, Nathalie; Rudolph, Daniel; Meijerink, A; Rommel, Stefan; Weihrich, Richard; Kohlmann, Holger; Schleid, Thomas

    Luminescence properties of divalent europium in the mixed-anion hydride chloride EuHCl were studied for the first time. Olive-green single crystals of EuHCl (PbFCl-type structure: tetragonal, P4/nmm, a = 406.58(3) pm, c = 693.12(5) pm, c/a = 1.705, Z = 2) resulted from the reaction of elemental

  16. Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Stollenwerk, Tobias

    2013-09-15

    In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.

  17. Redox electrochemistry of europium fluoride complexes in an equimolar NaCl-KCl melt

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, S.A., E-mail: kuznet@chemy.kolasc.net.ru [Institute of Chemistry, Kola Science Centre RAS, 26 Akademgorodok., 184209 Apatity, Murmansk region (Russian Federation); Gaune-Escard, M. [Ecole Polytechnique, Mecanique Energetique, Technopole de Chateau Gombert, 5 rue Enrico Fermi, 13453 Marseille Cedex 13 (France)

    2011-07-15

    The electrochemical behavior of europium fluoride complexes was studied by different electrochemical methods at a glassy carbon electrode in the temperature range 973-1100 K in the NaCl-KCl melt. The diffusion coefficients of Eu(III) and Eu(II) were determined by linear sweep voltammetry. The standard rate constants of charge transfer for the Eu(III)/Eu(II) redox couple were found on the base cyclic voltammetry, impedance spectroscopy and chronoamperometry data. The formal standard redox potentials E{sub Eu(III)/Eu(II)}{sup *} were obtained by linear sweep and cyclic voltammetry. The electrochemical behavior of europium fluoride and europium chloride complexes in NaCl-KCl melt was compared and discussed in connection with the strength and stability of these complexes. It was shown that the formation of stronger fluoride complexes reduced values of diffusion coefficients, standard rate constants for charge transfer of the Eu(III)/Eu(II) redox couple and shifted the formal standard redox potentials to the more electronegative values.

  18. Lateral flow immunoassay using europium chelate-loaded silica nanoparticles as labels.

    Science.gov (United States)

    Xia, Xiaohu; Xu, Ye; Zhao, Xilin; Li, Qingge

    2009-01-01

    Despite their ease of use, lateral flow immunoassays (LFIAs) often suffer from poor quantitative discrimination and low analytical sensitivity. We explored the use of a novel class of europium chelate-loaded silica nanoparticles as labels to overcome these limitations. Antibodies were covalently conjugated onto europium chelate-loaded silica nanoparticles with dextran as a linker. The resulting conjugates were used as labels in LFIA for detection of hepatitis B surface antigen (HBsAg). We performed quantification with a digital camera and Adobe Photoshop software. We also used 286 clinical samples to compare the proposed method with a quantitative ELISA. A detection limit of 0.03 microg/L was achieved, which was 100 times lower than the colloidal gold-based LFIAs and lower than ELISA. A precise quantitative dose-response curve was obtained, and the linear measurement range was 0.05-3.13 microg/L, within which the CVs were 2.3%-10.4%. Regression analysis of LFIA on ELISA results gave: log (LFIA) = -0.14 log (ELISA) + 1.03 microg/L with r = 0.99 for the quantification of HBsAg in 35 positive serum samples. Complete agreement was observed for the qualitative comparison of 286 clinical samples assayed with LFIA and ELISA. Europium chelate-loaded silica nanoparticle labels have great potential to improve LFIAs, making them useful not only for simple screening applications but also for more sensitive and quantitative immunoassays.

  19. Luminescent solutions and films of new europium complexes with chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Ivanov, Alexey V.; Borisova, Nataliya E.; Kaminskaya, Tatiana P.; Patsaeva, Svetlana V.; Popov, Vladimir V.; Yuzhakov, Viktor I.

    2015-03-01

    The development of new complexes of rare earth elements (REE) with chelating organic ligands opens up the possibility of purposeful alteration in the composition and structure of the complexes, and therefore tuning their optical properties. New ligands possessing two pyridine rings in their structure were synthesized to improve coordination properties and photophysical characteristics of REE compounds. Complexes of trivalent europium with novel chelating ligands were investigated using luminescence and absorption spectroscopy, as well as atomic force microscopy. Luminescence properties of new compounds were studied both for solutions and films deposited on the solid support. All complexes exhibit the characteristic red luminescence of Eu (III) ion with the absolute lumenescence quantum yield in polar acetonitrile solution varying from 0.21 to 1.45 % and emission lifetime ranged from 0.1 to 1 ms. Excitation spectra of Eu coordination complexes correspond with absorption bands of chelating ligand. The energy levels of the triplet state of the new ligands were determined from the phosphorescence at 77 K of the corresponding Gd (III) complexes. The morphology of films of europium complexes with different substituents in the organic ligands was investigated by atomic force microscopy (AFM). It strongly depends both on the type of substituent in the organic ligand, and the rotation speed of the spin-coater. New europium complexes with chelating ligands containing additional pyridine fragments represent outstanding candidates for phosphors with improved luminescence properties.

  20. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength.

    Science.gov (United States)

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2013-01-01

    Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f'' = 11.17 e(-), at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules.

  1. Hydrothermal treatment for preparation of europium-lanthanum phosphates and exploration of their fluorescence properties

    Directory of Open Access Journals (Sweden)

    Hiroaki Onoda

    2014-04-01

    Full Text Available Europium-substituted lanthanum phosphates (Eu; 5 mol% were prepared from lanthanum nitrate, europium nitrate, and sodium polyphosphate solutions by a hydrothermal process at 120 and 160 °C up to 8 h. The obtained phosphates were studied using XRD, IR spectroscopy, TG–DTA, and SEM. UV–vis absorbance and reflectance, as well as fluorescence, were estimated as functional properties of these phosphate materials. We found that samples prepared without hydrothermal treatment were amorphous (as indicated by their XRD patterns, whereas those prepared by a hydrothermal treatment contained peaks corresponding to lanthanum orthophosphate, indicating that the hydrothermal process caused the polyphosphate(s to decompose into orthophosphate(s. The TG–DTA curves of the samples prepared by a hydrothermal treatment were different from those of the samples prepared without hydrothermal treatment. All samples reported herein had no specified shape despite using prolonged hydrothermal treatment times. Although the samples prepared without hydrothermal treatment showed only weak fluorescence peaks, those prepared by a hydrothermal treatment showed strong peaks at 556, 590, 615, and 690 nm. These peaks corresponded to transitions from 5D0 to 7F0, 7F1, 7F2, and 7F4, respectively. Collectively, these results indicate that the hydrothermal treatment is a useful method of obtaining europium-substituted lanthanum phosphates with fluorescence properties.

  2. Fabrication of coated graphite electrode for the selective determination of europium (III) ions.

    Science.gov (United States)

    Upadhyay, Anjali; Singh, Ashok Kumar; Bandi, Koteswara Rao; Jain, A K

    2013-10-15

    Preliminary complexation study showed that two ligands (ionophores) (2-((2-phenyl-2-(pyridin-2-yl)hydazono)methyl)pyridine) [L1], (2-((2-phenyl-2-(pyridin-2-yl)hydazono) methyl)phenol) [L2] can act as europium selective electrode. Europium selective coated graphite electrodes (CGE) were prepared by using ligands [L1] and [L2] and their potentiometric characteristics were determined. Membranes having different compositions of poly(vinylchloride) (PVC), the different plasticizers, anionic additives and ionophores were coated onto the graphite surface. The potential response measurements showed that the best performance was exhibited by the proposed CGE. This electrode had the widest working concentration range, Nernstian slope and fast response times of 10s. The selectivity studies showed that this electrode have higher selectivity towards Eu(3+) over a large number of cations. Furthermore, the electrode generated constant potentials in the pH range 2.7-9.0. This electrode can be used to quantify europium in soil, binary mixtures and also used as an indicator electrode in the potentiometric titration of Eu(3+) with EDTA. The proposed electrode was also successfully applied to the determination of fluoride ions in real samples. © 2013 Elsevier B.V. All rights reserved.

  3. Fluorescent Sulfur-Tagged Europium(III) Coordination Polymers for Monitoring Reactive Oxygen Species.

    Science.gov (United States)

    Wang, Huai-Song; Bao, Wen-Jing; Ren, Shi-Bin; Chen, Ming; Wang, Kang; Xia, Xing-Hua

    2015-07-07

    Oxidative stress caused by reactive oxygen species (ROS) is harmful to biological systems and implicated in various diseases. A variety of selective fluorescent probes have been developed for detecting ROS to uncover their biological functions. Generally, the preparation of the fluorescent probes usually undergoes multiple synthetic steps, and the successful fluorescent sensing usually relies on trial-and-error tests. Herein we present a simple way to prepare fluorescent ROS probes that can be used both in biological and environmental systems. The fluorescent europium(III) coordination polymers (CPs) are prepared by simply mixing the precursors [2,2'-thiodiacetic acid and Eu(NO3)3·6H2O] in ethanol. Interestingly, with the increase of reaction temperature, the product undergoes a morphological transformation from microcrystal to nanoparticle while the structure and fluorescent properties retain. The fluorescence of the sulfur-tagged europium(III) CPs can be selectively quenched by ROS, and thus, sensitive and selective monitoring of ROS in aerosols by the microcrystals and in live cells by the nanoparticles has been achieved. The results reveal that the sulfur-tagged europium(III) CPs provide a novel sensor for imaging ROS in biological and environmental systems.

  4. Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite

    Science.gov (United States)

    Niño-Martínez, Nereyda; Patiño-Marín, Nuria

    2016-01-01

    The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1) in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours. PMID:27965525

  5. Real-time in situ monitoring via europium emission of the photo-release of antitumor cisplatin from a Eu-Pt complex.

    Science.gov (United States)

    Li, Hongguang; Lan, Rongfeng; Chan, Chi-Fai; Jiang, Lijun; Dai, Lixiong; Kwong, Daniel W J; Lam, Michael Hon-Wah; Wong, Ka-Leung

    2015-09-25

    A water-soluble light-responsive antitumor agent, PtEuL, based on a cisplatin-linked europium-cyclen complex has been synthesized and evaluated for controlled cisplatin release by linear/two-photon excitation in vitro with concomitant turn-on and long-lived europium emission as a responsive traceable signal.

  6. Europium doping induced symmetry deviation and its impact on the second harmonic generation of doped ZnO nanowires

    Science.gov (United States)

    Dhara, Soumen; Imakita, Kenji; Mizuhata, Minoru; Fujii, Minoru

    2014-06-01

    In this work, we investigated the effects of europium doping on the second harmonic generation (SHG) of ZnO nanowires (NWs). A non-monotonic enhancement in the SHG is observed with the increase of the europium concentration. Maximum SHG is observed from the 1 at.% europium doped ZnO NWs with an enhancement factor of 4.5. To understand the underlying mechanism, the effective second order non-linear coefficient (deff) is calculated from the theoretical fitting with consideration of the absorption effect. Microstructural characterization reveals the structural deformation of the ZnO NWs caused by europium doping. We estimated the deviation in the crystal site symmetry around the Eu3+ ions (defined as the asymmetric factor) from photoluminescence measurement and it is found to be strongly correlated with the calculated deff value. A strong linear dependence between the magnitudes of deff and the asymmetric factor suggests that deviation in the local site symmetry of the ZnO crystal by europium doping could be the most probable origin of the observed large second order non-linearity.

  7. 33 CFR 157.126 - Pumps.

    Science.gov (United States)

    2010-07-01

    ... Washing (COW) System on Tank Vessels Design, Equipment, and Installation § 157.126 Pumps. (a) Crude oil must be supplied to the COW machines by COW system pumps or cargo pumps. (b) The pumps under paragraph...) A sufficient pressure and flow is supplied to allow the simultaneous operation of those COW machines...

  8. 49 CFR 15.7 - Covered persons.

    Science.gov (United States)

    2010-10-01

    ... including a person formerly in such position. (l) Each person for which a vulnerability assessment has been... assessment that will be provided to DOT or DHS in support of a Federal security program. (m) Each person... Office of the Secretary of Transportation PROTECTION OF SENSITIVE SECURITY INFORMATION § 15.7 Covered...

  9. 7 CFR 3560.157 - Occupancy rules.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.157 Occupancy... access. A copy of these rules must be attached to the tenant's lease upon initial occupancy. At a minimum... office locations, hours, and emergency telephone numbers; (8) The restrictions on storage and...

  10. Charge growth, dispersion in europium manganite (EuMnO{sub 3-{delta}}) ceramics revealed using opto-impedance probe

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, S. [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India); Jagannathan, R., E-mail: jags57_99@yahoo.com [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India)

    2011-05-19

    Highlights: > In this study, using opto-, magneto-opto impedance techniques, experimental proof for charge growth in europium manganite (EuMnO{sub 3}) near the region of its Neel temperature is presented. > This study gives data related to dielectric properties of europium manganite. > This study may open-up new avenues for investigating the dielectric characteristics of many electronic-ceramics. - Abstract: In this preliminary report, we present the impedance characteristics of poly-crystalline europium manganite, a promising colossal magneto resistance (CMR) system investigated under optical ({approx}5 eV) and magnetic (0.1 T) perturbations yielding some clues on the charge build-up and dispersion processes. This may possibly be resulting from switching between ferromagnetic and anti-ferromagnetic phases through a charge transfer transition mediated process centering Mn{sup 3+/4+} 3d spins thereby meriting a more detailed study correlating with magnetic measurements.

  11. Rapid and accurate tumor-target bio-imaging through specific in vivo biosynthesis of a fluorescent europium complex.

    Science.gov (United States)

    Ye, Jing; Wang, Jianling; Li, Qiwei; Dong, Xiawei; Ge, Wei; Chen, Yun; Jiang, Xuerui; Liu, Hongde; Jiang, Hui; Wang, Xuemei

    2016-04-01

    A new and facile method for rapidly and accurately achieving tumor targeting fluorescent images has been explored using a specifically biosynthesized europium (Eu) complex in vivo and in vitro. It demonstrated that a fluorescent Eu complex could be bio-synthesized through a spontaneous molecular process in cancerous cells and tumors, but not prepared in normal cells and tissues. In addition, the proteomics analyses show that some biological pathways of metabolism, especially for NADPH production and glutamine metabolism, are remarkably affected during the relevant biosynthesis process, where molecular precursors of europium ions are reduced to fluorescent europium complexes inside cancerous cells or tumor tissues. These results proved that the specific self-biosynthesis of a fluorescent Eu complex by cancer cells or tumor tissues can provide a new strategy for accurate diagnosis and treatment strategies in the early stages of cancers and thus is beneficial for realizing precise surgical intervention based on the relevant cheap and readily available agents.

  12. Polystyrene latex particles containing europium complexes prepared by miniemulsion polymerization using bovine serum albumin as a surfactant for biochemical diagnosis.

    Science.gov (United States)

    Aikawa, Tatsuo; Mizuno, Akihiro; Kohri, Michinari; Taniguchi, Tatsuo; Kishikawa, Keiki; Nakahira, Takayuki

    2016-09-01

    Luminescent particles have been attracting significant attention because they can be used in biochemical applications, such as detecting and imaging biomolecules. In this study, luminescent polystyrene latex particles were prepared through miniemulsion polymerization of styrene with dissolved europium complexes in the presence of bovine serum albumin (BSA) and poly(ethylene glycol) monomethoxy methacrylate as surfactants. The solubility of the europium complex in styrene has a strong effect on the yield of the particle. Europium tris(2-thenoyl trifluoroacetonate) di(tri-n-octyl phosphine oxide), which has a high solubility in styrene, was sufficiently incorporated into the polystyrene particles compared to europium tris(2-thenoyl trifluoroacetonate), which has a low solubility in styrene. The luminescence property of the europium complex could remain intact even after its incorporation through the miniemulsion polymerization. In the aqueous dispersion, the resulting particles could emit strong luminescence, which is a characteristic of the europium complex. The antibody fragments were covalently attached to BSA-covered particles after a reaction with a bifunctional linker, N-(6-maleimidocaproyloxy)succinimide. The time-resolved fluoroimmunoassay technique showed that 3.3pg/mL of human α-fetoproteins (AFP) can be detected by using the resulting luminescent particles. An immunochromatographic assay using the resulting particles was also performed as a convenient method to qualitatively detect biomolecules. The detection limit of AFP measured by the immunochromatographic assay was determined to be 2000pg/mL. These results revealed that the luminescent particles obtained in this study can be utilized for the highly sensitive detection of biomolecules and in vitro biochemical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Detection of Escherichia coli O157 and non-O157 Serogroups in ...

    African Journals Online (AJOL)

    Of the 21 (5.5%) diarrhoeagenic Escherichia coli strains recovered E. coli O157 accounted for 5 (1.3%), 6 (1.6%) and 9 (2.4%) respectively. The rate of isolation of E. coli O157 in cattle faeces and raw cow milk was 1.5% each while, water was 6.3%. The frequency of isolation of E. coli O118, O111 and O26 serotypes from ...

  14. Presence of Escherichia coli O157 and O157:H7 in raw milk and Van herby cheese

    Directory of Open Access Journals (Sweden)

    Sancak Yakup Can

    2015-12-01

    Full Text Available The Shiga toxin-producing Escherichia coli (STEC strains are currently considered important emerging pathogens threatening public health. Among Shiga toxin-producing Escherichia coli, E. coli O157:H7 strains have emerged as important human pathogens. This study was conducted to determine the presence of Escherichia coli O157 and O157:H7 in raw milk samples and Van herby cheese samples. For this purpose, 100 samples of raw milk were collected and 100 samples of herby cheese sold for consumption in Van province in Turkey were obtained from grocers and markets in order to detect the presence of Escherichia coli O157 and O157:H7. The method of E. coli O157 and O157:H7 isolation proposed by the Food and Drug Administration (FDA was used. E. coli O157 in raw milk and herby cheese samples was found in 11% and 6% of samples respectively, and E. coli O157:H7 was found in 2% of herby cheese samples. No E. coli O157:H7 was detected in raw milk samples. This study showed that raw milk was contaminated with E. coli O157 and herby cheese was contaminated with both E. coli O157 and E. coli O157:H7; therefore, herby cheese poses a serious risk to public health.

  15. Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)

    2016-07-01

    The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.

  16. Electron-induced desorption of europium atoms from oxidized tungsten surface: concentration dependence of low-energy peak

    CERN Document Server

    Davydov, S Y

    2002-01-01

    One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms

  17. Optical properties of europium(III) {beta}-diketonate/polymer-doped systems using supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimova, V.I., E-mail: vis@srd.sinp.msu.ru [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Antoshkov, A.A.; Zavorotny, Yu.S.; Rybaltovskii, A.O. [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Lemenovskii, D.A., E-mail: dali@org.chem.msu.ru [Chemistry Department, Moscow State University, Leninskie Gory 1-3, GSP-1, 119991 Moscow (Russian Federation)

    2013-02-15

    The optical properties of fluoropolymers and polypropylene doped with europium(III) {beta}-diketonates Eu(L){sub 3}{center_dot}2H{sub 2}O and Eu(L){sub 3}phen (L: fod=6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato, bta=4,4,4-trifluoro-1-phenyl-1,3-butanedione, tta=4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione, and phen=1,10-phenanthroline) using supercritical carbon dioxide were investigated by absorption and emission spectra. A comparative analysis of the PL decay times of Eu{sup 3+} ions in the initial europium (III) {beta}-diketonates and impregnated fluoropolymers was carried out. The supercritical fluid (SCF) impregnation of polymer samples with europium(III) {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed differently depending on the type of ligand in the entire investigated impregnation temperature range (T{sub SCF}=50-90 Degree-Sign S). It is shown that from the variety of Eu(L){sub 3}phen only Eu(fod){sub 3}phen can be introduced into the polymer matrix by this method. - Highlights: Black-Right-Pointing-Pointer The optical properties of polymers doped with Eu{sup 3+} {beta}-diketonates using SC CO{sub 2} were investigated. Black-Right-Pointing-Pointer A comparative analysis of the PL decay times in the initial Eu{sup 3+} {beta}-diketonates and doped polymers was carried out. Black-Right-Pointing-Pointer The SC CO{sub 2} impregnation of polymers with Eu{sup 3+} {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed.

  18. Reverse lyotropic liquid crystals from europium nitrate and P123 with enhanced luminescence efficiency.

    Science.gov (United States)

    Yi, Sijing; Li, Qintang; Liu, Hongguo; Chen, Xiao

    2014-10-02

    Fabrication of lyotropic aggregates containing the lanthanide ions is becoming a preferable way to prepare novel functional materials. Here, the lyotropic liquid crystals (LLCs) of reverse hexagonal, reverse bicontinuous cubic, and lamellar phases have been constructed in sequence directly from the mixtures of Eu(NO3)3·6H2O and Pluronic P123 amphiphilc block copolymer with increasing the salt proportion. Their phase types and structural characteristics were analyzed using polarized optical microscopy (POM) and small-angle X-ray scattering (SAXS) measurements. The driving forces of reverse LLC phase formation were investigated using Fourier-transformed infrared spectroscopy (FTIR) and rheological measurements. The hydrated europium salt was found to act not only as a solvent here, but also as the bridge to form hydrogen bonding between coordinated water molecules and PEO blocks, which played a key role in the reverse LLCs formation. Compared to those in aqueous solutions and solid state, the enhanced luminescence quantum yields and prolonged excited state lifetimes were observed in two europium containing reverse mesophases. The luminescence quenching effect of lanthanide ions was efficiently suppressed, probably due to the substitution of coordinated water molecules by oxyethyl groups of P123 and ordered phase structures of LLCs, where the coordinated europium ions were confined and isolated by PEO blocks. The optimum luminescence performance was then found to exist in the reverse hexagonal phase. The obtained results on such lanthanide-induced reverse LLCs should be referable for designing new luminescent soft materials construction to expand their application fields.

  19. How Do Radionuclides Accumulate in Marine Organisms? A Case Study of Europium with Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Shuh, David K; Minasian, Stefan G; Pacold, Joseph I; Solari, Pier-Lorenzo; Michel, Hervé; Oberhaensli, François R; Bottein, Yasmine; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2016-10-04

    In the ocean, complex interactions between natural and anthropogenic radionuclides, seawater, and diverse marine biota provide a unique window through which to examine ecosystem and trophic transfer mechanisms in cases of accidental dissemination. The nature of interaction between radionuclides, the marine environment, and marine species is therefore essential for better understanding transfer mechanisms from the hydrosphere to the biosphere. Although data pertaining to the rate of global transfer are often available, little is known regarding the mechanism of environmental transport and uptake of heavy radionuclides by marine species. Among marine species, sponges are immobile active filter feeders and have been identified as hyperaccumulators of several heavy metals. We have selected the Mediterranean sponge Aplysina cavernicola as a model species for this study. Actinide elements are not the only source of radioactive release in cases of civilian nuclear events; however, their physicochemical transfer mechanisms to marine species remain largely unknown. We have targeted europium(III) as a representative of the trivalent actinides such as americium or curium. To unravel biological uptake mechanisms of europium in A. cavernicola, we have combined radiometric (γ) measurements with spectroscopic (time-resolved laser-induced fluorescence spectroscopy, TRLIFS, and X-ray absorption near-edge structure, XANES) and imaging (transmission electron microscopy, TEM, and scanning transmission X-ray microscopy, STXM) techniques. We have observed that the colloids of NaEu(CO3)2·nH2O formed in seawater are taken up by A. cavernicola with no evidence that lethal dose has been reached in our working conditions. Spectroscopic results suggest that there is no change of speciation during uptake. Finally, TEM and STXM images recorded at different locations across a sponge cross section, together with differential cell separation, indicate the presence of europium particles (around

  20. 46 CFR 45.157 - Scuppers and gravity drains.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from spaces...

  1. 33 CFR 157.120 - Waiver of required documents.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Waiver of required documents. 157.120 Section 157.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... documents. The Coast Guard waives the requirement for the letter under § 157.116(b), if a U.S. tank vessel...

  2. 14 CFR 157.2 - Definition of terms.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Definition of terms. 157.2 Section 157.2... NOTICE OF CONSTRUCTION, ALTERATION, ACTIVATION, AND DEACTIVATION OF AIRPORTS § 157.2 Definition of terms..., seaplane base, ultralight flightpark, manned balloon launching facility, or other aircraft landing or...

  3. Immunomagnetic separation of Escherichia coli O157:H7 from ...

    African Journals Online (AJOL)

    Standard immunoassay kits specific for the O157 and H7 antigen and a biochemical indole test were used for further E. coli O157:H7 confirmation. Three colonies from one sewage sample (1.1 % of all sewage samples) agglutinated with anti-E. coli O157 and H7 antiserum and contained the genes coding for Stx2, eaeA ...

  4. 33 CFR 157.158 - COW operations: Changed characteristics.

    Science.gov (United States)

    2010-07-01

    ... characteristics. 157.158 Section 157.158 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND...: Changed characteristics. The COW system may be operated with characteristics that do not meet those... changed characteristics; (b) The changed characteristics used to pass the inspections under § 157.140 are...

  5. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent but...

  6. 33 CFR 157.440 - Autopilot alarm or indicator.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Autopilot alarm or indicator. 157.440 Section 157.440 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... § 157.440 Autopilot alarm or indicator. (a) A tankship owner or operator shall ensure that each...

  7. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova

    2012-03-01

    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  8. Synergistic extraction of europium and americium into nitrobenzene by using hydrogen dicarbollylcobaltate and dodecaethylene glycol.

    Science.gov (United States)

    Makrlík, Emanuel; Vaňura, Petr; Selucký, Pavel

    2013-01-01

    Extraction of microamounts of europium and americium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of dodecaethylene glycol (DDEG, L) has been investigated. The equilibrium data have been explained assuming that the species HL+, H2L2+, ML3+ and MH-1L2+ (M3+ = Eu3+, Am3+; L = DDEG) are extracted into the organic phase. The values of extraction and stability constants of the complex species in nitrobenzene saturated with water have been determined. It was found that in this nitrobenzene medium, the stability constant of the EuL3+ complex is comparable with that of AmL3+.

  9. Red/blue electroluminescence from europium-doped organic light emitting diodes

    Science.gov (United States)

    Hagen, Joshua A.; Li, Wayne X.; Grote, James G.; Steckl, Andrew J.

    2006-02-01

    Red/Blue emitting organic light emitting diodes (OLED) devices have been obtained using a Europium-doped organic emitting layer (NPB:Eu). The Eu-doped OLEDs emit in 2 color ranges: a broad blue (~420-500nm) band due to NPB emission and a narrow red peak at 620nm due to Eu emission. The red/blue devices achieve a brightness ~13x more intense than a similarly structured green (Alq 3) emitting OLED. These NPB:Eu emitting structures also reach a maximum efficiency of 0.2 cd/A at brightnesses above 100 cd/m2.

  10. Test of zircon materials for sorption of europium; Pruebas de materiales circoniferos para sorcion de europio

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-01

    In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)

  11. Sol-Gel Synthesis, X-Ray Diffraction Studies, and Electric Conductivity of Sodium Europium Silicate

    Directory of Open Access Journals (Sweden)

    Ekaterina V. Borisova

    2013-01-01

    Full Text Available Sodium europium silicate, NaEu9(SiO46O2, with apatite structure has been obtained and studied using X-ray diffraction and SEM. It has been shown that sodium sublimation does not take place upon synthesis by the sol-gel method. Rietveld refinement has revealed that sodium atoms are ordered and occupy the 4f position. O(4 atoms not related to silicate ions are placed at the centers of Eu(2 triangles. DC and AC electric conductivity and activation energy have been determined for the compound studied.

  12. New Class of Bright and Highly Stable Chiral Cyclen Europium Complexes for Circularly Polarized Luminescence Applications.

    Science.gov (United States)

    Dai, Lixiong; Lo, Wai-Sum; Coates, Ian D; Pal, Robert; Law, Ga-Lai

    2016-09-06

    High glum values of +0.30 (ΔJ = 1, 591 nm, in DMSO) and -0.23 (ΔJ = 1, 589 nm, in H2O) were recorded in our series of newly designed macrocyclic europium(III) complexes. A sterically locking approach involving a bidentate chromophore is adopted to control the formation of one stereoisomer, giving rise to extreme rigidity, high stability, and high emission intensity. The combination of a chiral substituent on a macrocyclic chelate for lanthanide ions opens up new perspectives for the further development of circulary polarized luminescent chiral tags in optical and bioapplications.

  13. A microemulsion preparation of nanoparticles of europium in silica with luminescence enhancement using silver

    Science.gov (United States)

    Ma, Zhi Ya; Dosev, Dosi; Kennedy, Ian M

    2010-01-01

    A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core–silica shell (Ag@SiO2) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag@SiO2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability. PMID:19417456

  14. Metal Controlled Diastereoselective Self-assembly and Circularly Polarized Luminescence of a Chiral Heptanuclear Europium Wheel

    Science.gov (United States)

    Bozoklu, Gülay; Gateau, Christelle; Imbert, Daniel; Pécaut, Jacques; Robeyns, Koen; Filinchuk, Yaroslav; Memon, Farah; Muller, Gilles

    2012-01-01

    The chiral dissymmetric tetradentate ligand SPhbipox (6’-(4-phenyloxazolin-2-yl)-2,2’-bipyridine-6-carboxylic acid) leads to the diastereoselective assembly of a homochiral Eu(III) triangle and of a highly emissive (QY=27%) heptanuclear wheel which is the largest example of chiral luminescent complex of Eu(III) reported to date. We show that the nuclearity of the assembly is controlled by the solvent and the europium cation. All the compounds show large circularly polarized luminescence with an activity which varies with the nature of the assembly (highest for the homochiral trimer). PMID:22548280

  15. A europium(III)-based PARACEST agent for sensing singlet oxygen by MRI

    Science.gov (United States)

    Song, Bo; Wu, Yunkou; Yu, Mengxiao; Zhao, Piyu; Zhou, Cheng; Kiefer, Garry E.

    2013-01-01

    A europium (III) DOTA-tetraamide complex was designed as a MRI sensor of singlet oxygen (1O2). The water soluble, thermodynamically stable complex reacts rapidly with 1O2 to form an endoperoxide derivative that results in an ∼3 ppm shift in the position of the Eu(III)-bound water chemical exchange saturation transfer (CEST) peak. The potential of using this probe to detect accumulation of the endoperoxide derivative in biological media by ratiometric CEST imaging was demonstrated. PMID:23575743

  16. TRUPACT-II 157 Examination Report

    Energy Technology Data Exchange (ETDEWEB)

    Barry H. O& #39; Brien; Jeffrey M. Lacy; Kip E. Archibald

    2003-12-01

    This report presents the results of examination and recovery activities performed on the TRUPACT-II 157 shipping container. The container was part of a contact-handled transuranic waste shipment being transported on a truck to the Waste Isolation Pilot Plant in New Mexico when an accident occurred. Although the transport vehicle sustained only minor damage, airborne transuranic contamination was detected in air samples extracted from inside TRUPACT-II 157 at the Waste Isolation Pilot Plant. Consequently, the shipping container was rejected, resealed, and returned to the Idaho National Engineering and Environmental Laboratory where the payload was disassembled, examined, and recovered for subsequent reshipment to the Waste Isolation Pilot Plant. This report documents the results of those activities.

  17. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  18. Colloidal europium nanoparticles via a solvated metal atom dispersion approach and their surface enhanced Raman scattering studies.

    Science.gov (United States)

    Urumese, Ancila; Jenjeti, Ramesh Naidu; Sampath, S; Jagirdar, Balaji R

    2016-08-15

    Chemistry of lanthanide metals in their zerovalent state at the nanoscale remains unexplored due to the high chemical reactivity and difficulty in synthesizing nanoparticles by conventional reduction methods. In the present study, europium(0) nanoparticles, the most reactive of all the rare earth metals have been synthesized by solvated metal atom dispersion (SMAD) method using hexadecyl amine as the capping agent. The as-prepared europium nanoparticles show surface Plasmon resonance (SPR) band in the visible region of the electromagnetic spectrum. This lead to the investigation of its surface enhanced Raman scattering (SERS) using visible light excitation source. The SERS activity of europium nanoparticles has been followed using 4-aminothiophenol and biologically important molecules such as hemoglobin and Cyt-c as the analytes. This is the first example of lanthanide metal nanoparticles as SERS substrate which can possibly be extended to other rare-earth metals. Since hemoglobin absorbs in the visible region, the use of visible light excitation source leads to surface enhanced resonance Raman spectroscopy (SERRS). The interaction of biomolecules with Eu(0) has been followed using FT-IR and UV-visible spectroscopy techniques. The results indicate that there is no major irreversible change in the structure of biomolecules upon interaction with europium nanoparticles. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Rapid screening of oxytetracycline residue in catfish muscle by dispersive liquid-liquid microextraction and europium-sensitized luminescence

    Science.gov (United States)

    Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...

  20. Luminescence variations in europium-doped silicon-substituted hydroxyapatite nanobiophosphor via three different methods

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Cao Xuan; Pham, Vuong-Hung, E-mail: vuong.phamhung@hust.edu.vn

    2015-07-15

    Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.

  1. Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS

    CERN Document Server

    AUTHOR|(CDS)2099873; Marsh, Bruce Alan

    The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...

  2. Structural and electrical properties of the europium-doped indium zinc oxide thin film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Chu-Chi, E-mail: ccting@ccu.edu.tw [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Advanced Institute for Manufacturing with High-Tech Innovations, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Li, Wei-Yang; Wang, Ching-Hua; Yong, Hua-En [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China)

    2014-07-01

    The EuInZnO (EIZO) thin film transistor (TFT) devices were fabricated by the sol–gel spin-coating technique. The EIZO TFT operates in the n-channel depletion mode and exhibits a well-defined pinch-off and saturation region. Because europium ion possesses lower electronegativity (1.2) and standard electrode potential (− 1.991 V), it can act as the carrier suppressor to reduce the carrier concentrations of the IZO (In:Zn = 1:1) thin film. Eu{sup 3+} (13 mol%)-doped IZO TFT possesses the optimum performance, and its field-effect mobility in the saturated regime, threshold voltage, on–off ratio, and S-factor are 1.23 cm{sup 2}/Vs, 3.28 V, 1.07 × 10{sup 6}, and 2.28 V/decade, respectively. - Highlights: • Europium ions can act as the carrier suppressor in the InZnO system. • The EuInZnO forms an n-channel material for the thin film transistor (TFT) device. • The optimum performance of the EuInZnO TFT is the sample with 13 mol% Eu{sup 3+} doping.

  3. Europium phosphomolybdate and osmium metallopolymer multi-functional LbL films: redox and electrocatalytic properties.

    Science.gov (United States)

    Fernandes, Diana M; Vos, Johannes G; Freire, Cristina

    2014-04-15

    Hybrid multilayer films composed by osmium metallopolymer [Os(bpy)2(PVP)10Cl]Cl (Os-poly) and europium phosphomolybdate, K₁₁[Eu(III)(PMo₁₁O₃₉)₂] (Eu(PMo11)2), were prepared using the electrostatic layer-by-layer (LbL) self-assembly method. The film build-up, monitored by electronic spectroscopy, showed a regular stepwise growth indicating a strong interaction between layers. The XPS measurements corroborated the successful fabrication of the hybrid films with the Os-poly/Eu(PMo11)2 composition. SEM images revealed a completely covered surface with a highly roughened texture. Electrochemical characterisation of films by cyclic voltammetry revealed three Mo-based reduction processes (Mo(VI)→Mo(V)) in the potential range between -0.4 and 0.1 V and one Os reduction process (Os(III)→Os(II)) at ≈0.270 V. The cyclic voltammograms of two electroactive probes, [Fe(CN)₆](3-/4-) and [Ru(NH₃)₆](3+/2+) on {Os-poly/Eu(PMo11)2}n modified electrodes revealed redox mediation between film and the probes. Furthermore, the {Os-poly/Eu(PMo11)2}n multilayer films also showed excellent Mo-based electrocatalytic activity towards reduction of nitrite and iodate, confirming the multi-functional properties of the hybrid europium phosphomolybdate - osmium metallopolymer LbL films. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  5. pH-controlled delivery of luminescent europium coated nanoparticles into platelets

    Science.gov (United States)

    Davies, Amy; Lewis, David J.; Watson, Stephen P.; Thomas, Steven G.; Pikramenou, Zoe

    2012-01-01

    Water soluble, luminescent gold nanoparticles are delivered into human platelets via a rapid, pH-controlled mechanism using a pH low insertion peptide, pHLIP. The approach introduces cocoating of gold nanoparticles with a europium luminescent complex, EuL and the pHLIP peptide to give pHLIP•EuL•Au. The 13-nm diameter gold nanoparticles act as a scaffold for the attachment of both the luminescent probe and the peptide to target delivery. Their size allows delivery of approximately 640 lanthanide probes per nanoparticle to be internalized in human platelets, which are not susceptible to transfection or microinjection. The internalization of pHLIP•EuL•Au in platelets, which takes just minutes, was studied with a variety of imaging modalities including luminescence, confocal reflection, and transmission electron microscopy. The results show that pHLIP•EuL•Au only enters the platelets in low pH conditions, pH 6.5, mediated by the pHLIP translocation across the membrane, and not at pH 7.4. Luminescence microscopy images of the treated platelets show clearly the red luminescence signal from the europium probe and confocal reflection microscopy confirms the presence of the gold particles. Furthermore, transmission electron microscopy gives a detailed insight of the internalization and spatial localization of the gold nanoparticles in the platelets. Thus, we demonstrate the potential of the design to translocate multimodal nanoparticle probes into cells in a pH dependent manner. PMID:22308346

  6. Analysis of metal surfaces coated with europium-doped titanium dioxide by laser induced breakdown spectroscopy.

    Science.gov (United States)

    Głogocka, Daria; Noculak, Agnieszka; Pucińska, Joanna; Jopek, Wojciech; Podbielska, Halina; Langner, Marek; Przybyło, Magdalena

    2015-01-01

    The surface passivation with titanium sol-gel coatings is a frequently used technique to control the adsorption of selected biological macromolecules and to reduce the exposure of the bulk material to biological matter. Due to the increasing number of new coating-preparation methods and new gel compositions with various types of additives, the quality and homogeneity determination of the surface covering is a critical factor affecting performance of any implanted material. While coating thickness is easy to determine, the homogeneity of the surface distribution of coating materials requires more elaborate methodologies. In the paper, the laser induced breakdown spectroscopy (LIBS) based method, capable to quantitate the homogeneity and uniformity of the europium in titanium dioxide sol-gel coatings on stainless steel surfaces prepared with two different procedures: spin-coating and dip-coating, is presented. The emission intensity of titanium has been used to determine the coating thickness whereas the relative values of europium and titanium emission intensities provide data on the coating homogeneity. The obtained results show that the spin-coating technique provides better surface coverage with titanium dioxide. However, when the surface coating compositions were compared the dip-coating technique was more reliable.

  7. Europium(III) Macrocyclic Complexes with Alcohol Pendant Groups as Chemical Exchange Saturation Transfer Agents

    Science.gov (United States)

    Woods, Mark; Woessner, Donald E.; Zhao, Piyu; Pasha, Azhar; Yang, Meng-Yin; Huang, Ching-Hui; Vasalitiy, Olga; Morrow, Janet R.; Sherry, A. Dean

    2009-01-01

    Paramagnetic lanthanide(III) complexes that contain hyperfine-shifted exchangeable protons offer considerable advantages over diamagnetic molecules as chemical exchange saturation transfer (CEST) agents for MRI. As part of a program to investigate avenues to improve the sensitivity of such agents, the CEST characteristics of europium(III) macrocyclic complexes having appended hydroxyethyl groups were investigated. The CEST spectrum of the asymmetrical complex, EuCNPHC3+, shows five distinct peaks for each magnetically nonequivalent exchangeable proton in the molecule. The CEST spectra of this complex were fitted to NMR Bloch theory to yield exchange rates between each of six exchanging proton pools (five on the agent plus bulk water). Exchange between the Eu3+-bound hydroxyl protons and bulk water protons was slow in dry acetonitrile but accelerated incrementally upon stepwise addition of water. In pure water, exchange was too fast to observe a CEST effect. The utility of this class of europium(III) complex for CEST imaging applications is ultimately limited by the small chemical shifts induced by the hydroxyl-appended ligands of this type and the resulting small Δω values for the exchangeable hydroxyl protons. PMID:16881645

  8. Red light emission from europium doped zinc sodium bismuth borate glasses

    Science.gov (United States)

    Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.

    2017-12-01

    Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.

  9. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  10. Induced Europium Circularly Polarized Luminescence Monitors Reversible Drug Binding to Native α1 -Acid Glycoprotein.

    Science.gov (United States)

    Jennings, Laura; Waters, Ryan S; Pal, Robert; Parker, David

    2017-02-03

    Alpha-1-acid glycoprotein (α1 -AGP) is an important blood plasma glycoprotein. Following an acute-phase reaction such as stress, inflammation, burn, or infection, the bloodstream concentration of α1 -AGP can increase up to 400 % of its normal concentration. A wide range of drugs is known to bind α1 -AGP. Increased binding of pharmacologically active compounds to α1 -AGP moderates their clinical effect by decreasing the amount of unbound drug in the bloodstream. This has important clinical ramifications for such applications as the duration of anesthesia and in determining dosage for drug therapy. In this study, the competitive binding to α1 -AGP of a dynamically racemic europium(III) complex with seven pharmacologically active drugs absorbing in the range λ 250-290 nm was monitored by following changes in europium total emission and in induced circularly polarized luminescence (CPL). Binding affinities corresponding to Kd values in the range 0.5-100 μm were measured, in good agreement with published data. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

    Directory of Open Access Journals (Sweden)

    Zhang Kui-Hua

    2011-01-01

    Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

  12. "Rigid" Luminescent Soft Materials: Europium-Containing Lyotropic Liquid Crystals Based on Polyoxyethylene Phytosterols and Ionic Liquids.

    Science.gov (United States)

    Yi, Sijing; Wang, Jiao; Feng, Zhenyu; Chen, Xiao

    2017-10-05

    Soft materials of europium β-diketonate complexes constructed in lyotropic liquid crystals (LLCs) mediated by ionic liquids (ILs) are impressive for their excellent luminescence performance and stability. For the aim to further improve their mechanical processability and luminescent tunablility, the polyoxyethylene phytosterols (BPS-n) were introduced here as structure directing agents to prepare relatively "rigid" lamellar luminescent LLCs in 1-butyl-3-methyl-imidazolium hexafluorophosphate by doping europium β-diketonate complexes with different imidazolium counterions. As a result of the solvophobic sterol ring structure of BPS-n, the more effective isolation and confinement effects of europium complexes could be achieved. The longest fluorescence lifetime and the highest quantum efficiency reported so far for europium containing lyotropic organized soft materials were thus obtained. Changing the molecular structures of BPS-n with different oxyethylene chains or doped complexes with imidazolium counterions of different alkyl chain lengths, the spacings of lamellar LLC matrixes and position of dispersed complexes became tunable. The measured luminescent and rheological properties for such composite LLCs showed a dependence on the rigidity and isolation capability afforded by sterol molecules. It was also found that the increase of counterion alkyl chain length would weaken the LLC matrix's confinement and isolation effects and therefore exhibit the deteriorated luminescence performance. The enhanced luminescence efficiency and stability of doped BPS-n LLCs reflected the excellent segregation of europium complexes from each other and therefore the reduced self-quenching process. The obtained results here present the designability of LLC matrixes and their great potential to promote achieving the luminescence tunability of soft materials.

  13. Preparation and photoluminescence of some europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dunjia, E-mail: dunjiawang@163.com; Pi, Yan; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Wei, Xianhong

    2013-10-15

    Highlights: •Preparation of europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands. •Photoluminescence behavior of europium (III) ternary complexes. •Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), the lifetime (τ) and the luminescent quantum yield (η). -- Abstract: Preparation and photoluminescence behavior of four new europium (III) ternary complexes with β-diketones (1-(6-methoxy-naphthalen-2-yl)-3-phenyl-propane-1,3-dione (MNPPD) and 1-(4-tert-butyl-phenyl)-3-(6-methoxy-naphthalen-2-yl)-propane-1,3-dione (BPMPD)) and 2,2-dipyridine (Bipy) or 1,10-phenanthroline (Phen) were reported, in the solid state. Complexes Eu(MPPD){sub 3}·Bipy, Eu(BMPD){sub 3}·Bipy, Eu(MPPD){sub 3}·Phen and Eu(BMPD){sub 3}·Phen were characterized by elemental analysis, FT-IR, {sup 1}H NMR, UV–vis absorption. The emission spectra show narrow emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion. Based on the emission spectra and luminescence decay curves in solid state, the intensity parameters (Ω{sub t}), lifetime (τ) and emission quantum efficiency (η) were determined. The Ω{sub 2} values indicate that the Eu(III) ion in these complexes is in a highly polarizable chemical environment. Complexes Eu(MPPD){sub 3}·Bipy and Eu(MPPD){sub 3}·Phen showed a longer lifetime (τ) and a higher luminescence quantum efficiency (η), which indicated that the energy transfer to the europium ion from MNPPD ligand is more efficient than that from BPMPD ligand.

