
Sample records for europium 154 target

  1. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  2. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  3. A non-aqueous reduction process for purifying ¹⁵³Gd produced in natural europium targets. (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R


    Gadolinium-153 is a low-energy gamma-emitter used in nuclear medicine imaging quality assurance. Produced in nuclear reactors using natural Eu₂O₃ targets, ¹⁵³Gd is radiochemically separated from europium isotopes by europium reduction. However, conventional aqueous europium reduction produces hydrogen gas, a flammability hazard in radiological hot cells. We altered the traditional reduction method, using methanol as the process solvent to nearly eliminate hydrogen gas production. This new, non-aqueous reduction process demonstrates greater than 98% europium removal and gadolinium yields of 90%. © 2013 Elsevier Ltd. All rights reserved.

  4. Rapid and accurate tumor-target bio-imaging through specific in vivo biosynthesis of a fluorescent europium complex. (United States)

    Ye, Jing; Wang, Jianling; Li, Qiwei; Dong, Xiawei; Ge, Wei; Chen, Yun; Jiang, Xuerui; Liu, Hongde; Jiang, Hui; Wang, Xuemei


    A new and facile method for rapidly and accurately achieving tumor targeting fluorescent images has been explored using a specifically biosynthesized europium (Eu) complex in vivo and in vitro. It demonstrated that a fluorescent Eu complex could be bio-synthesized through a spontaneous molecular process in cancerous cells and tumors, but not prepared in normal cells and tissues. In addition, the proteomics analyses show that some biological pathways of metabolism, especially for NADPH production and glutamine metabolism, are remarkably affected during the relevant biosynthesis process, where molecular precursors of europium ions are reduced to fluorescent europium complexes inside cancerous cells or tumor tissues. These results proved that the specific self-biosynthesis of a fluorescent Eu complex by cancer cells or tumor tissues can provide a new strategy for accurate diagnosis and treatment strategies in the early stages of cancers and thus is beneficial for realizing precise surgical intervention based on the relevant cheap and readily available agents.

  5. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  6. A lysosome targetable luminescent bioprobe based on a europium β-diketonate complex for cellular imaging applications. (United States)

    George, T M; Krishna, Mahesh S; Reddy, M L P


    Herein, we report a novel lysosome targetable luminescent bioprobe derived from a europium coordination compound, namely Eu(pfphOCH3IN)3(DDXPO) 4 [where HpfphOCH3IN = 4,4,5,5,5-pentafluoro-3-hydroxy-1-(1-(4-methoxyphenyl)-1H-indol-3-yl)pent-2-en-1-one and DDXPO = 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene oxide]. Notably, the newly designed europium complex exhibits significant quantum yield (Φoverall = 25 ± 3%) and 5D0 excited state lifetime (τ = 398 ± 3 μs) values under physiological pH (7.2) conditions when excited at 405 nm. Hence the developed europium complex has been evaluated for live cell imaging applications using mouse pre-adipocyte cell lines (3T3L1). Colocalization studies of the designed bio-probe with commercial Lysosome-GFP in 3T3L1 cells demonstrated the specific localization of the probe in the lysosome with a high colocalization coefficient (A = 0.83). Most importantly, the developed bioprobe exhibits good cell permeability, photostability and non-cytotoxicity.

  7. Folic acid-conjugated europium complexes as luminescent probes for selective targeting of cancer cells. (United States)

    Quici, Silvio; Casoni, Alessandro; Foschi, Francesca; Armelao, Lidia; Bottaro, Gregorio; Seraglia, Roberta; Bolzati, Cristina; Salvarese, Nicola; Carpanese, Debora; Rosato, Antonio


    We report the synthesis of three optical probes (Eu(3+)⊂1, Eu(3+)⊂2, and Eu(3+)⊂3) having a luminescent Eu complex (signaling unit) bonded in different positions to folic acid (FA), the folate receptor (FR) targeting unit. The structures of the two regioisomers Eu(3+)⊂1 and Eu(3+)⊂2 were assigned by mass spectrometric experiments. The optical properties and stability of these probes were assessed in phosphate-buffered saline, cell culture medium, rat serum, and cellular lysate, and results indicated that they are chemically and photophysically stable. Cytotoxicity was studied with ovarian cancer cells having high (SKOV-3), intermediate (OVCAR-3), low (IGROV-1), or null (A2780) expression of FRs. The internalized probe, evaluated in SKOV-3, IGROV-1, and A2780 cells, was in the order Eu(3+)⊂2 > Eu(3+)⊂1 > Eu(3+)⊂3. No internalization was observed for A2780 cells. Such results, together with those obtained in competition experiments of FA versus Eu(3+)⊂2 and FA or Eu(3+)⊂2 versus (3)H-FA, indicate that internalization is receptor-mediated and that Eu(3+)⊂2 shows high selectivity and specificity for FR.

  8. Mitochondria Targetable Time-Gated Luminescence Probe for Singlet Oxygen Based on a β-Diketonate-Europium Complex. (United States)

    Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli


    Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.

  9. Fluorescent Europium Chelate Stain (United States)

    Scaff, W. L.; Dyer, D. L.; Mori, K.


    The europium chelate of 4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione (thenoyl-trifluoroacetone; TTA) is firmly bound to microorganisms. It fluoresces brightly at 613 nm with activation at 340 nm. Cells may be stained with 10−3m chelate in 50% ethyl alcohol, followed by washing with 50% ethyl alcohol. Equal or better stains are produced with 10−3m aqueous europium salt, water wash, and 10−2m aqueous TTA. A noncomplexing buffer should be used to maintain the pH at 6.5 to 6.8. Images PMID:4181107

  10. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui


    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  11. Excitation functions for the formation of longer lived isotopes by deuteron irradiation of Europium

    Energy Technology Data Exchange (ETDEWEB)

    Takács, S., E-mail: [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Hermanne, A.; Adam-Rebeles, R. [Cyclotron Laboratory, Vrije Universiteit Brussel, Brussels 1090 (Belgium); Takács, M.P. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Institute of Physics, University of Debrecen, 4026 Debrecen (Hungary)


    Excitation functions for nuclear reactions induced on natural europium targets by energetic deuterons were studied up to 50 MeV. A standard stacked foil technique was used for irradiation and high resolution gamma spectrometry was applied for activity assessment. Direct or cumulative cross sections for reaction products with half-life longer than 2 h were determined. Reactions leading to the formation of the radionuclides {sup 147,149,151,153}Gd, {sup 147,148,149,150m,150g,152m,152g,154g}Eu, {sup 153}Sm and {sup 150}Pm were studied. In most cases no earlier data were available in the literature. The new experimental results were compared with values tabulated in the on-line TENDL2011 library.

  12. Europium-155 in Debris from Nuclear Weapons

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Lippert, Jørgen Emil


    The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...... of europium-155 from weapons was estimated at 1400 atoms per 10$^{6}$ fissions, which is close to the yield of europium-155 from fast fission of uranium-238....

  13. The electrochemical synthesis of europium boride

    Directory of Open Access Journals (Sweden)

    Bukatova G.A.


    Full Text Available The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. % melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  14. The electrochemical synthesis of europium boride


    Bukatova G.A.; Kuznetsov S.A.; Gaune-Escard M.


    The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. %) melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  15. Synthesis and luminescence properties of salicylaldehyde isonicotinoyl hydrazone derivatives and their europium complexes. (United States)

    Shan, Wenfei; Liu, Fen; Liu, Jiang; Chen, Yanwen; Yang, Zehui; Guo, Dongcai


    Four novel salicylaldehyde isonicotinoyl hydrazone derivatives and their corresponding europium ion complexes were synthesized and characterized, while the luminescence properties and the fluorescence quantum yields of the target complexes were investigated. The results indicated that the ligands favored energy transfers to the emitting energy level of europium ion, and four target europium complexes showed the characteristic luminescence of central europium ion. Besides the luminescence intensity of the complex with methoxy group, which possessed the highest fluorescence quantum yield (0.522), was stronger than that of other complexes. Furthermore, the electrochemical properties of the target complexes were further investigated by cyclic voltammetry, the results indicated that the highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO) energy levels and the oxidation potential of the complexes with electron donating group increased, however, that of the complexes with accepting electron group decreased. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Murine High Specificity/Sensitivity Competitive Europium Insulin Autoantibody Assay (United States)

    Babaya, Naru; Liu, Edwin; Miao, DongMei; Li, Marcella; Yu, Liping


    Abstract Background Most insulin autoantibody assays for both human and animal models are in a radioassay format utilizing 125I-insulin, but despite the radioassay format international workshops have documented difficulty in standardization between laboratories. There is thus a need for simpler assay formats that do not utilize radioactivity, yet retain the high specificity and sensitivity of radioassays. Methods To establish an easier enzyme-linked immunosorbent assay (ELISA) for insulin autoantibodies of non-obese diabetic (NOD) mice, we used an ELISA format, competition with unlabeled insulin, europium-avidin, and time-resolved fluorescence detection (competitive europium insulin autoantibody assay). Results The competitive europium assay of insulin autoantibodies when applied to sera from NOD mice had high sensitivity and specificity (92% sensitivity, 100% specificity) compared to our standard insulin autoantibody radioassay (72% sensitivity, 100% specificity) in analyzing blind workshop sera. It is noteworthy that though the assay has extremely high sensitivity for murine insulin autoantibodies and utilizes human insulin as target autoantigen, human sera with high levels of insulin autoantibodies are not detected. Conclusions Our results clearly indicate that low levels of insulin autoantibodies can be detected in an ELISA-like format. Combining a europium-based ELISA with competition with fluid-phase autoantigen can be applicable to many autoantigens to achieve high specificity and sensitivity in an ELISA format. PMID:19344197

  17. Production cross sections of elements near the N=126 shell in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets (United States)

    Mayorov, D. A.; Werke, T. A.; Alfonso, M. C.; Bennett, M. E.; Folden, C. M.


    Excitation functions for shell-stabilized evaporation residues produced in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets have been measured in experiments performed at the Cyclotron Institute at Texas A&M University. The examined energy range predominantly covers the 3n and 4n evaporation channels with higher cross sections measured for the 4n products. The σ4n are nearly invariant within experimental uncertainty in reactions with Tb159,Dy162, and Ho165 with the maxima at 12.6 ± 1.9, 12.6 ± 1.7, and 9.4 ± 1.3 mb, respectively. For the reaction with Gd154, the maximum is slightly lower at 4.0 ± 0.6 mb. A simple model to describe the measured production cross sections was employed. Capture was estimated by using the "diffused barrier formula" from the "fusion by diffusion" model proposed by Świątecki et al. [Phys. Rev. C 71, 014602 (2005)]., 10.1103/PhysRevC.71.014602 The fusion probability was estimated by using a phenomenological expression presented by Siwek-Wilczyńska et al. [Int. J. Mod. Phys. E 17, 12 (2008)]., 10.1142/S0218301308009501 The survival probability was calculated according to the formula of Vandenbosch and Huizenga [Nuclear Fission (Academic, New York, 1973)], derived from transition-state theory. The best agreement is reached between calculation and experiment upon inclusion of collective effects in the calculation of the survival probability, shown previously to be important for production of weakly deformed nuclei. This, in turn, challenges the expectation that strong shell stabilization benefits the production cross section. The present data are compared with earlier studies on production of neutron-deficient nuclei in Ca-induced reactions with lanthanide targets.

  18. Liposome Biodistribution via Europium Complexes. (United States)

    Mignet, Nathalie; Scherman, Daniel


    The drug delivery field needs tools to follow vector biodistribution. Radioactive tracers and conventional fluorophores are widely used. We propose here to use europium complexes. Use of pulsed light source time-resolved fluorimetry takes into account the fluorescence decay time of the lanthanide chelates to gain sensitivity in biological media. The method was developed to follow liposome biodistribution. Octadecyl-DTPA.Eu compound has been prepared and incorporated into liposomes without alteration of its fluorescence signal. The method has been validated by comparison with fluorophore-labeled liposomes. The way to proceed to use this method for liposomes or other vectors is detailed.

  19. Resonance ionization scheme development for europium

    CERN Document Server

    Chrysalidis, K; Fedosseev, V N; Marsh, B A; Naubereit, P; Rothe, S; Seiffert, C; Kron, T; Wendt, K


    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  20. Resonance ionization scheme development for europium

    Energy Technology Data Exchange (ETDEWEB)

    Chrysalidis, K., E-mail:; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)


    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  1. Electronic state of europium atoms on surface of oxidized tungsten

    CERN Document Server

    Davydov, S Y


    The energy scheme of the europium atoms adsorption system on the tungsten surface, coated with the oxygen monolayer, is considered. The evaluations of the europium adatoms charged state on the oxidized tungsten surface are performed. It is established, that europium, adsorbed at the oxidized tungsten surface, is a positive ion with the charge close to the unit. The zonal scheme of the Eu-O/W adsorption system for the europium low and high concentrations is proposed

  2. Europium anomaly in plagioclase feldspar - Experimental results and semiquantitative model. (United States)

    Weill, D. F.; Drake, M. J.


    The partition of europium between plagioclase feldspar and magmatic liquid is considered in terms of the distribution coefficients for divalent and trivalent europium. A model equation is derived giving the europium anomaly in plagioclase as a function of temperature and oxygen fugacity. The model explains europium anomalies in plagioclase synthesized under controlled laboratory conditions as well as the variations of the anomaly observed in natural terrestrial and extraterrestrial igneous rocks.

  3. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength. (United States)

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan


    Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f'' = 11.17 e(-), at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules.

  4. Fermi Surface and Antiferromagnetism in Europium Metal

    DEFF Research Database (Denmark)

    Andersen, O. Krogh; Loucks, T. L.


    We have calculated the Fermi surface of europium in order to find those features which determine the wave vector of the helical moment arrangement below the Néel point. We find that there are two pieces of Fermi surface: an electron surface at the symmetry point H, which has the shape of rounded...... of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...

  5. Organophosphate Nerve Agent Detection with Europium Complexes

    Directory of Open Access Journals (Sweden)

    Jake R. Schwierking


    Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.

  6. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  7. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail:; Sony, G., E-mail:


    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  8. The Europium Oxybarometer: Power and Pitfalls (United States)

    McKay, G.


    One of the most important characteristics of a planet is the oxidation state of its mantle, as reflected in primitive basalts. Petrologists have devised several methods to estimate the oxygen fugacity under which basalts crystallized. One method that has been the subject of recent interest involves the depth of the Eu anomaly in first-crystallizing minerals. A discussion detailing the experimental calibration of the Europium oxybarometer and the application of this device to Angrites and Martian basaltic meteorites are presented. The strengths and weaknesses of the instrument are also included.

  9. Development of a microchip Europium nanoparticle immunoassay for sensitive point-of-care HIV detection. (United States)

    Liu, Jikun; Du, Bingchen; Zhang, Panhe; Haleyurgirisetty, Mohan; Zhao, Jiangqin; Ragupathy, Viswanath; Lee, Sherwin; DeVoe, Don L; Hewlett, Indira K


    Rapid, sensitive and specific diagnostic assays play an indispensable role in determination of HIV infection stages and evaluation of efficacy of antiretroviral therapy. Recently, our laboratory developed a sensitive Europium nanoparticle-based microtiter-plate immunoassay capable of detecting target analytes at subpicogram per milliliter levels without the use of catalytic enzymes and signal amplification processes. Encouraged by its sensitivity and simplicity, we continued to miniaturize this assay to a microchip platform for the purpose of converting the benchtop assay technique to a point-of-care test. It was found that detection capability of the microchip platform could be readily improved using Europium nanoparticle probes. We were able to routinely detect 5 pg/mL (4.6 attomoles) of HIV-1 p24 antigen at a signal-to-blank ratio of 1.5, a sensitivity level reasonably close to that of microtiter-plate Europium nanoparticle assay. Meanwhile, use of the microchip platform effectively reduced sample/reagent consumption 4.5 fold and shortened total assay time 2 fold in comparison with microtiter plate assays. Complex matrix substance in plasma negatively affected the microchip assays and the effects could be minimized by diluting the samples before loading. With further improvements in sensitivity, reproducibility, usability, assay process simplification, and incorporation of portable time-resolved fluorescence reader, Europium nanoparticle immunoassay technology could be adapted to meet the challenges of point-of-care diagnosis of HIV or other health-threatening pathogens at bedside or in resource-limited settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Europium Effect on the Electron Transport in Graphene Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Bobadilla, Alfredo D.; Ocola, Leonidas E.; Sumant, Anirudha V.; Kaminski, Michael; Kumar, Narendra; Seminario, Jorge M.


    We report in this complementary theoretical-experimental work the effect of gating on the election transport of grapheme ribbons when exposed to very low concentration of europium in an aqueous solution. We find a direct correlation between the level of concentration of europium ions in the solvent and the change in electron transport in graphene, observing a change of up to 3 orders of magnitude at the lowest level of concentration tested (0.1 mM), suggesting a possibility that graphene ribbons can be used for detecting very low concentrations of europium in liquid solutions.