  14. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.

    1982-03-01

    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  15. Syntheses and electroluminescent properties of two europium ternary complexes Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT)

    Energy Technology Data Exchange (ETDEWEB)

    Guan Min [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Gao Lihua [Department of Chemistry, Beijing Normal University, Beijing 100875 (China); Wang Shanshan [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Huang Chunhui [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China)], E-mail: chhuang@pku.edu.cn; Wang Kezhi [Department of Chemistry, Beijing Normal University, Beijing 100875 (China)

    2007-12-15

    Two europium complexes, Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT) (DBM=dibenzoylmethanato, PBO=2-(2-pyridyl)benzoxazole, PBT=2-(2-pyridyl)benzothiazole), were prepared and used as emitting materials in organic electroluminescent (EL) devices. The devices with the structures ITO/TPD/Eu(DBM){sub 3}(PBO) (or Eu(DBM){sub 3}(PBT)/BCP/Alq{sub 3}/Mg:Ag/Ag emit red light originating from the europium complexes.

  16. Stability constants of europium complexes with a nitrogen heterocycle substituted methane-1,1-diphosphonic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, M.P.; Rickert, P.G.; Schmidt, M.A.; Nash, K.L.

    1996-06-01

    Even in moderately acidic solutions ([H{sup +}] > 0.01 M), N-piperidinomethane-1,1-diphosphonic acid (H{sub 4}PMDPA) is a strong complexant of trivalent lanthanide ions that shows enhanced complex solubility over previously studied 1,1-diphosphonic acids. The protonation constants of PMDPA in 2.0 M H/NaClO{sub 4} were determined by potentiometric and NMR titrations, and the stability constants for formation of complexes with Eu{sup 3+} were determined by solvent extraction. Difference in protonation equilibria induced by addition of the nitrogen heterocycle results in an increase in the complexation strength of PMDPA. In solutions containing 0.1 M H{sup +} and ligand concentrations greater than 0.02 M, PMDPA is the most effective 1,1-diphosphonic acid for europium complexation studied thus far.

  17. Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio

    Energy Technology Data Exchange (ETDEWEB)

    Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)

  18. First principles description of the insulator-metal transition in europium monoxide

    KAUST Repository

    Wang, Hao

    2012-02-01

    Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.

  19. Development of europium doped BaSO4 TL OSL dual phosphor for radiation dosimetry applications

    Science.gov (United States)

    Patle, Anita; Patil, R. R.; Kulkarni, M. S.; Bhatt, B. C.; Moharil, S. V.

    2015-08-01

    This paper presents the results on the preparation and characterization of Europium-doped Barium sulfate (BaSO4: Eu) TL /OSL dual phosphor. The OSL sensitivity was found to be 11% of the commercially available Al2O3: C, using area integration method. The sample also shows good TL sensitivity and the dosimetric peak appears around 190°C with a shoulder at 282°C. After OSL readout, No change in the TL glow curve is observed. Since the observed TL peaks are not responsible for the observed OSL, good OSL as well as TL sensitivity and low fading will make this phosphor suitable for applications in radiation dosimetry using OSL as well as TL.

  20. Chemiluminescence determination of tetracyclines using Fenton system in the presence europium(III) ions

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan, E-mail: blis@amu.edu.pl [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)

    2009-04-20

    A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.

  1. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A., E-mail: japojman@lsu.edu [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803-1804 (United States)

    2014-06-15

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  2. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics.

    Science.gov (United States)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A

    2014-06-01

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  3. Electrochemiluminescence Study of Europium (III Complex with Coumarin3-Carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Stefan Lis

    2008-01-01

    Full Text Available The europium (III complex of coumarin-3-carboxylic acid (C3CA has been prepared and characterized on the basis of elemental analysis, IR, and emission (photoluminescence and electrochemiluminescence spectroscopy. The synthesised complex having a formula Eu(C3CA2(NO3(H2O2 was photophysically characterized in solution and in the solid state. Electrochemiluminescence, ECL, of the system containing the Eu(III/C3CA complex was studied using an oxide-covered aluminium electrode. The goal of these studies was to show the possibility of the use of electrochemical excitation of the Eu(III ion in aqueous solution for emission generation. The generated ECL emission was very weak, and therefore its measurements and spectral analysis were carried out with the use of cut-off filters method. The studies proved a predominate role of the ligand-to-metal energy transfer (LMET in the generated ECL.

  4. Europium incorporated in silica matrix obtained by sol-gel: luminescent materials

    Directory of Open Access Journals (Sweden)

    Nassar Eduardo José

    2003-01-01

    Full Text Available In this work we report some aspects of the chemistry involved in the preparation of modified silicon oxide by the sol-gel process. Europium III compounds were used as luminescent probe. An organic-inorganic hybrid was obtained by hydrolysis of tetraethylorthosilicate (TEOS and 3-aminopropyltriethoxysilane (APTS. The Eu III compounds were added in different ways. In the first, silica was prepared in the presence of Eu III, and in the second, Eu III was added on the silica surface. These materials were studied by luminescence, infrared spectroscopy and termogravimetric analysis. The results obtained for the hybrid material show different behavior for Eu III emission, which could be excited by the antenna effect and the influence of the surrounding in the luminescence quenching. The thermogravimetric data present different mass loss in samples to range temperature 50 - 150 °C. Thermogravimetric and infrared spectra showed that inorganic polymers incorporated the organic part.

  5. Europium as an inhibitor of Amyloid-β(1-42) induced membrane permeation.

    Science.gov (United States)

    Williams, Thomas L; Urbanc, Brigita; Marshall, Karen E; Vadukul, Devkee M; Jenkins, A Toby A; Serpell, Louise C

    2015-10-24

    Soluble Amyloid-beta (Aβ) oligomers are a source of cytotoxicity in Alzheimer's disease (AD). The toxicity of Aβ oligomers may arise from their ability to interact with and disrupt cellular membranes mediated by GM1 ganglioside receptors within these membranes. Therefore, inhibition of Aβ-membrane interactions could provide a means of preventing the toxicity associated with Aβ. Here, using Surface Plasmon field-enhanced Fluorescence Spectroscopy, we determine that the lanthanide, Europium III chloride (Eu(3+)), strongly binds to GM1 ganglioside-containing membranes and prevents the interaction with Aβ42 leading to a loss of the peptides ability to cause membrane permeation. Here we discuss the molecular mechanism by which Eu(3+) inhibits Aβ42-membrane interactions and this may lead to protection of membrane integrity against Aβ42 induced toxicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Radiation effects on beta /10.6/ of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as the result of X-ray and electron bombardment of pure monocrystalline and polycrystalline KCl and of divalent europium doped polycrystalline KCl were determined. A constant heat flow calorimetric method was used to measure the optical absorption coefficients. Both 300 kV X-ray irradiation and 2 MeV electron irradiation produced increases in the optical absorption coefficient at room temperature. X-ray irradiation produced more significant changes in pure monocrystalline KCl than equivalent amounts of electron irradiation. Electron irradiation of pure and Eu-doped polycrystalline KCl produced increases in the absorption by as much as a factor of 20 over untreated material. Bleaching of the electron-irradiated doped KCl with 649 millimicron light produced a further increase.

  7. Excitation functions for the formation of longer lived isotopes by deuteron irradiation of Europium

    Energy Technology Data Exchange (ETDEWEB)

    Takács, S., E-mail: stakacs@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Hermanne, A.; Adam-Rebeles, R. [Cyclotron Laboratory, Vrije Universiteit Brussel, Brussels 1090 (Belgium); Takács, M.P. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Institute of Physics, University of Debrecen, 4026 Debrecen (Hungary)

    2013-09-01

    Excitation functions for nuclear reactions induced on natural europium targets by energetic deuterons were studied up to 50 MeV. A standard stacked foil technique was used for irradiation and high resolution gamma spectrometry was applied for activity assessment. Direct or cumulative cross sections for reaction products with half-life longer than 2 h were determined. Reactions leading to the formation of the radionuclides {sup 147,149,151,153}Gd, {sup 147,148,149,150m,150g,152m,152g,154g}Eu, {sup 153}Sm and {sup 150}Pm were studied. In most cases no earlier data were available in the literature. The new experimental results were compared with values tabulated in the on-line TENDL2011 library.

  8. Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Klobes, B., E-mail: b.klobes@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail: y.arinicheva@fz-juelich.de; Neumeier, S., E-mail: s.neumeier@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail: r.simon@fz-juelich.de; Jafari, A., E-mail: a.jafari@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: d.bosbach@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: hermannrp@ornl.gov [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)

    2016-12-15

    Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.

  9. Photoluminescent polymer electrolyte based on agar and containing europium picrate for electrochemical devices

    Energy Technology Data Exchange (ETDEWEB)

    Lima, E. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Raphael, E.; Sentanin, F. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil); Rodrigues, L.C. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Ferreira, R.A.S.; Carlos, L.D. [Departamento de Fisica, CICECO, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Silva, M.M., E-mail: nini@quimica.uminho.pt [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Pawlicka, A. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer We prepared ionic conducting membranes for the specific requirements of the device. Black-Right-Pointing-Pointer Luminescent reporter groups, with many applications in biotechnology. Black-Right-Pointing-Pointer Thermal and electrochemical stability of electrolytes is adequate for application. - Abstract: Dispersion of photoluminescent rare earth metal complexes in polymer matrices is of great interest due to the possibility of avoiding the saturation of the photoluminescent signal. The possibility of using a natural ionic conducting polymer matrix was investigated in this study. Samples of agar-based electrolytes containing europium picrate were prepared and characterized by physical and chemical analyses. The FTIR spectra indicated strong interaction of agar O-H and 3,6-anhydro-galactose C-O groups with glycerol and europium picrate. The DSC analyses revealed no glass transition temperature of the samples in the -60 to 250 Degree-Sign C range. From the thermogravimetry (TG), a thermal stability of the samples of up to 180 Degree-Sign C was stated. The membranes were subjected to ionic conductivity measurement, which provided the values of 2.6 Multiplication-Sign 10{sup -6} S/cm for the samples with acetic acid and 1.6 Multiplication-Sign 10{sup -5} S/cm for the samples without acetic acid. Moreover, the temperature-dependent ionic conductivity measurements revealed both Arrhenius and VTF models of the conductivity depending on the sample. Surface visualization through scanning electron microscopy (SEM) demonstrated good uniformity. The samples were also applied in small electrochromic devices and showed good electrochemical stability. The present work confirmed that these materials may perform as satisfactory multifunctional component layers in the field of electrochemical devices.

  10. Spectroscopic investigation on europium doped heavy metal borate glasses for red luminescent application

    Energy Technology Data Exchange (ETDEWEB)

    Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)

    2017-05-15

    The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)

  11. Europium nanoparticle-based high performing immunoassay for the screening of treponemal antibodies.

    Directory of Open Access Journals (Sweden)

    Sheikh M Talha

    Full Text Available Treponema pallidum subspecies pallidum (Tp is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co ratios obtained with the two immunoassays (p=0.06. Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood

  12. Visible-light-excited and europium-emissive nanoparticles for highly-luminescent bioimaging in vivo.

    Science.gov (United States)

    Wu, Yongquan; Shi, Mei; Zhao, Lingzhi; Feng, Wei; Li, Fuyou; Huang, Chunhui

    2014-07-01

    Europium(III)-based material showing special milliseconds photoluminescence lifetime has been considered as an ideal time-gated luminescence probe for bioimaging, but is still limited in application in luminescent small-animal bioimaging in vivo. Here, a water-soluble, stable, highly-luminescent nanosystem, Ir-Eu-MSN (MSN = mesoporous silica nanoparticles, Ir-Eu = [Ir(dfppy)2(pic-OH)]3Eu·2H2O, dfppy = 2-(2,4-difluorophenyl)pyridine, pic-OH = 3-hydroxy-2-carboxypyridine), was developed by an in situ coordination reaction to form an insoluble dinuclear iridium(III) complex-sensitized-europium(III) emissive complex within mesoporous silica nanoparticles (MSNs) which had high loading efficiency. Compared with the usual approach of physical adsorption, this in-situ reaction strategy provided 20-fold the loading efficiency (43.2%) of the insoluble Ir-Eu complex in MSNs. These nanoparticles in solid state showed bright red luminescence with high quantum yield of 55.2%, and the excitation window extended up to 470 nm. These Ir-Eu-MSN nanoparticles were used for luminescence imaging in living cells under excitation at 458 nm with confocal microscopy, which was confirmed by flow cytometry. Furthermore, the Ir-Eu-MSN nanoparticles were successfully applied into high-contrast luminescent lymphatic imaging in vivo under low power density excitation of 5 mW cm(-2). This synthetic method provides a universal strategy of combining hydrophobic complexes with hydrophilic MSNs for in vivo bioimaging. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Europium Nanoparticle-Based High Performing Immunoassay for the Screening of Treponemal Antibodies

    Science.gov (United States)

    Talha, Sheikh M.; Hytönen, Jukka; Westhorpe, Adam; Kumar, Sushil; Khanna, Navin; Pettersson, Kim

    2013-01-01

    Treponema pallidum subspecies pallidum (Tp) is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF) immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co) ratios obtained with the two immunoassays (p = 0.06). Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood-bank settings as a

  14. Semiconducting polymer encapsulated mesoporous silica particles with conjugated Europium complexes: toward enhanced luminescence under aqueous conditions.

    Science.gov (United States)

    Zhang, Jixi; Prabhakar, Neeraj; Näreoja, Tuomas; Rosenholm, Jessica M

    2014-01-01

    Immobilization of lanthanide organic complexes in meso-organized hybrid materials for luminescence applications have attracted immense interest due to the possibility of controlled segregation at the nanoscopic level for novel optical properties. Aimed at enhancing the luminescence intensity and stability of the hybrid materials in aqueous media, we developed polyvinylpyrrolidone (PVP) stabilized, semiconducting polymer (poly(9-vinylcarbazole), PVK) encapsulated mesoporous silica hybrid particles grafted with Europium(III) complexes. Monosilylated β-diketonate ligands (1-(2-naphthoyl)-3,3,3-trifluoroacetonate, NTA) were first co-condensed in the mesoporous silica particles as pendent groups for bridging and anchoring the lanthanide complexes, resulting in particles with an mean diameter of ∼ 450 nm and a bimodal pore size distribution centered at 3.5 and 5.3 nm. PVK was encapsulated on the resulted particles by a solvent-induced surface precipitation process, in order to seal the mesopores and protect Europium ions from luminescence quenching by producing a hydrophobic environment. The obtained polymer encapsulated MSN-EuLC@PVK-PVP particles exhibit significantly higher intrinsic quantum yield (Φ(Ln) = 39%) and longer lifetime (τ(obs) = 0.51 ms), as compared with those without polymer encapsulation. Most importantly, a high luminescence stability was realized when MSN-EuLC@PVK-PVP particles were dispersed in various aqueous media, showing no noticeable quenching effect. The beneficial features and positive attributes of both mesoporous silica and semiconducting polymers as lanthanide-complex host were merged in a single hybrid carrier, opening up the possibility of using these hybrid luminescent materials under complex aqueous conditions such as biological/physiological environments.

  15. Surface-imprinted nanofilaments for europium-amplified luminescent detection of fluoroquinolone antibiotics.

    Science.gov (United States)

    Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C

    2013-07-29

    The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Faster Synthesis of Beta-Diketonate Ternary Europium Complexes: Elapsed Times & Reaction Yields.

    Science.gov (United States)

    Lima, Nathalia B D; Silva, Anderson I S; Gerson, P C; Gonçalves, Simone M C; Simas, Alfredo M

    2015-01-01

    β-diketonates are customary bidentate ligands in highly luminescent ternary europium complexes, such as Eu(β-diketonate)3(L)2, where L stands for a nonionic ligand. Usually, the syntheses of these complexes start by adding, to an europium salt such as EuCl3(H2O)6, three equivalents of β-diketonate ligands to form the complexes Eu(β-diketonate)3(H2O)2. The nonionic ligands are subsequently added to form the target complexes Eu(β-diketonate)3(L)2. However, the Eu(β-diketonate)3(H2O)2 intermediates are frequently both difficult and slow to purify by recrystallization, a step which usually takes a long time, varying from days to several weeks, depending on the chosen β-diketonate. In this article, we advance a novel synthetic technique which does not use Eu(β-diketonate)3(H2O)2 as an intermediate. Instead, we start by adding 4 equivalents of a monodentate nonionic ligand L straight to EuCl3(H2O)6 to form a new intermediate: EuCl3(L)4(H2O)n, with n being either 3 or 4. The advantage is that these intermediates can now be easily, quickly, and efficiently purified. The β-diketonates are then carefully added to this intermediate to form the target complexes Eu(β-diketonate)3(L)2. For the cases studied, the 20-day average elapsed time reduced to 10 days for the faster synthesis, together with an improvement in the overall yield from 42% to 69%.

  17. Modified magnetic and optical properties of manganese nanoparticles incorporated europium doped magnesium borotellurite glass

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, Siti Maisarah; Sahar, M.R., E-mail: mrahim057@gmail.com; Ghoshal, S.K.

    2017-02-01

    This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)

  18. Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yu, E-mail: liuyu03b@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Wang, Yafei [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Li, Chun [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China); Huang, Ying; Dang, Dongfeng; Zhu, Meixiang [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Zhu, Weiguo, E-mail: zhuwg18@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Cao, Yong, E-mail: yongcao@scut.edu.cn [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China)

    2014-02-14

    A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM){sub 3}(BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM){sub 3}(BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu{sup 3+} ion emission, based on the {sup 5}D{sub 0} → {sup 7}F{sub 2} transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE{sub ext}) of 1.26% at current density of 1.65 mA cm{sup −2}, with a maximum brightness of 568 cd m{sup −2} at 137.8 mA cm{sup −2} was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM){sub 3}(BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM){sub 3}(BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices.

  19. Escherichia coli O157:H7 and rectoanal junction cell interactome

    Science.gov (United States)

    Introduction. Cattle are the primary E. coli O157 (O157) reservoir and principal source of human infection. The anatomical site of O157 persistence is the bovine recto-anal (RAJ) junction; hence, an in-depth understanding of O157-RAJ interactions will help develop novel modalities to limit O157 in c...

  20. Electron paramagnetic resonance and photoluminescence investigation of europium local structure in oxyfluoride glass ceramics containing SrF2 nanocrystals

    Science.gov (United States)

    Antuzevics, A.; Kemere, M.; Krieke, G.; Ignatans, R.

    2017-10-01

    Different compositions of europium doped aluminosilicate oxyfluoride glass ceramics prepared in air atmosphere have been studied by electron paramagnetic resonance (EPR) and optical spectroscopy methods. X-ray diffraction (XRD) and transmission electron microscopy (TEM) measurements show presence of homogenously distributed SrF2 nanocrystals after the heat treatment of the precursor glass. Efficient Eu3+ incorporation in the high symmetry environment of glass ceramics is observed from the photoluminescence spectra. EPR spectra indicate Eu3+ → Eu2+ reduction upon precipitation of crystalline phases in the glass matrix. For composition abundant with Eu2+ in the glassy state such behaviour is not detected. Local structure around europium ions is discussed based on differences in chemical compositions.

  1. Bright, highly water-soluble triazacyclononane europium complexes to detect ligand binding with time-resolved FRET microscopy.

    Science.gov (United States)

    Delbianco, Martina; Sadovnikova, Victoria; Bourrier, Emmanuel; Mathis, Gérard; Lamarque, Laurent; Zwier, Jurriaan M; Parker, David

    2014-09-26

    Luminescent europium complexes are used in a broad range of applications as a result of their particular emissive properties. The synthesis and application of bright, highly water-soluble, and negatively charged sulfonic- or carboxylic acid derivatives of para-substituted aryl-alkynyl triazacyclononane complexes are described. Introduction of the charged solubilizing moieties suppresses cellular uptake or adsorption to living cells making them applicable for labeling and performing assays on membrane receptors. These europium complexes are applied to monitor fluorescent ligand binding on cell-surface proteins with time-resolved Förster resonance energy transfer (TR-FRET) assays in plate-based format and using TR-FRET microscopy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Optical and spectral studies on pure and europium doped olgite type Na(Sr,Ba)PO4 ceramics.

    Science.gov (United States)

    Jawaher, K Rackesh; Jagannathan, R; Das, S Jerome; Krishnan, S

    2015-04-05

    Europium ion doped olgite type Na(Sr,Ba)PO4 ceramics, a new generation of light emitting bulb, was prepared by a high temperature solid-state reaction method. The synthesized materials were subjected to various characterizations such as X-ray powder diffraction, Scanning electron microscopy and FT-IR spectra measurements. The EPR spectrum of the sample exhibits a well-resolved hyperfine structure of 151Eu2+ and 153Eu2+ isotopes and the g value has been calculated. Fluorescence spectra revealed that europium ions were present in divalent as well as in the trivalent oxidation states. The critical distance for energy transfer between Eu2+ and Eu2+ ion is calculated as 20Å, which is in good agreement with that of experimental data. The FTIR analysis reveals all the vibrations of PO4(3-) ions. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. 29 CFR 1952.157 - Changes to approved plan.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Changes to approved plan. 1952.157 Section 1952.157 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... approved plan. (a) Legislation. (1) On March 29, 1994, the Assistant Secretary approved North Carolina's...

  4. Search for Enterohaemorrhagic Escherichia coli O157:H7 and ...

    African Journals Online (AJOL)

    Enterohaemorrhagic Escherichia coli (EHEC) O157:H7 and Salmonella enterica are important zoonotic bacteria responsible for enteric infections in humans. The present study investigated the possible role of kittens in the zoonotic transmission of antimicrobial resistant EHEC O157 and Salmonella enterica to human using ...

  5. 33 CFR 157.500 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... Vegetable Oil § 157.500 Purpose and applicability. (a) The purpose of this subpart is to establish mandatory... fat or vegetable oil. (b) This subpart applies to each tank vessel specified in § 157.01 of this part that— (1) Is 5,000 gross tons or more; (2) Carries animal fat or vegetable oil in bulk as cargo or...

  6. 33 CFR 157.132 - Cargo tanks: Hydrocarbon vapor emissions.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo tanks: Hydrocarbon vapor... § 157.132 Cargo tanks: Hydrocarbon vapor emissions. Each tank vessel having a COW system under § 157.10a... must have— (a) A means to discharge hydrocarbon vapors from each cargo tank that is ballasted to a...

  7. 33 CFR 157.08 - Applicability of subpart B.

    Science.gov (United States)

    2010-07-01

    ... OIL IN BULK Design, Equipment, and Installation § 157.08 Applicability of subpart B. Note: An “oil... retains oily mixtures on board and discharges them to a reception facility. (f) Sections 157.11 (a... cohesive and adhesive characteristics, that inhibit effective product/water separation and monitoring. (g...

  8. 7 CFR 1900.157-1900.200 - [Reserved

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false 1900.157-1900.200 Section 1900.157-1900.200 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE SERVICE, RURAL UTILITIES SERVICE, AND FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE PROGRAM...

  9. 29 CFR 2570.157 - Allocation of burden of proof.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Allocation of burden of proof. 2570.157 Section 2570.157 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR ADMINISTRATION AND ENFORCEMENT UNDER THE EMPLOYEE RETIREMENT INCOME SECURITY ACT OF 1974...

  10. 40 CFR 98.157 - Records that must be retained.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.157 Section 98.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... that must be retained. (a) In addition to the data required by § 98.3(g), HCFC-22 production facilities...

  11. 18 CFR 157.16 - Exhibits relating to acquisitions.

    Science.gov (United States)

    2010-04-01

    ..., if the acquisition involved is by purchase of capital stock and liquidation of the acquired company. (8) A pro forma consolidating balance sheet, as of the date of the merger if the acquisition is by... acquisitions. 157.16 Section 157.16 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  12. Escherichia coli O157 infections and unpasteurised milk

    NARCIS (Netherlands)

    Allerberger, F; Wagner, M; Schweiger, P; Rammer, H P; Resch, A; Dierich, M P; Friedrich, A W; Karch, H

    2001-01-01

    We report on two children with Escherichia coli O157 infection, one of whom developed haemolytic uraemic syndrome (HUS). Both had drunk raw cows or goats milk in the week before their illness. Molecular subtyping identified a sorbitol fermenting Escherichia coli O157:H isolate from a dairy cow. This

  13. Prevalence and antibiogram of Escherichia coli O157 isolated from ...

    African Journals Online (AJOL)

    E. coli O157 is an important serotype that caused many food borne outbreaks worldwide in the past decades. This study was carried out to estimate the prevalence and determine the antimicrobial susceptibility of E. coli O157 isolated from bovine carcasses and cecal contents at one abattoir in Jimma. A total of 300 samples ...

  14. 33 CFR 157.13 - Designated observation area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Designated observation area. 157... OIL IN BULK Design, Equipment, and Installation § 157.13 Designated observation area. Each new vessel must have a designated observation area on the weather deck or above that is: (a) Located where the...

  15. A highly sensitive europium nanoparticle-based immunoassay for detection of influenza A/B virus antigen in clinical specimens.

    Science.gov (United States)

    Zhang, Panhe; Vemula, Sai Vikram; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L; Hewlett, Indira

    2014-12-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Semiconducting polymer dots doped with europium complexes showing ultranarrow emission and long luminescence lifetime for time-gated cellular imaging.

    Science.gov (United States)

    Sun, Wei; Yu, Jiangbo; Deng, Ruiping; Rong, Yu; Fujimoto, Bryant; Wu, Changfeng; Zhang, Hongjie; Chiu, Daniel T

    2013-10-18

    Bright dots: Semiconducting polymer dots (Pdots) doped with europium complexes possess line-like fluorescence emission, high quantum yield, and long fluorescence lifetime. The Pdots successfully labeled receptors on cells. The long fluorescence lifetime of the Pdots was used to distinguish them from other red fluorescence emitting nanoparticles, and improve the signal-to-noise ratio for time-gated cellular imaging. PVK=poly(9-vinylcarbazole). Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Translocation and biokinetic behavior of nanoscaled europium oxide particles within 5 days following an acute inhalation in rats.

    Science.gov (United States)

    Creutzenberg, Otto; Kock, Heiko; Schaudien, Dirk

    2016-03-01

    Nanoscaled europium oxide (Eu2O3) particles were inhaled by rats after acute exposure and the potential translocation of particles followed by chemical analysis and transmission electron microscopy (TEM) was investigated. An aqueous dispersion (phosphate buffer/bovine serum albumin) of a commercially available Eu2O3 particle fraction consisting partially of nanoscaled particles was aerosolized with pressurized air. After rapid evaporation, rats inhaled the dry aerosol for 6 h in a single exposure resulting in an alveolar calculated dose of approximately 39.5 μg Eu2O3. Using chemical analysis, 36.8 μg Eu2O3 was detected 1 h after lung inhalation. The amount declined slightly to 34.5 μg after 1 day and 35.0 μg after 5 days. The liver showed an increase of Eu2O3 from 32.3 ng 1 h up to 294 ng 5 days after inhalation. Additionally, lung-associated lymph nodes, thymus, kidneys, heart and testis exhibited an increase of europium over the period investigated. In the blood, the highest amount of europium was found 1 h after treatment whereas feces, urine and mesenteric lymph nodes revealed the highest amount 1 day after treatment. Using TEM analysis, particles could be detected only in lungs, and in the liver, no particles were detectable. In conclusion, the translocation of Eu2O3 within 5 days following inhalation could be determined very precisely by chemical analysis. A translocation of Eu2O3 particulate matter to liver was not detectable by TEM analysis; thus, the overproportional level of 0.8% of the lung load observed in the liver after 5 days suggests a filtering effect of dissolved europium with accumulation. Copyright © 2015 John Wiley & Sons, Ltd.

  18. A Highly Sensitive Europium Nanoparticle-Based Immunoassay for Detection of Influenza A/B Virus Antigen in Clinical Specimens

    Science.gov (United States)

    Zhang, Panhe; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L.

    2014-01-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. PMID:25297327

  19. Nature of the concentration thresholds of europium atom yield from the oxidized tungsten surface under electron stimulated desorption

    CERN Document Server

    Davydov, S Y

    2002-01-01

    The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level

  20. Ultrasmall Superparamagnetic Iron Oxide Nanoparticles with Europium(III) DO3A as a Bimodal Imaging Probe.

    Science.gov (United States)

    Carron, Sophie; Bloemen, Maarten; Vander Elst, Luce; Laurent, Sophie; Verbiest, Thierry; Parac-Vogt, Tatjana N

    2016-03-18

    A new prototype consisting of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles decorated with europium(III) ions encapsulated in a DO3A organic scaffold was designed as a platform for further development of bimodal contrast agents for MRI and optical imaging. The USPIO nanoparticles act as negative MRI contrast agents, whereas the europium(III) ion is a luminophore that is suitable for use in optical imaging detection. The functionalized USPIO nanoparticles were characterized by TEM, DLS, XRD, FTIR, and TXRF analysis, and a full investigation of the relaxometric and optical properties was conducted. The typical luminescence emission of europium(III) was observed and the main red emission wavelength was found at 614 nm. The relaxometric study of these ultrasmall nanoparticles showed r2 values of 114.8 mM(-1) Fes(-1) at 60 MHz, which is nearly double the r2 relaxivity of Sinerem(®). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. A lysosome targetable luminescent bioprobe based on a europium β-diketonate complex for cellular imaging applications.

    Science.gov (United States)

    George, T M; Krishna, Mahesh S; Reddy, M L P

    2016-11-22

    Herein, we report a novel lysosome targetable luminescent bioprobe derived from a europium coordination compound, namely Eu(pfphOCH3IN)3(DDXPO) 4 [where HpfphOCH3IN = 4,4,5,5,5-pentafluoro-3-hydroxy-1-(1-(4-methoxyphenyl)-1H-indol-3-yl)pent-2-en-1-one and DDXPO = 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene oxide]. Notably, the newly designed europium complex exhibits significant quantum yield (Φoverall = 25 ± 3%) and 5D0 excited state lifetime (τ = 398 ± 3 μs) values under physiological pH (7.2) conditions when excited at 405 nm. Hence the developed europium complex has been evaluated for live cell imaging applications using mouse pre-adipocyte cell lines (3T3L1). Colocalization studies of the designed bio-probe with commercial Lysosome-GFP in 3T3L1 cells demonstrated the specific localization of the probe in the lysosome with a high colocalization coefficient (A = 0.83). Most importantly, the developed bioprobe exhibits good cell permeability, photostability and non-cytotoxicity.

  2. Mössbauer spectroscopy of europium-doped fluorochlorozirconate glasses and glass ceramics: optimization of storage phosphors in computed radiography.

    Science.gov (United States)

    Pfau, C; Paßlick, C; Gray, S K; Johnson, J A; Johnson, C E; Schweizer, S

    2013-05-22

    Eu(2+)-doped fluorochlorozirconate (FCZ) glasses and glass ceramics, which are being developed for medical and photovoltaic applications, have been analysed by Mössbauer spectroscopy. The oxidation state and chemical environment of the europium ions, which are important for the performance of these materials, were investigated. Routes for maximizing the divalent europium content were also investigated. By using EuCl2 instead of EuF2 in the starting material a fraction of about 90% of the europium was maintained in the Eu(2+) state as opposed to about 70% when using EuF2. The glass ceramics produced by subsequent thermal processing contain BaCl2 nanocrystals in which Eu(2+) is incorporated, as shown by the narrower linewidth in the Mössbauer spectrum. Debye temperatures of 147 K and 186 K for Eu(2+) and Eu(3+), respectively, were determined from temperature dependent Mössbauer measurements. The f-factors were used to obtain the Eu(2+)/Eu(3+) ratio from the area ratio of the corresponding absorption lines.

  3. The effects of free chlorine concentration, organic load, and exposure time on the inactivation of Salmonella, Escherichia coli O157:H7 and non-O157 STEC

    Science.gov (United States)

    This study evaluated the effects of free chlorine (FC) concentration, contact time, and organic load on the inactivation of Salmonella, E. coli O157:H7, and non-O157 STEC in suspension. Four strains each of Salmonella, E. coli O157:H7, or non-O157 STEC cells were inoculated separately or as a multi-...

  4. [Survival of VTEC O157 and non-O157 in water troughs and bovine feces].

    Science.gov (United States)

    Polifroni, Rosana; Etcheverría, Analía I; Arroyo, Guillermo H; Padola, Nora L

    2014-01-01

    Verotoxin-producing Escherichia coli (VTEC) is the etiologic agent of hemolytic-uremic syndrome (HUS), which typically affects children ranging in age from six months to five years old. Transmission is produced by consumption of contaminated food, by direct contact with animals or the environment and from person to person. In previous studies we determined that the environment of a dairy farm is a non-animal reservoir; thus, we proposed to study the survival of 4 VTEC isolates (O20:H19; O91:H21; O157:H7 and O178:H19) in sterile water troughs and bovine feces by viable bacteria count and detection of virulence genes by PCR. It was demonstrated that the survival of different VTEC isolates (O157 and non-O157) varied in terms of their own characteristics as well as of the environmental conditions where they were found. The main differences between isolates were their survival time and the maximal counts reached. The competitive and adaptive characteristics of some isolates increase the infection risk for people that are visiting or working on a farm, as well as the risk for reinfection of the animals and food contamination. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  5. Effect of carvacrol on O157 and non-O157 Shiga toxin producing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Alexandros Stratakos

    2017-06-01

    Full Text Available Shiga toxin Escherichia coli (STEC strains are important foodborne bacteria linked to diarrhea, enteritis, hemolytic-uremic syndrome and in some cases death. E. coli O157:H7 is the most common strain amongst STECs however non-O157 STECs have been connected with several outbreaks on an international level.  The use of natural plant extracts to reduce the risk from foodborne pathogens is gaining increasing importance. Therefore in this study, we tested the antibacterial effect of carvacrol, a major component of oregano essential oil, on E. coli serogroups O157, O26, O45, O103, O111, O121, O145 as well as serogroup O104 responsible for the massive outbreak in Germany in 2011. Carvacrol showed antibacterial effect on all strains tested. The relative electric conductivity was assessed in order to investigate the changes in membrane permeability and thus to investigate the antimicrobial mechanism of carvacrol. Results showed that the relative conductivity increased with increasing concentrations of carvacrol which showed that there was an increasing leakage of electrolytes due to disruption of the cell membrane. The data presented here revealed that carvacrol has the potential to be used as a natural antimicrobial against STECs.

  6. Toxicity by NSAIDs. Counteraction by stable gastric pentadecapeptide BPC 157.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Aralica, Gorana; Safic, Hana; Suran, Jelena; Rak, Davor; Dzidic, Senka; Vrcic, Hrvoje; Sebecic, Bozidar

    2013-01-01

    Stable gastric pentadecapeptide BPC 157 is an anti-ulcer peptidergic agent, proven in clinical trials to be both safe in inflammatory bowel disease (PL-10, PLD-116, PL 14736) and wound healing, stable in human gastric juice, with no toxicity being reported. Recently, we claim that BPC 157 may be used as an antidote against NSAIDs. We focused on BPC 157 beneficial effects on stomach, duodenum, intestine, liver and brain injuries, adjuvant arthritis, pain, hyper/hypothermia, obstructive thrombus formation and thrombolysis, blood vessel function, counteraction of prolonged bleeding and thrombocytopenia after application of various anticoagulants and antiplatelet agents and wound healing improvement. The arguments for BPC 157 antidote activity (i.e., the role of BPC 157 in cytoprotection, being a novel mediator of Robert's cytoprotection and BPC 157 beneficial effects on NSAIDs mediated lesions in the gastrointestinal tract, liver and brain and finally, counteraction of aspirin-induced prolonged bleeding and thrombocytopenia) obviously have a counteracting effect on several established side-effects of NSAIDs use. The mentioned variety of the beneficial effects portrayed by BPC 157 may well be a foundation for establishing BPC 157 as a NSAIDs antidote since no other single agent has portrayed a similar array of effects. Unlike NSAIDs, a very high safety (no reported toxicity (LD1 could be not achieved)) profile is reported for BPC 157. Also, unlike the different dosage levels of aspirin, as a NSAIDs prototype, which differ by a factor of about ten, all these beneficial and counteracting effects of BPC 157 were obtained using the equipotent dosage (μg, ng/kg) in parenteral or peroral regimens.

  7. Perforating corneal injury in rat and pentadecapeptide BPC 157.

    Science.gov (United States)

    Masnec, Sanja; Kokot, Antonio; Zlatar, Mirna; Kalauz, Miro; Kunjko, Kristian; Radic, Bozo; Klicek, Robert; Drmic, Domagoj; Lazic, Ratimir; Brcic, Luka; Radic, Radivoje; Ivekovic, Renata; Seiwerth, Sven; Sikiric, Predrag

    2015-07-01

    Based on its healing effects in various tissues, we hypothesized that the stable gastric pentadecapeptide BPC 157 heals corneal ulcerations in rats and effects corneal transparency. We made a penetrant linear 2-mm incision in the paralimbal region of the left cornea at the 5 o'clock position with a 20-gauge MVR incision knife at 45° under an operating microscope. Medication was BPC 157 (2 pg/mL, 2 ng/mL, and 2 μg/mL distilled water, two eye drops/left rat eye) immediately after injury induction and then every 8 h up to 120 h; controls received an equal volume of distilled water. In contrast to the poor healing response in controls, BPC 157 significantly accelerated the healing process in 2 μg and 2 ng BPC 157-treated eyes, starting 24 h after the injury, and the fluorescein and Seidel tests became negative. The epithelial defects were completely healed at 72 h (2 μg BPC 157-treated group) and at 96 h (2 ng BPC 157-treated group) after injury. Aqueous cells were absent at 96 h and 120 h after injury in the 2 μg and 2 ng BPC 157-treated groups, respectively. In conclusion, BPC 157 effects the rapid regaining of corneal transparency. Whereas controls developed new vessels that grew from the limbus to the penetrated area, BPC 157-treated rats generally had no new vessels, and those that did form in the limbus did not make contact with the penetrated area. Thus, BPC 157 eye drops successfully close perforating corneal incisions in rats. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Topological data analysis of Escherichia coli O157:H7 and non-O157 survival in soils

    Science.gov (United States)

    Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in major fresh produce-growing soils are limited due to the complexity in datasets generated from different ...

  9. Topological Data Analysis of Escherichia coli O157:H7 and Non-O157 Survival in Soils

    Directory of Open Access Journals (Sweden)

    ABASIOFIOK MARK IBEKWE

    2014-09-01

    Full Text Available Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in soils are limited due to the complexity in datasets generated from different environmental variables and bacterial taxa. There is a continuing need to distinguish the various environmental variables and different bacterial groups to understand the relationships among these factors and the pathogen survival. Using an approach called Topological Data Analysis (TDA; we reconstructed the relationship structure of E. coli O157 and non-O157 survival in 32 soils (16 organic and 16 conventionally managed soils from California (CA and Arizona (AZ with a multi-resolution output. In our study, we took a community approach based on total soil microbiome to study community level survival and examining the network of the community as a whole and the relationship between its topology and biological processes. TDA produces a geometric representation of complex data sets. Network analysis showed that Shiga toxin negative strain E. coli O157:H7 4554 survived significantly longer in comparison to E. coli O157:H7 EDL933, while the survival time of E. coli O157:NM was comparable to that of E. coli O157:H7 strain 933 in all of the tested soils. Two non-O157 strains, E. coli O26:H11 and E. coli O103:H2 survived much longer than E. coli O91:H21 and the three strains of E. coli O157. We show that there are complex interactions between E. coli strain survival, microbial community structures, and soil parameters.

  10. Fast and Selective Preconcentration of Europium from Wastewater and Coal Soil by Graphene Oxide/Silane@Fe3O4 Dendritic Nanostructure.

    Science.gov (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K

    2015-05-19

    In this study, nanocomposite of graphene oxide and silane modified magnetic nanoparticles (silane@Fe3O4) were synthesized in a form of dendritic structure. For this, silane@Fe3O4 nanoparticle gets sandwiched between two layers of graphene oxide by chemical synthesis route. The synthesized dendritic structure was used as a monomer for synthesis of europium ion imprinted polymer. The synthesis of imprinted polymer was contemplated onto the surface of the vinyl group modified silica fiber by activated generated free radical atom-transfer radical polymerization, that is, AGET-ATRP technique. The synthesized dendritic monomer was characterized by XRD, FT-IR, VSM, FE-SEM, and TEM analyses. The imprinted polymer modified silica fiber was first validated in the aqueous and blood samples for successful extraction and detection of europium ion with limit of detection = 0.050 pg mL(-1) (signal/noise = 3). The imprinted polymer modified silica fiber was also used for preconcentration and separation of europium metal ion from various soil samples of coal mine areas. However, the same silica fiber was also used for wastewater treatment and shows 100% performance for europium removal. The findings herein suggested that dendritic nanocomposite could be potentially used as a highly effective material for the enrichment and preconcentration of europium or other trivalent lanthanides/actinides in nuclear waste management.

  11. Antiinflammatory effect of BPC 157 on experimental periodontitis in rats.

    Science.gov (United States)

    Keremi, B; Lohinai, Z; Komora, P; Duhaj, S; Borsi, K; Jobbagy-Ovari, G; Kallo, K; Szekely, A D; Fazekas, A; Dobo-Nagy, C; Sikiric, P; Varga, G

    2009-12-01

    The pentadecapeptide BPC 157 has been shown to have anti-inflammatory and wound healing effects on multiple target tissues and organs. The purpose of the present study was to investigate the effect of BPC 157 on inflammation and bone resorption in experimental periodontitis in rats. First the acute effect of BPC was tested on gingival blood flow by laser doppler flowmetry. Then periodontitis was produced by a silk ligature placed around the lower left first molar. Rats were treated with BPC 157 (once daily for 12 days) or vehicle. At day 13, the gingivomucosal tissues encircling the molars were removed on both sides. Inflammation was assessed by Evans blue plasma extravasation technique and by histology. Alveolar bone loss was analyzed by microCT. BPC 157 had no effect on gingivomucosal blood flow. Twelve day ligature caused a significantly increased Evans blue extravasation in the gingivomucosal tissue, histological signs of inflammation, and alveolar bone destruction. BPC 157 treatment significantly reduced both plasma extravasation, histological alterations and alveolar bone resorption. In conclusion, systemic application of BPC 157 does not alter blood circulation in healthy gingiva. Chronic application of the peptide has potent antiinflammatory effects on periodontal tissues in ligature induced periodontitis in rats. Taken together, this proof of concept study suggests that BPC 157 may represent a new peptide candidate in the treatment of periodontal disease.

  12. Development of europium doped core-shell silica cobalt ferrite functionalized nanoparticles for magnetic resonance imaging.

    Science.gov (United States)

    Kevadiya, Bhavesh D; Bade, Aditya N; Woldstad, Christopher; Edagwa, Benson J; McMillan, JoEllyn M; Sajja, Balasrinivasa R; Boska, Michael D; Gendelman, Howard E

    2017-02-01

    The size, shape and chemical composition of europium (Eu3+) cobalt ferrite (CFEu) nanoparticles were optimized for use as a "multimodal imaging nanoprobe" for combined fluorescence and magnetic resonance bioimaging. Doping Eu3+ ions into a CF structure imparts unique bioimaging and magnetic properties to the nanostructure that can be used for real-time screening of targeted nanoformulations for tissue biodistribution assessment. The CFEu nanoparticles (size ∼7.2nm) were prepared by solvothermal techniques and encapsulated into poloxamer 407-coated mesoporous silica (Si-P407) to form superparamagnetic monodisperse Si-CFEu nanoparticles with a size of ∼140nm. Folic acid (FA) nanoparticle decoration (FA-Si-CFEu, size ∼140nm) facilitated monocyte-derived macrophage (MDM) targeting. FA-Si-CFEu MDM uptake and retention was higher than seen with Si-CFEu nanoparticles. The transverse relaxivity of both Si-CFEu and FA-Si-CFEu particles were r2=433.42mM-1s-1 and r2=419.52mM-1s-1 (in saline) and r2=736.57mM-1s-1 and r2=814.41mM-1s-1 (in MDM), respectively. The results were greater than a log order-of-magnitude than what was observed at replicate iron concentrations for ultrasmall superparamagnetic iron oxide (USPIO) particles (r2=31.15mM-1s-1 in saline) and paralleled data sets obtained for T2 magnetic resonance imaging. We now provide a developmental opportunity to employ these novel particles for theranostic drug distribution and efficacy evaluations. A novel europium (Eu3+) doped cobalt ferrite (Si-CFEu) nanoparticle was produced for use as a bioimaging probe. Its notable multifunctional, fluorescence and imaging properties, allows rapid screening of future drug biodistribution. Decoration of the Si-CFEu particles with folic acid increased its sensitivity and specificity for magnetic resonance imaging over a more conventional ultrasmall superparamagnetic iron oxide particles. The future use of these particles in theranostic tests will serve as a platform for

  13. Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal, A., E-mail: antonio.mariscal@csic.es [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)

    2016-06-30

    Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.