  11. Paramagnetic Europium Salen Complex and Sickle-Cell Anemia (United States)

    Wynter, Clive I.; Ryan, D. H.; May, Leopold; Oliver, F. W.; Brown, Eugene; Hoffman, Eugene J.; Bernstein, David


    A new europium salen complex, Eu(salen)2NH4, was synthesized, and its composition was confirmed by chemical analysis and infrared spectroscopy. Further characterization was carried out by 151 Eu Mössbauer spectroscopy and magnetic susceptibility measurements. Mössbauer spectroscopic measurements were made at varying temperatures between 9 K and room temperature and a value of Debye temperature of 133 ±5 K was computed. Both Mössbauer and magnetic susceptibility measurements confirmed the paramagnetic behavior of this complex and the trivalent state of the europium ion. In view of the fact that the "odd" paramagnetic molecule NO has been shown to reverse sickling of red blood cells in sickle cell anemia, the interaction between the paramagnetic europium salen complex and sickle cells was examined after incubation with this europium complex and shown to have similar effects.

  12. Europium polyoxometalates encapsulated in silica nanoparticles - characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)


    The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Spectral Properties of a bis-Azospiropyran Complexed with Europium (United States)

    Nourmohammadian, F.; Ghahari, M.; Gholami, M. Davoudzadeh


    The complexation of recently synthesized symmetrical bifunctional bis-azospiropyran photochromic dye with europium nitrate and its effect on UV-vis absorption and fluorescent emission was studied. Upon addition of Eu 3+ to colorless spiropyran, a yellow merocyanine europium complex was obtained with an absorption band at 410 nm. Negatively charged phenolic oxygenin zwitterionic ring-open form provides an effective metal binding site for Eu 3+ . Meanwhile, the inherent fluorescence emission of the photochromic dye at 380 nm is switched off due to the Eu 3+ - induced drive of spiro-mero equilibrium to form mero form. The stoichiometry of dye-europium complexation was evaluated by fluorescence emission and UV-vis absorption spectroscopy and a 8:1 ratio was obtained in both cases. The binding constant (K) value of the dye-europium complex was 3 × 106 M -1 . In conclusion, the current molecular switch is a useful sensitive dual measuring tool for solutions containing europium or europium-like elements by evaluation of visible absorption or fluorescent emission spectroscopy.

  14. Metal plasmon enhanced europium complex luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Liu Feng [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Aldea, Gabriela [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Petru Poni Institute of Macromolecular Chemistry Iasi, Aleea Grigore Ghica Voda 41A, 700487 Iasi (Romania); Nunzi, Jean-Michel, E-mail: nunzijm@queensu.c [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada)


    The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod){sub 3}) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.

  15. Preparation of europium-labelled DNA probes and their properties. (United States)

    Hurskainen, P; Dahlén, P; Ylikoski, J; Kwiatkowski, M; Siitari, H; Lövgren, T


    A chemical method for labelling DNA with a europium chelate is presented. First, primary aliphatic amino groups are introduced onto DNA in a transamination reaction. The transamination reaction is altered by adjusting temperature and duration of the reaction. Subsequently, the modified DNA is reacted with an isothiocyanate derivative of a Eu chelate. The optimum amount of Eu chelates on a DNA probe is 4-8% of total nucleotides. There is a decrease of 0.7 degrees C in the melting temperature of DNA for each incorporated Eu chelate on 100 bases. Hybridization efficiency is lowered by the introduction of Eu chelates but this effect can be partly overcome by using high DNA probe concentrations. The detection limit of the Eu-labelled probe is 0.15 attomoles of target DNA in a mixed-phase hybridization assay on microtitration wells. In addition to high sensitivity the Eu-labelled probes offer convenience in use and results which are quantitative and easy to interpret. PMID:1826948

  16. Novel fluorescent probe for low density lipoprotein, based on the enhancement of Europium emission band


    Courrol, Lilia Coronato; Monteiro, A.M.; SILVA, F.R.O.; L. Gomes; VIEIRA, N.D.; Gidlund, Magnus; Figueiredo Neto, A.M.


    We report here the observation of the enhancement of Europium-tetracycline complex emission in Low Density Lipoprotein (LDL) solutions. Europium emission band of tetracycline solution containing Europium (III) chloride hexahydrate was tested to obtain effective enhancement in the presence of native LDL and oxidized LDL. Europium emission lifetime in the presence of lipoproteins was measured, resulting in a simple method to measure the lipoproteins quantity in an aqueous solution at physiologi...

  17. Europium ion as a probe for binding sites to carrageenans

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail:; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)


    Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.

  18. 46 CFR 154.1430 - Equipment locker. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equipment locker. 154.1430 Section 154.1430 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Safety Equipment § 154.1430 Equipment locker. One of each item of equipment under §§ 154.1400 and 154.1420 must be...

  19. How Do Radionuclides Accumulate in Marine Organisms? A Case Study of Europium with Aplysina cavernicola. (United States)

    Maloubier, Melody; Shuh, David K; Minasian, Stefan G; Pacold, Joseph I; Solari, Pier-Lorenzo; Michel, Hervé; Oberhaensli, François R; Bottein, Yasmine; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe


    In the ocean, complex interactions between natural and anthropogenic radionuclides, seawater, and diverse marine biota provide a unique window through which to examine ecosystem and trophic transfer mechanisms in cases of accidental dissemination. The nature of interaction between radionuclides, the marine environment, and marine species is therefore essential for better understanding transfer mechanisms from the hydrosphere to the biosphere. Although data pertaining to the rate of global transfer are often available, little is known regarding the mechanism of environmental transport and uptake of heavy radionuclides by marine species. Among marine species, sponges are immobile active filter feeders and have been identified as hyperaccumulators of several heavy metals. We have selected the Mediterranean sponge Aplysina cavernicola as a model species for this study. Actinide elements are not the only source of radioactive release in cases of civilian nuclear events; however, their physicochemical transfer mechanisms to marine species remain largely unknown. We have targeted europium(III) as a representative of the trivalent actinides such as americium or curium. To unravel biological uptake mechanisms of europium in A. cavernicola, we have combined radiometric (γ) measurements with spectroscopic (time-resolved laser-induced fluorescence spectroscopy, TRLIFS, and X-ray absorption near-edge structure, XANES) and imaging (transmission electron microscopy, TEM, and scanning transmission X-ray microscopy, STXM) techniques. We have observed that the colloids of NaEu(CO3)2·nH2O formed in seawater are taken up by A. cavernicola with no evidence that lethal dose has been reached in our working conditions. Spectroscopic results suggest that there is no change of speciation during uptake. Finally, TEM and STXM images recorded at different locations across a sponge cross section, together with differential cell separation, indicate the presence of europium particles (around

  20. Immunotargeting with CD154 (CD40 ligand) enhances DNA vaccine responses in ducks. (United States)

    Gares, Sheryl L; Fischer, Karl P; Congly, Stephen E; Lacoste, Stacey; Addison, William R; Tyrrell, D Lorne; Gutfreund, Klaus S


    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated duck hepatitis B virus (DHBV) core antigen (tcore) and chimera of tcore fused to tCD154 (tcore-tCD154). Expression in LMH cells demonstrated that all proteins were secreted and that tCD154 and tcore-tCD154 formed multimers. Ducks immunized with the plasmid ptcore-tCD154 developed accelerated and enhanced core-specific antibody responses compared to ducks immunized with ptcore or ptcore plus ptCD154. Antibody responses were better sustained in both ptcore-tCD154- and ptcore plus ptCD154-immunized ducks. Core-specific proliferative responses of duck peripheral blood mononuclear cells were enhanced in ducks immunized with ptcore-tCD154 or ptcore alone. This study suggests that the role of CD154 in the regulation of adaptive immune responses had already evolved before the divergence of birds and mammals. Thus, targeting of antigens to APCs with CD154 is an effective strategy to enhance DNA vaccine responses not only in mammalian species but also in avian species.

  1. First-Principles Investigations on Europium Monoxide

    KAUST Repository

    Wang, Hao


    Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.

  2. Chloride, bromide and iodide scintillators with europium (United States)

    Zhuravleva, Mariya; Yang, Kan


    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  3. Electrochemical extraction of europium from molten fluoride media

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Massot, L., E-mail: [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Chamelot, P.; Cassayre, L.; Taxil, P. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France)


    This work concerns the extraction of europium from molten fluoride media. Two electrochemical ways have been examined: (i) the use of a reactive cathode made of copper and (ii) the co-deposition with aluminium on inert electrode, leading to the formation of europium-copper and europium-aluminium alloys, respectively, as identified by SEM-EDS analysis. Cyclic voltammetry and square wave voltammetry were used to identify the reduction pathway and to characterise the step of Cu-Eu and Al-Eu alloys formation. Then, electrochemical extractions using the two methodologies have been performed with extraction efficiency around 92% for copper electrode and 99.7% for co-reduction with aluminium ions.

  4. Solubilization of europium fulvate in aqueous solutions containing complexing agents

    Energy Technology Data Exchange (ETDEWEB)

    Legin, E.K.; Trifonov, Yu.I.; Khokhlov, M.L. [Khlopin Radium Inst., St. Petersburg (Russian Federation)] [and others


    The europium fulvate complex is synthesized and characterized by spectroscopic and chemical methods. By an example of this complex, it is demonstrated that metal complexes of humic substances are solubilized in the presence of complexing anions such as OAc{sup {minus}}, C{sub 2}O{sup 2{minus}}{sub 4}, and EDTA{sup 2{minus}}. The solubilization is studied by the optical and radioactive tracer methods. The solubilization of europium fulvate increases parallel to the complexing power of anions. In the solid fulvate europium is bonded stronger than in the ethylenediaminetetraacetate complex. The solubilization is considered as a potential source for decomposition of the {open_quotes}absorbing soil complex,{close_quotes} resulting in mobile forms of a metal and humic component in soils and soil waters.

  5. Excess europium content in Precambrian sedimentary rocks and continental evolution (United States)

    Jakes, P.; Taylor, S. R.


    It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.

  6. Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

    Energy Technology Data Exchange (ETDEWEB)

    Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee


    This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

  7. pH-controlled delivery of luminescent europium coated nanoparticles into platelets (United States)

    Davies, Amy; Lewis, David J.; Watson, Stephen P.; Thomas, Steven G.; Pikramenou, Zoe


    Water soluble, luminescent gold nanoparticles are delivered into human platelets via a rapid, pH-controlled mechanism using a pH low insertion peptide, pHLIP. The approach introduces cocoating of gold nanoparticles with a europium luminescent complex, EuL and the pHLIP peptide to give pHLIP•EuL•Au. The 13-nm diameter gold nanoparticles act as a scaffold for the attachment of both the luminescent probe and the peptide to target delivery. Their size allows delivery of approximately 640 lanthanide probes per nanoparticle to be internalized in human platelets, which are not susceptible to transfection or microinjection. The internalization of pHLIP•EuL•Au in platelets, which takes just minutes, was studied with a variety of imaging modalities including luminescence, confocal reflection, and transmission electron microscopy. The results show that pHLIP•EuL•Au only enters the platelets in low pH conditions, pH 6.5, mediated by the pHLIP translocation across the membrane, and not at pH 7.4. Luminescence microscopy images of the treated platelets show clearly the red luminescence signal from the europium probe and confocal reflection microscopy confirms the presence of the gold particles. Furthermore, transmission electron microscopy gives a detailed insight of the internalization and spatial localization of the gold nanoparticles in the platelets. Thus, we demonstrate the potential of the design to translocate multimodal nanoparticle probes into cells in a pH dependent manner. PMID:22308346

  8. Tridentate benzimidazole-pyridine-tetrazolates as sensitizers of europium luminescence. (United States)

    Shavaleev, Nail M; Eliseeva, Svetlana V; Scopelliti, Rosario; Bünzli, Jean-Claude G


    We report on new anionic tridentate benzimidazole-pyridine-tetrazolate ligands that form neutral 3:1 complexes with trivalent lanthanides. The ligands are UV-absorbing chromophores that sensitize the red luminescence of europium with energy-transfer efficiency of 74-100%. The lifetime and quantum yield of the sensitized europium luminescence increase from 0.5 ms and 12-13% for the as-prepared solids to 2.8 ms and 41% for dichloromethane solution. From analysis of the data, the as-prepared solids can be described as aqua-complexes [Ln(κ(3)-ligand)2(κ(1)-ligand)(H2O)x] where the coordinated water molecules are responsible for the strong quenching of the europium luminescence. In solution, the coordinated water molecules are replaced by the nitrogen atoms of the κ(1)-ligand to give anhydrous complexes [Ln(κ(3)-ligand)3] that exhibit efficient europium luminescence. X-ray structures of the anhydrous complexes confirm that the lanthanide ion (La(III), Eu(III)) is nine-coordinate in a distorted tricapped trigonal prismatic environment and that coordination of the lanthanide ion by tetrazolate is weaker than by carboxylate.

  9. Europium 2-benzofuranoate: Synthesis and use for bioimaging (United States)

    Utochnikova, V. V.; Koshelev, D. S.; Medvedko, A. V.; Kalyakina, A. S.; Bushmarinov, I. S.; Grishko, A. Yu; Schepers, U.; Bräse, S.; Vatsadze, S. Z.


    Europium 2-benzofuranoate Eu(BFC)3(H2O)3 was successfully used for bioimaging in cellulo due to the combination of high solubility and high luminescence intensity in solution. It was possible due to the purposeful variation of the aromatic core of carboxylate anion.

  10. 46 CFR 154.446 - Tank design. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.446 Section 154.446 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type B § 154.446 Tank design. An independent tank type B must meet the calculations under § 154...


    Peppard, D.F.; Horwitz, E.P.; Mason, G.W.


    This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)

  12. Distribution, elimination, and renal effects of single oral doses of europium in rats. (United States)

    Ohnishi, Keiko; Usuda, Kan; Nakayama, Shin; Sugiura, Yumiko; Kitamura, Yasuhiro; Kurita, Akihiro; Tsuda, Yuko; Kimura, Motoshi; Kono, Koichi


    Single doses of europium (III) chloride hexahydrate were orally administered to several groups of rats. Cumulative urine samples were taken at 0-24 h, and blood samples were drawn after 24-h administration. The europium concentration was determined in these samples by inductively coupled plasma atomic emission spectroscopy. The volume, creatinine, ß-2-microglobulin, and N-acetyl-ß-D-glucosaminidase were measured in the urine samples to evaluate possible europium-induced renal effects. The blood samples showed low europium distribution, with an average of 77.5 μg/L for all groups. Although the urinary concentration and excretion showed dose-dependent increases, the percentage of europium excreted showed a dose-dependent decrease, with an average of 0.31% in all groups. The administration of europium resulted in a significant decrease of creatinine and a significant increase of urinary volume, N-acetyl-ß-D-glucosaminidase, and ß-2-microglobulin. Rare earth elements, including europium, are believed to form colloidal conjugates that deposit in the reticuloendothelial system and glomeruli. This specific reaction may contribute to low europium bioavailability and renal function disturbances. Despite low bioavailability, the high performance of the analytical method for determination of europium makes the blood and urine sampling suitable tools for monitoring of exposure to this element. The results presented in this study will be of great importance in future studies on the health impacts of rare earth elements.

  13. Interaction of CD154 with different receptors and its role in bidirectional signals. (United States)

    Alturaihi, Haydar; Hassan, Ghada S; Al-Zoobi, Loubna; Salti, Suzanne; Darif, Youssef; Yacoub, Daniel; El Akoum, Souhad; Oudghiri, Mounia; Merhi, Yahye; Mourad, Walid


    In addition to its classical receptor, CD40, it is now well established that CD154 also binds αIIbβ3, α5β1, and αMβ2 integrins. Although these integrins are all members of the same family, they bind CD154 differently. The current investigation aims to analyze the interaction of CD154 with α5β1 and αMβ2 and investigate its role in bidirectional signals in various human cell lines. Results obtained herein indicate that the CD154 residues involved in the interaction with α5β1 are N151 and Q166, whereas those involved in αMβ2 binding are common to residues required for CD40, namely Y145 and R203. Soluble CD40/CD154 or αMβ2/CD154 complexes do not interfere with the binding of CD154 to α5β1-positive cells, but inhibit the binding of CD154 to CD40- or αMβ2-positive cells, respectively. Ligation of CD154 on CD154-positive cells with soluble CD40, αIIbβ3, α5β1, or αMβ2 stimulates intracellular signaling, including MAPK phosphorylation. Given that CD154 exists as a trimer, our data strongly suggest that CD154 may bind concomitantly to two receptors of the same or different family, and biologically activate cells expressing both receptors. The characterization of CD154/receptor interactions helps the identification of new therapeutic targets for the prevention and/or treatment of CD154-associated autoimmune and inflammatory diseases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. [Synthesis and luminescence properties of reactive ternary europium complexes]. (United States)

    Guo, Dong-cai; Shu, Wan-gen; Zhang, Wei; Liu, You-nian; Zhou, Yue


    In this paper, five new reactive ternary europium complexes were synthesized with the first ligand of 1,10-phenanthroline and the reactive second ligands of maleic anhydride, acrylonitrile, undecenoic acid, oleic acid and linoleic acid, and also characterized by means of elemental analysis, EDTA titrimetric method, FTIR spectra and UV spectra. The fluorescence spectra show that the five new ternary complexes have much higher luminescence intensity than their corresponding binary complexes, and the synergy ability sequence of the five reactive ligands is as follows: linoleic acid > oleic acid > acrylonitrile > maleic anhydride > undecenoic acid. At the same time, the reactive ternary europium complexes coordinated with the reactive ligands, which can be copolymerized with other monomers, will provide a new way for the synthesis of bonding-type rare earth polymer functional materials with excellent luminescence properties.