  14. Pentadecapeptide BPC 157 and the esophagocutaneous fistula healing therapy.

    Science.gov (United States)

    Cesarec, Vedran; Becejac, Tomislav; Misic, Marija; Djakovic, Zeljko; Olujic, Danijela; Drmic, Domagoj; Brcic, Luka; Rokotov, Dinko Stancic; Seiwerth, Sven; Sikiric, Predrag

    2013-02-15

    Esophagocutaneous fistulas are a failure of the NO-system, due to NO-synthase blockage by the NOS-blocker L-NAME consequently counteracted by l-arginine and gastric pentadecapeptide BPC 157 (l-arginine BPC 157), precipitating a therapeutic benefit. Previously, there was an established BPC 157-NO-system interaction. BPC 157 GEPPPGKPADDAGLV, MW 1419 (LD1 not achieved), is a safe and stable anti-ulcer peptide, successful in inflammatory bowel disease trials, counteracting esophagitis, sphincter failure, gastrointestinal and skin ulcers, gastrocutaneous or colocutaneous fistulas. We treated rats with established cervical esophagocutaneous fistulas throughout four days (both open skin and esophageal defects, with significant leakage) with BPC 157 (parenterally and perorally) and L-NAME (blocking NO genesis) and l-arginine (NO-substrate) alone or in combination. RT-PCR investigated eNOS, iNOS, COX-2 mRNA levels in the fistulas. We evidenced a closely inter-related process of unhealed skin, esophageal defects, unhealed fistulas (up regulated eNOS, iNOS and COX2 mRNA levels), usually lethal, particularly NO-system related and therapy dependent. Generally, the course of fistula healing was accelerated either to a greater extent (with BPC 157 (in particular, less eNOS gene expression) completely counteracting L-NAME effects, in L-NAME+BPC 157 and L-NAME+l-arginine+BPC 157 groups), or to a lesser extent (with l-arginine). Conversely, the process was aggravated, rapidly and prominently (with L-NAME). In particular, BPC 157 was effective either given per-orally/intraperitoneally, in μg- and ng-regimens. Shortly, defects started to heal, with less fistula leakage and no mortality at day 4. Failure of pyloric and lower esophageal sphincter pressure was restored, with practically no esophagitis. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Prevalence of O157:H7 and non-O157 E. coli in Iranian domestic sheep.

    Science.gov (United States)

    Tahamtan, Yahya; Namavari, Mehdi

    2014-01-01

    The aim of the present study was the isolation of both E. coli O157 and non-O157 in sheep. Verotoxins (VT) 1, 2 and eae genes were tested for this propose. Sheep faces are an important source of Shiga toxin-producing Escherichia coli (STEC). Escherichia coli O157:H7 is a highly virulent food-borne pathogen and threat to public health. Rectal swab samples from sheep were collected during 2009-2010. Conventional plating and Polymerase Chain Reaction (PCR) were carried out according to virulence factors (Stx1, Stx2 and eaeA).There significant differences between prevalence of STEC and session were observed. It was at highest in spring and late summer. Six (3.92%) sheep carcasses were contaminated by E. coli O157:H7.Only six samples were positive by PCR specific for the VT2 gene and produced verocytotoxin VT2, whereas all isolates were negative for the presence of VT1 and eae virulence genes considered. Geographical variations and season may be influenced in the prevalence rate. The composition of the gastrointestinal flora may be changed by different diet and, therefore O157 STEC rate in sheep and lamb was different. Iranian sheep indicated as a natural host of E. coli O157 strains therefore, may be potentially pathogenic for humans. This is the first report of E. coli O157 detection from sheep in Iran.

  16. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)

    2012-05-15

    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  17. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Science.gov (United States)

    Bicho, Rita C.; Soares, Amadeu M. V. M.; Nogueira, Helena I. S.; Amorim, Mónica J. B.

    2016-12-01

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of "no effect" are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  18. Spectral Interferences Manganese (Mn) - Europium (Eu) Lines in X-Ray Fluorescence Spectrometry Spectrum

    Science.gov (United States)

    Tanc, Beril; Kaya, Mustafa; Gumus, Lokman; Kumral, Mustafa

    2016-04-01

    X-ray fluorescence (XRF) spectrometry is widely used for quantitative and semi quantitative analysis of many major, minor and trace elements in geological samples. Some advantages of the XRF method are; non-destructive sample preparation, applicability for powder, solid, paste and liquid samples and simple spectrum that are independent from chemical state. On the other hand, there are some disadvantages of the XRF methods such as poor sensitivity for low atomic number elements, matrix effect (physical matrix effects, such as fine versus course grain materials, may impact XRF performance) and interference effect (the spectral lines of elements may overlap distorting results for one or more elements). Especially, spectral interferences are very significant factors for accurate results. In this study, semi-quantitative analyzed manganese (II) oxide (MnO, 99.99%) was examined. Samples were pelleted and analyzed with XRF spectrometry (Bruker S8 Tiger). Unexpected peaks were obtained at the side of the major Mn peaks. Although sample does not contain Eu element, in results 0,3% Eu2O3 was observed. These result can occur high concentration of MnO and proximity of Mn and Eu lines. It can be eliminated by using correction equation or Mn concentration can confirm with other methods (such as Atomic absorption spectroscopy). Keywords: Spectral Interferences; Manganese (Mn); Europium (Eu); X-Ray Fluorescence Spectrometry Spectrum.

  19. Performance of fluorescent europium(III) nanoparticles and colloidal gold reporters in lateral flow bioaffinity assay.

    Science.gov (United States)

    Juntunen, Etvi; Myyryläinen, Tiina; Salminen, Teppo; Soukka, Tero; Pettersson, Kim

    2012-09-01

    Lateral flow (LF) immunoassays (i.e., immunochromatographic assays) have traditionally been applied to analytes that do not require very high analytical sensitivity or quantitative results. The selection of potential analytes is often limited by the performance characteristics of the assay technology. Analytes with more demanding sensitivity requirements call for reporter systems enabling high analytical sensitivity. In this study, we systematically compared the performance of fluorescent europium(III) [Eu(III)] chelate dyed polystyrene nanoparticles and colloidal gold particles in lateral flow assays. The effect of time-resolved measurement mode was also studied. Because binder molecules used in immunoassays might not behave similarly when conjugated to different reporter particles, two model assays were constructed to provide reliable technical comparison of the two reporter systems. The comparative experiment demonstrated that the fluorescent nanoparticles yielded 7- and 300-fold better sensitivity compared with colloidal gold in the two test systems, respectively. Although the two reporter particles may induce variable effects using individual binders, overall the high specific activity of Eu(III) nanoparticles has superior potential over colloidal gold particles for the development of robust high-sensitivity bioaffinity assays. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Carbon nanotube-loaded Nafion film electrochemical sensor for metal ions: europium.

    Science.gov (United States)

    Wang, Tingting; Zhao, Daoli; Guo, Xuefei; Correa, Jaime; Riehl, Bill L; Heineman, William R

    2014-05-06

    A Nafion film loaded with novel catalyst-free multiwalled carbon nanotubes (MWCNTs) was used to modify a glassy carbon (GC) electrode to detect trace concentrations of metal ions, with europium ion (Eu(3+)) as a model. The interaction between the sidewalls of MWCNTs and the hydrophobic backbone of Nafion allows the MWCNTs to be dispersed in Nafion, which was then coated as a thin film on the GC electrode surface. The electrochemical response to Eu(3+) was found to be ∼10 times improved by MWCNT concentrations between 0.5 and 2 mg/mL, which effectively expanded the electrode surface into the Nafion film and thereby reduced the diffusion distance of Eu(3+) to the electrode surface. At low MWCNT concentrations of 0.25 and 0.5 mg/mL, no significant improvement in signal was obtained compared with Nafion alone. Scanning electron microscopy and electrochemical impedance spectroscopy were used to characterize the structure of the MWCNT-Nafion film, followed by electrochemical characterization with Eu(3+) via cyclic voltammetry and preconcentration voltammetry. Under the optimized conditions, a linear range of 1-100 nM with a calculated detection limit of 0.37 nM (signal/noise = 3) was obtained for determination of Eu(3+) by Osteryoung square-wave voltammetry after a preconcentration time of 480 s.

  1. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Energy Technology Data Exchange (ETDEWEB)

    Bicho, Rita C., E-mail: ritabicho@ua.pt; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)

    2016-12-15

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  2. EUROPIUM ION INFLUENCE ON THE FORMATION OF Ag-NANOPARTICLES IN FLUORINE PHOSPHATE GLASSES

    Directory of Open Access Journals (Sweden)

    R. O. Pysh'ev

    2015-05-01

    Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.

  3. Nanoparticles in the zirconia-europium niobate system via hydrothermal route.

    Science.gov (United States)

    Hirano, Masanori; Dozono, Hayato

    2013-10-01

    The effect of the composition on the hydrothermal formation, structure, and properties of nanocrystalline luminescent materials in the zirconia (ZrO2)-europium niobate 1/4(Eu3NbO7) system was investigated. In the composition range 40 particles with crystallite size 6.0-7.6 nm that were hydrothermally formed from the precursor solutions of NbCl5, ZrOCI2, and EuCl3 under weakly basic conditions at 240 degrees C showed cubic structure. The lattice parameter when estimated as a single cubic phase linearly decreased as the concentration of ZrO2 increased. The presence of zirconia component effectively promoted the formation of nanocrystals containing the niobate, Eu3NbO7 under hydrothermal condition. The nanocrystalline particles could be excited by ultraviolet light 395 nm (f-f transition) and emitted orange (590 nm) and red light (610 nm) corresponding to 5D0 --> 7F1 and 5D0 --> 7F2 transitions of Eu3+, respectively. The intensity of the electric dipole transition (5D0 --> 7F2) that was expressed in values relative to the magnetic dipole transition (5D0 --> 7F1) increased with increased heat-treatment temperature in the range from 950 to 1200 degrees C.

  4. Photoluminescence of monocrystalline and stain-etched porous silicon doped with high temperature annealed europium

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Lemus, R; Montesdeoca-Santana, A; Gonzalez-Diaz, B; Diaz-Herrera, B; Hernandez-Rodriguez, C; Jimenez-Rodriguez, E [Departamento de Fisica Basica, Universidad de La Laguna (ULL), Avenida AstrofIsico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain); Velazquez, J J, E-mail: rglemus@ull.es [Departamento de Fisica Fundamental y Experimental, Electronica y Sistemas, Universidad de La Laguna (ULL), Avenida Astrofisico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain)

    2011-08-24

    In this work, for the first time, the photoluminescent emission and excitation spectra of non-textured layers and stain-etched porous silicon layers (PSLs) doped with high temperature annealed europium (Eu) are evaluated. The PSLs are evaluated as a host for rare earth ions and as an antireflection coating. The applied doping process, which consists in a simple impregnation method followed by a high-temperature annealing step, is compatible with the standard processes in the fabrication of solar cells. The results show down-shifting processes with a maximum photoluminescent intensity at 615 nm, related to the transition {sup 5}D{sub 0} {yields} {sup 7}F{sub 2}. Different initial concentrations of Eu(NO{sub 3}){sub 3} are evaluated to study the influence of the rare earth concentration on the photoluminescent intensity. The chemical composition and the morphology of Eu-doped PSLs are examined by means of x-ray dispersion spectroscopy, Fourier-transform infrared spectroscopy and scanning electron microscopy. These Eu-doped layers are considered to be applied as energy converters in silicon-based third generation solar cells.

  5. Europium (III) and Uranium (VI) complexation by natural organic matter (NOM): Effect of source.

    Science.gov (United States)

    Kautenburger, Ralf; Sander, Jonas M; Hein, Christina

    2017-03-01

    For the safe long-term storage of high-level radioactive waste (HLW), detailed information about geo-chemical behavior of radioactive and toxic metal ions under environmental conditions is important. Natural organic matter (NOM) can play a crucial role in the immobilization or mobilization of these metal ions due to its complexation and colloid formation tendency. In this study, the complexation of europium (as chemical homologue of trivalent actinides such as americium) and uranium (as main component of HLW) by ten humic acids (HA) from different sources and Suwannee NOM river extract has been analyzed. Capillary electrophoresis in combination with inductively coupled plasma mass spectrometry has been used for the evaluation of complex stability constants log β. In order to determine the complex stability constants a conservative single site model was used in this study. In dependence of their source and thus of NOM structure the log β values for the analyzed humic acids are in the range of 6.1-7.0 for Eu(III) and 5.2-6.4 for U(VI) (UO 2 2+ ), respectively. In contrast to the results for HA the used Suwannee river NOM reveals log β values in the range of nearly two orders of magnitude lower (4.6 for Eu 3+ and 4.5 for UO 2 2+ ) under the geochemical conditions applied in this study. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Europium incorporated into titanium oxide by the sol-gel method

    Directory of Open Access Journals (Sweden)

    Lucas Alonso Rocha

    2005-09-01

    Full Text Available In this work titanium sol was prepared from tetraethylorthotitanate (TEOT in ethanol, stabilized with beta-diketonate 2,4 pentanedione in molar ratio 1:1 homogenized by magnetic stirring, europium ion was add as structural probe. The xerogels were heat treated at 500, 750 and 1000 °C and the characterization was realized by x-ray diffraction (XRD, transmission electron microscopy (TEM, thermogravimetric analysis (TGA/DSC and photoluminescence (PL. The excitation spectra of Eu (III ion present maximum in 394 nm correspondent to 5L6 level and emission spectra present bands characteristic transitions arising from the 5 D0 -> 7F J (J = 0, 1, 2, 3, 4 manifolds to samples treat at 500 and 750 °C. The Eu (III emission disappear, when heated at 1000 °C, probably due to phase transition anatase to rutile and migrations of ions to the external surface that was proved by x-ray diffraction, transmission electronic microscopy and the thermogravimetric analyses of xerogels.

  7. Luminescence studies on the europium doped strontium metasilicate phosphor prepared by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2017-03-01

    Full Text Available Europium doped strontium meta-silicate (namely SrSiO3:Eu3+ phosphor was prepared by a high temperature solid state reaction method. The sintered SrSiO3:Eu3+ phosphor possesses a monoclinic structure by the XRD. Energy dispersive X-ray spectrum (EDS confirms the presence of elements in the desired sample. Thermoluminescence (TL kinetic parameters such as activation energy (E, order of kinetics (b, and frequency factor (s were calculated by the peak shape method. The orange–red emission was shown to originate from the 5D0–7FJ (J = 0, 1, 2, 3, 4 transitions of Eu3+ ions as the sample was excited at 396 nm. The SrSiO3:Eu3+ phosphor with almost pure orange-red color purity (99.62% shows the quantum efficiency of 10.2% (excited by 396 nm, which is higher than those of commercial red phosphors Y2O3:Eu3+ and Y2O2S:Eu3+ with quantum efficiencies of 9.6% (excited by 394 nm and 4.2% (excited by 395 nm, respectively. Mechanoluminescence (ML intensity of the SrSiO3:Eu3+ phosphor was also found to increase linearly with increasing the impact velocity of the moving piston, suggesting that the discussed phosphor can be used as a stress sensor.

  8. Europium Luminescence Used for Logic Gate and Ions Sensing with Enoxacin As the Antenna.

    Science.gov (United States)

    Lu, Lixia; Chen, Chuanxia; Zhao, Dan; Sun, Jian; Yang, Xiurong

    2016-01-19

    Luminescent lanthanide ion complexes have received increasing attention because of their unique optical properties. Herein, we discovered that the luminescence of europium(III) (Eu(3+)) could be regulated by Ag(+) and SCN(-) in seconds with enoxacin (ENX) as the antenna. Under given conditions, only the simultaneous introduction of Ag(+) and SCN(-) could remarkably enhance the luminescence intensity of Eu(3+)-ENX complexes. This phenomenon has been exploited to design an "AND" logic gate and specific luminescence turn-on assays for sensitively sensing Ag(+) and SCN(-) for the first time. Furthermore, the addition of S(2-) resulted in efficient luminescence quenching of the Eu(3+)/ENX/Ag(+)/SCN(-) system due to the strong affinity between Ag(+) and S(2-). Thus, a new luminescent sensing platform for S(2-) was established, which exhibited excellent selectivity and high sensitivity. S(2-) could be detected within the concentration range of 100 nM to 12.5 μM with a detection limit of 60 nM. Such sensing system features simplicity, rapidity, and flexibility. Moreover, this proposed Eu(3+)-based luminescent assay could be successfully applied in the real environmental water sample analysis.

  9. Radiation effects on beta 10.6 of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as a result of X-ray and electron bombardment of pure KCl (monocrystalline and polycrystalline), and divalent europium doped polycrystalline KCl were determined. The optical absorption coefficients were measured by a constant heat flow calorimetric method. Both 300 KV X-irradiation and 2 MeV electron irradiation produced significant increases in beta 10.6, measured at room temperature. The X-irradiation of pure moncrystalline KCl increased beta 10.6 by 0.005/cm for a 113 MR dose. For an equivalent dose, 2 MeV electrons were found less efficient in changing beta 10.6. However, electron irradiation of pure and Eu-doped polycrystalline KCl produced marked increases in adsorption. Beta increased to over 0.25/cm in Eu-doped material for a 30 x 10 to the 14th power electrons/sq cm dose, a factor of 20 increase over unirradiated material. Moreover, bleaching the electron irradiated doped KCl with 649 m light produced and additional factor of 1.5 increase. These findings will be discussed in light of known defect-center properties in KCl.

  10. Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods.

    Science.gov (United States)

    Wei, Peng-Fei; Zhang, Li; Nethi, Susheel Kumar; Barui, Ayan Kumar; Lin, Jun; Zhou, Wei; Shen, Yi; Man, Na; Zhang, Yun-Jiao; Xu, Jing; Patra, Chitta Ranjan; Wen, Long-Ping

    2014-01-01

    Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. High-resolution Thermal Micro-imaging Using Europium Chelate Luminescent Coatings.

    Science.gov (United States)

    Benseman, Timothy M; Hao, Yang; Vlasko-Vlasov, Vitalii K; Welp, Ulrich; Koshelev, Alexei E; Kwok, Wai-Kwong; Divan, Ralu; Keiser, Courtney; Watanabe, Chiharu; Kadowaki, Kazuo

    2017-04-16

    Micro-electronic devices often undergo significant self-heating when biased to their typical operating conditions. This paper describes a convenient optical micro-imaging technique which can be used to map and quantify such behavior. Europium thenoyltrifluoroacetonate (EuTFC) has a 612 nm luminescence line whose activation efficiency drops strongly with increasing temperature, due to T-dependent interactions between the Eu3+ ion and the organic chelating compound. This material may be readily coated on to a sample surface by thermal sublimation in vacuum. When the coating is excited with ultraviolet light (337 nm) an optical micro-image of the 612 nm luminescent response can be converted directly into a map of the sample surface temperature. This technique offers spatial resolution limited only by the microscope optics (about 1 micron) and time resolution limited by the speed of the camera employed. It offers the additional advantages of only requiring comparatively simple and non-specialized equipment, and giving a quantitative probe of sample temperature.

  12. In vivo synthesis of europium selenide nanoparticles and related cytotoxicity evaluation of human cells.

    Science.gov (United States)

    Kim, Eun Bee; Seo, Ji Min; Kim, Gi Wook; Lee, Sang Yup; Park, Tae Jung

    2016-12-01

    Nanotechnology strives to combine new materials for development of noble nanoparticles. As the nanoparticles exhibit unique optical, electronic, and magnetic properties depending on their composition, developing safe, cost-effective and environmentally friendly technologies for the synthesis have become an important issue. In this study, in vivo synthesis of europium selenide (EuSe) nanoparticles was performed using recombinant Escherichia coli cells expressing heavy-metal binding proteins, phytochelatin synthase and metallothionein. The formation of EuSe nanoparticles was confirmed by using UV-vis spectroscopy, spectrofluorometry, X-ray diffraction, energy dispersive X-ray and transmission electron microscopy. The synthesized EuSe nanoparticles exhibited high fluorescence intensities as well as strong magnetic properties. Furthermore, anti-cancer effect of EuSe nanoparticles against cancer cell lines was investigated. This strategy for the biogenic synthesis of nanoparticles has a great potential as bioimaging tools and drug carrying agents in biomedical fields due to its simplicity and nontoxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands

    Science.gov (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.

    2009-01-01

    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  14. Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes.

    Science.gov (United States)

    Taha, Mohamed; Khan, Imran; Coutinho, João A P

    2016-04-01

    With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Luminescent single-walled carbon nanotube-sensitized europium nanoprobes for cellular imaging

    Science.gov (United States)

    Avti, Pramod K; Sitharaman, Balaji

    2012-01-01

    Lanthanoid-based optical probes with excitation wavelengths in the ultra-violet (UV) range (300–325 nm) have been widely developed as imaging probes. Efficient cellular imaging requires that lanthanoid optical probes be excited at visible wavelengths, to avoid UV damage to cells. The efficacy of europium-catalyzed single-walled carbon nanotubes (Eu-SWCNTs), as visible nanoprobes for cellular imaging, is reported in this study. Confocal fluorescence microscopy images of breast cancer cells (SK-BR-3 and MCF-7) and normal cells (NIH 3T3), treated with Eu-SWCNT at 0.2 μg/mL concentration, showed bright red luminescence after excitation at 365 nm and 458 nm wavelengths. Cell viability analysis showed no cytotoxic effects after the incubation of cells with Eu-SWCNTs at this concentration. Eu-SWCNT uptake is via the endocytosis mechanism. Labeling efficiency, defined as the percentage of incubated cells that uptake Eu-SWCNT, was 95%–100% for all cell types. The average cellular uptake concentration was 6.68 ng Eu per cell. Intracellular localization was further corroborated by transmission electron microscopy and Raman microscopy. The results indicate that Eu-SWCNT shows potential as a novel cellular imaging probe, wherein SWCNT sensitizes Eu3+ ions to allow excitation at visible wavelengths, and stable time-resolved red emission. The ability to functionalize biomolecules on the exterior surface of Eu-SWCNT makes it an excellent candidate for targeted cellular imaging. PMID:22619533

  16. Europium(III) DOTA-derivatives having ketone donor pendant arms display dramatically slower water exchange

    Science.gov (United States)

    Green, Kayla N.; Viswanathan, Subha; Rojas-Quijano, Federico A.; Kovacs, Zoltan; Sherry, A. Dean

    2011-01-01

    A series of new 1,4,7,10-tetraazacyclododecane-derivatives having a combination of amide and ketone donor groups as side-arms were prepared and their complexes with europium(III) studied in detail by high resolution NMR spectroscopy. The chemical shift of the Eu3+-bound water resonance, the chemical exchange saturation transfer (CEST) characteristics of the complexes, and the bound water residence lifetimes (τm) were found to vary dramatically with the chemical structure of the side-arms. Substitution of ketone oxygen donor atoms for amide oxygen donor atoms resulted in an increase in residence water lifetimes (τm) and a decrease in chemical shift of the Eu3+-bound water molecule (Δω). These experimental results along with density functional theory (DFT) calculations demonstrate that introduction of weakly donating oxygen atoms in these complexes results in a much weaker ligand field, more positive charge on the Eu3+ ion and an increased water residence lifetime as expected for a dissociative mechanism. These results provide new insights into the design of paramagnetic CEST agents with even slower water exchange kinetics that will make them more efficient for in vivo imaging applications. PMID:21306137

  17. Urinary monitoring of exposure to yttrium, scandium, and europium in male Wistar rats.

    Science.gov (United States)

    Kitamura, Yasuhiro; Usuda, Kan; Shimizu, Hiroyasu; Fujimoto, Keiichi; Kono, Rei; Fujita, Aiko; Kono, Koichi

    2012-12-01

    On the assumption that rare earth elements (REEs) are nontoxic, they are being utilized as replacements of toxic heavy metals in novel technological applications. However, REEs are not entirely innocuous, and their impact on health is still uncertain. In the past decade, our laboratory has studied the urinary excretion of REEs in male Wistar rats given chlorides of europium, scandium, and yttrium solutions by one-shot intraperitoneal injection or oral dose. The present paper describes three experiments for the suitability and appropriateness of a method to use urine for biological monitoring of exposure to these REEs. The concentrations of REEs were determined in cumulative urine samples taken at 0-24 h by inductively coupled plasma atomic emission spectroscopy, showing that the urinary excretion of REEs is <2 %. Rare earth elements form colloidal conjugates in the bloodstream, which make high REEs accumulation in the reticuloendothelial system and glomeruli and low urinary excretion. The high sensitivity of inductively coupled plasma-argon emission spectrometry analytical methods, with detection limits of <2 μg/L, makes urine a comprehensive assessment tool that reflects REE exposure. The analytical method and animal experimental model described in this study will be of great importance and encourage further discussion for future studies.

  18. Europium Luminescence: Electronic Densities and Superdelocalizabilities for a Unique Adjustment of Theoretical Intensity Parameters

    Science.gov (United States)

    Dutra, José Diogo L.; Lima, Nathalia B. D.; Freire, Ricardo O.; Simas, Alfredo M.

    2015-09-01

    We advance the concept that the charge factors of the simple overlap model and the polarizabilities of Judd-Ofelt theory for the luminescence of europium complexes can be effectively and uniquely modeled by perturbation theory on the semiempirical electronic wave function of the complex. With only three adjustable constants, we introduce expressions that relate: (i) the charge factors to electronic densities, and (ii) the polarizabilities to superdelocalizabilities that we derived specifically for this purpose. The three constants are then adjusted iteratively until the calculated intensity parameters, corresponding to the 5D0→7F2 and 5D0→7F4 transitions, converge to the experimentally determined ones. This adjustment yields a single unique set of only three constants per complex and semiempirical model used. From these constants, we then define a binary outcome acceptance attribute for the adjustment, and show that when the adjustment is acceptable, the predicted geometry is, in average, closer to the experimental one. An important consequence is that the terms of the intensity parameters related to dynamic coupling and electric dipole mechanisms will be unique. Hence, the important energy transfer rates will also be unique, leading to a single predicted intensity parameter for the 5D0→7F6 transition.

  19. Structural and spectroscopic analyses of europium doped yttrium oxyfluoride powders prepared by combustion synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Rakov, Nikifor [PG-Ciência dos Materiais, Universidade Federal do Vale do São Francisco, 48902-300 Juazeiro, BA (Brazil); Guimarães, R. B.; Maciel, Glauco S. [Instituto de Física, Universidade Federal Fluminense, 24210-346 Niterói, RJ (Brazil); Lozano B, W. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)

    2013-07-28

    A facile widely spread technique employed to produce low-cost high-yield oxide powders, combustion synthesis, was used to prepare yttrium oxyfluoride crystalline ceramic powders. The structure of the powders was analyzed by X-ray powder diffraction and Rietveld refinement. Samples heat treated at 700 °C had a predominance of vernier orthorhombic Y{sub 6}O{sub 5}F{sub 8} phase, while samples heat treated at 800 °C crystallized in stoichiometric rhombohedral YOF phase. The samples were doped with luminescent europium trivalent ions (Eu{sup 3+}) in different concentrations (1–15 wt.%) and Judd-Ofelt theory was used to probe the distortion from the inversion symmetry of the local crystal field and the degree of covalency between the rare-earth ion and the surrounding ligands. The luminescence lifetime was measured and the luminescence quantum efficiency (LQE) was estimated. We observed that Eu{sup 3+}:Y{sub 6}O{sub 5}F{sub 8} samples presented higher LQE in spite of the larger local crystal field anisotropy found for Eu{sup 3+}:YOF samples.

  20. Comparison of 4 label-based immunochromatographic assays for the detection of Escherichia coli O157:H7 in milk.

    Science.gov (United States)

    Luo, Kai; Hu, Liming; Guo, Qi; Wu, Chenghui; Wu, Songsong; Liu, Daofeng; Xiong, Yonghua; Lai, Weihua

    2017-07-01

    Immunochromatographic assays (ICA) are widely used to detect pathogens. In this study, we used traditional gold nanoparticles (GNP), quantum dots (QD), fluorescent nanoparticles (FNP), and europium (Eu) (III) chelate nanoparticles (EuNP) as ICA labels. We first compared the ability of the 4 ICA test strips to quantitatively detect Escherichia coli O157:H7 in milk. We then optimized various parameters influencing the ICA. The sensitivity to E. coli O157:H7 of the GNP-ICA, QD-ICA, FNP-ICA, and EuNP-ICA was 2.5 × 10 4 , 5 × 10 3 , 1.0 × 10 3 , and 5.0 × 10 2 cfu mL -1 , respectively. The EuNP-ICA exhibited the highest sensitivity. The amounts of monoclonal antibodies (mAb) per GNP-ICA, QD-ICA, FNP-ICA, and EuNP-ICA test strip were 0.16, 0.37, 0.04, and 0.10 μg, respectively. The corresponding coefficients of variation were 7.4 to 15.8%, 10.4 to 18.6%, 2.7 to 7.8%, and 6.9 to 10.5%, respectively. The FNP-ICA required the least mAb per test strip and had the best coefficient of variation. The linear ranges of GNP-ICA, QD-ICA, FNP-ICA, and EuNP-ICA were 1.0 × 10 4 to 1.0 × 10 6 , 2.5 × 10 3 to 1.0 × 10 6 , 2.5 × 10 2 to 2.5 × 10 5 , and 2.5 × 10 2 to 2.5 × 10 5 cfu mL -1 , respectively. The FNP-ICA and EuNP-ICA had wider linear ranges than GNP-ICA and QD-ICA. Additionally, the FNP-ICA and EuNP-ICA showed better tolerance than GNP-ICA and QD-ICA in the milk samples. The FNP-ICA and EuNP-ICA showed remarkable potential for detection of pathogens in milk. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Stable gastric pentadecapeptide BPC 157: novel therapy in gastrointestinal tract.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Vrcic, Hrvoje; Sebecic, Bozidar

    2011-01-01

    Stable gastric pentadecapeptide BPC 157 is an anti-ulcer peptidergic agent, safe in inflammatory bowel disease clinical trials (GEPPPGKPADDAGLV, M.W. 1419, PL 14736) and wound healing, stable in human gastric juice and has no reported toxicity. We focused on BPC 157 as a therapy in peridontitis, esophagus, stomach, duodenum, intestine, liver and pancreas lesions. Particularly, it has a prominent effect on alcohol-lesions (i.e., acute, chronic) and NSAIDs-lesions (interestingly, BPC 157 both prevents and reverses adjuvant arthritis). In rat esophagitis and failed function of both lower esophageal sphincter (LES) and pyloric sphincters (PS), BPC 157 increased pressure in both sphincters till normal and reduced esophagitis. However, in healthy rats, it may decrease (PS) or increase (LES) the pressure in sphincters. It has strong angiogenic potential, it acts protectively on endothelium, prevents and reverses thrombus formation after abdominal aorta anastomosis, affects many central disturbances (i.e., dopamine and 5-HT system), the NO-system (either L-arginine and L-NAME effects), endothelin, acts as a free radical scavenger (counteracting CCl4-, paracetamol-, diclofenac-injuries) and exhibits neuroprotective properties. BPC 157 successfully heals the intestinal anastomosis, gastrocutaneous, duodenocutaneous and colocutaneous fistulas in rats, as well as interacting with the NO-system. Interestingly, the fistula closure was achieved even when the BPC 157 therapy was postponed for one month. In short-bowel syndrome escalating throughout 4 weeks, the constant weight gain above preoperative values started immediately with peroral and parental BPC 157 therapy and the villus height, crypth depth and muscle thickness (inner (circular) muscular layer) additionally increased. Thus, BPC 157 may improve gastrointestinal tract therapy.

  2. Synthesis, photophysics, electrochemistry, thermal stability and electroluminescent performances of a new europium complex with bis(β-diketone) ligand containing carbazole group.

    Science.gov (United States)

    Liu, Jian; Liang, Quan-Bin; Wu, Hong-Bin

    2017-05-01

    We synthesized a new europium complex [Eu(ecbpd)3 (Phen)] with bis(β-diketone) ligand containing a carbazole group, in which ecbpd and Phen are dehydro-3,3'-(9-ethyl-9H-carbazole-3,6-diyl)bis(1-phenylpropane-1,3-dione) and 1,10-phenanthroline, respectively. Its UV/vis and photoluminescent spectra, quantum yield, luminescence lifetime, electrochemistry, thermal stability and electroluminescent performances were studied. This europium complex showed low efficiency luminescence, which is probably due to the mismatching energy levels of its ligand and Eu3+ , as well as the double Eu3+ core resonance. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Europium (III) PVC membrane sensor based on N-pyridine-2-carboxamido-8-aminoquinoline as a sensing material

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2012-04-01

    Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.

  4. A novel tridentate bis(phosphinic acid)phosphine oxide based europium(III)-selective Nafion membrane luminescent sensor.

    Science.gov (United States)

    Sainz-Gonzalo, F J; Popovici, C; Casimiro, M; Raya-Barón, A; López-Ortiz, F; Fernández, I; Fernández-Sánchez, J F; Fernández-Gutiérrez, A

    2013-10-21

    A new europium(III) membrane luminescent sensor based on a new tridentate bis(phosphinic acid)phosphine oxide (3) system has been developed. The synthesis of this new ligand is described and its full characterization by NMR, IR and elemental analyses is provided. The luminescent complex formed between europium(III) chloride and ligand 3 was evaluated in solution, observing that its spectroscopic and chemical characteristics are excellent for measuring in polymer inclusion membranes. Included in a Nafion membrane, all the parameters (ligand and ionic additives) that can affect the sensitivity and selectivity of the sensing membrane as well as the instrumental conditions were carefully optimized. The best luminescence signal (λexc = 229.06 nm and λem = 616.02 nm) was exhibited by the sensing film having a Nafion : ligand composition of 262.3 : 0.6 mg mL(-1). The membrane sensor showed a short response time (t95 = 5.0 ± 0.2 min) and an optimum working pH of 5.0 (25 mM acetate buffer solution). The membrane sensor manifested a good selectivity toward europium(III) ions with respect to other trivalent metals (iron, chromium and aluminium) and lanthanide(III) ions (lanthanum, samarium, terbium and ytterbium), although a small positive interference of terbium(III) ions was observed. It provided a linear range from 1.9 × 10(-8) to 5.0 × 10(-6) M with a very low detection limit (5.8 × 10(-9) M) and sensitivity (8.57 × 10(-7) a.u. per M). The applicability of this sensing film has been demonstrated by analyzing different kinds of spiked water samples obtaining recovery percentages of 95-97%.

  5. A Responsive Europium(III) Chelate that Provides a Direct Readout of pH by MRI

    Science.gov (United States)

    Wu, Yunkou; Soesbe, Todd C.; Kiefer, Garry E.; Zhao, Piyu; Sherry, A. Dean

    2010-01-01

    A europium(III) DO3A-tris(amide) complex is reported for imaging pH by MRI using ratiometric CEST principles. Deprotonation of a single phenolic proton between pH 6 and 7.6 results in an ~5 ppm shift in the water exchange CEST peak that is easily detected by MRI. Collection of two CEST images at two slightly different activation frequencies provides a direct readout of solution pH without the need of a concentration marker. PMID:20853833

  6. Spectroscopic properties and luminescence behaviour of europium doped lithium borate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Anjaiah, J., E-mail: anjaiah.juluru@gmail.com [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Department of Physics, Geethanjali College of Engineering and Technology, Keesara, RR Dist., Hyderabad 501 301 (India); Laxmikanth, C. [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Veeraiah, N. [Department of Physics, Acharya Nagarjuna University, Nagarjuna Nagar, Guntur 522 510, AP. (India)

    2014-12-01

    Li{sub 2}O–MO–B{sub 2}O{sub 3} (MO=ZnO, CaO and CdO) glasses doped with europium are prepared by using the melt quenching technique to study their absorption and luminescence properties to understand their lasing potentialities. The XRD pattern of the glasses confirmed the amorphous nature and the IR spectra reveal the presence of BO{sub 3} and BO{sub 4} units in the glass network. Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) are evaluated from the intensities of various absorption bands of optical absorption spectra. The J–O parameters have been used to calculate transition probabilities (A), lifetime (τ{sub R}), branching ratios (β{sub R}) and stimulated emission cross-section (σ{sub P}) for the {sup 5}D{sub 0}→{sup 7}F{sub J} (J=1–4) transitions of the Eu{sup 3+} ions. The decay from the {sup 5}D{sub 0} level of Eu{sup 3+} ions in these glasses has been measured and analysed. Branching ratios and stimulated emission cross-sections measured for all these glasses show that the {sup 5}D{sub 0}→{sup 7}F{sub 1} transition under investigation has the potential for laser applications. The high stimulated emission cross-section and branching ratios from the present glasses suggests their potential for infra red lasers. The study of the thermoluminescence is also carried out and the data suggests that the CdBEu glass is suitable for thermoluminescence emission output among the three Eu{sup 3+} doped glasses.

  7. Size-dependent cytotoxicity of europium doped NaYF{sub 4} nanoparticles in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang, E-mail: wsx@hbu.edu.cn; Zhang, Jinchao, E-mail: jczhang6970@163.com

    2014-10-01

    Lanthanide-doped sodium yttrium fluoride (NaYF{sub 4}) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF{sub 4} (NaYF{sub 4}:Eu{sup 3+}) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF{sub 4}:Eu{sup 3+} nanoparticles with three diameters have been synthesized. • NaYF{sub 4}:Eu{sup 3+} nanoparticles could be uptaken by endothelial cells (ECs). • NaYF{sub 4}:Eu{sup 3+} nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF{sub 4}:Eu{sup 3+} nanoparticles may be important to their toxicology effect.

  8. Two-dimensional high spatial-resolution dosimeter using europium doped potassium chloride: a feasibility study

    Science.gov (United States)

    Li, H. Harold; Driewer, Joseph P.; Han, Zhaohui; Low, Daniel A.; Yang, Deshan; Xiao, Zhiyan

    2014-01-01

    Recent research has shown that KCl:Eu2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had completed been incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl-) centers were the electron storage centers post×ray irradiation and that Eu2+ cations acted as luminescence centers in the photostimulation process. The 150-µm thick casted KCl:Eu2+ SPF showed sub-millimeter spatial resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu2+ and 80% low Z polymer binder exhibited almost no energy dependence in a 6 MV beam. KCl:Eu2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl’s intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu2+ based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. PMID:24651448

  9. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay

    Science.gov (United States)

    Shen, Yifeng; Xu, Shaohan; He, Donghua

    2015-01-01

    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0) respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5μg/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145μg/L). We propose that it can fulfill clinical applications. PMID:26056826

  10. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay.

    Directory of Open Access Journals (Sweden)

    Yifeng Shen

    Full Text Available A novel europium ligand 2,2',2'',2'''-(4,7-diphenyl-1,10-phenanthroline-2,9-diyl bis (methylene bis (azanetriyl tetra acetic acid (BC-EDTA was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm. It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0 respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5 μg/L. It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA reagents (0.2-145 μg/L. We propose that it can fulfill clinical applications.

  11. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: ntwaeab@ufs.ac.za [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)

    2014-03-15

    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  12. Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: jorgeiriqui@gimmunison.com [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)

    2015-10-15

    Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)

  13. Pentadecapeptide BPC 157 attenuates chronic amphetamine-induced behavior disturbances.

    Science.gov (United States)

    Sikiric, Predrag; Jelovac, Nikola; Jelovac-Gjeldum, Andjelka; Dodig, Goran; Staresinic, Mario; Anic, Tomislav; Zoricic, Ivan; Rak, Davor; Perovic, Darko; Aralica, Gorana; Buljat, Gojko; Prkacin, Ingrid; Lovric-Bencic, Martina; Separovic, Jadranka; Seiwerth, Sven; Rucman, Rudolf; Petek, Marijan; Turkovic, Branko; Ziger, Tihomil; Boban-Blagaic, Alenka; Bedekovic, Vlado; Tonkic, Ante; Babic, Slaven

    2002-05-01

    To investigate the effect of pentadecapeptide BPC 157 on chronic exposure to amphetamine in rats, particularly the changes commonly referred in chronic amphetamine studies as tolerance (lesser grade of stereotyped behavior, without increased excitability) and reverse tolerance (ie, prominent stereotyped behavior and heightened startle response upon late amphetamine challenges). After initial application (initial single dose-regimen), amphetamine (10 mg/kg,ip) was given once daily till d 5 (continuous administration-regimen), and thereafter on d 8, 16, and 46 (intermittent administration regimen). Fo r stereotyped behavior and heightened startle response the observation period was 120 min after amphetamine application, and each animal was observed for 10 s in 5 min intervals. Pentadecapeptide BPC 157 (10 microg/kg or 10 ng/k g, ip) or saline (5.0 mL/kg, ip) were given only at the beginning of the experiment, simultaneously with the initial dose of amphetamine. In relation to applied initial-single/continuous/intermittent amphetamine applications regimen, the control amphetamine rats throughout the experiment showed the changes in stereotyped behavior and heightened startle response, increment or decrement, commonly explained in chronic amphetamine studies as tolerance and reverse tolerance. After t he initial application of the amphetamine, the higher BPC 157 dosage apparently attenuated the stereotyped behavior, while the lower dosage of BPC 157 did not reach a statistical significance. Considering the forthcoming amphetamine challenges, in the rats initially treated with pentadecapeptide BPC 157, either 10 microg- or 10 ng-dose, at the time of the first application of amphetamine, the stereotyped behavior remains to be attenuated after all additional amphetamine challenges (on d 2-5, 8, 16, and 46). This attenuation was not limited to stereotyped behavior only. After the initial application of the amphetamine the heighten ed startle response was also apparently

  14. Gastric pentadecapeptide BPC 157 and short bowel syndrome in rats.

    Science.gov (United States)

    Sever, Marko; Klicek, Robert; Radic, Bozo; Brcic, Luka; Zoricic, Ivan; Drmic, Domagoj; Ivica, Mihovil; Barisic, Ivan; Ilic, Spomenko; Berkopic, Lidija; Blagaic, Alenka Boban; Coric, Marijana; Kolenc, Danijela; Vrcic, Hrvoje; Anic, Tomislav; Seiwerth, Sven; Sikiric, Predrag

    2009-10-01

    The gastric pentadecapeptide BPC 157, which was shown to be safe as an antiulcer peptide in trials for inflammatory bowel disease (PL14736, Pliva), successfully healed intestinal anastomosis and fistula in rat. Therefore, we studied for 4 weeks rats with escalating short bowel syndrome and progressive weight loss after small bowel resection from fourth ileal artery cranially of ileocecal valve to 5 cm beneath pylorus. BPC 157 (10 microg/kg or 10 ng/kg) was given perorally, in drinking water (12 ml/rat/day) or intraperitoneally (once daily, first application 30 min following surgery, last 24 h before sacrifice). Postoperatively, features of increasingly exhausted presentation were: weight loss appearing immediately regardless of villus height, twofold increase in crypt depth and fourfold increase in muscle thickness within the first week, jejunal and ileal overdilation, and disturbed jejunum/ileum relation. In contrast, constant weight gain above preoperative values was observed immediately with BPC 157 therapy, both perorally and parenterally, and villus height, crypt depth, and muscle thickness [inner (circular) muscular layer] also increased, at 7, 14, 21, and 28 days. Moreover, rats treated with pentadecapeptide BPC 157 showed not different jejunal and ileal diameters, constant jejunum-to-ileum ratio, and increased anastomosis breaking strength. In conclusion, pentadecapeptide BPC 157 could be helpful to cure short bowel syndrome.

  15. Synthesis and characterization of barium titanate, doped with europium and neodymium; Sintese e caracterizacao de titanato de bario, dopados com europio e neodimio

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: nanda_louise@yahoo.com.br [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica

    2013-07-01

    This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.