  15. Faster Synthesis of Beta-Diketonate Ternary Europium Complexes: Elapsed Times & Reaction Yields. (United States)

    Lima, Nathalia B D; Silva, Anderson I S; Gerson, P C; Gonçalves, Simone M C; Simas, Alfredo M


    β-diketonates are customary bidentate ligands in highly luminescent ternary europium complexes, such as Eu(β-diketonate)3(L)2, where L stands for a nonionic ligand. Usually, the syntheses of these complexes start by adding, to an europium salt such as EuCl3(H2O)6, three equivalents of β-diketonate ligands to form the complexes Eu(β-diketonate)3(H2O)2. The nonionic ligands are subsequently added to form the target complexes Eu(β-diketonate)3(L)2. However, the Eu(β-diketonate)3(H2O)2 intermediates are frequently both difficult and slow to purify by recrystallization, a step which usually takes a long time, varying from days to several weeks, depending on the chosen β-diketonate. In this article, we advance a novel synthetic technique which does not use Eu(β-diketonate)3(H2O)2 as an intermediate. Instead, we start by adding 4 equivalents of a monodentate nonionic ligand L straight to EuCl3(H2O)6 to form a new intermediate: EuCl3(L)4(H2O)n, with n being either 3 or 4. The advantage is that these intermediates can now be easily, quickly, and efficiently purified. The β-diketonates are then carefully added to this intermediate to form the target complexes Eu(β-diketonate)3(L)2. For the cases studied, the 20-day average elapsed time reduced to 10 days for the faster synthesis, together with an improvement in the overall yield from 42% to 69%.

  16. Solvent extraction of europium(III) to a fluorine-free ionic liquid phase with a diglycolamic acid extractant


    Rout, Alok; Souza, Ernesto Rezende; Binnemans, Koen


    Europium(III) was extracted by bis(2-ethylhexyl)diglycolamic acid (DEHDGA) dissolved in the non-fluorinated ionic liquid tetraoctylammonium dodecyl sulphate, [N8888][DS]. The extraction behaviour of europium(III) was investigated as a function of various parameters: pH, extractant concentration, concentration of the europium(III) ion in the aqueous feed and concentration of the salting-out agent. A comparison was made with extraction of europium(III) by the acidic extractants bis(2-ethylhexyl...

  17. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)


    Jul 25, 2017 ... Abstract. Europium (Eu3+) doped silver lead borate glasses with the composition of xEu2O3−(1 − x)Ag2. O−29PbO−70B2O3 (x = 0, 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional melt quenching method. Thermal, structural and luminescence properties have been studied ...

  18. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    Europium (Eu 3 + ) doped silver lead borate glasses with the composition of x Eu 2 O 3 −( 1 − x )Ag 2 O−29PbO−70B 2 O 3 ( x = 0 , 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional meltquenching method. Thermal, structural and luminescence properties have been studied using ...

  19. Synthesis and luminescence properties for europium oxide nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mo Zunli, E-mail: [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China) and State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Deng Zhepeng; Guo Ruibin [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China); Fu Qiangang [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Feng Chao; Liu Pengwei; Sun Yu [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China)


    Highlights: Black-Right-Pointing-Pointer A novel high temperature sensitive fluorescent CNTs/Eu{sub 2}O{sub 3} nanocomposite was fabricated. Black-Right-Pointing-Pointer The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 Degree-Sign C for 4 h. Black-Right-Pointing-Pointer The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. Black-Right-Pointing-Pointer We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 Degree-Sign C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the {sup 5}D{sub 0} {yields} {sup 7}F{sub j} (j = 0, 1) forced electric dipole transition of Eu{sup 3+} ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 Degree-Sign C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu{sup 3+} energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.

  20. Optical and magnetization studies on europium based iron pnictides

    Energy Technology Data Exchange (ETDEWEB)

    Zapf, Sina Maria Ute


    The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.

  1. 46 CFR 154.660 - Pipe welding. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Pipe welding. 154.660 Section 154.660 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.660 Pipe welding. (a) Pipe welding must meet Part 57 of this chapter. (b) Longitudinal butt welds...

  2. 46 CFR 154.466 - Design criteria. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.466 Section 154.466 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.466 Design criteria. (a) The insulation for a cargo tank without a secondary barrier must be...

  3. 46 CFR 154.471 - Design criteria. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.471 Section 154.471 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.471 Design criteria. (a) The cargo tank support system must be designed: (1) For the loads in...

  4. 33 CFR 154.570 - Lighting. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lighting. 154.570 Section 154.570... TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.570 Lighting. (a) Except as... fixed lighting that adequately illuminates: (1) Each transfer connection point on the facility; (2) Each...

  5. 32 CFR 154.61 - Security education. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Security education. 154.61 Section 154.61... PERSONNEL SECURITY PROGRAM REGULATION Continuing Security Responsibilities § 154.61 Security education. (a.... Through security briefings and education, the Department of Defense continues to provide for the...

  6. 29 CFR 1915.154 - Respiratory protection. (United States)


    ... 29 Labor 7 2010-07-01 2010-07-01 false Respiratory protection. 1915.154 Section 1915.154 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... (PPE) § 1915.154 Respiratory protection. Respiratory protection for shipyard employment is covered by...

  7. 46 CFR 154.1405 - Respiratory protection. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Respiratory protection. 154.1405 Section 154.1405... Equipment § 154.1405 Respiratory protection. When Table 4 references this section, a vessel carrying the listed cargo must have: (a) Respiratory protection equipment for each person on board that protects the...

  8. 46 CFR 154.520 - Piping calculations. (United States)


    ...: (a) Pipe weight loads; (b) Acceleration loads; (c) Internal pressure loads; (d) Thermal loads; and (e... 46 Shipping 5 2010-10-01 2010-10-01 false Piping calculations. 154.520 Section 154.520 Shipping... Process Piping Systems § 154.520 Piping calculations. A piping system must be designed to meet the...

  9. 46 CFR 154.429 - Calculations. (United States)


    ... § 154.429 Calculations. The tank design load calculations for a membrane tank must include the following... submitted to meet this paragraph. (c) The combined strains from static, dynamic, and thermal loads. ... 46 Shipping 5 2010-10-01 2010-10-01 false Calculations. 154.429 Section 154.429 Shipping COAST...

  10. 46 CFR 154.1020 - Emergency power. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Emergency power. 154.1020 Section 154.1020 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1020 Emergency power. The emergency generator must be designed to allow operation at the final...

  11. 46 CFR 154.665 - Welding procedures. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Welding procedures. 154.665 Section 154.665 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Construction § 154.665 Welding procedures. Welding procedure tests for cargo tanks for a design temperature...

  12. 33 CFR 154.510 - Loading arms. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Loading arms. 154.510 Section 154... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.510 Loading arms. (a) Each mechanical loading arm used for transferring oil or hazardous material and placed into service...

  13. 46 CFR 154.439 - Tank design. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.439 Section 154.439 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type A § 154.439 Tank design. An independent tank type A must meet the deep tank standard of the...

  14. 46 CFR 154.420 - Tank design. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.420 Section 154.420 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Integral Tanks § 154.420 Tank design. (a) The structure of an integral tank must meet the deep tank scantling standards...

  15. 11 CFR 100.154 - Candidate debates. (United States)


    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  16. 46 CFR 154.1410 - Decontamination shower. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Decontamination shower. 154.1410 Section 154.1410... Equipment § 154.1410 Decontamination shower. When Table 4 references this section, a vessel carrying the listed cargo must have a decontamination shower and an eye wash that: (a) Are on the weatherdeck; and (b...

  17. 46 CFR 154.428 - Allowable stress. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

  18. 46 CFR 154.447 - Allowable stress. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.447 Section 154.447 Shipping COAST... Tank Type B § 154.447 Allowable stress. (a) An independent tank type B designed from bodies of revolution must have allowable stresses 3 determined by the following formulae: 3 See Appendix B for stress...

  19. 46 CFR 154.440 - Allowable stress. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...

  20. 46 CFR 154.421 - Allowable stress. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.421 Section 154.421 Shipping COAST... § 154.421 Allowable stress. The allowable stress for the integral tank structure must meet the American Bureau of Shipping's allowable stress for the vessel's hull published in “Rules for Building and Classing...

  1. 46 CFR 154.1840 - Protective clothing. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Protective clothing. 154.1840 Section 154.1840 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1840 Protective clothing... operation, except those assigned to gas-safe cargo control rooms, wears protective clothing. ...

  2. 46 CFR 154.702 - Refrigerated carriage. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Refrigerated carriage. 154.702 Section 154.702 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Pressure and Temperature Control § 154.702 Refrigerated carriage. (a) Each refrigeration system must: (1...

  3. 7 CFR 58.154 - Refrigerated storage. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Refrigerated storage. 58.154 Section 58.154 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... § 58.154 Refrigerated storage. Finished product in containers subject to such conditions that will...

  4. 46 CFR 154.1715 - Moisture control. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Moisture control. 154.1715 Section 154.1715 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1715 Moisture control. When a vessel is carrying sulfur dioxide, the master shall ensure that: (a...

  5. 32 CFR 154.55 - Requirements. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Requirements. 154.55 Section 154.55 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Unfavorable Administrative Actions § 154.55 Requirements. (a) General. For...

  6. 46 CFR 154.703 - Methane (LNG). (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG). 154.703 Section 154.703 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... and Temperature Control § 154.703 Methane (LNG). Unless a cargo tank carrying methane (LNG) can...

  7. 40 CFR 417.154 - [Reserved (United States)


    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true 417.154 Section 417.154 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Spray Dried Detergents Subcategory § 417.154 ...

  8. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  9. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength


    Vijayakumar, Balakrishnan; Velmurugan, Devadasan


    Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level.

  10. Surface-imprinted nanofilaments for europium-amplified luminescent detection of fluoroquinolone antibiotics. (United States)

    Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C


    The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Enhancement in red emission at room temperature from europium doped ZnO nanowires by 1,10 phenanthroline-europium interface induced resonant excitations

    Directory of Open Access Journals (Sweden)

    Soumen Dhara


    Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.

  12. Dual doped graphene oxide for electrochemical sensing of europium ion (United States)

    Kumar, Sunil; Patra, Santanu; Madhuri, Rashmi; Sharma, Prashant K.


    This present work represents a single step hydrothermal method for the preparation of N, and N, S dual doped graphene oxide (GO). First time, a comparative electrochemical study between single dope and dual doped GO was carried out using potassium ferrocyanide as an electro-active probe molecule and found that the dual doped GO has the highest electrocatalytic activity than single doped, due to the presence of two heteroatoms as a doping material. Afterwards, the dual doped GO was successfully applied for the electrochemical detection of a rare earth element i.e. europium, with LOD value of 5.92 μg L-1.

  13. Crystal growth of nanoscaled europium selenide having characteristic crystal shapes

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Adachi, Taka-aki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Hasegawa, Yasuchika, E-mail: hasegawa@ms.naist.j [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Kawai, Tsuyoshi [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan)


    Tetrapod-shaped EuSe nanocrystals were prepared through the thermal reduction of europium chloride an organic selenide complex, n-hexadecylamine, and two additives oleic acid and oleylamine. The obtained EuSe nanoparticles were characterized by X-ray diffraction (XRD). The crystal grain size from the XRD spectrum was estimated to be 50 nm. In contrast, observation of the transmission electron microscope (TEM) gave larger sized EuSe (average size: 200 nm). Anisotropic crystal-growth of EuSe nanocrystals was achieved by addition of a small amount of oleic acid in the crystal growth process.

  14. Photoprotective properties of the fluorescent europium complex in UV-irradiated skin. (United States)

    Vogt, O; Lademann, J; Rancan, F; Meinke, M C; Schanzer, S; Stockfleth, E; Sterry, W; Lange-Asschenfeldt, B


    In this study, we compared the UV-protective abilities of the europium complex compared to titanium dioxide, which represents the most common physical filter for ultraviolet light in the broad-band spectral range. The UV absorption and light transformative capacities of the europium complex were evaluated using a spectrometer with a double-integrating sphere showing that the europium complex does not only absorb and reflect UV light, but transforms it into red and infrared light. It was found that the europium complex binds to the surface of Jurkat cells in vitro. Cells incubated with the europium complex showed a significantly higher viability after UVA and UVB irradiation as compared to untreated cells and cells incubated with titanium dioxide pointing out its photoprotective properties. The europium complex and titanium dioxide show similar penetration capacities into the stratum corneum as tested in human and porcine skin using tape stripping analysis. The europium complex has proved to be an efficient UV filter with a low cyto- and phototoxic profile and therefore represents a potential candidate for use in sunscreen formulations. Copyright © 2013 S. Karger AG, Basel.

  15. Synthesis and pharmacological characterization of a europium-labelled single-chain antagonist for binding studies of the relaxin-3 receptor RXFP3. (United States)

    Haugaard-Kedström, Linda M; Wong, Lilian L L; Bathgate, Ross A D; Rosengren, K Johan


    Relaxin-3 and its endogenous receptor RXFP3 are involved in fundamental neurological signalling pathways, such as learning and memory, stress, feeding and addictive behaviour. Consequently, this signalling system has emerged as an attractive drug target. Development of leads targeting RXFP3 relies on assays for screening and ligand optimization. Here, we present the synthesis and in vitro characterization of a fluorescent europium-labelled antagonist of RXFP3. This ligand represents a cheap and safe but powerful tool for future mechanistic and cell-based receptor-ligand interaction studies of the RXFP3 receptor.

  16. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.


    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  17. In Vivo Toxicity Studies of Europium Hydroxide Nanorods in Mice (United States)

    Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H; Mukhopadhyay, Debabrata


    Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence properties and pro-angiogenic to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [EuIII(OH)3] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mgKg−1day−1) and time dependent manner (8–60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice sacrificed on day 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods. PMID:19616569

  18. Temperature dependences in electron-stimulated desorption of neutral europium

    CERN Document Server

    Ageev, V N; Madey, T E


    The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...

  19. The Oxidation State of Europium in Halide Glasses (United States)

    Weber, J.K.R.; Vu, M.; Paßlick, C.; Schweizer, S.; Brown, D.E.; Johnson, C.E.; Johnson, J.A.


    The luminescent properties of divalent europium ions can be exploited to produce storage phosphors for x-ray imaging applications. The relatively high cost and limited availability of divalent europium halides makes it desirable to synthesize them from the readily available trivalent salts. In this work, samples of pure EuCl3 and fluoride glass melts doped with EuCl3 were processed at 700-800 °C in an inert atmosphere furnace. The Eu oxidation state in the resulting materials was determined using fluorescence and Mössbauer spectroscopy. Heat treatment of pure EuCl3 for 10 minutes at 710 °C resulted in a material comprising approximately equal amounts of Eu2+ and Eu3+. Glasses made using mixtures of EuCl2 and EuCl3 in the starting material contained both oxidation states. This paper describes the sample preparation and analysis and discusses the results in the context of chemical equilibria in the melts. PMID:22101252

  20. Innovative triboluminescence study of multivitamin doped europium tetrakis

    Energy Technology Data Exchange (ETDEWEB)

    Fontenot, R.S. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, K.N.; Aggarwal, M.D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); Hollerman, W.A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States)


    As the Space Shuttle program ends, NASA is developing the next generation of space vehicles. These new concept designs will require new and innovative structural health monitoring capabilities. One way to solve this problem is with smart impact sensors that use triboluminescent materials. In 2011, the authors reported an 82% increase in the triboluminescence yield of europium dibenzoylmethide triethylammonium (EuD{sub 4}TEA) by changing the starting material. It has been shown that introduction of dopants tends to enhance the triboluminescent light yield. Here we report the successful synthesis of a multivitamin doped europium tetrakis which appears to be spherical in shape. Inductively Coupled Plasma - Optical Emission Spectroscopy analysis showed the presence of 3.6% calcium, 0.62% magnesium, 0.1% iron, 0.01% copper and manganese. This new product has no shift in the triboluminescent or photoluminescent emission peaks, but only a change in the intensity. In addition, the doped EuD{sub 4}TEA powder statistically emits more triboluminescence while having the same decay time. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Development of europium doped core-shell silica cobalt ferrite functionalized nanoparticles for magnetic resonance imaging. (United States)

    Kevadiya, Bhavesh D; Bade, Aditya N; Woldstad, Christopher; Edagwa, Benson J; McMillan, JoEllyn M; Sajja, Balasrinivasa R; Boska, Michael D; Gendelman, Howard E


    The size, shape and chemical composition of europium (Eu3+) cobalt ferrite (CFEu) nanoparticles were optimized for use as a "multimodal imaging nanoprobe" for combined fluorescence and magnetic resonance bioimaging. Doping Eu3+ ions into a CF structure imparts unique bioimaging and magnetic properties to the nanostructure that can be used for real-time screening of targeted nanoformulations for tissue biodistribution assessment. The CFEu nanoparticles (size ∼7.2nm) were prepared by solvothermal techniques and encapsulated into poloxamer 407-coated mesoporous silica (Si-P407) to form superparamagnetic monodisperse Si-CFEu nanoparticles with a size of ∼140nm. Folic acid (FA) nanoparticle decoration (FA-Si-CFEu, size ∼140nm) facilitated monocyte-derived macrophage (MDM) targeting. FA-Si-CFEu MDM uptake and retention was higher than seen with Si-CFEu nanoparticles. The transverse relaxivity of both Si-CFEu and FA-Si-CFEu particles were r2=433.42mM-1s-1 and r2=419.52mM-1s-1 (in saline) and r2=736.57mM-1s-1 and r2=814.41mM-1s-1 (in MDM), respectively. The results were greater than a log order-of-magnitude than what was observed at replicate iron concentrations for ultrasmall superparamagnetic iron oxide (USPIO) particles (r2=31.15mM-1s-1 in saline) and paralleled data sets obtained for T2 magnetic resonance imaging. We now provide a developmental opportunity to employ these novel particles for theranostic drug distribution and efficacy evaluations. A novel europium (Eu3+) doped cobalt ferrite (Si-CFEu) nanoparticle was produced for use as a bioimaging probe. Its notable multifunctional, fluorescence and imaging properties, allows rapid screening of future drug biodistribution. Decoration of the Si-CFEu particles with folic acid increased its sensitivity and specificity for magnetic resonance imaging over a more conventional ultrasmall superparamagnetic iron oxide particles. The future use of these particles in theranostic tests will serve as a platform for