  16. Stability constants of the Europium complexes with the chloride ions; Constantes de estabilidad de los complejos del europio con los iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  17. LA-ICP-MS Allows Quantitative Microscopy of Europium-Doped Iron Oxide Nanoparticles and is a Possible Alternative to Ambiguous Prussian Blue Iron Staining.

    Science.gov (United States)

    Scharlach, Constantin; Müller, Larissa; Wagner, Susanne; Kobayashi, Yuske; Kratz, Harald; Ebert, Monika; Jakubowski, Norbert; Schellenberger, Eyk

    2016-05-01

    The development of iron oxide nanoparticles for biomedical applications requires accurate histological evaluation. Prussian blue iron staining is widely used but may be unspecific when tissues contain substantial endogenous iron. Here we tested whether microscopy by laser ablation coupled to inductively coupled plasma mass spectrometry (LA-ICP-MS) is sensitive enough to analyze accumulation of very small iron oxide particles (VSOP) doped with europium in tissue sections. For synthesis of VSOP, a fraction of Fe3+ (5 wt%) was replaced by Eu3+, resulting in particles with 0.66 mol% europium relative to iron (Eu-VSOP) but with otherwise similar properties as VSOP. Eu-VSOP or VSOP was intravenously injected into ApoE-/- mice on Western cholesterol diet and accumulated in atherosclerotic plaques of these animals. Prussian blue staining was positive for ApoE-/- mice with particle injection but also for controls. LA-ICP-MS microscopy resulted in sensitive and specific detection of the europium of Eu-VSOP in liver and atherosclerotic plaques. Furthermore, calibration with Eu-VSOP allowed calculation of iron and particle concentrations in tissue sections. The combination of europium-doped iron oxide particles and LA-ICP-MS microscopy provides a new tool for specific and quantitative analysis of particle distribution at the tissue level and allows correlation with other elements such as endogenous iron.

  18. Novel Time-Resolved Fluorescence Europium Nanoparticle Immunoassay for Detection of Human Immunodeficiency Virus-1 Group O Viruses Using Microplate and Microchip Platforms.

    Science.gov (United States)

    Haleyur Giri Setty, Mohan Kumar; Liu, Jikun; Mahtani, Prerna; Zhang, Panhe; Du, Bingchen; Ragupathy, Viswanath; Devadas, Krishnakumar; Hewlett, Indira K

    2016-06-01

    Accurate detection and quantification of HIV-1 group O viruses have been challenging for currently available HIV assays. We have developed a novel time-resolved fluorescence (TRF) europium nanoparticle immunoassay for HIV-1 group O detection using a conventional microplate enzyme-linked immunosorbent assay (ELISA) and a microchip platform. We screened several antibodies for optimal reactivity with several HIV-1 group O strains and identified antibodies that can detect all the strains of HIV-1 group O that were available for testing. The antibodies were used to develop a conventional ELISA format assay and an in-house developed europium nanoparticle-based assay for sensitivity. The method was evaluated on both microwell plate and microchip platforms. We identified two specific and sensitive antibodies among the six we screened. The antibodies, C65691 and ANT-152, were able to quantify 15 and detect all 17 group O viruses, respectively, as they were broadly cross-reactive with all HIV-1 group O strains and yielded better signals compared with other antibodies. We have developed a sensitive assay that reflects the actual viral load in group O samples by using an appropriate combination of p24 antibodies that enhance group O detection and a highly sensitive TRF-based europium nanoparticle for detection. The combination of ANT-152 and C65690M in the ratio 3:1 was able to give significantly higher signals in our europium-based assay compared with using any single antibody.

  19. Lanthanide-to-lanthanide energy-transfer processes operating in discrete polynuclear complexes: can trivalent europium be used as a local structural probe?

    Science.gov (United States)

    Zaïm, Amir; Eliseeva, Svetlana V; Guénée, Laure; Nozary, Homayoun; Petoud, Stéphane; Piguet, Claude

    2014-09-15

    This work, based on the synthesis and analysis of chemical compounds, describes a kinetic approach for identifying intramolecular intermetallic energy-transfer processes operating in discrete polynuclear lanthanide complexes, with a special emphasis on europium-containing entities. When all coordination sites are identical in a (supra)molecular complex, only heterometallic communications are experimentally accessible and a Tb → Eu energy transfer could be evidenced in [TbEu(L5)(hfac)6] (hfac = hexafluoroacetylacetonate), in which the intermetallic separation amounts to 12.6 Å. In the presence of different coordination sites, as found in the trinuclear complex [Eu3(L2)(hfac)9], homometallic communication can be induced by selective laser excitation and monitored with the help of high-resolution emission spectroscopy. The narrow and non-degenerated character of the Eu((5)D0 ↔ (7)F0) transition excludes significant spectral overlap between donor and acceptor europium cations. Intramolecular energy-transfer processes in discrete polynuclear europium complexes are therefore limited to short distances, in agreement with the Fermi golden rule and with the kinetic data collected for [Eu3(L2)(hfac)9] in the solid state and in solution. Consequently, trivalent europium can be considered as a valuable local structural probe in discrete polynuclear complexes displaying intermetallic separation in the sub-nanometric domain, a useful property for probing lanthanido-polymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide coordinated to europium(III) ions as reliable circularly polarized luminescence calibration standards†

    Science.gov (United States)

    Bonsall, Steven D.; Houcheime, Mona; Straus, Daniel A.; Muller, Gilles

    2009-01-01

    The synthesis of two optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide and the constant circularly polarized luminescence (CPL) activity of their acetonitrile trivalent europium complex solutions over a long period of time open new perspectives for performing accurate routine CPL calibration tests at low cost. PMID:17728891

  1. Photoluminescence behavior of europium (III) complexes containing 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione ligand.

    Science.gov (United States)

    Wang, Dunjia; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Zheng, Jing

    2014-01-03

    Three novel europium complexes with 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione (TNPD) and 2,2-dipyridine (Bipy) or 1,10-phenan-throline (Phen) were synthesized and confirmed by FT-IR, (1)H NMR, UV-vis absorption and elemental analysis. Photoluminescence behavior of complexes Eu(TNPD)3, Eu(TNPD)3·Bipy and Eu(TNPD)3·Phen were investigated in detail. Their emission spectra exhibited the characteristic emission bands that arise from the (5)D0→(7)FJ (J=0-4) transitions of the europium ion in solid state. Meanwhile, the results of their lifetime decay curves indicated that only one chemical environment existed around the europium ion. The intrinsic luminescence quantum efficiency (η) and the experimental intensity parameters (Ωt) of europium complexes were determined according to the emission spectra and luminescence decay curves in solid state. The complex Eu(TNPD)3·Phen showed much longer lifetime (τ) and higher luminescence quantum efficiency (η) than complexes Eu(TNPD)3 and Eu(TNPD)3·Bipy. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.

    2007-01-01

    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  3. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes.

    Science.gov (United States)

    Souza, E R; Mazali, I O; Sigoli, F A

    2014-01-01

    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  4. Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles

    Science.gov (United States)

    Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.

    2018-03-01

    The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

  5. A microwave-assisted solution combustion synthesis to produce europium-doped calcium phosphate nanowhiskers for bioimaging applications.

    Science.gov (United States)

    Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B

    2013-09-01

    Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  6. Europium nanoparticle-based simple to perform dry-reagent immunoassay for the detection of hepatitis B surface antigen.

    Science.gov (United States)

    Talha, Sheikh M; Salminen, Teppo; Juntunen, Etvi; Spangar, Anni; Gurramkonda, Chandrasekhar; Vuorinen, Tytti; Khanna, Navin; Pettersson, Kim

    2016-03-01

    Hepatitis B infection, caused by hepatitis B virus (HBV), presents a huge global health burden. Serological diagnosis of HBV mainly relies on the detection of hepatitis B surface antigen (HBsAg). Although there are high sensitivity commercial HBsAg enzyme immunoassays (EIAs) available, many low-resource laboratories lacking trained technicians continue to use rapid point-of-care assays with low sensitivities for HBsAg detection, due to their simplicity to operate. We developed a time-resolved fluorometric dry-reagent HBsAg immunoassay which meets the detection limit of high sensitivity EIAs but is simple to operate. To develop the assay, anti-HBsAg monoclonal antibody coated on europium nanoparticles was dried atop of biotinylated anti-HBsAg polyclonal antibody immobilized on streptavidin-coated microtiter wells. To test a sample in dry-reagent assay, serum sample and assay buffer were added to the wells, incubated, washed and europium signals were measured. The assay showed a detection limit of 0.25 ng/ml using HBsAg spiked in serum sample. When evaluated with 24 HBV positive and 37 negative serum samples, assay showed 100% sensitivity and specificity. Assay wells are stable for at least 26 weeks when stored at 4°C, and can tolerate elevated temperatures of up to 35°C for two weeks. The developed assay has high potential to be used in low-resource laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Bright mono-aqua europium complexes based on triazacyclononane that bind anions reversibly and permeate cells efficiently.

    Science.gov (United States)

    Butler, Stephen J; McMahon, Brian K; Pal, Robert; Parker, David; Walton, James W

    2013-07-15

    A series of five europium(III) complexes has been prepared from heptadentate N5O2 ligands that possess a brightness of more than 10 mM(-1) cm(-1) in water, following excitation over the range λ=330-355 nm. Binding of several oxy anions has been assessed by emission spectral titrimetric analysis, with the binding of simple carboxylates, lactate and citrate involving a common ligation mode following displacement of the coordinated water. Selectivity for bicarbonate allows the rapid determination of this anion in human serum, with K(d)=37 mM (295 K). The complexes are internalised quickly into mammalian cells and exhibit a mitochondrial localisation at early time points, migrating after a few hours to reveal a predominant lysosomal distribution. Herein, we report the synthesis and complexation behaviour of strongly emissive europium (III) complexes that bind oxy-anions in aqueous media with an affinity and selectivity profile that is distinctively different from previously studied systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands.

    Science.gov (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario

    2015-09-21

    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  9. Highly Sensitive Luminescence Assessment of Bile Acid Using a Balofloxacin-Europium(III) Probe in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong [Shihezi Univ., Shihezi (China)

    2012-12-15

    A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10{sup -9} - 7.0 Χ 10{sup -7} mol L{sup -1} with a detection limit of 1.3 Χ 10{sup -9} mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10{sup -8} mol L{sup -1} bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly.

  10. Investigation of the influence of silver and tin on the luminescence of trivalent europium ions in glass

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.A. [Department of Chemistry, University of Puerto Rico, Mayagueez, PR 00681 (United States); Lysenko, S. [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Liu, H., E-mail: hliu@uprm.ed [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Fachini, E.; Cabrera, C.R. [Center for Nanoscale Materials, University of Puerto Rico, Rio Piedras, PR 00931 (Puerto Rico)

    2010-01-15

    Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu{sup 3+} ions luminescence have been assessed. For the glass system containing only europium, Eu{sup 3+} PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu{sup 3+} PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag{sup +} ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu{sup 3+} PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu{sup 3+}->Eu{sup 2+} reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu{sup 3+} PL.

  11. Extensive genomic diversity and selective conservation of virulence-determinants in enterohemorrhagic Escherichia coli strains of O157 and non-O157 serotypes

    OpenAIRE

    Ogura, Yoshitoshi; Ooka, Tadasuke; Asadulghani,; Terajima, Jun; Nougayr?de, Jean-Philippe; Kurokawa, Ken; Tashiro, Kousuke; Tobe, Toru; Nakayama, Keisuke; Kuhara, Satoru; Oswald, Eric; Watanabe, Haruo; Hayashi, Tetsuya

    2007-01-01

    Background: Enterohemorrhagic Escherichia coli (EHEC) O157 causes severe food-borne illness in humans. The chromosome of O157 consists of 4.1 Mb backbone sequences shared by benign E. coli K-12, and 1.4 Mb O157-specific sequences encoding many virulence determinants, such as Shiga toxin genes (stx genes) and the locus of enterocyte effacement (LEE). Non-O157 EHECs belonging to distinct clonal lineages from O157 also cause similar illness in humans. According to the "parallel" evolution model,...

  12. Behaviour of europium (III) and its hydroxo and carbonate complexes in a solvent extraction system with HDBM in 2 M NaCl at 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico); Solache-Rios, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Rojas-Hernandez, A. [Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico)

    1999-07-01

    The behaviour of europium in the solvent extraction system Eu{sup 3+}-water-2 M NaCl-HDBM-benzene was studied, taking into account the pC{sub H} and the carbonate ion concentration in the solutions. The stability constants for the hydrolysis and carbonate complexes of europium were determined at 303 K in the same medium by pH titration followed by a computational refinement. The obtained data were: log {beta}{sub Eu,H} = -8.29 {+-} 0.02, log {beta}{sub Eu,2H} = -16.37 {+-} 0.02, log {beta}{sub Eu,3H} = -24.54 {+-} 0.11, log {beta}{sub Eu,4H} = -34.91 {+-} 0.26, log {beta}{sub CO{sub 2}{sup 2-},H} = 9.30 {+-} 0.05, log {beta}{sub Eu,CO{sub 3}{sup 2-}} = 5.96 {+-} 0.03, log {beta}{sub Eu,CO{sub 3}{sup 2-},H} = -1.24 {+-} 0.05 and log {beta}{sub Eu,CO{sub 3}{sup 2-},2H} = -11.39 {+-} 0.11. Log K{sub W} was -13.78 {+-} 0.06. The behaviour of europium in this solvent extraction system was simulated, taking into account the hydrolysis and carbonate complexes plus the formation of Eu(DBM){sub 3}(OH){sup 1-} and Eu(DBM){sub 3}(CO{sub 3}){sup 2-} in the aqueous phase. The only europium species considered in the organic phase was Eu(DBM){sub 3}. The first hydrolysis constant of europium was also determined by using this solvent extraction system under the same conditions. A good conformity was found with the results obtained by both techniques. (orig.)

  13. Bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex a new apoptotic agent through Flk-1 down regulation, caspase-3 activation and oligonucleosomes DNA fragmentation.

    Science.gov (United States)

    Azab, Hassan A; Hussein, Belal H M; El-Azab, Mona F; Gomaa, Mohamed; El-Falouji, Abdullah I

    2013-01-01

    New bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex was synthesized and characterized. In vivo anti-angiogenic activities of bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex against Ehrlich ascites carcinoma (EAC) cells are described. The newly synthesized complex resulted in inhibition of proliferation of EAC cells and ascites formation. The anti-tumor effect was found to be through anti-angiogenic activity as evident by the reduction of microvessel density in EAC solid tumors. The anti-angiogenic effect is mediated through down-regulation of VEGF receptor type-2 (Flk-1). The complex was also found to significantly increase the level of caspase-3 in laboratory animals compared to the acridine ligand and to the control group. This was also consistent with the DNA fragmentation detected by capillary electrophoresis that proved the apoptotic effect of the new complex. Our complex exhibited anti-angiogenic and apoptotic activity in vivo, a thing that makes it a potential effective chemotherapeutic agent. The interaction of calf thymus DNA (ct-DNA) with bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex has been investigated using fluorescence technique. A competitive experiment of the europium(III)-acridine complex with ethidium bromide (EB) to bind DNA revealed that interaction between the europium(III)-acridine and DNA was via intercalation. The interaction of the synthesized complex with tyrosine kinases was also studied using molecular docking simulation to further substantiate its mode of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Experimental Escherichia coli O157:H7 carriage in calves.

    OpenAIRE

    Brown, C A; Harmon, B G; Zhao, T; Doyle, M P

    1997-01-01

    Nine weaned calves (6 to 8 weeks of age) were given 10(10) CFU of a five-strain mixture of enterohemorrhagic Escherichia coli O157:H7 by oral-gastric intubation. After an initial brief period of pyrexia in three calves and transient mild diarrhea in five calves, calves were clinically normal throughout the 13- to 27-day study. The population of E. coli O157:H7 in the faces decreased dramatically in all calves during the first 2 weeks after inoculation. Thereafter, small populations of E. coli...

  15. Using Candida oleophila as a biocontriol agens to prevent foodborne Escherichia coli O157 EHEC infections

    OpenAIRE

    Wang, Yujian; Wei, An; Li, Hongyu

    2012-01-01

    Escherichia coli O157:H7 (EHEC O157) is a serious pathogen causing haemorrhagic colitis. In this study, inactivation kinetics of inoculated EHEC O157 and response of EHEC O157 in apple wounds by different concentrations of C. oleophila was investigated. The results presented in this study indicated that EHEC O157 could survive and grow in wounded ?Fuji? apples and extensively proliferate. Water as a decontaminant was ineffective in reducing EHEC O157 in wounded apples. C. oleophila could be a...

  16. Europium(III) reduction and speciation within a Wells-Dawson heteropolytungstate.

    Science.gov (United States)

    Jing, Jing; Burton-Pye, Benjamin P; Francesconi, Lynn C; Antonio, Mark R

    2008-08-04

    The redox speciation of Eu(III) in the 1:1 stoichiometric complex with the alpha-1 isomer of the Wells-Dawson anion, [alpha-1-P 2W 17O 61] (10-), was studied by electrochemical techniques (cyclic voltammetry and bulk electrolysis), in situ XAFS (X-ray absorption fine structure) spectroelectrochemistry, NMR spectroscopy ( (31)P), and optical luminescence. Solutions of K 7[(H 2O) 4Eu(alpha-1-P 2W 17O 61)] in a 0.2 M Li 2SO 4 aqueous electrolyte (pH 3.0) show a pronounced concentration dependence to the voltammetric response. The fully oxidized anion and its reduced forms were probed by Eu L 3-edge XANES (X-ray absorption near edge structure) measurements in simultaneous combination with controlled potential electrolysis, demonstrating that Eu(III) in the original complex is reduced to Eu(II) in conjunction with the reduction of polyoxometalate (POM) ligand. After exhaustive reduction, the heteropoly blue species with Eu(II) is unstable with respect to cluster isomerization, fragmentation, and recombination to form three other Eu-POMs as well as the parent Wells-Dawson anion, alpha-[P 2W 18O 62] (6-). EXAFS data obtained for the reduced, metastable Eu(II)-POM before the onset of Eu(II) autoxidation provides an average Eu-O bond length of 2.55(4) A, which is 0.17 A longer than that for the oxidized anion, and consistent with the 0.184 A difference between the Eu(II) and Eu(III) ionic radii. The reduction of Eu(III) is unusual among POM complexes with Lindqvist and alpha-2 isomers of Wells-Dawson anions, that is, [Eu(W 5O 18) 2] (9-) and [Eu(alpha-2-As 2W 17O 61) 2] (17-), but not to the Preyssler complex anion, [EuP 5W 30O 110] (12-), and fundamental studies of materials based on coupling Eu and POM redox properties are still needed to address new avenues of research in europium hydrometallurgy, separations, and catalysis sciences.

  17. Structural, optical and electrical properties of europium picrate tetraethylene glycol complex as emissive material for OLED

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: ekusrini@che.ui.ac.id [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I.; Adnan, Rohana [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Sha Shiong, Ng; Fun, H.K. [School of Physics, Universiti Sains Malaysia, 11800 Penang (Malaysia); Adhha Abdullah, M.A.; Mamat, Mazidah [Department of Chemical Sciences, Faculty of Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu Darul Iman (Malaysia); Za' aba, N.K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)

    2012-01-15

    A new europium complex [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O was synthesized and used as the emission material for the single layer device structure of ITO/EO4-Eu-Pic/Al, using a spin-coating technique. Study on the optical properties of the [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O complex where EO4=tetraethylene glycol and Pic=picrate anion, had to be undertaken before being applicable to the study of an organic light emitting diode (OLED). The electrical property of an OLED using current-voltage (I-V) measurement was also studied. In complex, the Eu(III) ion was coordinated with the EO4 ligand as a pentadentate mode, one water molecule, and with two Pic anions as bidentate and monodentate modes, forming a nine-coordination number. The photoluminescence (PL) spectra of the crystalline complex in the solid state and its thin film showed a hypersensitive peak at 613.5-614.9 nm that assigned to the {sup 5}D{sub 0}{yields}{sup 7}F{sub 2} transition. A narrow band emission from the thin film EO4-Eu-Pic was obtained. The typical semiconductor I-V curve of device ITO/EO4-Eu-Pic/Al showed the threshold and turn on voltages at 1.08 and 4.6 V, respectively. The energy transfer process from the ligand to the Eu(III) ion was discussed by investigating the excitation and PL characteristics. Effect of the picrate anion on the device performance was also studied. - Highlights: > The [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75(H{sub 2}O) is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in single layer device structure of ITO/EO4-Eu-Pic/Al. > The complex displays a red luminescence in both the crystalline complex and its thin film state. > The low turn on voltage of the device (4.6 V), indicating that this material is suitable for OLED. > The roughness and morphology of the thin film affects luminance and electrical properties of OLED.

  18. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli

    OpenAIRE

    Ogura, Yoshitoshi; Ooka, Tadasuke; Iguchi, Atsushi; Toh, Hidehiro; Asadulghani, Md; Oshima, Kenshiro; Kodama, Toshio; Abe, Hiroyuki; Nakayama, Keisuke; Kurokawa, Ken; Tobe, Toru; Hattori, Masahira; Hayashi, Tetsuya

    2009-01-01

    Among the various pathogenic Escherichia coli strains, enterohemorrhagic E. coli (EHEC) is the most devastating. Although serotype O157:H7 strains are the most prevalent, strains of different serotypes also possess similar pathogenic potential. Here, we present the results of a genomic comparison between EHECs of serotype O157, O26, O111, and O103, as well as 21 other, fully sequenced E. coli/Shigella strains. All EHECs have much larger genomes (5.5–5.9 Mb) than the other strains and contain ...

  19. Phenotype abnormality: 157 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 157 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u663i decreased efficiency... in organ named root hair cell during process named growth ... root hair cell ... decreased efficiency ... growth ...

  20. Prevalence and antibiogram of Escherichia coli O157 isolated from ...

    African Journals Online (AJOL)

    Safty and immunogenic- ity of Escherichia coli O157 O-specific polysacaride conjugate. Christopher, A., Mshana, S. E, Kidenya, B. R, Hokororo, A. and Morona, D. 2013. Bac- teremia and resistant gram-negative pathogens among under-fives in Tanzania. Ital. J. Pediatr., 39, 27-34. Carney, E., O'Brien, S. B., Sheridan, J. J., ...

  1. 29 CFR 780.157 - Other transportation incident to farming.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Other transportation incident to farming. 780.157 Section... transportation incident to farming. (a) Transportation by a farmer or on a farm as an incident to or in conjunction with the farming operations of the farmer or of that farm is within the scope of agriculture even...

  2. 33 CFR 157.124 - COW tank washing machines.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false COW tank washing machines. 157....124 COW tank washing machines. (a) COW machines must be permanently mounted in each cargo tank. (b... allowed in paragraph (f) of this section, each cargo tank must have COW machines located to wash all...

  3. 27 CFR 9.157 - San Francisco Bay.

    Science.gov (United States)

    2010-04-01

    ..., San Mateo, Santa Clara, Alameda, and Contra Costa, which border the San Francisco Bay. The area also... proceed along the San Francisco, San Mateo, and Santa Cruz County shoreline (across the Quadrangles of San... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false San Francisco Bay. 9.157...

  4. 18 CFR 157.218 - Changes in customer name.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Changes in customer... Act for Certain Transactions and Abandonment § 157.218 Changes in customer name. (a) Automatic... reflect the change in the name of an existing customer, if the certificate holder has filed any necessary...

  5. Enterohaemorrhagic Escherichia coli O157: a current threat ...

    African Journals Online (AJOL)

    Enterohaemorrhagic. Escherichia coli O157: a survey of dairy cattle in. Tripoli, Libya' (1). The Libyan data presented by Ghen- ghesh et al. in the 1990s were based on the analysis of stool specimens from pediatric patients aged between only a ...

  6. 33 CFR 157.23 - Cargo and ballast system information.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Design, Equipment, and Installation § 157.23 Cargo and ballast system information. (a... automatic and manual operation of the cargo and ballast system in the vessel. (b) The format and information... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo and ballast system...

  7. BPC 157: The counteraction of succinylcholine, hyperkalemia, and arrhythmias.

    Science.gov (United States)

    Stambolija, Vasilije; Stambolija, Tamara Perleta; Holjevac, Jadranka Katancic; Murselovic, Tamara; Radonic, Jelena; Duzel, Viktor; Duplancic, Bozidar; Uzun, Sandra; Zivanovic-Posilovic, Gordana; Kolenc, Danijela; Drmic, Domagoj; Romic, Zeljko; Seiwerth, Sven; Sikiric, Predrag

    2016-06-15

    After the demonstration of its life-saving effect in severe hyperkalemia and the recovery of skeletal muscle after injury, pentadecapeptide BPC 157 has been shown to attenuate the local paralytic effect induced by succinylcholine, in addition to systemic muscle disability (and consequent muscle damage). Hyperkalemia, arrhythmias and a rise in serum enzyme values, were counteracted in rats. Assessments were made at 3 and 30min and 1, 3, 5, and 7 days after succinylcholine administration (1.0mg/kg into the right anterior tibial muscle). BPC 157 (10µg/kg, 10ng/kg) (given intraperitoneally 30min before or immediately after succinylcholine or per-orally in drinking water through 24h until succinylcholine administration) mitigated both local and systemic disturbances. BPC 157 completely eliminated hyperkalemia and arrhythmias, markedly attenuated or erradicated behavioral agitation, muscle twitches, motionless resting and completely eliminated post-succinylcholine hyperalgesia. BPC 157 immediately eliminated leg contractures and counteracted both edema and the decrease in muscle fibers in the diaphragm and injected/non-injected anterior tibial muscles. Therefore, the depolarizing neuromuscular blocker effects of succinylcholine were successfully antagonized. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. 38 CFR 17.157 - Definition-adaptive equipment.

    Science.gov (United States)

    2010-07-01

    ... MEDICAL Automotive Equipment and Driver Training § 17.157 Definition-adaptive equipment. The term... Health or designee as ordinarily necessary for any of the classes of losses or combination of such losses..., and special equipment necessary to assist the eligible person into or out of the automobile or other...

  9. 40 CFR 205.157-3 - Configuration identification.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Configuration identification. 205.157... identification. (a) A separate vehicle configuration shall be determined by each combination of the following parameters: (1) Exhaust system (engine): (i) Mufflers; (ii) expansion chambers; (iii) spark arrestors; and...

  10. Enterohaemorrhagic Escherichia coli O157: a survey of dairy cattle ...

    African Journals Online (AJOL)

    The zoonotic potential of enterohaemorrhagic. Escherichia coli (EHEC) subtype O157 represents a serious food-borne threat to human health. (1Б3). A common animal vector of this pathogen is cattle, and human cases of infection are frequently caused by ingesting food products contaminated with bacteria shed in the ...

  11. Gastric pentadecapeptide BPC 157 effective against serotonin syndrome in rats.

    Science.gov (United States)

    Boban Blagaic, Alenka; Blagaic, Vladimir; Mirt, Mirela; Jelovac, Nikola; Dodig, Goran; Rucman, Rudolf; Petek, Marijan; Turkovic, Branko; Anic, Tomislav; Dubovecak, Miroslav; Staresinic, Mario; Seiwerth, Sven; Sikiric, Predrag

    2005-04-11

    Serotonin syndrome commonly follows irreversible monoamine oxidase (MAO)-inhibition and subsequent serotonin (5-HT) substrate (in rats with fore paw treading, hind limbs abduction, wet dog shake, hypothermia followed by hyperthermia). A stable gastric pentadecapeptide BPC 157 with very safe profile (inflammatory bowel disease clinical phase II, PL-10, PLD-116, PL-14736, Pliva) reduced the duration of immobility to a greater extent than imipramine, and, given peripherally, has region specific influence on brain 5-HT synthesis (alpha-[14C]methyl-L-tryptophan autoradiographic measurements) in rats, different from any other serotonergic drug. Thereby, we investigate this peptide (10 microg, 10 ng, 10 pg/kg i.p.) in (i) full serotonin syndrome in rat combining pargyline (irreversible MAO-inhibition; 75 mg/kg i.p.) and subsequent L-tryptophan (5-HT precursor; 100 mg/kg i.p.; BPC 157 as a co-treatment), or (ii, iii) using pargyline or L-tryptophan given separately, as a serotonin-substrate with (ii) pargyline (BPC 157 as a 15-min posttreatment) or as a potential serotonin syndrome inductor with (iii) L-tryptophan (BPC 157 as a 15 min-pretreatment). In all experiments, gastric pentadecapeptide BPC 157 contrasts with serotonin-syndrome either (i) presentation (i.e., particularly counteracted) or (ii) initiation (i.e., neither a serotonin substrate (counteraction of pargyline), nor an inductor for serotonin syndrome (no influence on L-tryptophan challenge)). Indicatively, severe serotonin syndrome in pargyline + L-tryptophan rats is considerably inhibited even by lower pentadecapeptide BPC 157 doses regimens (particularly disturbances such as hyperthermia and wet dog shake thought to be related to stimulation of 5-HT2A receptors), while the highest pentadecapeptide dose counteracts mild disturbances present in pargyline rats (mild hypothermia, feeble hind limbs abduction). Thereby, in severe serotonin syndrome, gastric pentadecapeptide BPC 157 (alone, no behavioral or

  12. Stable gastric pentadecapeptide BPC 157-NO-system relation.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Aralica, Gorana; Stupnisek, Mirjana; Suran, Jelena; Barisic, Ivan; Dzidic, Senka; Vrcic, Hrvoje; Sebecic, Bozidar

    2014-01-01

    We reviewed stable gastric pentadecapeptide BPC 157-NO-system-relation, its close participation in Moncada's (maintained vascular integrity, platelets control) homeostatic healing response of NO-system to injury. Namely, BPC 157's particular healing effect also affects all events after vascular integrity loss (dependent on circumstances, it reduces either thrombosis (abdominal aorta anastomosis) or bleeding/thrombocytopenia (amputation, heparin, warfarin, aspirin)) and in a series of different injurious models, acute and chronic, BPC 157 consistently advances healing after severe injuries in various tissues spontaneously unable to heal; stimulates egr-1 and naB2 genes; exhibits high safety (LD1 not achieved)). Hypothesis, that BPC 157 (since formed constitutively in the gastric mucosa, stable in human gastric juice, along with significance of NO-synthase and the basal formation of NO in stomach mucosa, greater than that seen in other tissues) exhibits a general, effective competing both with L-arginine analogues (i. e., L-NAME) and L-arginine, and that this has some physiologic importance (NO-generation), later, practically supports its beneficial effects illustrating BPC 157 and NOsystem mutual (with L-NAME/L-arginine; alone and together) relations in (i) gastric mucosa and mucosal protection, following alcohol lesions, in cytoprotection course, NO-generation, and blood pressure regulation; (ii) alcohol acute/chronic intoxication, and withdrawal; (iii) cardiovascular disturbances, chronic heart failure, pulmonary hypertension, and arrhythmias; (iv) disturbances after hypokalemia and hyperkalemia, and potassium-cell membrane dysfunction; and finally, in (v) complex healing failure, proved by the fistulas healing, colocutaneous and esophagocutaneous. However, how this advantage of modulating NO-system (i. e., particular effect on eNOS gene), may be practically translated into an enhanced clinical performance remains to be determined.

  13. Stable gastric pentadecapeptide BPC 157 heals rat colovesical fistula.

    Science.gov (United States)

    Grgic, Tihomir; Grgic, Dora; Drmic, Domagoj; Sever, Anita Zenko; Petrovic, Igor; Sucic, Mario; Kokot, Antonio; Klicek, Robert; Sever, Marko; Seiwerth, Sven; Sikiric, Predrag

    2016-06-05

    To establish the effects of BPC 157 on the healing of rat colovesical fistulas, Wistar Albino male rats were randomly assigned to different groups. BPC 157, a stable gastric pentadecapeptide, has been used in clinical applications-specifically, in ulcerative colitis-and was successful in treating both external and internal fistulas. BPC 157 was provided daily, perorally, in drinking water (10µg/kg, 12ml/rat/day) until sacrifice or, alternatively, 10µg/kg or 10ng/kg intraperitoneally, with the first application at 30min after surgery and the last at 24h before sacrifice. Controls simultaneously received an equivolume of saline (5.0ml/kg ip) or water only (12ml/rat/day). Assessment (i.e., colon and vesical defects, fistula leaking, fecaluria and defecation through the fistula, adhesions and intestinal obstruction as healing processes) took place on days 7, 14 and 28. Control colovesical fistulas regularly exhibited poor healing, with both of the defects persisting; continuous fistula leakage; fecaluria and defecation through the fistula; advanced adhesion formation; and intestinal obstruction. By contrast, BPC 157 given perorally or intraperitoneally and in µg- and ng-regimens rapidly improved the whole presentation, with both colon and vesical defects simultaneously ameliorated and eventually healed. The maximal instilled volume was continuously raised until it reached the values of healthy rats, there were no signs of fecaluria and no defecation through the fistula, there was counteraction of advanced adhesion formation or there was an intestinal obstruction. In conclusion, BPC 157 effects appear to be suited to inducing full healing of colocutaneous fistulas in rats. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Comparison of Enterohemorrhagic Escherichia coli (EHEC) O157 and EHEC Non-O157 Isolates from Patients with Diarrhea in Korea.

    Science.gov (United States)

    Oh, Kyung-Hwan; Jung, Su-Mi; Shin, Eunkyung; Chung, Gyung Tae; Seong, Won-Keun; Cho, Seung-Hak

    2017-05-24

    We compared 47 enterohemorrhagic Escherichia coli (EHEC) O157 isolates with 184 EHEC non-O157 isolates from Korean patients with diarrhea. In the O157 group, the strains harboring both Shiga toxin genes (stx1 and stx2) were detected with highest frequency, whereas the strains harboring only stx1 gene were most frequently detected in the non-O157 group. Eight virulence genes (eaeA, hlyA, ehx, iha, efa1, tir, toxB, and espA) were found to show a higher frequency of occurrence in the O157 group than in the non-O157 group. In addition, the symptom of bloody diarrhea was exhibited at a higher rate in the O157 group (51.1%) than in the non-O157 group (16.8%). Our findings demonstrate that EHEC O157 strains are more frequently implicated in cases of bloody diarrhea in the Korean population than EHEC non-O157 strains.

  15. Colonization of the meat extracellular matrix proteins by O157 and non-O157 enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Chagnot, Caroline; Caccia, Nelly; Loukiadis, Estelle; Ganet, Sarah; Durand, Alexandra; Bertin, Yolande; Talon, Régine; Astruc, Thierry; Desvaux, Mickaël

    2014-10-01

    Enterohemorrhagic Escherichia coli (EHEC) are anthropozoonotic agents that range third among food-borne pathogens respective to their incidence and dangerousness in the European Union. EHEC are Shiga-toxin producing E. coli (STEC) responsible for foodborne poisoning mainly incriminated to the consumption of contaminated beef meat. Among the hundreds of STEC serotypes identified, EHEC mainly belong to O157:H7 but non-O157 can represent 20 to 70% of EHEC infections per year. Seven of those serogroups are especially of high-risk for human health, i.e. O26, O45, O103, O111, O121, O145 and O104. While meat can be contaminated all along the food processing chain, EHEC contamination essentially occurs at the dehiding stage of slaughtering. Investigating bacterial colonization to the skeletal-muscle extracellular matrix (ECM) proteins, it appeared that environmental factors influenced specific and non-specific bacterial adhesion of O157 and non-O157 EHEC as well as biofilm formation. Importantly, mechanical treatment (i.e. shaking, centrifugation, pipetting and vortexing) inhibited and biased the results of bacterial adhesion assay. Besides stressing the importance of the protocol to investigate bacterial adhesion to ECM proteins, this study demonstrated that the colonization abilities to ECM proteins vary among EHEC serogroups and should ultimately be taken into consideration to evaluate the risk of contamination for different types of food matrices. Copyright © 2014. Published by Elsevier B.V.

  16. Synthesis of Luminescent Ink from Europium-Doped Y2O3 Dispersed in Polyvinyl Alcohol Solution

    Directory of Open Access Journals (Sweden)

    Astuti

    2009-01-01

    Full Text Available Luminescent ink from europium-doped Y2O3 ( Y2O3:Eu has been synthesized by two steps method: first, synthesis of luminescent powder of Y2O3:Eu by simple heating of metallic nitrates in a polymer solution and second, dispersing the powder in a polyvinyl alcohol (PVA solution. The stability of the ink (luminescent colloid was strongly affected by mixing process of the powder and the solution. Mixing process must be performed for a long time (about 8 hours at above room temperature to product stable colloids. We observed that mixing at 30–40∘C resulted in a stable and highly dispersed colloid. The writing test was performed on a white paper to show the potential use of the colloid for making security codes.

  17. Induced europium CPL for the selective signalling of phosphorylated amino-acids and O-phosphorylated hexapeptides.

    Science.gov (United States)

    Neil, Emily R; Fox, Mark A; Pal, Robert; Parker, David

    2016-05-17

    Two bright, europium(iii) complexes based on an achiral heptadentate triazacyclononane ligand bearing two strongly absorbing chromophores have been evaluated for the selective emission and CPL signalling of various chiral O-phosphono-anions. Binding of O-phosphono-Ser and Thr gives rise to a strong induced CPL signature and a favoured Δ complex configuration is adopted. A similarly large induced CPL signal arises when [Eu·](2+) binds to lysophosphatidic acid (LPA), where the strong binding (log K 5.25 (295 K)) in methanol allowed its detection over the range 5 to 40 μM. Strong and chemoselective binding to the phosphorylated amino-acid residues was also observed with a set of four structurally related hexapeptides: in one case, the sign of the gem value in the ΔJ = 1 transition allowed differentiation between the binding to O-P-Ser and O-P-Tyr residues.

  18. A new europium(III)-β-diketonate complex based on diphenylethyne as red phosphors applied in LED

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guang, E-mail: shaog@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Na; Lin, Duan [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Feng, Kenjun [Department of Chemical Engineering, Hui-Zhou University, Huizhou 516007 (China); Cao, Rihui, E-mail: caorihui@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Gong, Menglian [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China)

    2013-06-15

    A new europium(III) ternary complex based on a fluorinated β-diketonate ligand and 1,10-phenanthroline as an ancillary ligand has been prepared and evaluated as a candidate for light-emitting diode (LED). The complex exhibits a high decomposition temperature (316 °C). Photophysical properties such as FT-IR spectra, UV–vis absorption spectra, excitation and emission spectra, luminescence decay curve and quantum yield were investigated. The excitation band is well matched with the characteristic emission of 395 nm-emitting InGaN chips. The complex exhibits an efficient energy transfer pathway from the ligands to the central Eu{sup 3+} ion via a ligand-sensitized luminescence process. An intense red-emitting LED was fabricated by coating the complex onto a 395 nm-emitting InGaN chip, and its Commission International de I'Eclairage (CIE) chromaticity coordinate (x=0.6389, y=0.3255) is close to the National Television Standard Committee (NTSC) standard value for red color. Meanwhile, the energy transfer from the InGaN chip to the complex is very efficient. All the findings demonstrate the potential application of the Eu(III) complex as red-emitting phosphors for UV-based white LEDs. -- Highlights: ► A new europium(III)-β-diketonate complex was synthesized and characterized. ► Thermal stability and photophysical properties were investigated in detail. ► PL mechanism was proposed to involve a ligand-sensitized luminescence process. ► An intense red-emitting LED was fabricated by using the complex. ► CIE chromaticity coordinate is close to NTSC standard value for red color.

  19. Mitochondria Targetable Time-Gated Luminescence Probe for Singlet Oxygen Based on a β-Diketonate-Europium Complex.

    Science.gov (United States)

    Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli

    2015-12-21

    Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.

  20. 75 FR 56987 - Expansion of Foreign-Trade Zone 157, Casper, WY

    Science.gov (United States)

    2010-09-17

    ... Foreign-Trade Zones Board Expansion of Foreign-Trade Zone 157, Casper, WY Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as amended (19 U.S.C. 81a-81u), the Foreign-Trade Zones..., grantee of Foreign-Trade Zone 157, submitted an application to the Board for authority to expand FTZ 157...

  1. 27 CFR 25.157 - Determination of tax on bottled beer.

    Science.gov (United States)

    2010-04-01

    ... bottled beer. 25.157 Section 25.157 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Determination of Tax § 25.157 Determination of tax on bottled beer. The quantities of bottled beer removed subject to tax shall be computed to...

  2. 9 CFR 381.157 - Canned boned poultry and baby or geriatric food.

    Science.gov (United States)

    2010-01-01

    ... geriatric food. 381.157 Section 381.157 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE... Standards of Identity or Composition § 381.157 Canned boned poultry and baby or geriatric food. (a) Canned... with 25 percent broth.” (f) Poultry products intended for infant or geriatric use and represented as...

  3. 26 CFR 157.5891-1 - Imposition of excise tax on structured settlement factoring transactions.

    Science.gov (United States)

    2010-04-01

    ... settlement factoring transactions. 157.5891-1 Section 157.5891-1 Internal Revenue INTERNAL REVENUE SERVICE... SETTLEMENT FACTORING TRANSACTIONS Tax on Structured Settlement Factoring Transactions § 157.5891-1 Imposition of excise tax on structured settlement factoring transactions. (a) In general. Section 5891 imposes...

  4. Excitation energy transfer in europium chelate with doxycycline in the presence of a second ligand in micellar solutions of nonionic surfactants

    Science.gov (United States)

    Smirnova, T. D.; Shtykov, S. N.; Kochubei, V. I.; Khryachkova, E. S.

    2011-01-01

    The complexation of Eu3+ with doxycycline (DC) antibiotic in the presence of several second ligands and surfactant micelles of different types is studied by the spectrophotometric and luminescence methods. It is found that the efficiency of excitation energy transfer in Eu3+-DC chelate depends on the nature of the second ligand and surfactant micelles. Using thenoyltrifluoroacetone (TTA) as an example, it is shown that the second ligand additionally sensitizes the europium fluorescence, and the possibility of intermediate sensitization of DC and then of europium is shown by the example of 1,10-phenanthroline. In all cases, the excitation energy transfer efficiency was increased due to the so-called antenna effect. The decay kinetics of the sensitized fluorescence of the binary and mixed-ligand chelates in aqueous and micellar solutions of nonionic surfactants is studied and the relative quantum yields and lifetimes of fluorescence are determined.

  5. A Smart Europium-Ruthenium Complex as Anticancer Prodrug: Controllable Drug Release and Real-Time Monitoring under Different Light Excitations.

    Science.gov (United States)

    Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung

    2017-11-09

    A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λirr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.

  6. Meeting the challenges of 157-nm microstepper technology

    Science.gov (United States)

    Yamabe, Osamu; Uchida, Noboru; Itani, Toshiro

    2002-07-01

    For the aim of fabricating next-generation semiconductor devices, researchers are now attempting to enhance 157-nm lithography so as to achieve 70-nm node level various circuit designs. Many of the challenges for 157-nm technology such as contamination and purge control, calcium fluoride intrinsic birefringence, finding resists with suitable performance characteristics, have been performed. The major challenge, in terms of stability of tool performance, has been the apparent accumulation of contamination on the bottom of the objective. This has been evidenced by a reduction in resolution performance and an increase in the non-uniformity of the illumination intensity across the image plane. Uniformity over the entire imaging field has increased from 0.58% to as much as 18.5% through the use of the tool. This paper reports our demonstration that loss of uniformity due to contamination from resist outgassing can be reversed by cleaning the bottom surface of the lens of 157-nm microstepper (Ultratech Stepper Inc.) in- situ using 157-nm light and a small concentration of O2 in the N2 purging for exposure area. With an in-situ oxygen (O2) and vacuum ultra violet (VUV) cleaning, the uniformity of over the full imaging field has been improved from 18.5% to 6.0%. The edges of the imaging field do not recover as well during a cleaning as the center of the field, as the central 0.5 mm diameter of the field uniformity has been improved to more or less 2.0%. The procedure of this in-situ O2 cleaning will also be introduced, and in addition to this in-situ O2 cleaning, some recent results in system performance will be shown and many of these challenges will be discussed.

  7. Stable gastric pentadecapeptide BPC 157 heals rectovaginal fistula in rats.

    Science.gov (United States)

    Baric, Marko; Sever, Anita Zenko; Vuletic, Lovorka Batelja; Rasic, Zarko; Sever, Marko; Drmic, Domagoj; Pavelic-Turudic, Tatjana; Sucic, Mario; Vrcic, Hrvoje; Seiwerth, Sven; Sikiric, Predrag

    2016-03-01

    Rectovaginal fistula is a devastating condition providing more than 99% of patients for surgical treatment. We hypothesized that rectovaginal fistula may be healed by therapy with stable gastric pentadecapeptide BPC 157, in consistence with its initial clinical application and effect on external fistulas. BPC 157 (10μg/kg or 10ng/kg) was given perorally, in drinking water (0.16μg/ml or 0.16ng/ml, 12ml/rat/day) till sacrifice, or alternatively, intraperitoneally, first application at 30min after surgery, last at 24h before sacrifice. Controls simultaneously received an equivolume of saline (5.0ml/kg ip) or water only (12ml/rat/day). The assessment (i.e., rectal and vaginal defect, fistula leakage, defecation through the fistula, adhesions and intestinal obstruction as healing processes) was at day 1, 3, 5, 7, 10, 14 and 21. Regularly, rectovaginal fistulas exhibited poor healing, with both of the defects persisting, continuous fistula leakage, defecation through the fistula, advanced adhesion formation and intestinal obstruction. By contrast, BPC 157 given perorally or intraperitoneally, in μg- and ng-regimens rapidly improved the whole presentation, with both rectal and vaginal defects simultaneously ameliorated and eventually healed. The maximal instilled volume was continuously raised till the values of healthy rats were achieved, there were no signs of defecation through the fistula. A counteraction of advanced adhesion formation and intestinal obstruction was achieved. Microscopic improvement was along with macroscopic findings. BPC 157 effects appear to be suited to induce a full healing of rectovaginal fistulas in rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Structural and optical analysis on europium doped AZrO{sub 3} (A=Ba, Ca, Sr) phosphor for display devices application

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, Vikas, E-mail: jsvikasdubey@gmail.com [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)

    2016-05-06

    Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.

  9. Peptide therapy with pentadecapeptide BPC 157 in traumatic nerve injury.

    Science.gov (United States)

    Gjurasin, Miroslav; Miklic, Pavle; Zupancic, Bozidar; Perovic, Darko; Zarkovic, Kamelija; Brcic, Luka; Kolenc, Danijela; Radic, Bozo; Seiwerth, Sven; Sikiric, Predrag

    2010-02-25

    We focused on the healing of rat transected sciatic nerve and improvement made by stable gastric pentadecapeptide BPC 157 (10 microg, 10ng/kg) applied shortly after injury (i) intraperitoneally/intragastrically/locally, at the site of anastomosis, or after (ii) non-anastomozed nerve tubing (7 mm nerve segment resected) directly into the tube. Improvement was shown clinically (autotomy), microscopically/morphometrically and functionally (EMG, one or two months post-injury, walking recovery (sciatic functional index (SFI)) at weekly intervals). BPC 157-rats exhibited faster axonal regeneration: histomorphometrically (improved presentation of neural fascicles, homogeneous regeneration pattern, increased density and size of regenerative fibers, existence of epineural and perineural regeneration, uniform target orientation of regenerative fibers, and higher proportion of neural vs. connective tissue, all fascicles in each nerve showed increased diameter of myelinated fibers, thickness of myelin sheet, number of myelinated fibers per area and myelinated fibers as a percentage of the nerve transected area and the increased blood vessels presentation), electrophysiologically (increased motor action potentials), functionally (improved SFI), the autotomy absent. Thus, BPC 157 markedly improved rat sciatic nerve healing. Copyright 2009 Elsevier B.V. All rights reserved.

  10. Focus on ulcerative colitis: stable gastric pentadecapeptide BPC 157.

    Science.gov (United States)

    Sikiric, P; Seiwerth, S; Rucman, R; Turkovic, B; Rokotov, D S; Brcic, L; Sever, M; Klicek, R; Radic, B; Drmic, D; Ilic, S; Kolenc, D; Stambolija, V; Zoricic, Z; Vrcic, H; Sebecic, B

    2012-01-01

    Stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, M.W. 1419) may be the new drug stable in human gastric juice, effective both in the upper and lower GI tract, and free of side effects. BPC 157, in addition to an antiulcer effect efficient in therapy of inflammatory bowel disease (IBD) (PL 14736) so far only tested in clinical phase II, has a very safe profile, and exhibited a particular wound healing effect. It also has shown to interact with the NO-system, providing endothelium protection and angiogenic effect, even in severely impaired conditions (i.e., it stimulated expression of early growth response 1 gene responsible for cytokine and growth factor generation and early extracellular matrix (collagen) formation (but also its repressor nerve growth factor 1-A binding protein-2)), important to counteract severe complications of advanced and poorly controlled IBD. Hopefully, the lessons from animal studies, particularly advanced intestinal anastomosis healing, reversed short bowel syndrome and fistula healing indicate BPC 157's high significance in further IBD therapy. Also, this supportive evidence (i.e., no toxic effect, limit test negative, LD1 not achieved, no side effect in trials) may counteract the problems commonly exercised in the use of peptidergic agents, particularly those used on a long-term basis.

  11. Metal-organic framework luminescence in the yellow gap by codoping of the homoleptic imidazolate ∞(3)[Ba(Im)2] with divalent europium.

    Science.gov (United States)

    Rybak, Jens-Christoph; Hailmann, Michael; Matthes, Philipp R; Zurawski, Alexander; Nitsch, Jörn; Steffen, Andreas; Heck, Joachim G; Feldmann, Claus; Götzendörfer, Stefan; Meinhardt, Jürgen; Sextl, Gerhard; Kohlmann, Holger; Sedlmaier, Stefan J; Schnick, Wolfgang; Müller-Buschbaum, Klaus

    2013-05-08

    The rare case of a metal-triggered broad-band yellow emitter among inorganic-organic hybrid materials was achieved by in situ codoping of the novel imidazolate metal-organic framework ∞(3)[Ba(Im)2] with divalent europium. The emission maximum of this dense framework is in the center of the yellow gap of primary light-emitting diode phosphors. Up to 20% Eu2+ can be added to replace Ba2+ as connectivity centers without causing observable phase segregation. High-resolution energy-dispersive X-ray spectroscopy showed that incorporation of even 30% Eu2+ is possible on an atomic level, with 2-10% Eu2+ giving the peak quantum efficiency (QE = 0.32). The yellow emission can be triggered by two processes: direct excitation of Eu2+ and an antenna effect of the imidazolate linkers. The emission is fully europium-centered, involving 5d → 4f transitions, and depends on the imidazolate surroundings of the metal ions. The framework can be obtained by a solvent-free in situ approach starting from barium metal, europium metal, and a melt of imidazole in a redox reaction. Better homogeneity for the distribution of the luminescence centers was achieved by utilizing the hydrides BaH2 and EuH2 instead of the metals.

  12. α-Titanium phosphate intercalated with propylamine: An alternative pathway for efficient europium(III uptake into layered tetravalent metal phosphates

    Directory of Open Access Journals (Sweden)

    Jorge García-Glez

    2017-09-01

    Full Text Available α-Ti(HPO42·H2O (α-TiP and its propylamine intercalation product, Ti(HPO42·2C3H7NH2·H2O (α-TiPPr, have been synthesized and characterized. Later, their sorption capacity for europium(III was investigated, and this purpose was accomplished by treating α-TiP and α-TiPPr with europium(III nitrate solutions at different concentrations until the equilibrium is reached. All samples were characterized, among others, by powder X-ray diffraction (PXRD, scanning and transmission electron microscopies (SEM, TEM, STEM-EDX, SAED, thermogravimetric analysis (TGA, and photoluminescence (PL measurements. The results show that the Eu3+ uptake is limited to surface when α-TiP is used as sorbent. Nevertheless, the Eu-retention is considerably enhanced with α-TiPPr as a consequence of an ion-exchange process into the interlayer space of the layered titanium phosphate (involving propylammonium cations, C3H7NH3+, and hexahydrate europium(III species, [Eu(H2O6]3+, and the crystal structure of a hypothetical final product, α-[Eu(H2O6]2/3Ti(PO42·[(H2O6]1/3, has been proposed by using DFT calculations.

  13. Estimating true incidence of O157 and non-O157 Shiga toxin-producing Escherichia coli illness in Germany based on notification data of haemolytic uraemic syndrome

    NARCIS (Netherlands)

    Kuehne, A; Bouwknegt, M; Havelaar, A|info:eu-repo/dai/nl/072306122; Gilsdorf, A; Hoyer, P; Stark, K; Werber, D

    2016-01-01

    Shiga toxin-producing Escherichia coli (STEC) is an important cause of gastroenteritis (GE) and haemolytic uraemic syndrome (HUS). Incidence of STEC illness is largely underestimated in notification data, particularly of serogroups other than O157 ('non-O157'). Using HUS national notification data

  14. Electron tunneling transport across heterojunctions between europium sulfide and indium arsenide

    Science.gov (United States)

    Kallaher, Raymond L.

    This dissertation presents research done on utilizing the ferromagnetic semiconductor europium sulfide (EuS) to inject spin polarized electrons into the non-magnetic semiconductor indium arsenide (InAs). There is great interest in expanding the functionality of modern day electronic circuits by creating devices that depend not only on the flow of charge in the device, but also on the transport of spin through the device. Within this mindset, there is a concerted effort to establish an efficient means of injecting and detecting spin polarized electrons in a two dimensional electron system (2DES) as the first step in developing a spin based field effect transistor. Thus, the research presented in this thesis has focused on the feasibility of using EuS, in direct electrical contact with InAs, as a spin injecting electrode into an InAs 2DES. Doped EuS is a concentrated ferromagnetic semiconductor, whose conduction band undergoes a giant Zeeman splitting when the material becomes ferromagnetic. The concomitant difference in energy between the spin-up and spin-down energy bands makes the itinerant electrons in EuS highly spin polarized. Thus, in principle, EuS is a good candidate to be used as an injector of spin polarized electrons into non-magnetic materials. In addition, the ability to adjust the conductivity of EuS by varying the doping level in the material makes EuS particularly suited for injecting spins into non-magnetic semiconductors and 2DES. For this research, thin films of EuS have been grown via e-beam evaporation of EuS powder. This growth technique produces EuS films that are sulfur deficient; these sulfur vacancies act as intrinsic electron donors and the resulting EuS films behave like heavily doped ferromagnetic semiconductors. The growth parameters and deposition procedures were varied and optimized in order to fabricate films that have minimal crystalline defects. Various properties and characteristics of these EuS films were measured and compared to

  15. Synthesis, Optical Investigation and Biological Properties of Europium(III) Complexes with 2-(4-Chlorophenyl)-1-(2-Hydroxy-4-Methoxyphenyl)Ethan-1-one and Ancillary Ligands.

    Science.gov (United States)

    Nandal, Poonam; Khatkar, S P; Kumar, Rajesh; Khatkar, Avni; Taxak, V B

    2017-01-01

    Synthesis and photoluminescence behaviour of six novel europium complexes with novel β-hydroxyketone ligand, 2-(4-chlorophenyl)-1-(2-hydroxy-4-methoxyphenyl)ethan-1-one (CHME) and 2,2'-bipyridine (bipy) or neocuproine (neo) or 1,10-phenanthroline (phen) or 5,6-dimethyl-1,10-phenanthroline (dmphen) or bathophenanthroline (bathophen) were reported in solid state. The free ligand CHME and europium complexes, Eu(CHME)3.2H2O [1] Eu(CHME)3.bipy [2], Eu(CHME)3.neo [3], Eu(CHME)3.phen [4], Eu(CHME)3.dmphen [5] and Eu(CHME)3.bathophen [6]were characterized by elemental analysis, FT-IR and 1H-NMR. The photoluminescence emission spectra exhibited four characteristic peaks arising from the 5D0 → 7FJ (J = 1-4) transitions of the europium ion in the solid state on monitoring excitation at λex = 395 nm. The luminescence decay curves of these europium complexes possess single exponential behaviour indicating the presence of a single luminescent species and having only one site symmetry in the complexes. The luminescence quantum efficiency (η) and the experimental intensity parameters, Ω 2 and Ω 4 of europium complexes have also been calculated on the basis of emission spectra and luminescence decay curves. In addition, the antimicrobial and antioxidant activities were also studied of the investigated complexes.

  16. Antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli O157 and Non-O157 recovered from domestic farm animals in rural communities in Northwestern Mexico

    Directory of Open Access Journals (Sweden)

    Bianca A. Amézquita-López

    2016-01-01

    Full Text Available Abstract Background Antimicrobial resistance in Shiga toxin-producing Escherichia coli (STEC O157 and non-O157 is a matter of increasing concern. The aim of the present study was to investigate the antimicrobial resistance profiles of STEC O157 and non-O157 recovered from feces of domestic farm animals in the agricultural Culiacan Valley in Northwestern Mexico. Findings All of the examined STEC strains showed susceptibility to five antimicrobials, ceftazidime, ceftriaxone, ciprofloxacin, nalidixic acid, and trimethoprim-sulfamethoxazole. However, resistance to the four antimicrobials, ampicillin, cephalothin, chloramphenicol, and kanamycin was commonly observed. Interestingly, non-susceptibility to cephalothin was predominant among the examined STEC strains, corresponding to 85 % (22/26 of the O157:H7 from cattle, sheep and chicken and 73 % (24/33 of the non-O157 strains from cattle and sheep. Statistical analyses revealed that resistance to ampicillin was significantly correlated to 38 % (10/26 of STEC O157:H7 strains from multiple animal sources. Another significant correlation was found between serotype, source, and antimicrobial resistance; all of the O20:H4 strains, recovered from sheep, were highly resistant to tetracycline. Multidrug resistance profiles were identified in 42 % (22/53 of the non-susceptible STEC strains with clinically-relevant serotypes O8:H9, O75:H8, O146:H21, and O157:H7. Conclusions STEC O157 and non-O157 strains, recovered from domestic farm animals in the Culiacan Valley, exhibited resistance to classes of antimicrobials commonly used in Mexico, such as aminoglycosides, tetracyclines, cephalosporins and penicillin but were susceptible to fluoroquinolones, quinolones, and sulfonamides. These findings provide fundamental information that would aid in the surveillance of antimicrobial resistance in an important agricultural region in Northwestern Mexico.

  17. Highly luminescent pure-red-emitting fluorinated β-diketonate europium(III) complex for full solution-processed OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: carmen.coya@urjc.es [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)

    2015-03-15

    Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.

  18. Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Kautenburger, R.; Nowotka, K.; Beck, H.P. [Institut fuer Anorganische und Analytische Chemie und Radiochemie, Universitaet des Saarlandes, P.O. Box 151150, 66041 Saarbruecken (Germany)

    2005-07-01

    Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu{sup 3+}) and gadolinium (Gd{sup 3+}) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 {mu}l nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for {sup 153}Eu and 125 ppt for {sup 158}Gd. With this optimized CE

  19. Traumatic brain injury in mice and pentadecapeptide BPC 157 effect.

    Science.gov (United States)

    Tudor, Mario; Jandric, Ivan; Marovic, Anton; Gjurasin, Miroslav; Perovic, Darko; Radic, Bozo; Blagaic, Alenka Boban; Kolenc, Danijela; Brcic, Luka; Zarkovic, Kamelija; Seiwerth, Sven; Sikiric, Predrag

    2010-02-25

    Gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, an anti-ulcer peptide, efficient in inflammatory bowel disease trials (PL 14736), no toxicity reported, improved muscle crush injury. After an induced traumatic brain injury (TBI) in mice by a falling weight, BPC 157 regimens (10.0microg, 10.0ng/kgi.p.) demonstrated a marked attenuation of damage with an improved early outcome and a minimal postponed mortality throughout a 24h post-injury period. Ultimately, the traumatic lesions (subarachnoidal and intraventricular haemorrhage, brain laceration, haemorrhagic laceration) were less intense and consecutive brain edema had considerably improved. Given prophylactically (30 min before TBI) the improved conscious/unconscious/death ratio in TBI-mice was after force impulses of 0.068 Ns, 0.093 Ns, 0.113 Ns, 0.130 Ns, 0.145 Ns, and 0.159 Ns. Counteraction (with a reduction of unconsciousness, lower mortality) with both microg- and ng-regimens included the force impulses of 0.068-0.145 Ns. A higher regimen presented effectiveness also against the maximal force impulse (0.159 Ns). Furthermore, BPC 157 application immediately prior to injury was beneficial in mice subjected to force impulses of 0.093 Ns-TBI. For a more severe force impulse (0.130 Ns, 0.145 Ns, or 0159 Ns), the time-relation to improve the conscious/unconscious/death ratio was: 5 min (0.130 Ns-TBI), 20 min (0.145 Ns-TBI) or 30 min (0.159 Ns-TBI). Copyright 2009 Elsevier B.V. All rights reserved.

  20. Temperature effects on the interaction mechanisms between the europium (III) and uranyl ions and zirconium diphosphate; Effets de la temperature sur les mecanismes d'interaction entre les ions europium (3) et uranyle et le diphosphate de zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Finck, N

    2006-10-15

    Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)

  1. Photon Strength Functions for ^156, 157, 159Gd

    Science.gov (United States)

    Baramsai, Bayarbadrakh; Mitchell, G. E.; Chyzh, A.; Dashdorj, D.; Walker, C.; Bredeweg, T. A.; Couture, A.; Haight, R. C.; Jandel, M.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Wouters, J. M.; Ullmann, J. L.; Vieira, D. J.; Agvaanluvsan, U.; Becvar, F.; Krticka, M.

    2010-11-01

    In recent years the low energy behavior of the Photon Strength Function (PSF) has attracted much attention. A completely consistent description of this behavior is not available. The neutron capture γ-ray spectra measured by the DANCE detector array located at the Los Alamos Neutron Science Center has been used for the study of the PSF below the neutron separation energy. The radiative decay of the compound nuclei ^156, 157, 159Gd has been measured. The spectra were simulated with the DICEBOX code. A variety of phenomenological models of the PSF were considered in the simulations. Comparison of the experimental and simulated spectra will be presented.

  2. Modulatory effect of gastric pentadecapeptide BPC 157 on angiogenesis in muscle and tendon healing.

    Science.gov (United States)

    Brcic, L; Brcic, I; Staresinic, M; Novinscak, T; Sikiric, P; Seiwerth, S

    2009-12-01

    Angiogenesis is a natural and complex process controlled by angiogenic and angiostatic molecules, with a central role in healing process. One of the most important modulating factors in angiogenesis is the vascular endothelial growth factor (VEGF). Pentadecapeptide BPC 157 promotes healing demonstrating particular angiogenic/angiomodulatory potential. We correlated the angiogenic effect of BPC 157 with VEGF expression using in vitro (cell culture) and in vivo (crushed muscle and transected muscle and tendon) models. Results revealed that there is no direct angiogenic effect of BPC 157 on cell cultures. On the other hand, immunohistochemical analysis of muscle and tendon healing using VEGF, CD34 and FVIII antibodies showed adequately modulated angiogenesis in BPC 157 treated animals, resulting in a more adequate healing. Therefore the angiogenic potential of BPC 157 seems to be closely related to the healing process in vivo with BPC 157 stimulating angiogenesis by up-regulating VEGF expression.

  3. Quantum dot based on tin/titanium mixed oxide doped with europium synthesized by protein sol-gel method

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f

    2011-07-01

    Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)

  4. 340nm UV LED excitation in time-resolved fluorescence system for europium-based immunoassays detection

    Science.gov (United States)

    Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian

    2017-02-01

    In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.

  5. Interaction of europium and nickel with calcite studied by Rutherford Backscattering Spectrometry and Time-Resolved Laser Fluorescence Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sabau, A. [Agence Nationale pour la gestion des Déchets RAdioactifs, 1-7 rue J. Monnet, Parc de la Croix Blanche, 92298 Châtenay-Malabry Cedex (France); Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Pipon, Y., E-mail: pipon@ipnl.in2p3.fr [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Institut Universitaire de Technologie (IUT) Lyon-1, Université Claude Bernard Lyon 1, 69 622 Villeurbanne Cedex (France); Toulhoat, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); CEA/DEN, Saclay, 91191 Gif sur Yvette (France); Lomenech, C. [Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Jordan, N. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); Moncoffre, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Barkleit, A. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); and others

    2014-08-01

    This study aims at elucidating the mechanisms regulating the interaction of Eu and Ni with calcite (CaCO{sub 3}). Calcite powders or single crystals (some mm sized) were put into contact with Eu or Ni solutions at concentrations ranging from 10{sup −3} to 10{sup −5} mol L{sup −1} for Eu and 10{sup −3} mol L{sup −1} for Ni. The sorption durations ranged from 1 week to 1 month. Rutherford Backscattering Spectrometry (RBS) well adapted to discriminate incorporation processes such as: (i) adsorption or co precipitation at the mineral surfaces or, (ii) incorporation into the mineral structure (through diffusion for instance), has been carried out. Moreover, using the fluorescence properties of europium, the results have been compared to those obtained by Time-Resolved Laser Fluorescence Spectroscopy (TRLFS) on calcite powders. For the single crystals, complementary SEM observations of the mineral surfaces at low voltage were also performed. Results showed that Ni accumulates at the calcite surface whereas Eu is also incorporated at a greater depth. Eu seems therefore to be incorporated into two different states in calcite: (i) heterogeneous surface accumulation and (ii) incorporation at depth greater than 160 nm after 1 month of sorption. Ni was found to accumulate at the surface of calcite without incorporation.

  6. Orange-red emitting europium doped strontium ortho-silicate phosphor prepared by a solid state reaction method.

    Science.gov (United States)

    Sahu, Ishwar Prasad

    2017-05-01

    In the present article we report europium-doped strontium ortho-silicates, namely Sr 2 SiO 4 :xEu 3+ (x = 1.0, 1.5, 2.0, 2.5 or 3.0 mol%) phosphors, prepared by solid state reaction method. The crystal structures of the sintered phosphors were consistent with orthorhombic crystallography with a Pmna space group. The chemical compositions of the sintered phosphors were confirmed by energy dispersive X-ray spectroscopy (EDS). Thermoluminescence (TL) kinetic parameters such as activation energy, order of kinetics and frequency factors were calculated by the peak shape method. Orange-red emission originating from the 5 D 0 - 7 F J (J = 0, 1, 2, 3) transitions of Eu 3+ ions could clearly be observed after samples were excited at 395 nm. The combination of these emissions constituted orange-red light as indicated on the Commission Internationale de l'Eclairage (CIE) chromaticity diagram. Mechanoluminescence (ML) intensity of the prepared phosphor increased linearly with increasing impact velocity of the moving piston that suggests that these phosphors can also be used as sensors to detect the stress of an object. Thus, the present investigation indicates that the piezo-electricity was responsible for producing ML in the prepared phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Application of Europium Multiwalled Carbon Nanotubes as Novel Luminophores in an Electrochemiluminescent Aptasensor for Thrombin Using Multiple Amplification Strategies.

    Science.gov (United States)

    Wu, Dan; Xin, Xia; Pang, Xuehui; Pietraszkiewicz, Marek; Hozyst, Robert; Sun, Xian'ge; Wei, Qin

    2015-06-17

    A novel electrochemiluminescent (ECL) aptasensor was proposed for the determination of thrombin (TB) using exonuclease-catalyzed target recycling and hybridization chain reaction (HCR) to amplify the signal. The capture probe was immobilized on an Au-GS-modified electrode through a Au-S bond. Subsequently, the hybrid between the capture probe and the complementary thrombin binding aptamer (TBA) was aimed at obtaining double-stranded DNA (dsDNA). The interaction between TB and its aptamer led to the dissociation of dsDNA because TB has a higher affinity to TBA than the complementary strands. In the presence of exonuclease, aptamer was selectively digested and TB could be released for target recycling. Extended dsDNA was formed through HCR of the capture probe and two hairpin DNA strands (NH2-DNA1 and NH2-DNA1). Then, numerous europium multiwalled carbon nanotubes (Eu-MWCNTs) could be introduced through amidation reaction between NH2-terminated DNA strands and carboxyl groups on the Eu-MWCNTs, resulting in an increased ECL signal. The multiple amplification strategies, including the amplification of analyte recycling and HCR, and high ECL efficiency of Eu-MWCNTs lead to a wide linear range (1.0×10(-12)-5.0×10(-9) mol/L) and a low detection limit (0.23 pmol/L). The method was applied to serum sample analysis with satisfactory results.

  8. Spectrophotometric Determination and Removal of Unchelated Europium Ions from Solutions Containing Eu-Diethylenetriaminepentaacetic Acid Chelate-Peptide Conjugates1

    Science.gov (United States)

    Dayan Elshan, N. G. R.; Patek, Renata; Vagner, Josef; Mash, Eugene A.

    2014-01-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination, as well as the success of metal ion removal upon attempted purification. We compared the use of Empore™ chelating disks and Chelex® 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore™ chelating disks were found to give much higher recoveries of the probes under the conditions utilized. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. PMID:25058927

  9. Reusable temperature-sensitive luminescent material based on vitrified film of europium(III) β-diketonate complex

    Science.gov (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Lobkov, Vladimir S.; Knyazev, Andrey A.; Galyametdinov, Yury G.

    2018-01-01

    We have proposed a novel temperature-sensitive luminescent material which is a 20 μm thick vitrified film (sandwiched between two quartz plates) fabricated from an amorphous powder of a mesogenic europium(III) β-diketonate complex through a melt-processing technique. The film photoexcited by a 337 nm pulsed nitrogen laser displays a typical Eu3+ ion luminescence bands with the strongest peak at 612 nm and with the decay time of 537 μs at 298 K. It is obtained that both the mean luminescence intensity and the luminescence decay time at 612 nm decrease significantly with temperature increasing from 298 to 348 K; the average values of the relative and absolute temperature sensitivities of the luminescence decay time in the range of 298-348 K are -1.2%·K-1 and -6.5 μs·K-1, respectively. The thermal quenching mechanism of the luminescent properties was analyzed and discussed. The experiments showed that, the luminescent properties of the film is insensitive to oxygen, the film is photostable under UV light, there is full reversibility of the temperature-dependent luminescence intensity and the decay time, and the high luminescence brightness of the film can be observed with violet light excitation. These factors indicated that the film is promising material for reusable luminescent thermometers, suitable for long-term monitoring in the range of 298-348 K.

  10. Differential ERK activation during autophagy induced by europium hydroxide nanorods and trehalose: Maximum clearance of huntingtin aggregates through combined treatment.

    Science.gov (United States)

    Wei, Peng-Fei; Jin, Pei-Pei; Barui, Ayan Kumar; Hu, Yi; Zhang, Li; Zhang, Ji-Qian; Shi, Shan-Shan; Zhang, Hou-Rui; Lin, Jun; Zhou, Wei; Zhang, Yun-Jiao; Ruan, Ren-Quan; Patra, Chitta Ranjan; Wen, Long-Ping

    2015-12-01

    Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Synthesis of europium-doped VSOP, customized enhancer solution and improved microscopy fluorescence methodology for unambiguous histological detection.

    Science.gov (United States)

    de Schellenberger, Angela Ariza; Hauptmann, Ralf; Millward, Jason M; Schellenberger, Eyk; Kobayashi, Yuske; Taupitz, Matthias; Infante-Duarte, Carmen; Schnorr, Jörg; Wagner, Susanne

    2017-10-10

    Intrinsic iron in biological tissues frequently precludes unambiguous the identification of iron oxide nanoparticles when iron-based detection methods are used. Here we report the full methodology for synthesizing very small iron oxide nanoparticles (VSOP) doped with europium (Eu) in their iron oxide core (Eu-VSOP) and their unambiguous qualitative and quantitative detection by fluorescence. The resulting Eu-VSOP contained 0.7 to 2.7% Eu relative to iron, which was sufficient for fluorescent detection while not altering other important particle parameters such as size, surface charge, or relaxivity. A customized enhancer solution with high buffer capacity and nearly neutral pH was developed to provide an antenna system that allowed fluorescent detection of Eu-VSOP in cells and histologic tissue slices as well as in solutions even under acidic conditions as frequently obtained from dissolved organic material. This enhancer solution allowed detection of Eu-VSOP using a standard fluorescence spectrophotometer and a fluorescence microscope equipped with a custom filter set with an excitation wavelength (λex) of 338 nm and an emission wavelength (λem) of 616 nm. The fluorescent detection of Eu-doped very small iron oxide nanoparticles (Eu-VSOP) provides a straightforward tool to unambiguously characterize VSOP biodistribution and toxicology at tissue, and cellular levels, providing a sensitive analytical tool to detect Eu-doped IONP in dissolved organ tissue and biological fluids with fluorescence instruments.

  12. Efficient solution-processed double-layer red OLEDs based on a new europium complex with a carbazole group.

    Science.gov (United States)

    Liu, Jian; Miao, Jing-Sheng; Wu, Hong-Bin

    2015-06-01

    A new europium complex EuL3 (Phen) was used as guest dopant, and a blend of Polyvinylcarbazole and 2-(biphenyl-4-yl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole (PVK and PBD) as host matrix. Efficient red organic light-emitting devices (OLEDs) with double-layer structures were manufactured via a solution-processed technique. The guest-doped levels were 1, 3 and 5 wt% relative to the blend mass, respectively. For the 1 wt% doping-level device, the luminous efficiency and luminance were up to 2.96 cd/A and 635.78 cd/m(2) with emissions from both EuL3 (Phen) and from the host; for the 3 wt% doping-level device, the maximum luminous efficiency and luminance were 1.01 cd/A and 370.91 cd/m(2) for the single emission from EuL3 (Phen) only. Copyright © 2014 John Wiley & Sons, Ltd.

  13. Europium Nanospheres-Based Time-Resolved Fluorescence for Rapid and Ultrasensitive Determination of Total Aflatoxin in Feed.

    Science.gov (United States)

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen

    2015-12-02

    Immunochromatographic (IC) assays are considered suitable diagnostic tools for the determination of mycotoxins. A europium nanospheres-based time-resolved fluorescence immunoassay (Eu-Nano-TRFIA), based on a monoclonal antibody and a portable TRFIA reader, was developed to determine total aflatoxin (including aflatoxins B1, B2, G1, and G2) levels in feed samples. Under optimized conditions, the Eu-Nano-TRFIA method detected total aflatoxin within 12 min. It showed good linearity (R(2) > 0.985), LOD of 0.16 μg/kg, a wide dynamic range of 0.48-30.0 μg/kg, recovery rates of 83.9-113.9%, and coefficients of variation (CVs) of 3.5-8.8%. In the 397 samples from company and livestock farms throughout China, the detection rate was 78.3%, concentrations were 0.50-145.30 μg/kg, the highest total aflatoxin content was found in cottonseed meal, and corn was found to be the most commonly contaminated feed. This method could be a powerful alternative for the rapid and ultrasensitive determination of total aflatoxin in quality control and meet the required Chinese maximum residue limits.

  14. Spectrophotometric determination and removal of unchelated europium ions from solutions containing Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates.

    Science.gov (United States)

    Elshan, N G R Dayan; Patek, Renata; Vagner, Josef; Mash, Eugene A

    2014-11-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination as well as the success of metal ion removal on attempted purification. We compared the use of Empore chelating disks and Chelex 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore chelating disks were found to give much higher recoveries of the probes under the conditions used. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Formation and structural characterization of a europium(II mono(scorpionate complex and a sterically crowded pyrazabole

    Directory of Open Access Journals (Sweden)

    Phil Liebing

    2017-12-01

    Full Text Available The reaction of EuI2(THF2 with potassium hydrotris(3,5-diisopropylpyrazolylborate (K[HB(3,5-iPr2pz3] (= KTpiPr2, pz = pyrazolyl in a molar ratio of 1:1.5 resulted in extensive ligand fragmentation and formation of the europium(II mono(scorpionate complex bis(3,5-diisopropyl-1H-pyrazole[hydrotris(3,5-diisopropylpyrazolylborato]iodidoeuropium(II, [Eu(C27H46BN6I(C9H16N22] or (TpiPr2(3,5-iPr2pzH2EuIII, 1, in high yield (78%. As a typical by-product, small amounts of the sterically crowded pyrazabole derivative trans-4,8-bis(3,5-diisopropylpyrazol-1-yl-1,3,5,7-tetraisopropylpyrazabole, C36H62B2H8 or trans-{(3,5-iPr2pzHB(μ-3,5-iPr2pz}2, 2, were formed. Both title compounds have been structurally characterized through single-crystal X-ray diffraction. In 1, two isopropyl groups are each disordered over two orientations with occupancy ratios of 0.574 (10:0.426 (10 and 0.719 (16:0.281 (16. In 2, one isopropyl group is similarly disordered, occupancy ratio 0.649 (9:0.351 (9.

  16. Spectrofluorimetric study of the interaction between europium(III) and moxifloxacin in micellar solution and its analytical application

    Science.gov (United States)

    Kamruzzaman, Mohammad; Alam, Al-Mahmnur; Lee, Sang Hak; Ragupathy, Dhanusuraman; Kim, Young Ho; Park, Sang-Ryoul; Kim, Sung Hong

    2012-02-01

    A sensitive spectrofluorimetric method has been developed for the determination of moxifloxacin (MOX) using europium(III)-MOX complex as a fluorescence probe in the presence of an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS). The fluorescence (FL) intensity of Eu 3+ was enhanced by complexation with MOX at 614 nm after excitation at 373 nm. The FL intensity of the Eu 3+-MOX complex was significantly intensified in the presence of SDBS. Under the optimum conditions, it was found that the enhanced FL intensity of the system showed a good linear relationship with the concentration of MOX over the range of 1.8 × 10 -11-7.3 × 10 -9 g mL -1 with a correlation coefficient of 0.9998. The limit of detection of MOX was found to be 2.8 × 10 -12 g mL -1 with relative standard deviation (RSD) of 1.25% for 5 replicate determination of 1.5 × 10 -8 g mL -1 MOX. The proposed method is simple, offers higher sensitivity with wide linear range and can be successfully applied to determine MOX in pharmaceutical and biological samples with good reproducibility. The luminescence mechanism is also discussed in detail with ultraviolet absorption spectra.

  17. Photoluminescence properties of europium doped di-strontium magnesium di-silicate phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-01-01

    Full Text Available Europium doped di-strontium magnesium di-silicate phosphor namely (Sr2MgSi2O7:Eu3+ was prepared by the traditional high temperature solid state reaction method. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P42¯1m, this structure is a member of the melilite group and forms a layered compound. The EDX and FTIR spectra confirm the present elements in Sr2MgSi2O7:Eu3+ phosphor. Photoluminescence measurements showed that the phosphor exhibited strong emission peak with good intensity, corresponding to 5D0 → 7F2 (613 nm red emission and weak 5D0 → 7F1 (590 nm orange emission. The excitation spectra monitored at 613 nm show broad band from 220 to 300 nm ascribed to O–Eu charge-transfer band (CTB centered at about 269 nm, and the other peaks in the range of 300–400 nm originated from f–f transitions of Eu3+ ions. The strongest band at 395 nm can be assigned to 7F0 / 5L6 transition of Eu3+ ions due to the typical f–f transitions within Eu3+ of 4f6 configuration.

  18. Highly selective luminescent sensing of picric acid based on a water-stable europium metal-organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Tifeng; Zhu, Fengliang; Cui, Yuanjing, E-mail: cuiyj@zju.edu.cn; Yang, Yu; Wang, Zhiyu; Qian, Guodong, E-mail: gdqian@zju.edu.cn

    2017-01-15

    A water-stable metal-organic framework (MOF) EuNDC has been synthesized for selective detection of the well-known contaminant and toxicant picric acid (PA) in aqueous solution. Due to the photo-induced electron transfer and self-absorption mechanism, EuNDC displayed rapid, selective and sensitive detection of PA with a detection limit of 37.6 ppb. Recyclability experiments revealed that EuNDC retains its initial luminescent intensity and same quenching efficiency in each cycle, suggesting high photostability and reusability for long-term sensing applications. The excellent detection performance of EuNDC makes it a promising PA sensing material for practical applications. - Graphical abstract: A water-stable europium-based metal-organic framework has been reported for highly selective sensing of picric acid (PA) with a detection limit of 37.6 ppb in aqueous solution. - Highlights: • A water-stable metal-organic framework (MOF) EuNDC was synthesized. • The highly selective detection of picric acid with a detection limit of 37.6 ppb was realized. • The detection mechanism were also presented and discussed.

  19. One-pot carbonization synthesis of europium-doped carbon quantum dots for highly selective detection of tetracycline

    Science.gov (United States)

    Li Liu, Meng; Chen, Bin Bin; Yang, Tong; Wang, Jian; Liu, Xi Dong; Zhi Huang, Cheng

    2017-03-01

    The detection of tetracycline is of great significance because of its damaging effects on human health, such as renal toxicity and hemolytic anemia. Any release of tetracycline into the surrounding environment can produce bacterial drug resistance. We develop a new sensitive and selective detection approach for tetracycline in complex water samples by preparing europium-doped carbon quantum dots (Eu-CQDs) through a simple and rapid carbonization method operating at 200 °C for 5 min. The Eu-CQDs are characterized by blue photoluminescence, excitation-wavelength-dependent emission and excellent stability. Importantly, the fluorescence of the Eu-CQDs can be quenched efficiently by tetracycline, based on the strong inner filter effect mechanism between Eu-CQDs and tetracycline, making the fluorescence intensity ratio (I 0/I) of the Eu-CQDs at 465 nm correlate linearly with the concentration of tetracycline in the range of 0.5-200 μM, with a limit of detection of 0.3 μM. This shows the broad applicability of the Eu-CQDs in pursuing the concepts of simplicity and specificity for analytical purposes.

  20. Mesoporous Europium-Doped Titania Nanoparticles (Eu-MTNs) for Luminescence-Based Intracellular Bio-Imaging.

    Science.gov (United States)

    Chen, Kuan-Chou; Dutta, Saikat; Yamauchi, Yusuke; Alshehri, Saad M; Nguyen, Mai Thanh; Yonezawa, Tetsu; Shen, Kun-Hung; Wu, Kevin C W

    2015-12-01

    Monodisperse and mesoporous europium (Eu)-doped titania nanoparticles (denoted as Eu-MTNs) were prepared by a co-synthesis method with the presence of a cationic surfactant (i.e., CTAB). A maximum loading amount of 8 mol% of Eu could be successfully incorporated into the framework of MTNs. The synthesized Eu-MTNs samples were characterized with X-ray diffraction (XRD) and scanning electron microscopy (SEM), with their luminescent property examined by photoluminescence (PL). Under ultraviolet irradiation, the Eu-MTNs samples exhibit several characteristic luminescence corresponding to 5D0-7F(j) for Eu+3 ions, which can be attributed to the energy transfer from titania nanocrystallite to Eu3+ ions dispersed in amorphous mesoporous titania region. The potential intracellular bio-imaging application of the synthesized Eu-MTN nanoparticles was demonstrated with a breast cancer cell line (i.e., BT-20). High biocompatibility and strong luminescence of the Eu-MTNs show great potential in biomedical applications.

  1. Effect of heat treatment on the survival of Escherichia Coli O157:H7 ...

    African Journals Online (AJOL)

    The survival of Escherichia coli O157:H7 in raw milk treated in experimental pasteurizer was investigated in the year 2010. Raw milk was inoculated with different initial concentrations of E. coli O157:H7 and heated for 15 seconds at temperatures ranging from 69OC to 73OC. E. coli O157:H7 cells were not isolated from the ...

  2. Culture confirmation of Escherichia coli serotype O157:H7 by direct immunofluorescence.

    OpenAIRE

    Tison, D L

    1990-01-01

    An evaluation of a fluorescein-labeled, polyclonal, affinity-purified goat antibody to Escherichia coli serotype O157:H7 (Kirkegaard & Perry Laboratories Inc., Gaithersburg, Md.) was conducted to determine the efficacy of this research reagent for the rapid direct immunofluorescence identification of E. coli O157:H7 isolated from fecal specimens cultured on sorbitol-MacConkey (SMAC) agar. The E. coli O157:H7 fluorescent-antibody conjugate proved to be 100% sensitive and specific for the rapid...

  3. Prevalence of Escherichia coli O157:H7 in Gallbladders of Beef Cattle▿ †

    OpenAIRE

    Reinstein, S.; Fox, J. T.; Shi, X.; Nagaraja, T. G.

    2006-01-01

    Gallbladders and rectal contents were collected from cattle (n = 933) at slaughter to determine whether the gallbladder harbors Escherichia coli O157:H7. Both gallbladder mucosal swabs and homogenized mucosal tissues were used for isolation. Only five gallbladders (0.54%) were positive for E. coli O157:H7. Fecal prevalence averaged 7.1%; however, none of the cattle that had E. coli O157:H7 in the gallbladder was positive for E. coli O157:H7 in feces. Therefore, the gallbladder does not appear...

  4. The europium and praseodymium hydrolysis in a 2M NaCl environment; La hidrolisis del europio y del praseodimio en un medio 2M de NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1998-07-01

    It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)

  5. Specific chiral sensing of amino acids using induced circularly polarized luminescence of bis(diimine)dicarboxylic acid europium(III) complexes.

    Science.gov (United States)

    Okutani, Kazuhiro; Nozaki, Koichi; Iwamura, Munetaka

    2014-06-02

    The circularly polarized luminescence (CPL) from [Eu(pda)2](-) (pda = 1,10-phenanthroline-2,9-dicarboxylic acid) and [Eu(bda)2](-) (bda = 2,2'-bipyridine-6,6'-dicarboxylic acid) in aqueous solutions containing various amino acids was investigated. The europium(III) complexes exhibited bright-red luminescence assignable to the f-f transition of the Eu(III) ion when irradiated with UV light. Although the luminescence was not circularly polarized in the solid state or in aqueous solutions, in accordance with the achiral crystal structure, the complexes exhibited detectable induced CPL (iCPL) in aqueous solutions containing chiral amino acids. In the presence of L-pyrrolidonecarboxylic acid, both [Eu(pda)2](-) and [Eu(bda)2](-) showed similar iCPL intensity (glum ∼ 0.03 for the (5)D0 → (7)F1 transition at 1 mol·dm(-3) of the amino acid). On the other hand, in the presence of L-histidine or L-arginine, [Eu(pda)2](-) exhibited intense CPL (glum ∼ 0.08 for the (5)D0 → (7)F1 transition at 0.10 mol·dm(-3) of the amino acid), whereas quite weak CPL was observed for [Eu(bda)2](-) under the same conditions (glum europium(III) complexes possess coordination structures similar to that in the crystal with slight distortion to form a chiral structure due to specific interaction with two zwitterionic amino acids. This mechanism was in stark contrast to that of the europium(III) complex-pyrrolidonecarboxylic acid system in which one amino acid coordinates to the Eu(III) ion to yield an achiral coordination structure.

  6. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    Science.gov (United States)

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  7. Identification of Protozoa in Dairy Lagoon Wastewater that Consume Escherichia coli O157:H7 Preferentially

    Science.gov (United States)

    Ravva, Subbarao V.; Sarreal, Chester Z.; Mandrell, Robert E.