  2. Photoactive thin films of polycaprolactam doped with europium (III) complex using phenylalanine as ligand

    Energy Technology Data Exchange (ETDEWEB)

    Santos Garcia, Irene Teresinha, E-mail: [Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil); Velleda Ribeiro, Patricia; Silva Correa, Diogo; Neto da Cunha, Igor Michel; Lenin Villarreal Carreno, Neftali [Instituto de Quimica e Geociencias, Universidade Federal de Pelotas, Campus Capao do Leao, s/n. CEP 96010-900, Pelotas, RS (Brazil); Ceretta Moreira, Eduardo [PPGEE, Universidade Federal do Pampa, Campus Bage, Bage- RS (Brazil); Severo Rodembusch, Fabiano [Departamento de Quimica Organica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil)


    A photoactive complex based on europium(III) using the amino acid phenylalanine as ligand was prepared and characterized. The obtained europium(III)/phenylalanine complex presents an effective energy transfer from ligands to the rare earth center. The observed photoluminescent behavior for europium(III)/phenylalanine complex was similar to the well known europium(III)/ acetyl-{beta}-acetonate hydrate. New photoactive polyamide thin films were prepared using polycaprolactam as host of these complexes. The structural characterizations of the films were studied through Rutherford backscattering (RBS), Fourier transform infrared (FTIR) and Raman spectroscopies. The polyamide films doped with the amino acid and acetyl-{beta}-acetonate rare earth complexes maintain the original photoluminescent behavior, narrow emission bands corresponding to transitions {sup 5}D{sub 0} {yields} {sup 7}F{sub 0-4}, which indicates that this polymer is an excellent host to these complexes.

  3. [Synthesis and luminescence properties of ternary complexes of europium with aromatic carboxylic acid and acrylonitrile]. (United States)

    Guo, Dong-cai; Yi, Li-ming; Shu, Wan-gen; Zhang, Zhen-zhen; Zeng, Zhao-rong; Zhang, Xi-qian


    Five ternary complexes were synthesized from europium with aromatic carboxylic acid (p-methylbenzoic acid, methoxybenzoic acid, m-chlorobenzoic acid and benzoic acid, p-hydroxylbenzoic acid) and acrylonitrile, and characterized by means of elemental analysis, thermal analysis, FTIR spectra and UV spectra. The fluorescence spectra show that five ternary complexes have good luminescence properties, and the sequence of the ability of the aromatic carboxylic acids to transfer light energy to europium ion is as follows: p-methylbenzoic acid>benzoic acid>m-chlorobenzoic acid>p-hydroxylbenzoic acid>methoxybenzoic acid. Meanwhile, the ternary europium complexes containing a reactive ligand acrylonitrile will possibly have a potential application to the fabrication of bonding-type europium polymer luminescent materials.

  4. 33 CFR 154.1216 - Facility classification. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Facility classification. 154.1216... Vegetable Oils Facilities § 154.1216 Facility classification. (a) The Coast Guard classifies facilities that... classification of a facility that handles, stores, or transports animal fats or vegetable oils. The COTP may...

  5. 32 CFR 154.34 - Priority requests. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Priority requests. 154.34 Section 154.34... requests. To insure that personnel security investigations are conducted in an orderly and efficient manner, requests for priority for individual investigations or categories of investigations shall be kept to a...

  6. 42 CFR 441.154 - Active treatment. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Active treatment. 441.154 Section 441.154 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... treatment. Inpatient psychiatric services must involve “active treatment”, which means implementation of a...

  7. 46 CFR 154.1725 - Ethylene oxide. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide. 154.1725 Section 154.1725 Shipping COAST....1725 Ethylene oxide. (a) A vessel carrying ethylene oxide must: (1) Have cargo piping, vent piping, and... space of an ethylene oxide cargo tank for a period of 30 days under the condition of paragraph (e) of...

  8. 32 CFR 154.30 - General. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false General. 154.30 Section 154.30 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... security investigations shall be limited to those required to accomplish the Defense mission. Such requests...

  9. 32 CFR 154.1 - Purpose. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Purpose. 154.1 Section 154.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... employees in the Department of Defense (DoD), and granting members of the Armed Forces, DoD civilian...

  10. 18 CFR 154.502 - Reports. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 154.502... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS Refunds and Reports § 154.502 Reports. (a) When the natural gas company is required, either by a Commission order or as a part of a...

  11. 33 CFR 154.1075 - Appeal process. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Appeal process. 154.1075 Section 154.1075 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED....1075 Appeal process. (a) Any owner or operator of a facility who desires to appeal the classification...

  12. 46 CFR 154.1755 - Nitrogen. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Nitrogen. 154.1755 Section 154.1755 Shipping COAST GUARD... Nitrogen. Except for deck tanks and their piping systems, cargo containment systems and piping systems carrying nitrogen must be specially approved by the Commandant (CG-522). ...

  13. 46 CFR 154.605 - Toughness test. (United States)


    ... of this chapter. (b) If subsize test specimens are used for the Charpy V-notch toughness test, the... 46 Shipping 5 2010-10-01 2010-10-01 false Toughness test. 154.605 Section 154.605 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR...

  14. 46 CFR 154.460 - Design criteria. (United States)


    ... dynamic loads in § 154.409(e); (c) If the primary barrier fails, prevent the temperature of the vessel's structure from falling below the minimum allowable service temperature of the steel; and (d) Be designed so... tank for at least 15 days under the dynamic loads in § 154.409(e); (b) If a partial secondary barrier...

  15. 34 CFR 668.154 - Institutional accountability. (United States)


    ... 34 Education 3 2010-07-01 2010-07-01 false Institutional accountability. 668.154 Section 668.154 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY... accountability. An institution shall be liable for the Title IV, HEA program funds disbursed to a student whose...

  16. 40 CFR 93.154 - Conformity analysis. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  17. 33 CFR 154.800 - Applicability. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Applicability. 154.800 Section 154.800 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... receives cargo vapor from a vessel is connected to a facility vapor control system that serves tank storage...

  18. Optical characterization of europium-doped indium hydroxide nanocubes obtained by Microwave-Assisted Hydrothermal method


    Motta, Fabiana Villela da; Marques,Ana Paula de Azevedo; Araújo,Vinícius Dantas de; Tavares, Mara Tatiane De Souza; Delmonte,Mauricio Roberto Bomio; Paskocimas, Carlos Alberto; Li, Máximo Siu; Nascimento, Rubens Maribondo do; Longo, Elson [UNESP


    Crystalline europium-doped indium hydroxide (In(OH)3:Eu) nanostructures were prepared by rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of europium-doped indium hydroxide (IH:xEu) samples under excitation (350.7 nm) present...

  19. Structural and optical properties of europium doped zirconia single crystals fibers grown by laser floating zone


    Soares, M.R.N.; Nico, C.; Peres, M.; Ferreira, N.; Fernandes, A.J.S.; Monteiro, T.; COSTA, F.M.


    Yttria stabilized zirconia single crystal fibers doped with europium ions were developed envisaging optical applications. The laser floating zone technique was used in order to grow millimetric high quality single crystal fibers. The as-grown fibers are completely transparent and inclusion free, exhibiting a cubic structure. Under ultraviolet (UV) excitation, a broad emission band appears at 551 nm. The europium doped fibers are translucent with a tetragonal structure and exhibit an intense r...

  20. Intercalated europium metal in epitaxial graphene on SiC (United States)

    Anderson, Nathaniel A.; Hupalo, Myron; Keavney, David; Tringides, Michael C.; Vaknin, David


    X-ray magnetic circular dichroism (XMCD) reveals the magnetic properties of intercalated europium metal under graphene on SiC(0001). The intercalation of Eu nanoclusters (average size 2.5 nm) between graphene and SiC substate are formed by deposition of Eu on epitaxially grown graphene that is subsequently annealed at various temperatures while keeping the integrity of the graphene layer. Using sum-rules analysis of the XMCD of Eu M4 ,5 edges at T =15 K, our samples show paramagnetic-like behavior with distinct anomaly at T ≈90 K, which may be related to the Nèel transition, TN=91 K, of bulk metal Eu. We find no evidence of ferromagnetism due to EuO or antiferromagnetism due to Eu2O3 , indicating that the graphene layer protects the intercalated metallic Eu against oxidation over months of exposure to atmospheric environment.