    2010-01-01

    Escherichia coli O157:H7 (EcO157), an agent of life threatening hemolytic-uremic syndrome, resides in ruminants and is released in feces at numbers as high as 10 million cells/gram. EcO157 could survive in manure for as long as 21 months, but we observed a 90% decrease in cells of an outbreak strain of EcO157 within half a day in wastewater from dairy lagoons. Although chemical, environmental and biological factors may be responsible for this decrease, we observed an 11-fold increase in native protozoa when wastewater was re-inoculated with 2×107 cells of EcO157/mL. These protozoa engulfed the green fluorescent protein labeled EcO157 within 2 hours after inoculation, but expelled vacuoles filled with live EcO157 cells within 3 days into surrounding wastewater, whereas other protozoa retained the EcO157-filled vacuoles for 7 days. EcO157 was not detected by confocal microscopy either inside or outside protozoa after 7 days. Mixed cultures of protozoa enriched from wastewater consumed EcO157 preferentially as compared to native aerobic bacteria, but failed to eliminate them when EcO157 cells declined to 104/mL. We isolated three protozoa from mixed cultures and typed them by 18S sequencing as Vorticella microstoma, Platyophyra sp. and Colpoda aspera. While all three protozoa internalized EcO157, only Platyophyra and Colpoda acted as predators. Similar to mixed cultures, these protozoa failed to eliminate EcO157 from PBS containing no other supplemental nutrients or prey. However, spiking PBS with cereal grass medium as nutrients induced predation of EcO157 by Platyophyra sp. after 3 days or enhanced predation by Colpoda after 5 days. Therefore, attempts to enrich protozoa to decrease EcO157 from dairy lagoons, may correspond to an increase in protozoa similar to Vorticella and possibly facilitate transport of bacterial pathogens to food crops grown in proximity. PMID:21187934

  8. Inhibition of methyldigoxin-induced arrhythmias by pentadecapeptide BPC 157: a relation with NO-system.

    Science.gov (United States)

    Balenovic, Dijana; Bencic, Martina Lovric; Udovicic, Mario; Simonji, Karol; Hanzevacki, Jadranka Separovic; Barisic, Ivan; Kranjcevic, Stjepan; Prkacin, Ingrid; Coric, Vedran; Brcic, Luka; Coric, Marijana; Brcic, Iva; Borovic, Suzana; Radic, Bozo; Drmic, Domagoj; Vrcic, Hrvoje; Seiwerth, Sven; Sikiric, Predrag

    2009-08-07

    Pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, MW 1419) reversed congestive heart failure and various arrhythmias, influenced the NO-system and showed no proarrhythmic effect. In therapy analogy, we challenged rats with digitalis, to show attenuation by BPC 157 and the relation between the NO-system and digitalis toxicity. (i). BPC 157 prophylactic effect. Development of cumulative intravenous digitalis toxicity, BPC 157 (50 microg, 10 microg, 10 ng/kg applied intravenously immediately before a methyldigoxin increment regimen (2.0/1.5/1.5/1.0 mg/kg at 15 min-intervals, total dose 6.0 mg/kg/45 min)) reduced the number of ventricular premature beats, prolonged the time before onset of ventricular tachycardia, reduced ventricular tachycardia and AV-block duration (microg-regimes) or reduced mainly the AV-block duration (ng-regimen). (ii). BPC 157 therapy. Advanced methyldigoxin toxicity (6.0 mg/kg i.v. bolus). BPC 157 applied at the 20th second of the grade 3 AV-block shortened AV-blocks, mitigated a further digitalis toxicity course. Ventricular tachycardias were either avoided (50 microg), or markedly reduced (10 microg, 10 ng). Fatal outcome was either avoided (50 microg), reduced (10 microg), or only delayed (10 ng) (iii) BPC 157, L-NAME, l-arginine, L-NAME+l-arginine application. L-NAME-application (5 mg/kg i.p.) aggravated methyldigoxin-arrhythmias. l-arginine (200 mg/kg i.p.) alone had no effect but blunted L-NAME-exaggeration (L-NAME+l-arginine). In this respect, BPC 157 (50 microg/kg i.p.) was prophylactically and therapeutically more effective: the antagonism of L-NAME with BPC 157 produced an effect similar to BPC 157 alone. In conclusion, digitalis-induced arrhythmias in rats could be prevented and counteracted by pentadecapeptide BPC 157, mainly through an interaction with the NO-system.

  9. Protective effects of pentadecapeptide BPC 157 on gastric ulcer in rats.

    Science.gov (United States)

    Xue, Xiao-Chang; Wu, Yong-Jie; Gao, Ming-Tang; Li, Wen-Guang; Zhao, Ning; Wang, Zeng-Lu; Bao, Chun-Jie; Yan, Zhen; Zhang, Ying-Qi

    2004-04-01

    To investigate the protective effects of gastric pentadecapeptide BPC 157 on acute and chronic gastric ulcers in rats and to compare the results in therapy of human gastric ulcers by different administration methods. Gastric pentadecapeptide BPC 157 was administered (initial single or continuous administration) into rats either intragastrically or intramuscularly before (induced acute gastric ulcer) or after (induced chronic gastric ulcer) the applications of inducing agents, and each animal was sacrificed to observe the protective effects of BPC 157 on gastric ulcers. Both intramuscular (im) and intragastric (ig) administration of BPC 157 could apparently reduce the ulcer area and accelerate the healing of induced ulcer in different models and the effect of im administered BPC 157 was better than that of ig. The rats treated with higher dosages (400 ng/kg, 800 ng/kg) of BPC 157 (im and ig) showed significantly less lesion (PBPC 157 in pylorus ligation induced model (PBPC 157) in three models, the inhibition ratio of ulcer formation was 65.5%, 65.6% and 59.9%, respectively, which was better than that of famotidine (its inhibition rate was 60.8%, 57.2% and 34.3%, respectively). Continuous application of BPC 157 (in chronic acetate induced gastric ulcer) could accelerate rebuilding of glandular epithelium and formation of granulation tissue (PBPC 157 can apparently ameliorate acute gastric ulcer in rats and antagonize the protracted effect of acetate challenge on chronic ulcer. The effect of im administration of BPC 157 is better than that of ig, and the effective dosage of the former is lower than that of the latter.

  10. PCR and ELISA (VIDAS ECO O157®) Escherichia coli O157:H7 identification in Minas Frescal cheese commercialized in Goiânia, GO

    Science.gov (United States)

    Carvalho, Rosangela Nunes; de Oliveira, Antonio Nonato; de Mesquita, Albenones José; Minafra e Rezende, Cíntia Silva; de Mesquita, Adriano Queiroz; Romero, Rolando Alfredo Mazzoni

    2014-01-01

    Escherichia coli O157:H7 has been incriminated in food poisoning outbreaks and sporadic cases of hemorrhagic colitis and hemolytic uremic syndrome in many countries. Considering the high susceptibility of Minas Frescal cheese to contamination by E. coli O157:H7, the aim of this study was to determine the occurrence of this pathogen through PCR (Polymerase Chain Reaction) and ELISA (VIDAS ECO O157®, bioMérieux, Lyon, France) test. Thirty cheese samples manufactured by artisan farmhouse producers were collected from open-air markets in Goiânia and thirty from industries under Federal Inspection located in Goiás State which trade their products in supermarkets in Goiânia. E. coli O157:H7 was detected in 6.67% samples collected in open air markets using ELISA, and 23,33% with PCR. The pathogen was not detected in samples from industries under Federal Inspection. PMID:24948907

  11. PCR and ELISA (VIDAS ECO O157® Escherichia coli O157:H7 identification in Minas Frescal cheese commercialized in Goiânia, GO

    Directory of Open Access Journals (Sweden)

    Rosangela Nunes Carvalho

    2014-01-01

    Full Text Available Escherichia coli O157:H7 has been incriminated in food poisoning outbreaks and sporadic cases of hemorrhagic colitis and hemolytic uremic syndrome in many countries. Considering the high susceptibility of Minas Frescal cheese to contamination by E. coli O157:H7, the aim of this study was to determine the occurrence of this pathogen through PCR (Polymerase Chain Reaction and ELISA (VIDAS ECO O157®, bioMérieux, Lyon, France test. Thirty cheese samples manufactured by artisan farmhouse producers were collected from open-air markets in Goiânia and thirty from industries under Federal Inspection located in Goiás State which trade their products in supermarkets in Goiânia. E. coli O157:H7 was detected in 6.67% samples collected in open air markets using ELISA, and 23,33% with PCR. The pathogen was not detected in samples from industries under Federal Inspection.

  12. Europium-activated phosphors containing oxides of rare-earth and group-IIIB metals and method of making the same

    Science.gov (United States)

    Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan

    2004-07-13

    Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.

  13. Synthesis and pharmacological characterization of a europium-labelled single-chain antagonist for binding studies of the relaxin-3 receptor RXFP3.

    Science.gov (United States)

    Haugaard-Kedström, Linda M; Wong, Lilian L L; Bathgate, Ross A D; Rosengren, K Johan

    2015-06-01

    Relaxin-3 and its endogenous receptor RXFP3 are involved in fundamental neurological signalling pathways, such as learning and memory, stress, feeding and addictive behaviour. Consequently, this signalling system has emerged as an attractive drug target. Development of leads targeting RXFP3 relies on assays for screening and ligand optimization. Here, we present the synthesis and in vitro characterization of a fluorescent europium-labelled antagonist of RXFP3. This ligand represents a cheap and safe but powerful tool for future mechanistic and cell-based receptor-ligand interaction studies of the RXFP3 receptor.

  14. Bis{[6-methoxy-2-(4-methylphenyliminiomethyl]phenolate-κ2O,O′}tris(nitrato-κ2O,O′europium(III

    Directory of Open Access Journals (Sweden)

    Hang-Ming Guo

    2010-11-01

    Full Text Available The crystal structure of title compound, [Eu(NO33(C15H15NO22], contains two Schiff base 6-methoxy-2-[(4-methylphenyliminomethyl]phenolate (L ligands and three independent nitrate ions that chelate to the europium(III ion via the O atoms. The coordination number of the EuIII ion is ten. The L ligands chelate with a strong Eu—O(deprotonated phenolate bond and a weak Eu—O(methoxy contact, the latter can be interpreted as the apices of the bicapped square-antiprismatic EuIII polyhedron. Intramolecular N—H...O hydrogen bonds occur.

  15. Problems in classical electromagnetism 157 exercises with solutions

    CERN Document Server

    Macchi, Andrea; Pegoraro, Francesco

    2017-01-01

    This book contains 157 problems in classical electromagnetism, most of them new and original compared to those found in other textbooks. Each problem is presented with a title in order to highlight its inspiration in different areas of physics or technology, so that the book is also a survey of historical discoveries and applications of classical electromagnetism. The solutions are complete and include detailed discussions, which take into account typical questions and mistakes by the students. Without unnecessary mathematical complexity, the problems and related discussions introduce the student to advanced concepts such as unipolar and homopolar motors, magnetic monopoles, radiation pressure, angular momentum of light, bulk and surface plasmons, radiation friction, as well as to tricky concepts and ostensible ambiguities or paradoxes related to the classical theory of the electromagnetic field. With this approach the book is both a teaching tool for undergraduates in physics, mathematics and electric engine...

  16. 10 CFR 52.157 - Contents of applications; technical information in final safety analysis report.

    Science.gov (United States)

    2010-01-01

    ...; technical information in final safety analysis report. The application must contain a final safety analysis... 10 Energy 2 2010-01-01 2010-01-01 false Contents of applications; technical information in final safety analysis report. 52.157 Section 52.157 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES...

  17. 21 CFR 133.157 - Part-skim mozzarella and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Part-skim mozzarella and scamorza cheese. 133.157... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.157 Part-skim mozzarella and scamorza cheese. Part-skim...

  18. Antibacterial activity of cinnamaldehyde and Sporan against Escherichia coli O157:H7 and Salmonella

    Science.gov (United States)

    The in vitro antimicrobial effect of cinnamaldehyde and Sporan in combination with acetic acid against E. coli O157:H7 and Salmonella was investigated. A five strain cocktail of E. coli O157:H7 and Salmonella were inoculated in Luria-Bertoni broth (LB broth, 7 log CFU ml-1) containing cinnamaldehyde...

  19. Internalization of E. coli O157:H7 in spinach cultivated in soil and hydroponic media

    Science.gov (United States)

    Introduction: Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. Previous studies that have investigated uptake of E. coli O157:H7 into leafy greens have expressed green fluorescent protein (gfp) from a plasmid, possibly limiting detecti...

  20. 40 CFR 65.157 - Performance test and flare compliance determination requirements.

    Science.gov (United States)

    2010-07-01

    ... determination requirements. 65.157 Section 65.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... requirements. (a) Performance tests and flare compliance determinations. Where §§ 65.145 through 65.155 require... halogen reduction device, or a compliance determination for a flare, the requirements of paragraphs (b...

  1. Occurrence of Escherichia coli O157 in a river used for fresh ...

    African Journals Online (AJOL)

    PRECIOUS

    2010-01-11

    Jan 11, 2010 ... Key words: Escherichia coli O157, contamination, irrigation water, nitrate, fresh produce, surface waters. INTRODUCTION. Escherichia coli O157 is an important agent of food- and water-borne illnesses in humans globally (Chalmers et al., 2000; Bettelheim and Beutin, 2003; Duffy, 2003). The first reported ...

  2. 18 CFR 157.212 - Synthetic and liquefied natural gas facilities.

    Science.gov (United States)

    2010-04-01

    ... natural gas facilities. 157.212 Section 157.212 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES... 7 OF THE NATURAL GAS ACT Interstate Pipeline Blanket Certificates and Authorization Under Section 7...

  3. Diet, fecal microbiome and Escherichia coli O157:H7 shedding in beef Cattle

    Science.gov (United States)

    Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7, and in cattle the terminal gastrointestinal tra...

  4. Diet, Escherichia coli O157:H7, and cattle: A review after 10 years

    Science.gov (United States)

    Escherichia coli are commensal bacteria that can account for up to 1% of the bacterial population of the gut. Ruminant animals are reservoirs of the pathogenic bacteria E. coli O157:H7, and approximately 30% of feedlot cattle shed E. coli O157:H7. Feedlot and high-producing dairy cattle are fed hi...

  5. Escherichia coli O157:H7, diet, and fecal microbiome in beef cattle

    Science.gov (United States)

    Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7, and in cattle the terminal gastrointestinal tra...

  6. 17 CFR 1.57 - Operations and activities of introducing brokers.

    Science.gov (United States)

    2010-04-01

    ... introducing brokers. 1.57 Section 1.57 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION... introducing brokers. (a) Each introducing broker must: (1) Open and carry each customer's and option customer..., That an introducing broker which has entered into a guarantee agreement with a futures commission...

  7. Carbon footprint assessment of recycling technologies for rare earth elements: A case study of recycling yttrium and europium from phosphor.

    Science.gov (United States)

    Hu, Allen H; Kuo, Chien-Hung; Huang, Lance H; Su, Chao-Chin

    2017-02-01

    Rare earth elements are key raw materials in high-technology industries. Mining activities and manufacturing processes of such industries have caused considerable environmental impacts, such as soil erosion, vegetation destruction, and various forms of pollution. Sustaining the long-term supply of rare earth elements is difficult because of the global shortage of rare earth resources. The diminishing supply of rare earth elements has attracted considerable concern because many industrialized countries regarded such elements as important strategic resources for economic growth. This study aims to explore the carbon footprints of yttrium and europium recovery techniques from phosphor. Two extraction recovery methods, namely, acid extraction and solvent extraction, were selected for the analysis and comparison of carbon footprints. The two following functional units were used: (1) the same phosphor amounts for specific Y and Eu recovery concentrations, and (2) the same phosphor amounts for extraction. For acid extraction method, two acidic solutions (H2SO4 and HCl) were used at two different temperatures (60 and 90°C). For solvent extraction method, acid leaching was performed followed by ionic liquid extraction. Carbon footprints from acid and solvent extraction methods were estimated to be 10.1 and 10.6kgCO2eq, respectively. Comparison of the carbon emissions of the two extraction methods shows that the solvent extraction method has significantly higher extraction efficiency, even though acid extraction method has a lower carbon footprint. These results may be used to develop strategies for life cycle management of rare earth resources to realize sustainable usage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Europium doped di-calcium magnesium di-silicate orange–red emitting phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-07-01

    Full Text Available A new orange–red europium doped di-calcium magnesium di-silicate (Ca2MgSi2O7:Eu3+ phosphor was prepared by the traditional high temperature solid state reaction method. The prepared Ca2MgSi2O7:Eu3+ phosphor was characterized by X-ray diffractometer (XRD, transmission electron microscopy (TEM, field emission scanning electron microscopy (FESEM with energy dispersive x-ray spectroscopy (EDX, fourier transform infrared spectra (FTIR, photoluminescence (PL and decay characteristics. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P4¯21m, this structure is a member of the melilite group and forms a layered compound. The chemical composition of the sintered Ca2MgSi2O7:Eu3+ phosphor was confirmed by EDX spectra. The PL spectra indicate that Ca2MgSi2O7:Eu3+ can be excited effectively by near ultraviolet (NUV light and exhibit bright orange–red emission with excellent color stability. The fluorescence lifetime of Ca2MgSi2O7:Eu3+ phosphor was found to be 28.47 ms. CIE color coordinates of Ca2MgSi2O7:Eu3+ phosphor is suitable as orange-red light emitting phosphor with a CIE value of (X = 0.5554, Y = 0.4397. Therefore, it is considered to be a new promising orange–red emitting phosphor for white light emitting diode (LED application.

  9. Evaluation of in vivo cytogenetic toxicity of europium hydroxide nanorods (EHNs) in male and female Swiss albino mice.

    Science.gov (United States)

    Bollu, Vishnu Sravan; Nethi, Susheel Kumar; Dasari, Rama Krishna; Rao, Soma Shiva Nageshwara; Misra, Sunil; Patra, Chitta Ranjan

    2016-01-01

    Our group already demonstrated that europium hydroxide nanorods (EHNs) show none or mild toxicity in C57BL/6 mice even at high dose and exhibited excellent pro-angiogenic activity towards in vitro and in vivo models. In the present study, we evaluated the in vivo cytogenetic toxicity of intraperitoneally administered EHNs (12.5-250 mg/kg/b.w.) in male and female Swiss albino mice by analyzing chromosomal aberrations (CAs), mitotic index (MI), micronucleus (MN) from bone marrow and peripheral blood. Furthermore, we performed the cytogenetic toxicity study of EHNs towards Chinese hamster ovary (CHO) cells, in order to compare with the in vivo results. The results of CA assay of mice treated with EHNs (12.5-125 mg/kg/b.w.) showed no significant change in the formation of aberrant metaphases compared to the control group. Also, there was no significant difference in the number of dividing cells between the control group and EHNs-treated groups observed by MI study, suggesting the non-cytotoxicity of EHNs. Additionally, FACS study revealed that EHNs do not arrest cells at any phase of cell cycle in the mouse model. Furthermore, MN test of both bone marrow and peripheral blood showed no significant differences in the induction of MNs when compared with the control group. In vitro results from CHO cells also support our in vivo observations. Considering the role of angiogenesis by EHNs and the absence of its genotoxicity in mouse model, we strongly believe the future application of EHNs in treating various diseases, where angiogenesis plays an important role such as cardiovascular diseases, ischemic diseases and wound healing.

  10. Impact of Vacuum Cooling on Escherichia coli O157:H7 Infiltration into Lettuce Tissue▿

    Science.gov (United States)

    Li, Haiping; Tajkarimi, Mehrdad; Osburn, Bennie I.

    2008-01-01

    Vacuum cooling is a common practice in the California leafy green industry. This study addressed the impact of vacuum cooling on the infiltration of Escherichia coli O157:H7 into lettuce as part of the risk assessment responding to the E. coli O157:H7 outbreaks associated with leafy green produce from California. Vacuum cooling significantly increased the infiltration of E. coli O157:H7 into the lettuce tissue (2.65E+06 CFU/g) compared to the nonvacuumed condition (1.98E+05 CFU/g). A stringent surface sterilization and quadruple washing could not eliminate the internalized bacteria from lettuce. It appeared that vacuuming forcibly changed the structure of lettuce tissue such as the stomata, suggesting a possible mechanism of E. coli O157:H7 internalization. Vacuuming also caused a lower reduction rate of E. coli O157:H7 in stored lettuce leaves than that for the nonvacuumed condition. PMID:18344328

  11. Current trends in detecting non-O157 Shiga toxin-producing Escherichia coli in food.

    Science.gov (United States)

    Wang, Fei; Yang, Qianru; Kase, Julie A; Meng, Jianghong; Clotilde, Laurie M; Lin, Andrew; Ge, Beilei

    2013-08-01

    Non-O157 Shiga toxin-producing Escherichia coli (non-O157 STEC) strains are increasingly recognized as important foodborne pathogens worldwide. Together with E. coli O157:H7, six additional STEC serogroups (O26, O45, O103, O111, O121, and O145) are now regulated as adulterants in certain raw beef products in the United States. However, effective detection and isolation of non-O157 STEC strains from food matrices remain challenging. In the past decade, great attention has been paid to developing rapid and reliable detection methods for STEC in general (targeting common virulence factors) and specific STEC serogroups in particular (targeting serogroup-specific traits). This review summarizes current trends in detecting non-O157 STEC in food, including culture, immunological, and molecular methods, as well as several novel technologies.

  12. Changes in Gene Transcription Induced by Hydrogen Peroxide Treatment of Verotoxin-Producing Escherichia coli O157:H7 and Non-O157 Serotypes on Romaine Lettuce.

    Science.gov (United States)

    Mei, Gui-Ying; Tang, Joshua; Bach, Susan; Kostrzynska, Magdalena

    2017-01-01

    Disease outbreaks of verotoxin-producing Escherichia coli (VTEC) O157:H7 and non-O157 serotypes associated with leafy green vegetables are becoming a growing concern. A better understanding of the behavior of VTEC, particularly non-O157 serotypes, on lettuce under stress conditions is necessary for designing more effective control strategies. Hydrogen peroxide (H2O2) can be used as a sanitizer to reduce the microbial load in leafy green vegetables, particularly in fresh produce destined for the organic market. In this study, we tested the hypothesis that H2O2 treatment of contaminated lettuce affects in the same manner transcription of stress-associated and virulence genes in VTEC strains representing O157 and non-O157 serotypes. Six VTEC isolates representing serotypes O26:H11, O103:H2, O104:H4, O111:NM, O145:NM, and O157:H7 were included in this study. The results indicate that 50 mM H2O2 caused a population reduction of 2.4-2.8 log10 (compared to non-treated control samples) in all six VTEC strains present on romaine lettuce. Following the treatment, the transcription of genes related to oxidative stress (oxyR and sodA), general stress (uspA and rpoS), starvation (phoA), acid stress (gadA, gadB, and gadW), and virulence (stx1A, stx2A, and fliC) were dramatically downregulated in all six VTEC serotypes (P ≤ 0.05) compared to not treated control samples. Therefore, VTEC O157:H7 and non-O157 serotypes on lettuce showed similar survival rates and gene transcription profiles in response to 50 mM H2O2 treatment. Thus, the results derived from this study provide a basic understanding of the influence of H2O2 treatment on the survival and virulence of VTEC O157:H7 and non-O157 serotypes on lettuce.

  13. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

    Science.gov (United States)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

    2017-06-01

    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  14. Investigation on the co-luminescence effect of europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system and its application.

    Science.gov (United States)

    Si, Hailin; Zhao, Fang; Cai, Huan

    2013-01-01

    A novel luminescence, enhancement phenomenon in the europium(III)-dopamine-sodium dodecylbenzene sulfonate system was observed when lanthanum(III) was added. Based on this, a sensitive co-luminescence method was established for the determination of dopamine. The luminescence signal for the europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system was monitored at λ(ex) = 300 nm, λ(em) = 618 nm and pH 8.3. Under optimized conditions, the enhanced luminescence signal responded linearly to the concentration of dopamine in the range 1.0 × 10(-10)-5.0 × 10(-7) mol/L with a correlation coefficient of 0.9993 (n = 11). The detection limit (3σ) was 2.7 × 10(-11) mol/L and the relative standard deviation for 11 parallel measurements of 3.0 × 10(-8) mol/L dopamine was 1.9%. The presented method was successfully applied for the estimation of dopamine in samples of pharmaceutical preparations, human serum and urine. The possible luminescence enhancement mechanism of the system is discussed briefly. Copyright © 2013 John Wiley & Sons, Ltd.

  15. Europium-phenolic network coated BaGdF5 nanocomposites for tri-modal computed tomography/magnetic resonance/luminescence imaging.

    Science.gov (United States)

    Zhu, Wei; Liang, Shuang; Wang, Jing; Yang, Zhe; Zhang, Li; Yuan, Tianmeng; Xu, Zushun; Xu, Haibo; Li, Penghui

    2017-05-01

    Multifunctional nanocomposites based on BaGdF5 nanoparticles (NPs) and metal phenolic network (MPN) have been engineered as novel contrast agents for potential applications in X-ray computed tomography, magnetic resonance and luminescence imaging. The BaGdF5@MPN nanocomposites were synthesized at room temperature by coating BaGdF5 NPs with europium-phenolic network, which was obtained by the coordination of europium (III) with tannic acid (TA). The in vitro cytotoxicity assays against HepG2 cells revealed that the BaGdF5@MPN nanocomposites presented better cytocompatibility and lower cytotoxity than pure BaGdF5 NPs. In addition, vivid red and green luminescence can be observed by confocal laser scanning microscope (CLSM) from the BaGdF5@MPN nanocomposites laden HepG2 cells under the excitation of UV (390 nm) and visible light (440 nm), respectively. The longitudinal relaxivity value (r1) of the nanocomposites was 2.457 mM-1s-1. Moreover, the nanocomoposites exhibited X-ray computed tomography (CT) and T1-weighted magnetic resonance (MR) imaging capacities, and the intensities of the enhanced signals of in vitro CT and MR images were proportional to the concentrations of the nanocomposites. These results indicated that the as-prepared BaGdF5@MPN nanocomposites are promising contrast agents for CT/MR/luminescence imaging.

  16. Effective visible light-active boron and europium co-doped BiVO4 synthesized by sol-gel method for photodegradion of methyl orange.

    Science.gov (United States)

    Wang, Min; Che, Yinsheng; Niu, Chao; Dang, Mingyan; Dong, Duo

    2013-11-15

    Eu-B co-doped BiVO4 visible-light-driven photocatalysts have been synthesized using the sol-gel method. The resulting materials were characterized by a series of joint techniques, including XPS, XRD, SEM, BET, and UV-vis DRS analyses. Compared with BiVO4 and B-BiVO4 photocatalysts, the Eu-B-BiVO4 photocatalysts exhibited much higher photocatalytic activity for methyl orange (MO) degradation under visible light irradiation. The optimal Eu doping content is 0.8 mol%. It was revealed that boron and europium were doped into the lattice of BiVO4 and this led to more surface oxygen vacancies, high specific surface areas, small crystallite size, a narrower band gap and intense light absorbance in the visible region. The doped Eu(III) cations can help in the separation of photogenerated electrons. The synergistic effects of boron and europium in doped BiVO4 were the main reason for improving visible light photocatalytic activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Emission tunability and local environment in europium-doped OH{sup −}-free calcium aluminosilicate glasses for artificial lighting applications

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others

    2015-04-15

    The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.

  18. Modulation of CD157 expression in multi-lineage myeloid differentiation of promyelocytic cell lines.

    Science.gov (United States)

    Hussain, A M; Lee, H C; Chang, C F

    2000-10-01

    CD157/BST-1 is expressed on mature myeloid cells but not on their precursors in vivo. Also CD38, a homologous gene to CD157, is upregulated in promyelocytic HL-60 cells by the monocyte and granulocyte differentiation-inducing 1alpha,25dihydroxyvitamin D3 (VD3) and all-trans retinoic acid (ATRA), respectively. We have examined whether CD157 expression is upregulated when the promyeloid HL-60 and/or U937 cells are induced to differentiate into mature phenotypes in vitro. VD3 treatment irreversibly upregulated the expression of CD157 in HL-60 cells but not in U937 cells in a time- and concentration-dependent manner when analyzed by flow cytometry, immunoblotting and/or RT-PCR. Different monocyte and granulocyte lineage inducers induced CD157 expression to varying extents while the macrophage differentiation-inducing phorbol 12-myristate 13-acetate (PMA) induced its down-regulation. Time-kinetics of VD3 treatment of HL-60 cells showed that the appearance of CD157 and CD11b (a differentiation marker) antigens were not substantial up to 24 hours but increased subsequently although the appearance of CD38 became significant within 6 hours. Two-color staining of VD3-treated HL-60 cells displayed an apparently linear correlation between CD157 and CD11b expression. Dibutyryl cAMP (cAMP agonist) and forskolin (cAMP-increasing agent) augmented the VD3-dependent induction of CD157 and CD11b expression while PGE1 (cAMP-decreasing agent) inhibited it, suggesting the involvement of a cAMP-dependent mechanism in VD3-induced CD157 upregulation. Co-treatment of HL-60 cells with VD3 plus TNF-alpha or ara-C produced an additive effect on CD157 upregulation. The upregulated CD157 in the VD3-differentiated HL-60 cells was able to activate CD157-dependent tyrosine kinase signal when cross-linked with anti-CD157 antibody.

  19. Vivione Bioscience RAPID-B(®) E. coli O157 test kit and non-O157 STEC test kit evaluation.

    Science.gov (United States)

    Miller, Melinda; Ramsaroop, Shawn; Lopez, Chris; Brahmanda, Bharath

    2015-01-01

    RAPID-B(®) is a high performance, integrated microbiology/infectious disease diagnostic system. The system uses hardware and software that are specifically designed for optimal detection using custom, immuno-based reagents designed to react to cell surface antigens of the target bacteria. The Vivione Bioscience RAPID-B Escherichia coli O157 and non-O157 Shiga toxin-producing E. coli (STEC) kits were validated alongside the U.S. Department of Agriculture, Food Safety and Inspection Service (FSIS), Microbiology Laboratory Guidebook (MLG) 5.07 (for E. coli O157) and FSIS MLG 5B.04 (for non-O157 STEC) reference methods for the detection of E. coli O157 and STEC. The matrixes, ground beef and beef trim, were inoculated with appropriate CFU/test portion of E. coli O157 and STEC so as to generate fractional positives results, 5 to 15 positives out of 20 inoculated samples. Samples were enriched in prewarmed Brain Heart Infusion broth at 42 ± 1°C for 6.5-7.5 h or 8.5-9.5 h depending on the sample size. All samples were confirmed using the MLG reference method, regardless of initial screen result. The RAPID-B test methods were statistically equivalent to the reference method for the detection of E. coli O157 and STEC in all tested samples. Inclusivity and exclusivity testing of the RAPID-B methods showed 100% specificity for both kits. Finally, the RAPID-B test methods were shown to be robust when variations were applied to enrichment time, broth temperature, and vortexing time.

  20. 17 CFR 230.157 - Small entities under the Securities Act for purposes of the Regulatory Flexibility Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Small entities under the Securities Act for purposes of the Regulatory Flexibility Act. 230.157 Section 230.157 Commodity and... General § 230.157 Small entities under the Securities Act for purposes of the Regulatory Flexibility Act...

  1. 75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product

    Science.gov (United States)

    2010-03-08

    ... Food Safety Inspection Service Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef... raw beef product that FSIS has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also... Agency procedures for identifying product that may be positive for E. coli O157:H7. DATES: The public...

  2. Plant lesions promote the rapid multiplication of Escherichia coli O157:H7 on post-harvest lettuce

    Science.gov (United States)

    Several outbreaks of Escherichia coli O157:H7 (EcO157) infections have been associated with minimally processed leafy vegetables in the U.S. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with EcO157, the e...

  3. Super-Shed Escherichia coli O157:H7 have potential for increased pathogen persistence and antibiotic resistance dissemination

    Science.gov (United States)

    Cattle are primary reservoirs of Escherichia coli O157:H7 (O157), and super-shedding cattle shed O157 at greater than or equal to 10,000 colony-forming units/g feces. Host, bacteria, and/or the environment reportedly influence the super-shedding phenomenon. We recently demonstrated that a super-she...

  4. 33 CFR Appendix A to Part 157 - Damage Assumptions, Hypothetical Outflows, and Cargo Tank Size and Arrangements

    Science.gov (United States)

    2010-07-01

    ... Outflows, and Cargo Tank Size and Arrangements A Appendix A to Part 157 Navigation and Navigable Waters... MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Pt. 157, App. A Appendix A to Part 157... from tank vessels, three dimensions of the extent of damage of a parallelepiped on the side and bottom...

  5. Detection of Escherichia coli O157:H7 using immuno beads

    Science.gov (United States)

    Tu, Shu-I.; Gehring, Andrew

    2005-11-01

    A new fluorescent sandwich method for the detection of Escherichia coli O157:H7 was developed. Strepavidin coated magnetic beads and fluorescence beads reacted with biotinylated anti E. coli O157 antibodies to form the immuno magnetic beads (IMB) and immuno fluorescence beads (IFB), respectively. The E. coli bacteria captured by IMB were further labeled with IFB to form IMBM-(E. coliO157:H7)N-IFBO sandwich complexes where the subscripts M, N and O were integral numbers. Using broth cultured E. coli O157:H7, the sandwich method was able to detect the bacteria at the level of ~ 103to 104 CFU/mL. Known quantity of freshly cultured E. coli O157:H7 cells were added to ground beef obtained from local markets. The bacteria in inoculated beef patties were enriched in EC broth containing novobiocin. After enriched for 4 h at 40 °C, the developed IMB-IFB method was applied to detect the presence of E. coli O157:H7. The results demonstrated that the developed method could detect the presence of 1 CFU of E. coli O157:H7 per gram of ground beef.

  6. Comparison of two methods for detection of E. coli O157H7 in unpasteurized milk.

    Science.gov (United States)

    Farahmandfar, Maryam; Moori-Bakhtiari, Naghmeh; Gooraninezhad, Saad; Zarei, Mehdi

    2016-10-01

    The most common serotype of enterohaemorrhagic Esherichia coli group or Shiga-toxin-producing E. coli is O157:H7. Domestic and wild ruminants are regarded as the main natural reservoirs. O157:H7 serotype is the major cause of gastrointestinal infections in developed countries. In this study was conducted to survey on the toxigenic E. coli O157: H7 strains in milk of industrial dairy farms. A total number of 150 milk samples were collected from dairy industry in Khuzestan, over a period of 6 months and were evaluated by cultivation in selective media (CT-SMAC) and multiplex PCR. Two isolates were identified as E. coli using biochemical tests, none of them were toxigenic E. coli O157:H7 as determined by multiplex PCR. Using direct PCR on milk samples, 45 samples contained at least one gene of the studied genes in this investigation (rfb, flic, stx1, stx2). With direct PCR, 2 milk samples were positive for toxigenic O157:H7. E. coli O157:H7 is present in this region and so the necessity for strict compliance of health standards is recommended. This is the first study on O157: H7 E. coli milk contamination in Khuzestan province. Based on these results, direct PCR is more accurate than indirect PCR.

  7. Pentadecapeptide BPC 157 Enhances the Growth Hormone Receptor Expression in Tendon Fibroblasts

    Directory of Open Access Journals (Sweden)

    Chung-Hsun Chang

    2014-11-01

    Full Text Available BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

  8. Gastric pentadecapeptide BPC 157 counteracts morphine-induced analgesia in mice.

    Science.gov (United States)

    Boban Blagaic, A; Turcic, P; Blagaic, V; Dubovecak, M; Jelovac, N; Zemba, M; Radic, B; Becejac, T; Stancic Rokotov, D; Sikiric, P

    2009-12-01

    Previously, the gastric pentadecapeptide BPC 157, (PL 14736, Pliva) has been shown to have several beneficial effects, it exert gastroprotective, anti-inflammatory actions, stimulates would healing and has therapeutic value in inflammatory bowel disease. The present study aimed to study the effect of naloxone and BPC 157 on morphine-induced antinociceptive action in hot plate test in the mouse. It was found that naloxone and BPC 157 counteracted the morphine (16 mg/kg s.c.) - analgesia. Naloxone (10 mg/kg s.c.) immediately antagonised the analgesic action and the reaction time returned to the basic values, the development of BPC 157-induced action (10 pg/kg, 10 ng/kg, 10 microg/kg i.p.) required 30 minutes. When haloperidol, a central dopamine-antagonist (1 mg/kg i.p.), enhanced morphine-analgesia, BPC 157 counteracted this enhancement and naloxone reestablished the basic values of pain reaction. BPC 157, naloxone, and haloperidol per se failed to exert analgesic action. In summary, interaction between dopamine-opioid systems was demonstrated in analgesia, BPC 157 counteracted the haloperidol-induced enhancement of the antinociceptive action of morphine, indicating that BPC acts mainly through the central dopaminergic system.

  9. Pentadecapeptide BPC 157 enhances the growth hormone receptor expression in tendon fibroblasts.

    Science.gov (United States)

    Chang, Chung-Hsun; Tsai, Wen-Chung; Hsu, Ya-Hui; Pang, Jong-Hwei Su

    2014-11-19

    BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

  10. Cloacael Carriage and Multidrug Resistance Escherichia coli O157:H7 from Poultry Farms, Eastern Ethiopia

    Directory of Open Access Journals (Sweden)

    Mude Shecho

    2017-01-01

    Full Text Available A cross-sectional study was carried out to determine antimicrobial drug resistance patterns of E. coli O157:H7 isolates and estimate the level of the pathogen. A total of 194 cloacae swab samples were collected randomly in two poultry farms. Standard cultural, biochemical, and serological (latex agglutination methods were used to isolate E. coli O157:H7. The isolates were subjected to antimicrobial susceptibility testing using disc diffusion method. Out of 194 cloacae samples examined, 13.4% (n=26 were found to be positive for E. coli O157:H7. The finding indicated differences in E. coli O157:H7 infection among the different risk factors. Chicken from Adele Poultry Farm showed higher E. coli O157:H7 infection (OR = 3.89 than Haramaya University poultry farm and young birds had more infection (OR = 4.62 than adult birds. Of the total 14 antimicrobials included in the panel of study, the susceptibility results were varied with 96.15% and 0% E. coli O157:H7 isolates expressing resistance to erythromycin, clindamycin, spectinomycin, and ciprofloxacin, respectively. Multidrug resistance to more than two antimicrobial agents was detected in 24 (92.30% of the isolates. The study showed high presence of antimicrobial resistant isolates of E. coli O157:H7. Further study is required to better understand the ecology and evolution of bacterial resistance to antimicrobial agents.

  11. Effects of lactoferrin treatment on Escherichia coli O157:H7 rectal colonization in cattle.

    Science.gov (United States)

    Rybarczyk, Joanna; Kieckens, Evelien; De Zutter, Lieven; Remon, Jean Paul; Vanrompay, Daisy; Cox, Eric

    2017-04-01

    The terminal rectal mucosa has been identified as the predominant colonization site of Escherichia coli O157:H7 in cattle, thus a possible intervention approach should directly target this colonization site. To determine the effect of lactoferrin on E. coli O157:H7 mucosal colonization at the rectum, five 6-month-old Holstein-Friesian calves were experimentally infected with E. coli O157:H7 and received daily rectal treatment with bovine lactoferrin. Three calves that did not receive the lactoferrin served as control group. The treatment decreased faecal shedding of E. coli O157:H7 and completely eliminated the infection in all animals (n=5) after 19 days administration. The rectal mucosa of all animals (n=5) was cleared from E. coli O157:H7 within 13 days of lactoferrin treatment. To evaluate the local immune responses, three calves treated previously with lactoferrin and three calves of the control group were re-infected when E. coli O157:H7 excretion was no longer detected. The rectal administration of lactoferrin resulted in an EspA- and EspB-specific IgA responses at the rectal mucosa. These mucosal antibodies were not detected in the animals which did not receive the lactoferrin powder. Interestingly, no serum IgA antibodies could be found in animals of the group that received the lactoferrin. These findings emphasize the ability of bovine lactoferrin to clear E. coli O157:H7 colonization in cattle, where lactoferrin may influence the local immune processes against E. coli O157:H7 infection. Thus, bovine lactoferrin treatment could be used in the field to eliminate high-level faecal excretion of E. coli O157:H7 in cattle. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Characteristics of Shiga Toxin-Producing Escherichia coli O157 in Slaughtered Reindeer from Northern Finland.

    Science.gov (United States)

    Zweifel, Claudio; Fierz, Lisa; Cernela, Nicole; Laaksonen, Sauli; Fredriksson-Ahomaa, Maria; Stephan, Roger

    2017-03-01

    Fecal samples collected from 470 slaughtered reindeer 6 to 7 months of age were screened by real-time PCR (after enrichment) for Shiga toxin genes (stx) and then for Escherichia coli serogroup O157. Shiga toxin genes were found frequently (>30% of samples), and serogroup O157 was detected in 20% of the stx-positive samples. From these samples, a total of 25 E. coli O157:H - isolates (nonmotile but PCR positive for fliC H7 ) were obtained. Twenty-four of these E. coli O157:H - isolates did not ferment sorbitol and originated from one geographic area. These 24 isolates belonged to the multilocus sequence type 11, typical for Shiga toxin-producing E. coli (STEC) O157:H7 and O157:H - , and harbored genes stx 1a , stx 2c , eae, and hlyA; the stx 2c subtype has been associated with high virulence. In contrast, one E. coli O157:H - isolate (multilocus sequence type 11) did ferment sorbitol, lacked Shiga toxin genes, but was positive for eae, hlyA, and sfpA. This isolate closely resembled an STEC that has lost its Shiga toxin genes. Additional examination revealed that reindeer can be colonized by various other STEC isolates; 21 non-O157 STEC isolates belonged to four multilocus sequence types, harbored stx 1a (8 isolates) or stx 2b (13 isolates), and in the stx 2b -positive isolates the recently described new allelic variants (subAB2-2 and subAB2-3) for subtilase cytotoxin were identified. Hence, slaughtered semidomesticated Finnish reindeer might constitute a little known reservoir for STEC O157:H7/H - and other serogroups, and the risk of direct or indirect transmission of these pathogens from reindeer to humans and domestic livestock must not be overlooked.

  13. Plant Lesions Promote the Rapid Multiplication of Escherichia coli O157:H7 on Postharvest Lettuce▿

    Science.gov (United States)

    Brandl, M. T.

    2008-01-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, the population sizes of E. coli O157:H7 increased 4.0-, 4.5-, and 11.0-fold on lettuce leaves that were mechanically bruised, cut into large pieces, and shredded into multiple pieces, respectively. During the same time, E. coli O157:H7 population sizes increased only twofold on leaves that were left intact after harvest. Also, the population size of E. coli O157:H7 was 27 times greater on young leaves affected by soft rot due to infection by Erwinia chrysanthemi than on healthy middle-aged leaves. Confocal microscopy revealed that leaf tip burn lesions, which are caused by a common physiological disorder of lettuce, harbored dense populations of E. coli O157:H7 cells both internally and externally. Investigation of the colonization of cut lettuce stems by E. coli O157:H7 showed that the pathogen grew 11-fold over 4 h of incubation after its inoculation onto the stems, from which large amounts of latex were released. The results of this study indicate that plant tissue damage of various types can promote significant multiplication of E. coli O157:H7 over a short time and suggest that harvesting and processing are critical control points in the prevention or reduction of E. coli O157:H7 contamination of lettuce. PMID:18641153

  14. Plant lesions promote the rapid multiplication of Escherichia coli O157:H7 on postharvest lettuce.

    Science.gov (United States)

    Brandl, M T

    2008-09-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, the population sizes of E. coli O157:H7 increased 4.0-, 4.5-, and 11.0-fold on lettuce leaves that were mechanically bruised, cut into large pieces, and shredded into multiple pieces, respectively. During the same time, E. coli O157:H7 population sizes increased only twofold on leaves that were left intact after harvest. Also, the population size of E. coli O157:H7 was 27 times greater on young leaves affected by soft rot due to infection by Erwinia chrysanthemi than on healthy middle-aged leaves. Confocal microscopy revealed that leaf tip burn lesions, which are caused by a common physiological disorder of lettuce, harbored dense populations of E. coli O157:H7 cells both internally and externally. Investigation of the colonization of cut lettuce stems by E. coli O157:H7 showed that the pathogen grew 11-fold over 4 h of incubation after its inoculation onto the stems, from which large amounts of latex were released. The results of this study indicate that plant tissue damage of various types can promote significant multiplication of E. coli O157:H7 over a short time and suggest that harvesting and processing are critical control points in the prevention or reduction of E. coli O157:H7 contamination of lettuce.

  15. Escherichia coli O157:H7: Animal Reservoir and Sources of Human Infection

    Science.gov (United States)

    Ferens, Witold A.

    2011-01-01

    Abstract This review surveys the literature on carriage and transmission of enterohemorrhagic Escherichia coli (EHEC) O157:H7 in the context of virulence factors and sampling/culture technique. EHEC of the O157:H7 serotype are worldwide zoonotic pathogens responsible for the majority of severe cases of human EHEC disease. EHEC O157:H7 strains are carried primarily by healthy cattle and other ruminants, but most of the bovine strains are not transmitted to people, and do not exhibit virulence factors associated with human disease. Prevalence of EHEC O157:H7 is probably underestimated. Carriage of EHEC O157:H7 by individual animals is typically short-lived, but pen and farm prevalence of specific isolates may extend for months or years and some carriers, designated as supershedders, may harbor high intestinal numbers of the pathogen for extended periods. The prevalence of EHEC O157:H7 in cattle peaks in the summer and is higher in postweaned calves and heifers than in younger and older animals. Virulent strains of EHEC O157:H7 are rarely harbored by pigs or chickens, but are found in turkeys. The bacteria rarely occur in wildlife with the exception of deer and are only sporadically carried by domestic animals and synanthropic rodents and birds. EHEC O157:H7 occur in amphibian, fish, and invertebrate carriers, and can colonize plant surfaces and tissues via attachment mechanisms different from those mediating intestinal attachment. Strains of EHEC O157:H7 exhibit high genetic variability but typically a small number of genetic types predominate in groups of cattle and a farm environment. Transmission to people occurs primarily via ingestion of inadequately processed contaminated food or water and less frequently through contact with manure, animals, or infected people. PMID:21117940

  16. British Escherichia coli O157 in Cattle Study (BECS): to determine the prevalence of E. coli O157 in herds with cattle destined for the food chain.

    Science.gov (United States)

    Henry, M K; Tongue, S C; Evans, J; Webster, C; McKENDRICK, I J; Morgan, M; Willett, A; Reeves, A; Humphry, R W; Gally, D L; Gunn, G J; Chase-Topping, M E

    2017-11-01

    Escherichia coli O157 are zoonotic bacteria for which cattle are an important reservoir. Prevalence estimates for E. coli O157 in British cattle for human consumption are over 10 years old. A new baseline is needed to inform current human health risk. The British E. coli O157 in Cattle Study (BECS) ran between September 2014 and November 2015 on 270 farms across Scotland and England & Wales. This is the first study to be conducted contemporaneously across Great Britain, thus enabling comparison between Scotland and England & Wales. Herd-level prevalence estimates for E. coli O157 did not differ significantly for Scotland (0·236, 95% CI 0·166-0·325) and England & Wales (0·213, 95% CI 0·156-0·283) (P = 0·65). The majority of isolates were verocytotoxin positive. A higher proportion of samples from Scotland were in the super-shedder category, though there was no difference between the surveys in the likelihood of a positive farm having at least one super-shedder sample. E. coli O157 continues to be common in British beef cattle, reaffirming public health policy that contact with cattle and their environments is a potential infection source.

  17. Characterization of biofilms produced by Escherichia coli O157 isolated from cattle hides

    Science.gov (United States)

    Milojević, L.; Velebit, B.; Baltić, T.; Nikolić, A.; Mitrović, R.; Đorđević, V.

    2017-09-01

    This study aimed to investigate possibility E. coli O157 from cattle hides to produced biofilms. We had 28 suspect primoisolates and 17 were confirmed to be E. coli O157. Biofilm production test showed that more than 50% of this isolates did not produce biofilm. From the other half of the isolates, 5 of them were weakly adherent, 3 were moderately adherent. Since E. coli O157 are one of the main foodborne hazards in meat processing industry and the discovery that some of them can produce moderately adherent biofilms, request necessity of strict implementation of HACCP procedures to prevent further expansion this pathogen.

  18. Determination of the hydrolysis constants of Europium (III), in ion strength media 4, 5 and 6 M NaClO{sub 4} at 303 K; Determinacion de las constantes de hidrolisis del Europio (III), en medios de fuerza ionica 4, 5 y 6 M de NaClO{sub 4} a 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado B, A.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC{sub H} values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)

  19. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  20. Europium-Labeled Synthetic C3a Protein as a Novel Fluorescent Probe for Human Complement C3a Receptor.

    Science.gov (United States)

    Dantas de Araujo, Aline; Wu, Chongyang; Wu, Kai-Chen; Reid, Robert C; Durek, Thomas; Lim, Junxian; Fairlie, David P

    2017-06-21

    Measuring ligand affinity for a G protein-coupled receptor is often a crucial step in drug discovery. It has been traditionally determined by binding putative new ligands in competition with native ligand labeled with a radioisotope of finite lifetime. Competing instead with a lanthanide-based fluorescent ligand is more attractive due to greater longevity, stability, and safety. Here, we have chemically synthesized the 77 residue human C3a protein and conjugated its N-terminus to europium diethylenetriaminepentaacetate to produce a novel fluorescent protein (Eu-DTPA-hC3a). Time-resolved fluorescence analysis has demonstrated that Eu-DTPA-hC3a binds selectively to its cognate G protein-coupled receptor C3aR with full agonist activity and similar potency and selectivity as native C3a in inducing calcium mobilization and phosphorylation of extracellular signal-regulated kinases in HEK293 cells that stably expressed C3aR. Time-resolved fluorescence analysis for saturation and competitive binding gave a dissociation constant (Kd) of 8.7 ± 1.4 nM for Eu-DTPA-hC3a and binding affinities for hC3a (pKi of 8.6 ± 0.2 and Ki of 2.5 nM) and C3aR ligands TR16 (pKi of 6.8 ± 0.1 and Ki of 138 nM), BR103 (pKi of 6.7 ± 0.1 and Ki of 185 nM), BR111 (pKi of 6.3 ± 0.2 and Ki of 544 nM) and SB290157 (pKi of 6.3 ± 0.1 and Ki of 517 nM) via displacement of Eu-DTPA-hC3a from hC3aR. The macromolecular conjugate Eu-DTPA-hC3a is a novel nonradioactive probe suitable for studying ligand-C3aR interactions with potential value in accelerating drug development for human C3aR in physiology and disease.

  1. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  2. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  3. Genotypic analyses of shiga toxin-producing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico.

    Directory of Open Access Journals (Sweden)

    Bianca A Amézquita-López

    Full Text Available Shiga toxin-producing Escherichia coli (STEC are zoonotic enteric pathogens associated with human gastroenteritis worldwide. Cattle and small ruminants are important animal reservoirs of STEC. The present study investigated animal reservoirs for STEC in small rural farms in the Culiacan Valley, an important agricultural region located in Northwest Mexico. A total of 240 fecal samples from domestic animals were collected from five sampling sites in the Culiacan Valley and were subjected to an enrichment protocol followed by either direct plating or immunomagnetic separation before plating on selective media. Serotype O157:H7 isolates with the virulence genes stx2, eae, and ehxA were identified in 40% (26/65 of the recovered isolates from cattle, sheep and chicken feces. Pulse-field gel electrophoresis (PFGE analysis grouped most O157:H7 isolates into two clusters with 98.6% homology. The use of multiple-locus variable-number tandem repeat analysis (MLVA differentiated isolates that were indistinguishable by PFGE. Analysis of the allelic diversity of MLVA loci suggested that the O157:H7 isolates from this region were highly related. In contrast to O157:H7 isolates, a greater genotypic diversity was observed in the non-O157 isolates, resulting in 23 PFGE types and 14 MLVA types. The relevant non-O157 serotypes O8:H19, O75:H8, O111:H8 and O146:H21 represented 35.4% (23/65 of the recovered isolates. In particular, 18.5% (12/65 of all the isolates were serotype O75:H8, which was the most variable serotype by both PFGE and MLVA. The non-O157 isolates were predominantly recovered from sheep and were identified to harbor either one or two stx genes. Most non-O157 isolates were ehxA-positive (86.5%, 32/37 but only 10.8% (4/37 harbored eae. These findings indicate that zoonotic STEC with genotypes associated with human illness are present in animals on small farms within rural communities in the Culiacan Valley and emphasize the need for the development of

  4. Genotypic Analyses of Shiga Toxin-Producing Escherichia coli O157 and Non-O157 Recovered from Feces of Domestic Animals on Rural Farms in Mexico

    Science.gov (United States)

    Amézquita-López, Bianca A.; Quiñones, Beatriz; Cooley, Michael B.; León-Félix, Josefina; Castro-del Campo, Nohelia; Mandrell, Robert E.; Jiménez, Maribel; Chaidez, Cristóbal

    2012-01-01

    Shiga toxin-producing Escherichia coli (STEC) are zoonotic enteric pathogens associated with human gastroenteritis worldwide. Cattle and small ruminants are important animal reservoirs of STEC. The present study investigated animal reservoirs for STEC in small rural farms in the Culiacan Valley, an important agricultural region located in Northwest Mexico. A total of 240 fecal samples from domestic animals were collected from five sampling sites in the Culiacan Valley and were subjected to an enrichment protocol followed by either direct plating or immunomagnetic separation before plating on selective media. Serotype O157:H7 isolates with the virulence genes stx2, eae, and ehxA were identified in 40% (26/65) of the recovered isolates from cattle, sheep and chicken feces. Pulse-field gel electrophoresis (PFGE) analysis grouped most O157:H7 isolates into two clusters with 98.6% homology. The use of multiple-locus variable-number tandem repeat analysis (MLVA) differentiated isolates that were indistinguishable by PFGE. Analysis of the allelic diversity of MLVA loci suggested that the O157:H7 isolates from this region were highly related. In contrast to O157:H7 isolates, a greater genotypic diversity was observed in the non-O157 isolates, resulting in 23 PFGE types and 14 MLVA types. The relevant non-O157 serotypes O8:H19, O75:H8, O111:H8 and O146:H21 represented 35.4% (23/65) of the recovered isolates. In particular, 18.5% (12/65) of all the isolates were serotype O75:H8, which was the most variable serotype by both PFGE and MLVA. The non-O157 isolates were predominantly recovered from sheep and were identified to harbor either one or two stx genes. Most non-O157 isolates were ehxA-positive (86.5%, 32/37) but only 10.8% (4/37) harbored eae. These findings indicate that zoonotic STEC with genotypes associated with human illness are present in animals on small farms within rural communities in the Culiacan Valley and emphasize the need for the development of control

  5. Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

    Energy Technology Data Exchange (ETDEWEB)

    Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee

    2004-07-01

    This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

  6. The ecological habitat and transmission of Escherichia coli O157:H7.

    Science.gov (United States)

    Chekabab, Samuel Mohammed; Paquin-Veillette, Judith; Dozois, Charles M; Harel, Josée

    2013-04-01

    Since its first description in 1982, the zoonotic life-threatening Shiga toxin-producing Escherichia coli O157:H7 has emerged as an important food- and water-borne pathogen that causes diarrhea, hemorrhagic colitis, and hemolytic-uremic syndrome in humans. In the last decade, increases in E. coli O157:H7 outbreaks were associated with environmental contamination in water and through fresh produce such as green leaves or vegetables. Both intrinsic (genetic adaptation) and extrinsic factors may contribute and help E. coli O157:H7 to survive in adverse environments. This makes it even more difficult to detect and monitor food and water safety for public health surveillance. E. coli O157:H7 has evolved in behaviors and strategies to persist in the environment. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  7. Attribution of human VTEC O157 infection from meat products: a quantitative risk assessment approach.

    Science.gov (United States)

    Kosmider, Rowena D; Nally, Pádraig; Simons, Robin R L; Brouwer, Adam; Cheung, Susan; Snary, Emma L; Wooldridge, Marion

    2010-05-01

    To address the risk posed to human health by the consumption of VTEC O157 within contaminated pork, lamb, and beef products within Great Britain, a quantitative risk assessment model has been developed. This model aims to simulate the prevalence and amount of VTEC O157 in different meat products at consumption within a single model framework by adapting previously developed models. The model is stochastic in nature, enabling both variability (natural variation between animals, carcasses, products) and uncertainty (lack of knowledge) about the input parameters to be modeled. Based on the model assumptions and data, it is concluded that the prevalence of VTEC O157 in meat products (joints and mince) at consumption is low (i.e., <0.04%). Beef products, particularly beef burgers, present the highest estimated risk with an estimated eight out of 100,000 servings on average resulting in human infection with VTEC O157.

  8. Surface Characteristics and Adhesion Behavior of Escherichia coli O157:H7: Role of Extracellular Macromolecules

    Science.gov (United States)

    Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...

  9. Gastric pentadecapeptide BPC 157 promotes corneal epithelial defects healing in rats.

    Science.gov (United States)

    Lazić, Ratimir; Gabrić, Nikica; Dekaris, Iva; Bosnar, Damir; Boban-Blagaić, Alenka; Sikirić, Predrag

    2005-06-01

    We evaluated the role of human gastric pentadecapeptide BPC 157 in corneal epithelial defects healing in rats. 48 rats, in 4 groups (N=12). Total debridement of corneal epithelium preformed unilaterally and lesions stained and photographed. Animals medicated as follows: distilled water (control group) or BPC 157 2 pg/ml, 2 ng/ml, 2 microg/ml, 2 drops/rat eye started immediately after injury induction, every 8 hours up to 40 hours (i.e., at 0, 8, 16, 24, 32, 40 h). Lesions were photographed before application or sacrifice (at 48 h). Defect area was analyzed using a special program. Through 48 hour period a steady recovery is noted in controls. Recovery was markedly accelerated in eyes on microg- or ng-topical regimen of BPC 157 (p BPC 157 was shown to be effective in promoting corneal defects healing in rats. Results were dose dependent.

  10. Lettuce cultivar mediates both phyllosphere and rhizosphere activity of Escherichia coli O157:H7.

    Science.gov (United States)

    Quilliam, Richard S; Williams, A Prysor; Jones, Davey L

    2012-01-01

    Plant roots and leaves can be colonized by human pathogenic bacteria, and accordingly some of the largest outbreaks of foodborne illness have been associated with salad leaves contaminated by E. coli O157. Integrated disease management strategies often exploit cultivar resistance to provide a level of protection from economically important plant pathogens; however, there is limited evidence of whether the genotype of the plant can also influence the extent of E. coli O157 colonization. To determine cultivar-specific effects on colonization by E. coli O157, we used 12 different cultivars of lettuce inoculated with a chromosomally lux-marked strain of E. coli O157:H7. Lettuce seedlings grown gnotobiotically in vitro did exhibit a differential cultivar-specific response to E. coli O157 colonization, although importantly there was no relationship between metabolic activity (measured as bioluminescence) and cell numbers. Metabolic activity was highest and lowest on the cultivars Vaila-winter gem and Dazzle respectively, and much higher in endophytic and tightly bound cells than in epiphytic and loosely bound cells. The cultivar effect was also evident in the rhizosphere of plants grown in compost, which suggests that cultivar-specific root exudate influences E. coli O157 activity. However, the influence of cultivar in the rhizosphere was the opposite to that in the phyllosphere, and the higher number and activity of E. coli O157 cells in the rhizosphere may be a consequence of them not being able to gain entry to the plant as effectively. If metabolic activity in the phyllosphere corresponds to a more prepared state of infectivity during human consumption, leaf internalization of E. coli O157 may pose more of a public health risk than leaf surface contamination alone.

  11. Sorbitol-fermenting Shiga toxin-producing Escherichia coli O157 in Austria.

    Science.gov (United States)

    Orth, Dorothea; Grif, Katharina; Zimmerhackl, Lothar Bernd; Würzner, Reinhard

    2009-01-01

    Infections with enterohemorrhagic Escherichia coli (EHEC) are the major cause of hemolytic uremic syndrome (HUS), the most common cause of acute renal failure in childhood. Shiga toxins are considered to be the most important virulence factor of EHEC strains. Non-sorbitol-fermenting EHEC O157:H7 is still the most prevalent serotype isolated worldwide; however, sorbitol-fermenting (SF) EHEC O157:H- (H- indicates nonmotility) strains are increasingly reported. Thirteen SF EHEC O157:H- strains (11 of human origin, two from animals) were detected in Austria between 2002 and 2008. Among the 11 human cases, seven suffered from HUS, two from diarrhea and the remaining two were asymptomatic. Seven of the cases were identified in patients living in or visiting (in one case) the province Salzburg, four were in patients from the province Vorarlberg. Three outbreaks with no more than three persons involved were detected, the other four cases occurred sporadically. The pulsed-field gel-electrophoresis banding patterns of the 13 SF EHEC O157:H- isolates were grouped into three distinct clusters (groups 1, 2 and 3). Strains of the three outbreaks were identical (except for one outbreak strain with one band difference) within each outbreak. In comparison, the Bavarian epidemic strain showed a pattern different from all SF O157:H- strains isolated in Austria. For effective detection of SF EHEC O157:H-, screening for Shiga toxins by ELISA and/or Shiga toxin genes by PCR is absolutely necessary; screening on the basis of phenotypic characteristics such as sorbitol-non-fermentation is not sufficient. Typing methods relying solely on investigation of O157 will detect these strains but should nevertheless also be avoided, so that the prevalent non-O157 strains causing HUS are not missed.

  12. Enhanced detection sensitivity of Escherichia coli O157:H7 using surface-modified gold nanorods

    OpenAIRE

    Ramasamy M; Yi DK; An SSA

    2015-01-01

    Mohankandhasamy Ramasamy,1 Dong Kee Yi,2,3 Seong Soo A An4 1School of Chemical Engineering, Yeungnam University, Gyeongsan, 2Department of Chemistry, 3Department of Energy and Biotechnology, Myongji University, Yongin, 4Department of BioNano Technology, Gachon University, Seongnam, Republic of Korea Abstract: Escherichia coli O157:H7 (O157) is a Gram negative and highly virulent bacteria found in food and water sources, and is a leading cause of chronic diseases worldwide. Diagnosis and pre...

  13. Lettuce cultivar mediates both phyllosphere and rhizosphere activity of Escherichia coli O157:H7.

    Directory of Open Access Journals (Sweden)

    Richard S Quilliam

    Full Text Available Plant roots and leaves can be colonized by human pathogenic bacteria, and accordingly some of the largest outbreaks of foodborne illness have been associated with salad leaves contaminated by E. coli O157. Integrated disease management strategies often exploit cultivar resistance to provide a level of protection from economically important plant pathogens; however, there is limited evidence of whether the genotype of the plant can also influence the extent of E. coli O157 colonization. To determine cultivar-specific effects on colonization by E. coli O157, we used 12 different cultivars of lettuce inoculated with a chromosomally lux-marked strain of E. coli O157:H7. Lettuce seedlings grown gnotobiotically in vitro did exhibit a differential cultivar-specific response to E. coli O157 colonization, although importantly there was no relationship between metabolic activity (measured as bioluminescence and cell numbers. Metabolic activity was highest and lowest on the cultivars Vaila-winter gem and Dazzle respectively, and much higher in endophytic and tightly bound cells than in epiphytic and loosely bound cells. The cultivar effect was also evident in the rhizosphere of plants grown in compost, which suggests that cultivar-specific root exudate influences E. coli O157 activity. However, the influence of cultivar in the rhizosphere was the opposite to that in the phyllosphere, and the higher number and activity of E. coli O157 cells in the rhizosphere may be a consequence of them not being able to gain entry to the plant as effectively. If metabolic activity in the phyllosphere corresponds to a more prepared state of infectivity during human consumption, leaf internalization of E. coli O157 may pose more of a public health risk than leaf surface contamination alone.

  14. Escherichia coli O157:H7 - An Emerging Pathogen in foods of Animal Origin

    Directory of Open Access Journals (Sweden)

    Ch. Bindu Kiranmayi

    Full Text Available Escherichia coli O157:H7 is an emerging public health concern in most countries of the world. E. coli O157:H7 was known to be a human pathogen for nearly 24 years. EHEC O157 infection is estimated to be the fourth most costly food borne disease in Canada and USA, not counting the cost of possible litigation. E. coli O157:H7 and Salmonella are the leading causes of produce related outbreaks, accounting for 20 and 30% respectively. The authority of the Federal Meat Inspection Act, FSIS (Food Safety and Inspection Service declared Escherichia coli O157:H7, an adulterant in raw ground beef and enforced “zero tolerance” (USDA-FSIS, 17 December 1998. Because of the severity of these illnesses and the apparent low infective dose (less than 10 cells, Escherichia coli O157:H7 is considered one of the most serious of known food borne pathogens. Escherichia coli O157:H7 is mainly pathogenic to human but in cattle and other animals, it did not induce any clinical disease except diarrhea. So, these animals act as carriers to Escherichia coli O157:H7. The majority transmission is through eating of undercooked contaminated ground meat and consumption of raw milk, raw vegetables, fruits contaminated by water, cheese, curd and also through consumption of sprouts, lettuce and juice. The conventional isolation procedure includes growth in enrichment broth like modified EC (E. coli broth or modified tryptic soy broth (mTSB Since the infection primarily occurs via faeco-oral route, the preventive measures include food hygiene measures like proper cooking of meat, consumption of pasteurized milk, washing fruits and vegetables especially those to be eaten raw and drinking chlorine treated water and personnel hygiene measures like washing hands after toilet visits. [Veterinary World 2010; 3(8.000: 382-389

  15. Brain-gut Axis and Pentadecapeptide BPC 157: Theoretical and Practical Implications.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Kolenc, Danijela; Vuletic, Lovorka Batelja; Drmic, Domagoj; Grgic, Tihomir; Strbe, Sanja; Zukanovic, Goran; Crvenkovic, Dalibor; Madzarac, Goran; Rukavina, Iva; Sucic, Mario; Baric, Marko; Starcevic, Neven; Krstonijevic, Zoran; Bencic, Martina Lovric; Filipcic, Igor; Rokotov, Dinko Stancic; Vlainic, Josipa

    2016-01-01

    Brain-gut interaction involves, among others, peptidergic growth factors which are native in GI tract and have strong antiulcer potency and thus could from periphery beneficially affect CNS-disorders. We focused on the stable gastric pentadecapeptide BPC 157, an antiulcer peptidergic agent, safe in inflammatory bowel disease trials and now in multiple sclerosis trial, native and stable in human gastric juice. Review of our research on BPC 157 in terms of brain-gut axis. BPC 157 may serve as a novel mediator of Robert's cytoprotection, involved in maintaining of GI mucosa integrity, with no toxic effect. BPC 157 was successful in the therapy of GI tract, periodontitis, liver and pancreas lesions, and in the healing of various tissues and wounds. Stimulated Egr-1 gene, NAB2, FAK-paxillin and JAK-2 pathways are hitherto implicated. Initially corresponding beneficial central influence was seen when BPC 157 was given peripherally and a serotonin release in particular brain areas, mostly nigrostriatal, was changed. BPC 157 modulates serotonergic and dopaminergic systems, beneficially affects various behavioral disturbances that otherwise appeared due to specifically (over)stimulated/damaged neurotransmitters systems. Besides, BPC 157 has neuroprotective effects: protects somatosensory neurons; peripheral nerve regeneration appearent after transection; after traumatic brain injury counteracts the otherwise progressing course, in rat spinal cord compression with tail paralysis, axonal and neuronal necrosis, demyelination, cyst formation and rescues tail function in both short-terms and long-terms; after NSAIDs or insulin overdose or cuprizone encephalopathies were attenuated along with GI, liver and vascular injuries. BPC 157, a gastric peptide, may serve as remedy in various CNS-disorders.

  16. Plant Lesions Promote the Rapid Multiplication of Escherichia coli O157:H7 on Postharvest Lettuce▿

    OpenAIRE

    Brandl, M. T.

    2008-01-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, th...

  17. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays

    Directory of Open Access Journals (Sweden)

    Jinliang Wang

    2016-03-01

    Full Text Available Shiga toxin-producing Escherichia coli O157:H7 (STEC cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2 that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA; one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 105 CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  18. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays.

    Science.gov (United States)

    Wang, Jinliang; Katani, Robab; Li, Lingling; Hegde, Narasimha; Roberts, Elisabeth L; Kapur, Vivek; DebRoy, Chitrita

    2016-03-25

    Shiga toxin-producing Escherichia coli O157:H7 (STEC) cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2) that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA); one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 10⁵ CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  19. Reduction of Escherichia coli O157:H7 populations in soy sauce, a fermented seasoning.

    Science.gov (United States)

    Masuda, S; Hara-Kudo, Y; Kumagai, S

    1998-06-01

    We studied five Escherichia coli O157:H7 strains in soy sauce which was incubated at 4, 18, or 30 degrees C after inoculation. The cell numbers of E. coli O157:H7 decreased to an undetectable level (soy sauce samples at 30 degrees C, but did not decrease in the 0.1 M phosphate-buffered saline (pH 7.0) control solution under the same conditions. Soy sauce reduced the cell numbers of bacteria at 18 degrees C to a lesser extent than at 30 degrees C, but to a greater extent than at 4 degrees C. Components of soy sauce such as 10% or 16% NaCl, 5% ethanol, lactic acid, or acetic acid at pH 4.5, sodium benzoate (0.6 g/kg), or p-hydroxybenzoic acid n-butyl ester (0.05 g/liter) caused a reduction of the E. coli O157:H7 population at 30 degrees C, and the anti-E. coli O157:H7 effect of each component was less than that of soy sauce. The fate of E. coli O157:H7 cells in a buffered solution containing various components of soy sauce resembled that in soy sauce at 30 degrees C, which demonstrated the importance of the combination of the soy sauce components for its anti-E coli O157:H7 action.

  20. Selection of antibiotics in detection procedure of Escherichia coli O157:H7 in vegetables

    Science.gov (United States)

    Hoang, Hoang A.; Nhung, Nguyen T. T.

    2017-09-01

    Detection of Escherichia coli O157:H7 in ready-to-eat fresh vegetables is important since this bacteria is considered as one of the most important pathogens in relation to public health. However, it could be a big challenge for detection of initial low concentrations of E. coli O157:H7 in the samples. In this study, selection of antibiotics that suppress growth of background bacteria to enable detection of E. coli O157:H7 in ready-to-eat fresh vegetables was investigated. Firstly, different combinations of two antibiotics, i.e. novobiocin (N) and vancomycin (V), in BHI broth were conducted. The three antibiotic combinations were preliminary examined their effect on the growth of E. coli O157:H7 and Bacillus spp. in broth based on OD600nm measurement. The combination of both the antibiotics was selected to examine their possibility to support detection of E. coli O157:H7 in vegetables. It was successful when two antibiotics showed their support in detection of E. coli O157:H7 at very low concentration of 2 CFU per one gram of lettuce. Usage of these antibiotics is simple and cheap in the detection procedure and could be applied to other types of ready-to-eat fresh vegetables popular in Vietnam.

  1. Soil macropores and compaction control the leaching potential of Escherichia coli O157:H7.

    Science.gov (United States)

    Artz, Rebekka R E; Townend, John; Brown, Katie; Towers, Willie; Killham, Ken

    2005-02-01

    The influence of soil structure in controlling leaching of Escherichia coli O157:H7 through soil was investigated under controlled conditions using both intact and repacked soil cores. Leaching rates of E. coli O157:H7 decreased with increasing dry bulk density and were significantly increased by the presence of earthworm (Lumbricus terrestris) burrows in repacked cores. For intact cores, the percentage of E. coli O157:H7 that leached through replicate cores within 72 h varied from 0.01% to 24%. In contrast, the dry bulk densities of intact cores varied only slightly and were not significantly correlated with leaching. Differences in the numbers of E. coli O157:H7 cells in the leachates were not related to variability in the flow volumes, which were relatively constant as a result of the experimental design, but were strongly correlated with the variations in concentrations of E. coli O157:H7 in the leachates. Relatively small variations in the internal structure of soil cores can therefore significantly affect the pathway that cells can take through soil. Factors such as compaction and the occurrence of pores providing preferential flow are prime determinants in the degree of leaching of E. coli O157:H7 through soil.

  2. Complexation of lactate with neodymium(III) and europium(III) at variable temperatures: studies by potentiometry, microcalorimetry, optical absorption, and luminescence spectroscopy.

    Science.gov (United States)

    Tian, Guoxin; Martin, Leigh R; Rao, Linfeng

    2010-11-15

    The complexation of neodymium(III) and europium(III) with lactate was studied at variable temperatures by potentiometry, absorption spectrophotometry, luminescence spectroscopy, and microcalorimetry. The stability constants of three successive lactate complexes (ML(2+), ML(2)(+), and ML(3)(aq), where M stands for Nd and Eu and L stands for lactate) at 10, 25, 40, 55, and 70 °C were determined. The enthalpies of complexation at 25 °C were determined by microcalorimetry. Thermodynamic data show that the complexation of trivalent lanthanides (Nd(3+) and Eu(3+)) with lactate is exothermic and the complexation becomes weaker at higher temperatures. Results from optical absorption and luminescence spectroscopy suggest that the complexes are inner-sphere chelate complexes in which the protonated α-hydroxyl group of lactate participates in the complexation.

  3. Selective separation of americium from europium using 2,9-bis(triazine)-1,10-phenanthrolines in ionic liquids: a new twist on an old story.

    Science.gov (United States)

    Williams, Neil J; Dehaudt, Jérémy; Bryantsev, Vyacheslav S; Luo, Huimin; Abney, Carter W; Dai, Sheng

    2017-02-28

    Bis-triazine phenanthrolines have shown great promise for f-block metal separations, attributable to their highly preorganized structure, nitrogen donors, and more enhanced covalent bonding with actinides over lanthanides. However, their limited solubility in traditional solvents remains a technological bottleneck. Herein we report our recent work using a simple 2,9-bis(triazine)-1,10-phenanthroline (Me-BTPhen) dissolved in an ionic liquid (IL), demonstrating the efficacy of IL extraction systems for the selective separation of americium from europium, achieving separation factors in excess of 7500 and selectively removing up to 99% of the americium. Characterization of the coordination environment was performed using a combination of X-ray absorption fine structure spectroscopy (XAFS) and density functional theory (DFT) calculations.

  4. Experimental and Theoretical Studies on the Structure and Photoluminescent Properties of New Mononuclear and Homodinuclear Europium(III β-Diketonate Complexes

    Directory of Open Access Journals (Sweden)

    João P. Martins

    2015-01-01

    Full Text Available Two novel europium(III complexes, a monomer and a homodimer, with 1-(4-chlorophenyl-4,4,4-trifluoro-1,3-butanedione (Hcbtfa and 5-chloro-1,10-phenanthroline (cphen ligands, formulated as [Eu(cbtfa3(cphen] and [Eu2(cbtfa4(cphen2(CH3O2], have been synthesized. Their structures have been elucidated by X-ray diffraction and their absorption and emission properties have been studied in the solid state. The experimental data has then been used to test the recently released LUMPAC software, a promising tool which can facilitate the design of more efficient lanthanide light-conversion molecular devices by combining ground state geometry, excited state energy, and luminescent properties calculations.

  5. Optical Temperature Probe Based on the Fluorescence Decay Time of Tris-(dibenzoylmethane mono (5-amino-1,10-phenanthroline-europium(III

    Directory of Open Access Journals (Sweden)

    Hung T. LAM

    2010-08-01

    Full Text Available The measurement of temperature is essential in defining the physical and chemical properties of any system. This is particularly true in dynamic systems where the temperature may fluctuate during the process. In this paper we investigated the potential of tris-(dibenzoylmethane mono (5-amino-1, 10-phenanthroline-europium(III ( Eu[tdap] as an optical temperature probe. The principle of the measurement is based on the temperature dependence of the fluorescence decay time of Eu(tdap embedded in polystyrene. Within the investigated temperature range between 3 and 70°C a linear correlation between temperature and decay time was found. The probe is accurate and repeatable and there is no cross-sensitivity to pH changes. Continuous measurement for more than 2.5 hours at which the temperature is switched between two different temperatures shows no signal drift. The relative standard deviation is less than 0.65 percent.

  6. Crystal structure and luminescence of a europium coordination polymer {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞

    Science.gov (United States)

    Li, X.; Zheng, X.; Jin, L.; Lu, S.; Qin, W.

    2000-02-01

    The structure of the complex [Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy) ( m-MOBA: m-methoxybenzoate, 4,4'-bpy: 4,4'-bipyridine) was determined by single crystal X-ray diffraction. The bonding around each europium consists of two oxygen atoms of the chelated carboxyl group, two oxygen atoms of two water molecules and four oxygen atoms of the bidentate bridging carboxylate groups, forming an infinite polymeric chain structure. The luminescence behaviour of Eu 3+ in {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞ was observed at 77 K. The emission spectra of 5D 1→ 7F J ( J=1-3) and 5D 0→ 7F J ( J=0-4) transitions were recorded. The complex displays intense luminescence which may be related to the m-MOBA ligand and the polymeric coordination.

  7. Synthesis and luminescence properties of two novel europium (III) perchlorate complexes with bis(benzylsulfinyl)methane and 1,10-phenanthroline

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail: nmglwx@163.com [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Guo, Feng [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-Fang; Feng, Shu-Yan; Bai, Juan; Xin, Xiao-Dong [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)

    2014-09-15

    Two novel binary and ternary Europium (III) perchlorate complexes were synthesized. The binary complex was prepared with bis(benzylsulfinyl)methane as ligand, and the ternary complex was with bis(benzylsulfinyl)methane as first ligand and 1,10-Phenanthroline as second ligand. They were characterized by element analysis, molar conductivity, coordination titration analysis, IR, TG-DSC, {sup 1}HNMR and UV spectra. The results indicated that the composition of binary and ternary complexes was EuL{sub 2.5}·(ClO{sub 4}){sub 3}·3H{sub 2}O and Eu{sub 2}L{sub 4}·phen·(ClO{sub 4}){sub 6}·12H{sub 2}O (L=C{sub 6}H{sub 5}CH{sub 2}SOCH{sub 2}SOCH{sub 2}C{sub 6}H{sub 5}), respectively. The fluorescent spectra illustrated that the complexes displayed characteristic Europium (III) ion fluorescence in solid state, indicating the ligands favored energy transfer to the excitation state energy level of it. The strongest characteristic fluorescence emission intensity of the ternary system was 1.87 times as strong as that of the binary system. The fluorescent quantum yields of the Eu (III) ternary and binary complexes were also calculated. Additionally, the phosphorescence spectra and the luminescence mechanisms of the complexes were studied and explained. - Highlights: • Two rare earth complexes are new. And they are stabilized. • The intensities of the two rare earth complexes were all stronger and the lifetimes were longer. • The introduction of the second organic ligand1,10-Phenanthroline enhanced the fluorescence intensity. • The fluorescent quantum yields of two complexes being calculated are both very high.

  8. Effect of Citrus Byproducts on Survival of O157:H7 and Non-O157 Escherichia coli Serogroups within In Vitro Bovine Ruminal Microbial Fermentations

    Directory of Open Access Journals (Sweden)

    Heather A. Duoss-Jennings

    2013-01-01

    Full Text Available Citrus byproducts (CBPs are utilized as a low cost nutritional supplement to the diets of cattle and have been suggested to inhibit the growth of both Escherichia coli O157:H7 and Salmonella. The objective of this study was to examine the effects in vitro that varying concentrations of CBP in the powdered or pelleted variety have on the survival of Shiga-toxin Escherichia coli (STEC serotypes O26:H11, O103:H8, O111:H8, O145:H28, and O157:H7 in bovine ruminal microorganism media. The O26:H11, O111:H8, O145:H28, and O157:H7 serotypes did not exhibit a change in populations in media supplemented with CBP with either variety. The O103:H8 serotype displayed a general trend for an approximate 1log10 reduction in 5% powdered CBP and 20% pelleted CBP over 6 h. There was a trend for reductions in populations of a variant form of O157:H7 mutated in the stx1 and stx2 genes in higher concentrations of CBP. These results suggest that variations exist in the survival of these serotypes of STEC within mixed ruminal microorganism fluid media when supplemented with CBP. Further research is needed to determine why CBPs affect STEC serotypes differently.

  9. Growth of Escherichia coli O157:H7, Non-O157 Shiga Toxin-Producing Escherichia coli , and Salmonella in Water and Hydroponic Fertilizer Solutions.

    Science.gov (United States)

    Shaw, Angela; Helterbran, Kara; Evans, Michael R; Currey, Christopher

    2016-12-01

    The desire for local, fresh produce year round is driving the growth of hydroponic growing systems in the United States. Many food crops, such as leafy greens and culinary herbs, grown within hydroponics systems have their root systems submerged in recirculating nutrient-dense fertilizer solutions from planting through harvest. If a foodborne pathogen were introduced into this water system, the risk of contamination to the entire crop would be high. Hence, this study was designed to determine whether Escherichia coli O157:H7, non-O157 Shiga toxin-producing E. coli , and Salmonella were able to survive and reproduce in two common hydroponic fertilizer solutions and in water or whether the bacteria would be killed or suppressed by the fertilizer solutions. All the pathogens grew by 1 to 6 log CFU/ml over a 24-h period, depending on the solution. E. coli O157:H7 reached higher levels in the fertilizer solution with plants (3.12 log CFU/ml), whereas non-O157 Shiga toxin-producing E. coli and Salmonella reached higher levels in the fertilizer solution without plants (1.36 to 3.77 log CFU/ml). The foodborne pathogens evaluated here survived for 24 h in the fertilizer solution, and populations grew more rapidly in these solutions than in plain water. Therefore, human pathogens entering the fertilizer solution tanks in hydroponic systems would be expected to rapidly propagate and spread throughout the system and potentially contaminate the entire crop.

  10. Therapeutic potential of pro-angiogenic BPC157 is associated with VEGFR2 activation and up-regulation.

    Science.gov (United States)

    Hsieh, Ming-Jer; Liu, Hsien-Ta; Wang, Chao-Nin; Huang, Hsiu-Yun; Lin, Yuling; Ko, Yu-Shien; Wang, Jong-Shyan; Chang, Vincent Hung-Shu; Pang, Jong-Hwei S

    2017-03-01

    BPC 157, a pentadecapeptide with extensive healing effects, has recently been suggested to contribute to angiogenesis. However, the underlying mechanism is not yet clear. The present study aimed to explore the potential therapeutic effect and pro-angiogenic mechanism of BPC 157. As demonstrated by the chick chorioallantoic membrane (CAM) assay and endothelial tube formation assay, BPC 157 could increase the vessel density both in vivo and in vitro, respectively. BPC 157 could also accelerate the recovery of blood flow in the ischemic muscle of the rat hind limb as detected by laser Doppler scanning, indicating the promotion of angiogenesis. Histological analysis of the hind limb muscle confirmed the increased number of vessels and the enhanced vascular expression of vascular endothelial growth factor receptor 2 (VEGFR2) in rat with BPC 157 treatment. In vitro study using human vascular endothelial cells further confirmed the increased mRNA and protein expressions of VEGFR2 but not VEGF-A by BPC 157. In addition, BPC 157 could promote VEGFR2 internalization in vascular endothelial cells which was blocked in the presence of dynasore, an inhibitor of endocytosis. BPC 157 time dependently activated the VEGFR2-Akt-eNOS signaling pathway which could also be suppressed by dynasore. The increase of endothelial tube formation induced by BPC 157 was also inhibited by dynasore. This study demonstrates the pro-angiogenic effects of BPC 157 that is associated with the increased expression, internalization of VEGFR2, and the activation of VEGFR2-Akt-eNOS signaling pathway. BPC 157 promotes angiogenesis in CAM assay and tube formation assay. BPC 157 accelerates the blood flow recovery and vessel number in rats with hind limb ischemia. BPC 157 up-regulates VEGFR2 expression in rats with hind limb ischemia and endothelial cell culture. BPC 157 promotes VEGFR2 internalization in association with VEGFR2-Akt-eNOS activation. BPC 157 promotes angiogenesis in CAM assay and tube

  11. Isolation of shiga toxin-producing Escherichia coli O157:H7/NM from hamburger and chicken nugget

    Directory of Open Access Journals (Sweden)

    Ali Miri

    2014-01-01

    Material and Methods: From June 2013 to July 2013, a total of 190 hamburger (120 and chicken nugget (70, were collected from four randomly selected factories in Isfahan, Iran. They were evaluated for the presence of E. coli O157:H7/NM using microbiological culture and polymerase chain reaction. Statistical analysis was performed using SPSS software version 16.0 (SPSS Inc., Chicago o, IL, USA. Results: From a total of 190 samples analyzed four samples (2.1% were contaminated with E. coli O157. All of the E. coli O157 were isolated from hamburger samples (3.3% and chicken nugget samples were negative. Of four E. coli O157 isolated, only one sample was serotype E. coli O157:H7 and others were serotype E. coli O157:NM. Among four E. coli O157:H7/NM isolates, one strain was positive for all stx1, stx2, eaeA and ehxA genes. One strain was positive for stx2 gene. The other two were negative for these genes. All isolates (100% were resistant to one or more antimicrobial agents. Conclusions: The results of this study showed that hamburger could be a significant source of E. coli O157:H7 and E. coli O157:NM serotypes in Iran and multi-resistance was found in 27% of E. coli O157 strains and this is a major public health concern.

  12. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives.

    Science.gov (United States)

    Dasari, Srikanth; Patra, Ashis K

    2015-12-14

    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  13. Application of a room temperature ionic liquid for nuclear spent fuel reprocessing: speciation of trivalent europium and solvatation effects; Application d'un liquide ionique basse temperature pour les procedes de separation: speciation de l'europium trivalent et effets solvatation

    Energy Technology Data Exchange (ETDEWEB)

    Moutiers, G.; Mekki, S. [CEA Saclay, Dept. de Physico-Chimie, Service de Chimie Physique, 91 - Gif sur Yvette (France); Billard, I. [IN2P3/CNRS, 69 - Villeurbanne (France)

    2007-07-01

    One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf{sub 2}N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf{sub 2}N for the whole thesis and start with

  14. Overexpression of CD157 contributes to epithelial ovarian cancer progression by promoting mesenchymal differentiation.

    Directory of Open Access Journals (Sweden)

    Simona Morone

    Full Text Available Epithelial ovarian carcinoma (EOC is an aggressive tumor often diagnosed at an advanced stage, when there is little or no prospect of cure. Despite advances in surgical and chemotherapeutic strategies, only marginal improvements in patient outcome have been obtained. Hence, unraveling the biological mechanisms underpinning EOC progression is critical for improving patients' survival. Recently, we reported that CD157 (an ectoenzyme regulating leukocyte diapedesis is expressed in EOC and that high expression of the molecule is negatively correlated with the disease outcome in patients. Here, we demonstrate that forced overexpression of CD157 in OVCAR-3, TOV-21G, A2780 and OV-90 ovarian cancer cell lines promotes morphological and phenotypic changes characterized by disruption of intercellular junctions, downregulation of epithelial markers and upregulation of mesenchymal ones. These changes in cell shape and phenotype bring to reduced sensitivity to anoikis, increased anchorage-independent growth, cell motility and mesothelial invasion. Conversely, knockdown of CD157 in OV-90 and OC314 cells reverts the mesenchymal phenotype and reduces the cells' migratory potential. Transcriptome profiling analysis highlighted 378 significantly differentially expressed genes, representing the signature of CD157-overexpressing OVCAR-3 and OV-90 cells. The modulation of selected genes translates into alteration of protein expression that give cells a highly malignant phenotype. The overall picture deduced from the analysis of the modulated transcripts is that high expression of CD157 strengthens a number of biological processes favoring tumor progression (including development and cell motility, and weakens several biological processes hindering tumor progression (such as apoptosis, cell death and response to stress. Together, these findings implicate CD157 in the progression of EOC to metastatic disease and suggest that CD157 may represent a valuable therapeutic

  15. Characterization of Shiga Toxin-Producing Escherichia coli O157 Isolates from Bovine Carcasses.

    Science.gov (United States)

    Fontcuberta, M; Planell, R; Torrents, A; Sabaté, S; Gonzalez, R; Ramoneda, M; de Simón, M

    2016-08-01

    The main purpose of this study was to determine the prevalence of Escherichia coli O157 on bovine carcasses before and after chilling at a large slaughterhouse located in the city of Barcelona, Spain, to assess the effectiveness of dry chilling on reducing E. coli O157 contamination of carcasses. In addition, the study characterized the E. coli O157 strains isolated in terms of virulence factors, antibiotic susceptibility, and their genetic diversity. Individual bovine carcasses were sampled before (n = 300) and after (n = 300) chilling over an 8-month period. Positive samples for E. coli O157 were subjected to virulence screening by PCR (stx1, stx2, and eaeA genes and the fliCH7 gene), antimicrobial susceptibility testing, and molecular typing by pulsed-field gel electrophoresis. A total of 9.7% (29 of 300) of the nonrefrigerated carcasses examined and 2.3% (7 of 300) of the refrigerated carcasses were positive for E. coli O157. All the isolates were serotype O157:H7, 92% (33 of 36) carried the stx1, stx2, and eaeA genes, and 8% (3 of 36) carried the stx2 and eaeA genes. Antimicrobial susceptibility testing showed a high degree of resistance: 29 strains (81%) were resistant to at least 1 antimicrobial of the 12 antimicrobials tested; 69% (25 of 36) were resistant to 4 or more antimicrobials. Molecular typing by pulsed-field gel electrophoresis found a high diversity of genetic types, implying little cross-contamination in the slaughterhouse. This study confirms that E. coli O157:H7 is present on the carcasses slaughtered in Spain, although its prevalence is reduced by the dry chilling process used. The recovered isolates showed potential pathogenesis and a high degree of multidrug resistance, confirming the importance of bovine meat monitoring.

  16. Role of glycoside hydrolase genes in sinigrin degradation by E. coli O157:H7.

    Science.gov (United States)

    Cordeiro, Roniele P; Doria, Juan H; Zhanel, George G; Sparling, Richard; Holley, Richard A

    2015-07-16

    This work examined Escherichia coli O157:H7 strain 02-0304 for putative genes responsible for sinigrin hydrolysis. Sinigrin is a glucosinolate present in Oriental mustard (Brassica juncea), and its hydrolysis is mediated in plants by the enzyme myrosinase. Sinigrin hydrolysis by plant or bacterial myrosinase yields allyl isothiocyanate (AITC) which is bactericidal. In silico analysis using public databases found sequence similarity between plant myrosinase and enzymes encoded by genes from β-glucosidase families in E. coli O157:H7. Specifically, 6-phospho-β-glucosidase encoded by the genes bglA and ascB (family 1), and chbF (family 4) present in E. coli O157:H7 showed the highest similarity. Polymerase chain reaction (PCR) confirmed the presence of bglA, ascB, and chbF in the clinical E. coli strain tested. Disruption of these genes in wild-type E. coli O157:H7 strain 02-0304 using lambda-red replacement created single and double mutants. The relative importance of each gene in the hydrolysis of sinigrin by E. coli O157:H7 was also assessed by comparing gene expression and sinigrin degradation rates among the E. coli O157:H7 wild-type strain and its mutants. The results suggested that the genes bglA and ascB play a substantial role in the degradation of sinigrin by E. coli O157:H7 strain 02-0304. Copyright © 2015. Published by Elsevier B.V.

  17. ADP ribosyl-cyclases (CD38/CD157), social skills and friendship.

    Science.gov (United States)

    Chong, Anne; Malavasi, Fabio; Israel, Salomon; Khor, Chiea Chuen; Yap, Von Bing; Monakhov, Mikhail; Chew, Soo Hong; Lai, Poh San; Ebstein, Richard P

    2017-04-01

    Why some individuals seek social engagement while others shy away has profound implications for normal and pathological human behavior. Evidence suggests that oxytocin (OT), the paramount human social hormone, and CD38 that governs OT release, contribute to individual differences in social skills from intense social involvement to extreme avoidance that characterize autism. To explore the neurochemical underpinnings of sociality, CD38 expression of peripheral blood leukocytes (PBL) was measured in Han Chinese undergraduates. First, CD38 mRNA levels were correlated with lower Autism Quotient (AQ), indicating enhanced social skills. AQ assesses the extent of autistic-like traits including the propensity and dexterity needed for successful social engagement in the general population. Second, three CD157 eQTL SNPs in the CD38/CD157 gene region were associated with CD38 expression. CD157 is a paralogue of CD38 and is contiguous with it on chromosome 4p15. Third, association was also observed between the CD157 eQTL SNPs, CD38 expression and AQ. In the full model, CD38 expression and CD157 eQTL SNPs altogether account for a substantial 14% of the variance in sociality. Fourth, functionality of CD157 eQTL SNPs was suggested by a significant association with plasma oxytocin immunoreactivity products. Fifth, the ecological validity of these findings was demonstrated with subjects with higher PBL CD38 expression having more friends, especially for males. Furthermore, CD157 sequence variation predicts scores on the Friendship questionnaire. To summarize, this study by uniquely leveraging various measures reveals salient elements contributing to nonkin sociality and friendship, revealing a likely pathway underpinning the transition from normality to psychopathology. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Influence of transportation stress and animal temperament on fecal shedding of Escherichia coli O157:H7 in feedlot cattle.

    Science.gov (United States)

    Schuehle Pfeiffer, C E; King, D A; Lucia, L M; Cabrera-Diaz, E; Acuff, G R; Randel, R D; Welsh, T H; Oliphint, R A; Curley, K O; Vann, R C; Savell, J W

    2009-02-01

    To test the influence of transportation stress and temperament on shedding of Escherichia coli O157:H7, cattle (n=150) were classified at various stages of production as Excitable, Intermediate or Calm based on a variety of disposition scores. Presence of E. coli O157:H7 was determined by rectal swabs from live animals and from colons collected postmortem. Percentage of cattle shedding E. coli O157:H7 at arrival at the feedlot was approximately equal among temperament groups. Before shipment to the processing facility, a higher (P=0.03) proportion of cattle from the Calm group shed E. coli O157:H7 compared to the other temperament groups. When pooled across all sampling periods, cattle from the Calm group had a greater percentage test positive for E. coli O157:H7. Neither the acute stressor of transportation nor a more excitable temperament led to increased shedding of E. coli O157:H7 in cattle.

  19. Inactivation of Escherichia coli O157:H7 by essential oil from Cinnamomum zeylanicum.

    Science.gov (United States)

    Senhaji, Ouafae; Faid, Mohamed; Kalalou, Ichraq

    2007-04-01

    Escherichia coli O157:H7 is a pathogen strain, which causes hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans. The control of bacterial cells in foods is an important factor to reduce foodborne diseases due to E. coli O157:H7. Assays to inactivate E. coli O157:H7 were carried out by using the cinnamon oil obtained by steam distillation for 6 hours. When E. coli O157:H7 cells were incubated at 37 degrees C for 2 hours in the presence of 0.025% of the essential oil from cinnamon, a dramatic decrease was observed in the viable counts (from 10(7) to 3.10(4) CFU/mL-1). In the presence of 0.05% of the oil, most of cells were killed after 30 min, suggesting that the antimicrobial activity of essential oil is bactericidal against E. coli. The minimal inhibitory concentration of the essential oil from cinnamon was around 625 ppm against E. coli O157:H7 and E. coli ATCC 25921, around 1250 ppm against E. coli ATCC25922 and around 2500 ppm against E. coli ATCC11105.

  20. Inactivation of Escherichia coli O157:H7 by essential oil from Cinnamomum zeylanicum

    Directory of Open Access Journals (Sweden)

    Ouafae Senhaji

    Full Text Available Escherichia coli O157:H7 is a pathogen strain, which causes hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans. The control of bacterial cells in foods is an important factor to reduce foodborne diseases due to E. coli O157:H7. Assays to inactivate E. coli O157:H7 were carried out by using the cinnamon oil obtained by steam distillation for 6 hours. When E. coli O157:H7 cells were incubated at 37°C for 2 hours in the presence of 0.025% of the essential oil from cinnamon, a dramatic decrease was observed in the viable counts (from 10(7 to 3.10(4 CFU/mL-1. In the presence of 0.05% of the oil, most of cells were killed after 30 min, suggesting that the antimicrobial activity of essential oil is bactericidal against E. coli. The minimal inhibitory concentration of the essential oil from cinnamon was around 625 ppm against E. coli O157:H7 and E. coli ATCC 25921, around 1250 ppm against E. coli ATCC25922 and around 2500 ppm against E. coli ATCC11105.

  1. Environmental sources and transmission of Escherichia coli O157 in feedlot cattle.

    Science.gov (United States)

    Van Donkersgoed, J; Berg, J; Potter, A; Hancock, D; Besser, T; Rice, D; LeJeune, J; Klashinsky, S

    2001-01-01

    A study was conducted in 2 feedlots in southern Alberta to identify environmental sources and management factors associated with the prevalence and transmission of Escherichia coli O157:H7. Escherichia coli O157:H7 was isolated in preslaughter pens of cattle from feces (0.8%), feedbunks (1.7%), water troughs (12%), and incoming water supplies (4.5%), but not from fresh total mixed rations. Fresh total mixed rations did not support the growth of E. coli O157:H7 and E. coli from bovine feces following experimental inoculation. Within a feedlot, the feces, water troughs, and feedbunks shared a few indistinguishable subtypes of E. coli O157:H7. A few subtypes were repeatedly isolated in the same feedlot, and the 2 feedlots shared a few indistinguishable subtypes. The prevalence of E. coli O157:H7 in water troughs of preslaughter cattle in 1 feedlot was associated with season, maximum climatic temperatures the week before sampling; total precipitation the week before sampling, and coliform and E. coli counts in the water trough. PMID:11565371

  2. Detection and in vitro metabolism of the confiscated peptides BPC 157 and MGF R23H.

    Science.gov (United States)

    Cox, Holly D; Miller, Geoff D; Eichner, Daniel

    2017-10-01

    A new peptide, body protecting compound (BPC), BPC 157, and a variant of mechano-growth factor (MGF), MGF R23H, were identified in confiscated vials. BPC 157 has the amino acid sequence, GEPPPGKPADDAGLV, and is currently under investigation for the promotion of healing and recovery in a variety of tissues. In vitro metabolism experiments in plasma demonstrate that MGF R23H has good stability and should be detectable in urine, while BPC 157 forms a stable metabolite that should be detectable in urine. A weak cation exchange solid phase extraction method was validated for detection of BPC 157 in urine. The method has a limit of detection of 0.1 ng/mL, precision of less than 20%, and good linearity, r(2) 0.998. BPC 157 was stable in urine for at least 4 days. The specificity of the method is improved by measurement of a potential BPC metabolite along with the parent peptide. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Gastric pentadecapeptide BPC 157 as an effective therapy for muscle crush injury in the rat.

    Science.gov (United States)

    Novinscak, Tomislav; Brcic, Luka; Staresinic, Mario; Jukic, Ivana; Radic, Bozo; Pevec, Danira; Mise, Sandro; Tomasovic, Sanja; Brcic, Iva; Banic, Tihomir; Jakir, Ana; Buljat, Gojko; Anic, Tomislav; Zoricic, Ivan; Romic, Zeljko; Seiwerth, Sven; Sikiric, Predrag

    2008-01-01

    Stable gastric pentadecapeptide BPC 157 accelerates the healing of a transected Achilles tendon and a transected quadriceps muscle. It may also be of clinical relevance as a systemic and local peptide treatment for crush injury of a major muscle, such as gastrocnemius muscle complex. BPC 157 is effective without a carrier, and it is presently undergoing trials for inflammatory bowel disease, and no toxicity has so far been reported. In crushed rats (force delivered 0.727 Ns/cm2), BPC 157 was applied either intraperitoneally or locally, as a thin cream layer, immediately after injury (sacrifice at 2 h), and once a day for 14 days. BPC 157 improved muscle healing, macroscopically (less hematoma and edema, no post-injury leg contracture), microscopically, functionally, and also based on enzyme activity (creatine kinase, lactate dehydrogenase, aspartate aminotransferase, alanine aminotransferase). BPC 157, at all investigated intervals, given locally or intraperitoneally, accelerated post-injury muscle healing and also helped to restore the full function.

  4. Pentadecapeptide BPC 157 (PL 14736) improves ligament healing in the rat.

    Science.gov (United States)

    Cerovecki, Tomislav; Bojanic, Ivan; Brcic, Luka; Radic, Bozo; Vukoja, Ivan; Seiwerth, Sven; Sikiric, Predrag

    2010-09-01

    We improved medial collateral ligament (MCL) healing throughout 90 days after surgical transection. We introduced intraperitoneal, per-oral (in drinking water) and topical (thin cream layer) peptide therapy always given alone, without a carrier. Previously, as an effective peptide therapy, stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, an anti-ulcer peptide effective in inflammatory bowel disease therapy (PL 14736)) particularly improved healing of transected tendon and muscle and wound healing effect including the expression of the early growth response 1 (egr-1) gene. After MCL transection BPC 157 was effective in rats when given once daily intraperitoneally (10 microg or 10 ng/kg) or locally as a thin layer (1.0 microg dissolved in distilled water/g commercial neutral cream) at the site of injury, first application 30 min after surgery and the final application 24 h before sacrifice. Likewise, BPC 157 was effective given per-orally (0.16 microg/ml in the drinking water (12 ml/day/rat)) until sacrifice. Commonly, BPC 157 microg-ng-rats exhibited consistent functional, biomechanical, macroscopic and histological healing improvements. Thus, we suggest BPC 157 improved healing of acute ligament injuries in further ligament therapy. (c) 2010 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  5. The stable gastric pentadecapeptide BPC 157, given locally, improves CO2 laser healing in mice.

    Science.gov (United States)

    Bilic, M; Bumber, Z; Blagaic, A Boban; Batelja, L; Seiwerth, S; Sikiric, P

    2005-05-01

    The stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV; mol. wt. 1419), which is at present in phase II clinical trials for the treatment of inflammatory bowel disease, has been shown to counteract healing impairment by systemic corticosteroids in burned mice, both in vivo and in vitro, in the absence of carrier or protease inhibitor. Because of the particular healing problems associated with laser use, we have now studied the effect of pentadecapeptide BPC 157 on CO(2) laser injuries (Sharplan 1075 laser: 20 W, distance 12.5 cm, spot size 0.8 mm and exposure time 1s) created on the dorsal skin of anaesthetised male NMRI-Hannover mice. The injury was either not treated or treated by topical application of a thin layer of neutral cream containing pentadecapeptide BPC 157 (1 microg, 1 ng or 1 pg (dissolved in saline)/g) or vehicle only, once daily, with the first application 60 min after injury and the last 24 h before killing (1, 7 and 21 days after the laser application). BPC 157 consistently improved healing after the CO(2) laser injury, both macroscopically and microscopically. The effect was produced with a simple method of application and favourable peptide stability (no carrier), and confirms the effectiveness of an ointment containing 1 microg BPC 157 (dissolved in saline)/g neutral cream.

  6. Impact of pentadecapeptide BPC 157 on muscle healing impaired by systemic corticosteroid application.

    Science.gov (United States)

    Pevec, Danira; Novinscak, Tomislav; Brcic, Luka; Sipos, Kristijan; Jukic, Ivana; Staresinic, Mario; Mise, Sandro; Brcic, Iva; Kolenc, Danijela; Klicek, Robert; Banic, Tihomir; Sever, Marko; Kocijan, Ana; Berkopic, Lidija; Radic, Bozo; Buljat, Gojko; Anic, Tomislav; Zoricic, Ivan; Bojanic, Ivan; Seiwerth, Sven; Sikiric, Predrag

    2010-03-01

    The effect of systemic and local peptide treatment effective in muscle contusion and then on counteraction of corticosteroid-induced impairment was tested. The pentadecapeptide BPC 157, given without a carrier, improved the healing of transected quadriceps muscle. It also improved muscle healing in rats with muscle crush injury when applied systemically or locally. Importantly, it counteracted corticosteroid-impairment in tendon to bone healing. Thus BPC 157 is proposed as an effective treatment that can improve muscle healing in spite of corticosteroid treatment. After the gastrocnemius muscle complex had been injured, rats received BPC 157 (intraperitoneally or locally as a cream) and/or 6alpha-methylprednisolone (intraperitoneally) only once (immediately after injury, sacrifice at 2 h) or once daily (final dose 24 hours before sacrifice and/or assessment procedure at days 1, 2, 4, 7, and 14). Muscle healing was evaluated functionally, macroscopically, and histologically. Without therapy, crushed gastrocnemius muscle complex controls showed limited improvement. 6alpha-methylprednisolone markedly aggravated healing. In contrast, BPC 157 induced faster muscle healing and full function restoration and improved muscle healing despite systemic corticosteroid treatment when given intraperitoneally or locally and demonstrated functionally, macroscopically, and histologically at all investigated intervals. BPC 157 completely reversed systemic corticosteroid-impaired muscle healing.

  7. Targeting CD157 in AML using a novel, Fc-engineered antibody construct.

    Science.gov (United States)

    Krupka, Christina; Lichtenegger, Felix S; Köhnke, Thomas; Bögeholz, Jan; Bücklein, Veit; Roiss, Michael; Altmann, Torben; Do, To Uyen; Dusek, Rachel; Wilson, Keith; Bisht, Arnima; Terrett, Jon; Aud, Dee; Pombo-Villar, Esteban; Rohlff, Christian; Hiddemann, Wolfgang; Subklewe, Marion

    2017-05-30

    Antibody-based immunotherapy represents a promising strategy to eliminate chemorefractory leukemic cells in acute myeloid leukemia (AML). In this study, we evaluated a novel Fc-engineered antibody against CD157 (MEN1112) for its suitability as immunotherapy in AML. CD157 was expressed in 97% of primary AML patient samples. A significant, albeit lower expression level of CD157 was observed within the compartment of leukemia-initiating cells, which are supposed to be the major source of relapse. In healthy donor bone marrow, CD157 was expressed on CD34+ cells. In ex vivo assays, MEN1112 triggered natural killer (NK) cell-mediated cytotoxicity against AML cell lines and primary AML cells. Compared to its parental analogue, the Fc-engineered antibody exhibited higher antibody dependent cellular cytotoxicity responses. Using NK cells from AML patients, we observed heterogeneous MEN1112-mediated cytotoxicity against AML cells, most likely due to well-documented defects in AML-NK cells and corresponding inter-patient variations in NK cell function. Cytotoxicity could not be correlated to the time after completion of chemotherapy. In summary, we could demonstrate that CD157 is strongly expressed in AML. MEN1112 is a promising antibody construct that showed high cytotoxicity against AML cells and warrants further clinical testing. Due to variability in NK-cell function of AML patients, the time of application during the course of the disease as well as combinatorial strategies might influence treatment results.

  8. Phylogenetic Analysis of Enterohemorrhagic Escherichia coli O157, Germany, 1987–2008

    Science.gov (United States)

    Jenke, Christian; Harmsen, Dag; Weniger, Thomas; Rothgänger, Jörg; Hyytiä-Trees, Eija; Bielaszewska, Martina; Karch, Helge

    2010-01-01

    Multilocus variable number tandem repeat analysis (MLVA) is a subtyping technique for characterizing human pathogenic bacteria such as enterohemorrhagic Escherichia coli (EHEC) O157. We determined the phylogeny of 202 epidemiologically unrelated EHEC O157:H7/H– clinical isolates through 8 MLVA loci obtained in Germany during 1987–2008. Biodiversity in the loci ranged from 0.66 to 0.90. Four of 8 loci showed null alleles and a frequency <44.1%. These loci were distributed among 48.5% of all strains. Overall, 141 MLVA profiles were identified. Phylogenetic analysis assigned 67.3% of the strains to 19 MLVA clusters. Specific MLVA profiles with an evolutionary persistence were identified, particularly within sorbitol-fermenting EHEC O157:H–.These pathogens belonged to the same MLVA cluster. Our findings indicate successful persistence of this clone. PMID:20350374

  9. Outbreak of Escherichia coli O157 infection associated with a music festival.

    Science.gov (United States)

    Crampin, M; Willshaw, G; Hancock, R; Djuretic, T; Elstob, C; Rouse, A; Cheasty, T; Stuart, J

    1999-04-01

    Seven persons who attended the Glastonbury Music Festival were infected with Vero cytotoxin-producing Escherichia coli O157 and an eighth person had serological evidence of infection. Cases were reported from different parts of England. Patients were interviewed by telephone about clinical symptoms, festival attendance, camping details, food history, water exposure, and contact with mud and animals. The interviews identified no common food source, differing use of water sources and widely dispersed camping sites. Escherichia coli O157 strains from seven persons and from a cow belonging to a herd that had previously grazed the site all belonged to phage type 2 and possessed genes for Vero cytotoxin 2. Drug resistance and DNA-based tests showed that six patients were infected with strains indistinguishable from each other and from the bovine isolate. The most likely vehicle of infection was mud contaminated with Escherichia coli O157 from infected cattle.

  10. Fast detection of both O157 and non-O157 shiga-toxin producing Escherichia coli by real-time optical immunoassay.

    Science.gov (United States)

    Mondani, L; Delannoy, S; Mathey, R; Piat, F; Mercey, T; Slimani, S; Fach, P; Livache, T; Roupioz, Y

    2016-01-01

    Among bacterial pathogens involved in food-illnesses, seven serogroups (O26, O45, O103, O111, O121, O145 and O157) of Shiga-toxin producing Escherichia coli (STEC), are frequently identified. During such outbreak, and due to the perishable property of most foodstuff, the time laps for the identification of contaminated products and pathogens is thus critical to better circumvent their spread. Traditional detection methods using PCR or culture plating are time consuming and may present some limitations. In this study, we present a multiplexed immunoassay for the optical detection of most commonly enterohemorrhagic E. coli serogroups: O26, O45, O103, O111, O121, O145 and O157:H7 in a single device. The use of Surface Plasmon Resonance imaging not only enabled the label-free analysis of the samples but gave results in a real-time manner. A dedicated protocol was set up for the detection of both low contaminating bacterial concentrations of food samples (5 CFU per 25 g) and postenrichment aliquots. By combining one single device for the detection of O157 and non-O157 STEC in a label-free manner, this rapid approach may have an important economic and societal impact. This article presents a simple-to-operate immunoassay for the specific detection of Shiga-toxin producing Escherichia coli (STEC). This approach consists in the on-chip assay detection of viable cells on a specifically designed antibody microarray. By skipping any enrichment step and avoiding the use of labelling agent, this approach based on the Surface Plasmon Resonance imaging of the microarrays turns out to be much faster and more cost effective by comparison with standardized methods. © 2015 The Society for Applied Microbiology.

  11. Derivation of Escherichia coli O157:H7 from Its O55:H7 Precursor

    Science.gov (United States)

    Zhou, Zhemin; Li, Xiaomin; Liu, Bin; Beutin, Lothar; Xu, Jianguo; Ren, Yan; Feng, Lu; Lan, Ruiting; Reeves, Peter R.; Wang, Lei

    2010-01-01

    There are 29 E. coli genome sequences available, mostly related to studies of species diversity or mode of pathogenicity, including two genomes of the well-known O157:H7 clone. However, there have been no genome studies of closely related clones aimed at exposing the details of evolutionary change. Here we sequenced the genome of an O55:H7 strain, closely related to the major pathogenic O157:H7 clone, with published genome sequences, and undertook comparative genomic and proteomic analysis. We were able to allocate most differences between the genomes to individual mutations, recombination events, or lateral gene transfer events, in specific lineages. Major differences include a type II secretion system present only in the O55:H7 chromosome, fewer type III secretion system effectors in O55:H7, and 19 phage genomes or phagelike elements in O55:H7 compared to 23 in O157:H7, with only three common to both. Many other changes were found in both O55:H7 and O157:H7 lineages, but in general there has been more change in the O157:H7 lineages. For example, we found 50% more synonymous mutational substitutions in O157:H7 compared to O55:H7. The two strains also diverged at the proteomic level. Mutational synonymous SNPs were used to estimate a divergence time of 400 years using a new clock rate, in contrast to 14,000 to 70,000 years using the traditional clock rates. The same approaches were applied to three closely related extraintestinal pathogenic E. coli genomes, and similar levels of mutation and recombination were found. This study revealed for the first time the full range of events involved in the evolution of the O157:H7 clone from its O55:H7 ancestor, and suggested that O157:H7 arose quite recently. Our findings also suggest that E. coli has a much lower frequency of recombination relative to mutation than was observed in a comparable study of a Vibrio cholerae lineage. PMID:20090843

  12. Esophagogastric anastomosis in rats: Improved healing by BPC 157 and L-arginine, aggravated by L-NAME.

    Science.gov (United States)

    Djakovic, Zeljko; Djakovic, Ivka; Cesarec, Vedran; Madzarac, Goran; Becejac, Tomislav; Zukanovic, Goran; Drmic, Domagoj; Batelja, Lovorka; Zenko Sever, Anita; Kolenc, Danijela; Pajtak, Alen; Knez, Nikica; Japjec, Mladen; Luetic, Kresimir; Stancic-Rokotov, Dinko; Seiwerth, Sven; Sikiric, Predrag

    2016-11-07

    To cure typically life-threatening esophagogastric anastomosis in rats, lacking anastomosis healing and sphincter function rescue, in particular. Because we assume esophagogastric fistulas represent a particular NO-system disability, we attempt to identify the benefits of anti-ulcer stable gastric pentadecapeptide BPC 157, which was in trials for ulcerative colitis and currently for multiple sclerosis, in rats with esophagocutaneous fistulas. Previously, BPC 157 therapies have promoted the healing of intestinal anastomosis and fistulas, and esophagitis and gastric lesions, along with rescued sphincter function. Additionally, BPC 157 particularly interacts with the NO-system. In the 4 d after esophagogastric anastomosis creation, rats received medication (/kg intraperitoneally once daily: BPC 157 (10 μg, 10 ng), L-NAME (5 mg), or L-arginine (100 mg) alone and/or combined or BPC 157 (10 μg, 10 ng) in drinking water). For rats underwent esophagogastric anastomosis, daily assessment included progressive stomach damage (sum of the longest diameters, mm), esophagitis (scored 0-5), weak anastomosis (mL H2O before leak), low pressure in esophagus at anastomosis and in the pyloric sphincter (cm H2O), progressive weight loss (g) and mortality. Immediate effect assessed blood vessels disappearance (scored 0-5) at the stomach surface immediately after anastomosis creation. BPC 157 (all regimens) fully counteracted the perilous disease course from the very beginning (i.e., with the BPC 157 bath, blood vessels remained present at the gastric surface after anastomosis creation) and eliminated mortality. Additionally, BPC 157 treatment in combination with L-NAME nullified any effect of L-NAME that otherwise intensified the regular course. Consistently, with worsening (with L-NAME administration) and amelioration (with L-arginine), either L-arginine amelioration prevails (attenuated esophageal and gastric lesions) or they counteract each other (L-NAME + L-arginine); with the

  13. The promoting effect of pentadecapeptide BPC 157 on tendon healing involves tendon outgrowth, cell survival, and cell migration.

    Science.gov (United States)

    Chang, Chung-Hsun; Tsai, Wen-Chung; Lin, Miao-Sui; Hsu, Ya-Hui; Pang, Jong-Hwei Su

    2011-03-01

    Pentadecapeptide BPC 157, composed of 15 amino acids, is a partial sequence of body protection compound (BPC) that is discovered in and isolated from human gastric juice. Experimentally it has been demonstrated to accelerate the healing of many different wounds, including transected rat Achilles tendon. This study was designed to investigate the potential mechanism of BPC 157 to enhance healing of injured tendon. The outgrowth of tendon fibroblasts from tendon explants cultured with or without BPC 157 was examined. Results showed that BPC 157 significantly accelerated the outgrowth of tendon explants. Cell proliferation of cultured tendon fibroblasts derived from rat Achilles tendon was not directly affected by BPC 157 as evaluated by MTT assay. However, the survival of BPC 157-treated cells was significantly increased under the H(2)O(2) stress. BPC 157 markedly increased the in vitro migration of tendon fibroblasts in a dose-dependent manner as revealed by transwell filter migration assay. BPC 157 also dose dependently accelerated the spreading of tendon fibroblasts on culture dishes. The F-actin formation as detected by FITC-phalloidin staining was induced in BPC 157-treated fibroblasts. The protein expression and activation of FAK and paxillin were determined by Western blot analysis, and the phosphorylation levels of both FAK and paxillin were dose dependently increased by BPC 157 while the total amounts of protein was unaltered. In conclusion, BPC 157 promotes the ex vivo outgrowth of tendon fibroblasts from tendon explants, cell survival under stress, and the in vitro migration of tendon fibroblasts, which is likely mediated by the activation of the FAK-paxillin pathway.

  14. Evaluation of a novel antimicrobial solution and its potential for control E. coli O157:H7, non-O157:H7 shiga toxin-producing E. coli, Salmononella spp., and Listeria monocytogenes on beef

    Science.gov (United States)

    The goal of this study was to evaluate the efficacy of a novel antimicrobial solution made with chitosan, lauric arginate ester, and organic acids on Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and non-O157 shiga toxin-producing E. coli cocktails and to test its potential to b...

  15. Synthesis, characterization and luminescence of europium perchlorate with MABA-Si complex and coating structure SiO2@Eu(MABA-Si) luminescence nanoparticles.

    Science.gov (United States)

    Fu, Zhi-Fang; Li, Wen-Xian; Bai, Juan; Bao, Jin-Rong; Cao, Xiao-Fang; Zheng, Yu-Shan

    2017-05-01

    This article reports a novel category of coating structure SiO 2 @Eu(MABA-Si) luminescence nanoparticles (NPs) consisting of a unique organic shell, composed of perchlorate europium(III) complex, and an inorganic core, composed of silica. The binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O was synthesized using HOOCC 6 H 4 N(CONH(CH 2 ) 3 Si(OCH 2 CH 3 ) 3 ) 2 (MABA-Si) and was used as a ligand. Furthermore, the as-prepared silica NPs were successfully coated with the -Si(OCH 2 CH 3 ) 3 group of MABA-Si to form Si-O-Si chemical bonds by means of the hydrolyzation of MABA-Si. The binary complexes were characterized by elemental analysis, molar conductivity and coordination titration analysis. The results indicated that the composition of the binary complex was Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O. Coating structure SiO 2 @Eu(MABA-Si) NPs were characterized using transmission electron microscopy (TEM), scanning electron microscopy (SEM) and infrared (IR) spectra. Based on the SEM and TEM measurements, the diameter of core-SiO 2 particles was ~400 and 600 nm, and the thickness of the cladding layer Eu(MABA-Si) was ~20 nm. In the binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O, the fluorescence spectra illustrated that the energy of the ligand MABA-Si transferred to the energy level for the excitation state of europium(III) ion. Coating structure SiO 2 @Eu(MABA-Si) NPs exhibited intense red luminescence compared with the binary complex. The fluorescence lifetime and fluorescence quantum efficiency of the binary complex and of the coating structure NPs were also calculated. The way in which the size of core-SiO 2 spheres influences the luminescence was also studied. Moreover, the luminescent mechanisms of the complex were studied and explained. Copyright © 2016 John Wiley & Sons, Ltd.

  16. The structures of CyMe4-BTBP complexes of americium(iii) and europium(iii) in solvents used in solvent extraction, explaining their separation properties.

    Science.gov (United States)

    Ekberg, Christian; Löfström-Engdahl, Elin; Aneheim, Emma; Foreman, Mark R StJ; Geist, Andreas; Lundberg, Daniel; Denecke, Melissa; Persson, Ingmar

    2015-11-14

    Separation of trivalent actinoid (An(iii)) and lanthanoid (Ln(iii)) ions is extremely challenging due to their similar ionic radii and chemical properties. Poly-aromatic nitrogen compounds acting as tetradentate chelating ligands to the metal ions in the extraction, have the ability to sufficiently separate An(iii) from Ln(iii). One of these compounds, 6,6'-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-benzol[1,2,4]triazin-3-yl)[2,2]bipyridine, CyMe4-BTBP, has proven to be resistant towards acidic environments and strong radiation from radioactive decomposition. EXAFS studies of the dicomplexes of CyMe4-BTBP with americium(iii) and europium(iii) in nitrobenzene, cyclohexanone, 1-hexanol, 1-octanol and malonamide (DMDOHEMA) in 1-octanol have been carried out to get a deeper understanding of the parameters responsible for the separation. The predominating complexes independent of solvent used are [Am(CyMe4-BTBP)2(NO3)](2+) and [Eu(CyMe4-BTBP)2](3+), respectively, which are present as outer-sphere ion-pairs with nitrate ions in the studied solvents with low relative permittivity. The presence of a nitrate ion in the first coordination sphere of the americium(iii) complex compensates the charge density of the complex considerably in comparison when only outer-sphere ion-pairs are formed as for the [Eu(CyMe4-BTBP)2](3+) complex. The stability and solubility of a complex in a solvent with low relative permittivity increase with decreasing charge density. The [Am(CyMe4-BTBP)2(NO3)](2+) complex will therefore be increasingly soluble and stabilized over the [Eu(CyMe4-BTBP)2](3+) complex in solvents with decreasing relative permittivity of the solvent. The separation of americium(iii) from europium(iii) with CyMe4-BTBP as extraction agent will increase with decreasing relative permittivity of the solvent, and thereby also with decreasing solubility of CyMe4-BTBP. The choice of solvent is therefore a balance of a high separation factor and sufficient solubility of the CyMe4-BTBP

  17. Europium-decorated graphene quantum dots as a fluorescent probe for label-free, rapid and sensitive detection of Cu{sup 2+} and L-cysteine

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Liping [College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, 350002 (China); Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); Zhao, Li; Zhao, Tingting [Xiamen Huaxia College, Xiamen, 361024 (China); Chen, Xi, E-mail: xichen@xmu.edu.cn [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, 361005 (China)

    2015-09-03

    In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel “off-on” fluorescent probe for the label-free determination of Cu{sup 2+} and L-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu{sup 2+} owing to the coordination reaction between Cu{sup 2+} and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu{sup 2+} to L-Cys via the Cu–S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1–10 μM for Cu{sup 2+} and 0.5–50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu{sup 2+} and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu{sup 2+} and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. - Highlights: • The europium-decorated graphene quantum dots (Eu-GQDs) have been successfully prepared. • Various characterizations results proved that Eu atoms were successfully introduced into graphene quantum dots. • The introduced Eu atoms changed the electron density and surface chemical activities of Eu-GQDs. • Eu-GQDs were used as an “off-on” fluorescent probe for Cu{sup 2+} and L-cysteine detection

  18. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  19. 78 FR 54168 - Special Local Regulation, Cumberland River, Mile 157.0 to 159.0; Ashland City, TN

    Science.gov (United States)

    2013-09-03

    ... beginning at mile marker 157.0 and ending at mile marker 159.0, extending bank to bank. This zone is... ground floor of the Department of Transportation West ] Building, 1200 New Jersey Avenue SE., Washington... Purpose The Nashvegas Triathlon takes place on the Cumberland River from mile marker 157.0 to 159.0. The...

  20. 77 FR 26725 - Changes to FSIS Traceback, Recall Procedures for Escherichia coli O157:H7 Positive Raw Beef...

    Science.gov (United States)

    2012-05-07

    .... coli O157:H7. FSAs are complete investigations concerning the establishment's entire HACCP system. FSIS... effectiveness of HACCP measures in addressing the pathogen. Therefore, in order for a sampled and tested claim... its HACCP system measures designed to control for E. coli O157:H7, and it must use sampling and...

  1. Hha Represses Biofilm Formation in Escherichia coli O157:H7 by Affecting the Expression of Flagella and Curli Fimbriae

    Science.gov (United States)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a zoonotic pathogen that produces a broad-spectrum of diarrheal illnesses in infected humans. Although the genetic and molecular mechanisms enabling EHEC O157:H7 to produce characteristic adherence on epithelial cells are well characterized, the g...

  2. Evaluation of the Effects of SDIA, a LUXR Homologue, on Adherence and Motility of Escherichia coli O157:H7

    Science.gov (United States)

    Quorum-sensing (QS) signaling pathways are important regulatory networks for controlling the expression of genes promoting adherence of Enterohemorrhagic Escherichia coli (EHEC) O157:H7 to epithelial cells. A recent study has shown that EHEC O157:H7 encodes a luxR homologue, called sdiA¸ which upon...

  3. Control of VTEC O157 and Campylobacter jejuni/coli on cattle farms : Effective interventions and implementation

    NARCIS (Netherlands)

    Ellis-Iversen, J

    2009-01-01

    Verocytotoxogenic E. coli O157 (VTEC O157) and Campylobacter jejuni/coli are zoonotic pathogens of public health importance, which are commonly carried and shed by cattle. Control at farm level needed isto limit shedding and contamination of the environment and the human food chain. On- farm risk

  4. Functional metagenomics of Escherichia coli O157:H7 interactions with spinach indigenous microorganisms during biofilm formation

    Science.gov (United States)

    The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157) with spinach leaf microflora during co-colonization and establishment of a...

  5. Biofilm formation of non-O157 Shiga toxin-producing Escherichia coli (STEC) on equipment surfaces

    Science.gov (United States)

    Introduction: Shiga toxin-producing Escherichia coli (STEC) serotype O157:H7 has been the most commonly recognized STEC serotype responsible for foodborne outbreaks in the US. Numerous outbreaks associated with non-O157 serotypes have also been reported due to consumption of contaminated food. The ...

  6. Utilization of evolutionary model, bioinformatics and heuristics for development of a multiplex Escherichia coli O157:H7 PCR assay

    Science.gov (United States)

    Introduction: Escherichia coli O157:H7 is a devastating foodborne pathogen causing many foodborne outbreaks worldwide with significant morbidity and mortality. The plasticity of the E. coli O157:H7 genome, inconsistent expression of surface antigens, and sharing of genetic elements with other non-...

  7. Functional Metagenomics of Escherichia coli O157:H7 Interactions with Spinach Indigenous Microorganisms during Biofilm Formation

    Science.gov (United States)

    Carter, Michelle Q.; Xue, Kai; Brandl, Maria T.; Liu, Feifei; Wu, Liyou; Louie, Jacqueline W.; Mandrell, Robert E.; Zhou, Jizhong

    2012-01-01

    The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157) with spinach leaf indigenous microorganisms during co-colonization and establishment of a mixed biofilm on a stainless steel surface. Stainless steel surface was selected to mimic the surface of produce-processing equipment, where retention of foodborne pathogens such as EcO157 could serve as a potential source for transmission. We observed a positive effect of spinach-associated microbes on the initial attachment of EcO157, but an antagonistic effect on the EcO157 population at the later stage of biofilm formation. Metagenomic analyses of the biofilm community with the GeoChip revealed an extremely diverse community (gene richness, 23409; Shannon-Weiner index H, 9.55). Presence of EcO157 in the mixed biofilm resulted in a significant decrease in the community α-diversity (t test, Pbiofilm at 48 h (ANOVA, Pbiofilm is likely associated with its metabolic potential in utilizing spinach nutrients: the generation time of EcO157 in spinach lysates at 28°C is ∼ 38 min, which is comparable to that in rich broth. The significant decrease in the abundance of many genes involved in carbon, nitrogen, and phosphorus cycling in the EcO157-inoculated biofilms (t test, Pbiofilm species. PMID:22957052

  8. Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain

    NARCIS (Netherlands)

    Franz, E.; Bruggen, van A.H.C.

    2008-01-01

    There is an increased concern that plants might be more important as a carrier for human enteric pathogens like E. coli O157:H7 and Salmonella enterica serovars than previously thought. This review summarizes the knowledge available on the ecology of E. coli O157:H7 and Salmonella enterica in the

  9. Thermal inactivation of Escherichia coli O157:H7 in strawberry puree and its effect on anthocyanins and color

    Science.gov (United States)

    Raw whole strawberries, if contaminated with pathogens such as E. coli O157:H7, must be pasteurized prior to consumption. Therefore, the objective of this research was to investigate the thermal inactivation kinetics of E. coli O157:H7 in strawberry puree (SP), and evaluate the changes in anthocyan...

  10. Essential oils reduce Escherichia coli O157:H7 and Salmonella on spinach leaves without affecting produce quality

    Science.gov (United States)

    The efficacy of cinnamaldehyde and Sporan alone, or in combination with acetic acid in reducing E. coli O157:H7 and Salmonella on spinach leaves was investigated. Spinach leaves were inoculated with a cocktail of five-strain Salmonella or E. coli O157:H7, air-dried for 30 min, and then immersed in a...

  11. Comparative survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Murine Norovirus on spinach plants

    Science.gov (United States)

    Introduction: Outbreaks resulting from the consumption of leafy greens contaminated with E. coli O157:H7, Salmonella spp., and norovirus have occurred. It is unclear how the stress response factor rpoS in E. coli O157:H7 and Salmonella spp. affects their survival on spinach. Purpose: A comparison ...

  12. Detection and characterization of Escherichia coli O157:H7 from feral pigeon in Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Hossein Esameili

    2015-02-01

    Full Text Available Objective: To detect and characterize Escherichia coli (E. coli O157:H7 in feral pigeons in Qom province, Iran. Methods: In this survey, 290 cloacal samples were obtained from trapped feral pigeons in Qom province. Microbiological, biochemical and serological examinations were done to detect the E. coli O157:H7. Isolates were subjected to multiplex polymerase chain reaction for the detection of stx1, stx2, eaeA and hlyA genes. Results: Four samples (1.38% were positive for E. coli O157:H7 by using O157 and H7 antisera and only one E. coli O157:H7 strain isolated showed the presence of stx1, stx2, eaeA and hlyA genes. Conclusions: The results of present survey revealed that feral pigeons in Qom province had the potential to be a reservoir of E. coli O157:H7. The low prevalence of E. coli O157:H7 can be attributed to sampling each pigeon just once and fecal culture limits, and true prevalence of the E. coli O157:H7 might be higher than our findings.

  13. Pentadecapeptide BPC 157 reduces bleeding time and thrombocytopenia after amputation in rats treated with heparin, warfarin or aspirin.

    Science.gov (United States)

    Stupnisek, Mirjana; Franjic, Sandra; Drmic, Domagoj; Hrelec, Masa; Kolenc, Danijela; Radic, Bozo; Bojic, Davor; Vcev, Aleksandar; Seiwerth, Sven; Sikiric, Predrag

    2012-05-01

    Recently, in rat abdominal aorta terminoterminal-anastomosis the stable gastric pentadecapeptide BPC 157 prevents obstructive thrombus formation and rapidly destroys already formed obstructive thrombus. Also, BPC 157 wound healing may signify the clot as conductive matrix or "scaffold" to speed up wound healing process, and decrease bleeding. Here, in rats, BPC 157 (10 μg/kg, 10 ng/kg) improved always reduced bleeding time and amount of bleeding after (tail) amputation only, heparin (250 mg/kg, 25mg/kg, 10mg/kg i.v.), warfarin (1.5mg/kg i.g. once daily for 3 consecutive days), aspirin (0.1g/kg i.g. (once daily/3 consecutive days) or 1.0 g/kg i.p. once), and amputation associated with those agents application. BPC 157 counteracting regimens (i.v., i.p., i.g. (immediately after any challenge)) correspondingly follow the route of bleeding-agents application. All heparin-, warfarin-, and aspirin-rats and normal-rats that received BPC 157 exhibited lesser fall in platelets count. BPC 157 attenuated over-increased APTT-, TT-values in 10mg/kg heparin-rats, but did not influence heparin activity (anti-Xa test). Indicatively, unless counteracted in BPC 157 rats, excessive bleeding-acute thrombocytopenia (BPC 157 markedly prolongs the survival time (heparin-rats, 25mg/kg, right foot amputation). Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. A Novel Approach to Investigate Internalization of Escherichia coli O157:H7 in Lettuce and Spinach

    Science.gov (United States)

    The chromosomal integration of the green fluorescent protein (gfp) gene was successfully accomplished into four nalidixic acid resistant E. coli strains: two O157:H7 strains from produce outbreaks, 4407 and 5279, one O157:H7 strain from a beef-associated outbreak, 86-24h11, and a non-pathogenic comm...

  15. Distribution of the urease gene cluster among and urease activities of enterohemorrhagic Escherichia coli O157 isolates from humans

    NARCIS (Netherlands)

    Friedrich, Alexander W; Köck, Robin; Bielaszewska, Martina; Zhang, Wenlan; Karch, Helge; Mathys, Werner

    Enterohemorrhagic Escherichia coli (EHEC) O157 strains belong to two closely related major groups, which are differentiated by their sorbitol fermentation phenotypes. Here we studied the conservation of urease genes and their expression in sorbitol-fermenting (SF) and non-SF EHEC O157 isolates. PCR

  16. PREVALENCE OF VEROCYTOTOXIGENIC ESCHERICHIA-COLI SEROTYPE O157H7 IN CHILDREN WITH DIARRHEA ATTENDING A SYDNEY HOSPITAL

    NARCIS (Netherlands)

    ONG, J; ROBINSBROWNE, R; GAPES, M; OLOUGHLIN, EV

    Verotoxin producing Escherichia coli, in particular serotype O157:H7, have been implicated as an important cause of acute gastroenteritis in children. This study was undertaken to determine if E.coli O157:H7 is an important cause of acute gastroenteritis in children in metropolitan Sydney. During

  17. Evolution of a zoonotic pathogen: investigating prophage diversity in enterohaemorrhagic E. coli O157 by long-read sequencing

    Science.gov (United States)

    Enterohaemorrhagic Escherichia Coli (EHEC) is a zoonotic pathogen known to be potentially lethal in humans. Its main animal reservoir is ruminants, specifically cattle, and yearly outbreaks occur worldwide with the most prevalent serotype being EHEC O157:H7. Most virulence factors of EHEC O157, incl...

  18. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  19. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.(Michigan, Univ Of - Ann Arbor); Brockman, Fred J.(BATTELLE (PACIFIC NW LAB)); Chandler, Darrell P.(Pacific Northwest National Laboratory)

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  20. Optical methods for detecting Escherichia coli O157:H7 spiked on cantaloupes

    Science.gov (United States)

    Tu, Shu-I.; Uknalis, Joseph; Gehring, Andrew

    2004-11-01

    Outbreaks of E. coli O157:H7 by the consumption of contaminated cantaloupes fruits have been documented. Pathogens harbored in the networked but porous veins in khaki colored skin are difficult to remove. Thus, sensitive and efficient methods are needed to detect the presence of E. coli O157:H7 in cantaloupes. In this work, known quantities of the E. coli were inoculated on cantaloupe skins or flesh at room temperature for 1 h. The contaminated samples were incubated in growth media at 37°C for 3.3h. The bacteria captured by magnetic beads coated with anti E. coli O157 antibodies were further sandwiched by second anti E. coli O157 antibodies containing peroxidase for chemiluminescent measurements of captured bacteria. Alternatively, the captured bacteria were treated with electron-shuttering reagent to detect the cellular level of NAD(P)H via bioluminescence. The detected enzyme activity (peroxidase) and the NAD(P)H were used to measure the presence of the pathogen. The results indicated both the chemiluminescence and the fluorescence methods, in 96 well microplate format, could be applied to detect the E. coli contamination of cantaloupes.