  1. Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal, A., E-mail: [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)


    Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.

  2. Dicty_cDB: VHP154 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP154 (Link to dictyBase) - G23560 DDB0231372 Contig-U12088-1 | Contig-U13789-1 VHP...154P (Link to Original site) VHP154F 617 VHP154Z 715 VHP154P 1312 - - Show VHP154 Libr...ary VH (Link to library) Clone ID VHP154 (Link to dictyBase) Atlas ID - NBRP ID G23560 dictyBase ID Representative seq. ID VHP154P (Link to Original site) ...Representative DNA sequence >VHP154 (VHP154Q) /CSM/VH/VHP1-C/VHP154Q.Seq.d/ TACAACTGCAGCTAATTTATTCAAGAAAACCG

  3. Luminescent single-walled carbon nanotube-sensitized europium nanoprobes for cellular imaging (United States)

    Avti, Pramod K; Sitharaman, Balaji


    Lanthanoid-based optical probes with excitation wavelengths in the ultra-violet (UV) range (300–325 nm) have been widely developed as imaging probes. Efficient cellular imaging requires that lanthanoid optical probes be excited at visible wavelengths, to avoid UV damage to cells. The efficacy of europium-catalyzed single-walled carbon nanotubes (Eu-SWCNTs), as visible nanoprobes for cellular imaging, is reported in this study. Confocal fluorescence microscopy images of breast cancer cells (SK-BR-3 and MCF-7) and normal cells (NIH 3T3), treated with Eu-SWCNT at 0.2 μg/mL concentration, showed bright red luminescence after excitation at 365 nm and 458 nm wavelengths. Cell viability analysis showed no cytotoxic effects after the incubation of cells with Eu-SWCNTs at this concentration. Eu-SWCNT uptake is via the endocytosis mechanism. Labeling efficiency, defined as the percentage of incubated cells that uptake Eu-SWCNT, was 95%–100% for all cell types. The average cellular uptake concentration was 6.68 ng Eu per cell. Intracellular localization was further corroborated by transmission electron microscopy and Raman microscopy. The results indicate that Eu-SWCNT shows potential as a novel cellular imaging probe, wherein SWCNT sensitizes Eu3+ ions to allow excitation at visible wavelengths, and stable time-resolved red emission. The ability to functionalize biomolecules on the exterior surface of Eu-SWCNT makes it an excellent candidate for targeted cellular imaging. PMID:22619533

  4. CD40/CD154 blockade inhibits dendritic cell expression of inflammatory cytokines but not costimulatory molecules. (United States)

    Ferrer, Ivana R; Liu, Danya; Pinelli, David F; Koehn, Brent H; Stempora, Linda L; Ford, Mandy L


    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonism on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor Ag (OVA). Adoptive transfer of OVA-specific CD4(+) and CD8(+) T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c(+) DCs compared with untreated controls. However, DCs isolated from anti-CD154-treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of Ag-specific CD4(+) and CD8(+) T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival.

  5. 40 CFR 721.9511 - Silicic acid (H6SiO2O7), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (United States)


    ..., strontium salt(1:1:2), dysprosium and europium-doped. 721.9511 Section 721.9511 Protection of Environment...), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (a) Chemical substance and significant new..., strontium salt(1:1:2), dysprosium and europium-doped. (PMN P-98-848; CAS No.181828-07-9) is subject to...

  6. 154 GHz collective Thomson scattering in LHD (United States)

    Tanaka, K.; Nishiura, M.; Kubo, S.; Shimozuma, T.; Saito, T.; Moseev, D.; Abramovic, I.


    Collective Thomson scattering (CTS) was developed by using a 154 GHz gyrotron, and the first data has been obtained. Already, 77 GHz CTS has worked successfully. However, in order to access higher density region, 154 GHz option enhances the usability that reduces the refraction effect, which deteriorates in the local measurements. The system in the down converted frequency was almost identical to the system for 77 GHz. Probing beam, a notch filter, a mixer, and a local oscillator in the receiver system for 77 GHz option were replaced to those for the 154 GHz option. 154 GHz gyrotron was originally prepared for the second harmonic electron cyclotron heating (ECRH) at 2.75 T. However, scattering signal was masked by the second harmonic electron cyclotron emission (ECE) at 2.75 T. Therefore, 154 GHz CTS was operated at 1.375 T with fourth harmonic ECE, and an acceptable signal to noise ratio was obtained. There is a signature of fast ion components with neutral beam (NB) injection. In addition, the CTS spectrum became broader in hydrogen discharge than in deuterium discharge, as the theoretical CTS spectrum expects. This observation indicates a possibility to identify ion species ratio by the 154 GHz CTS diagnostic.

  7. Fluorescent lifetime imaging microscopy using Europium complexes improves atherosclerotic plaques discrimination. (United States)

    Sicchieri, Letícia Bonfante; de Andrade Natal, Rodrigo; Courrol, Lilia Coronato


    The objective of this study is to characterize arterial tissue with and without atherosclerosis by fluorescence lifetime imaging microscopy (FLIM) using Europium Chlortetracycline complex (EuCTc) as fluorescent marker. For this study, twelve rabbits were randomly divided into a control group (CG) and an experimental group (EG), where they were fed a normal and hypercholesterolemic diet, respectively, and were treated for 60 days. Cryosections of the aortic arch specimens were cut in a vertical plane, mounted on glass slides, and stained with Europium (Eu), Chlortetracycline (CTc), Europium Chlortetracycline (EuCTc), and Europium Chlortetracycline Magnesium (EuCTcMg) solutions. FLIM images were obtained with excitation at 405 nm. The average autofluorescence lifetime within plaque depositions was ~1.36 ns. Reduced plaque autofluorescence lifetimes of 0.23 and 0.31 ns were observed on incubation with EuCTc and EuCTcMg respectively. It was observed a quenching of collagen, cholesterol and TG emission spectra increasing EuCTc concentration. The drastic reduction in fluorescence lifetimes is due to a resonant energy transfer between collagen, triglycerides, cholesterol and europium complexes, quenching fluorescence.

  8. Visible-light sensitized luminescent europium(III)-β-diketonate complexes: bioprobes for cellular imaging. (United States)

    Reddy, M L P; Divya, V; Pavithran, Rani


    Visible-light sensitized luminescent europium(III) molecular materials are of considerable importance because their outstanding photophysical properties make them well suited as labels in fluorescence-based bioassays and low-voltage driven pure red-emitters in optoelectronic technology. One challenge in this field is development of visible-light sensitizing ligands that can form highly emissive europium(III) complexes with sufficient stability and aqueous solubility for practical applications. Indeed, some of the recent reports have demonstrated that the excitation-window can be shifted to longer-wavelengths in europium(III)-β-diketonate complexes by appropriate molecular engineering and suitably expanded π-conjugation in the complex molecules. In this review, attention is focused on the latest innovations in the syntheses and photophysical properties of visible-light sensitized europium(III)-β-diketonate complexes and their application as bioprobes for cellular imaging. Furthermore, luminescent nanomaterials derived from long-wavelength sensitized europium(III)-β-diketonate complexes and their application in life sciences are also highlighted.

  9. The electronic properties of mixed valence hydrated europium chloride thin film. (United States)

    Silly, M G; Charra, F; Lux, F; Lemercier, G; Sirotti, F


    We investigate the electronic properties of a model mixed-valence hydrated chloride europium salt by means of high resolution photoemission spectroscopy (HRPES) and resonant photoemission spectroscopy (RESPES) at the Eu 3d → 4f and 4d → 4f transitions. From the HRPES spectra, we have determined that the two europium oxidation states are homogeneously distributed in the bulk and that the hydrated salt film is exempt from surface mixed valence transition. From the RESPES spectra, the well separated resonant contributions characteristic of divalent and trivalent europium species (4f(6) and 4f(7) final states, respectively) are accurately extracted and quantitatively determined from the resonant features measured at the two edges. The partial absorption yield spectra, obtained by integrating the photoemission intensity in the valence-band region, can be well reproduced by atomic multiplet calculation at the M(4,5) (3d-4f) absorption edge and by an asymmetric Fano-like shape profile at the N(4,5) (4d-4f) absorption edge. The ratio of Eu(2+) and Eu(3+) species measured at the two absorption edges matches with the composition of the mixed valence europium salt as determined chemically. We have demonstrated that the observed spectroscopic features of the mixed valence salt are attributed to the mixed-valence ground state rather than surface valence transition. HRPES and RESPES spectra provide reference spectra for the study of europium salts and their derivatives.

  10. Europium-doped calcium titanate: Optical and structural evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)


    Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.

  11. 46 CFR 154.355 - Bow and stern loading piping. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading piping. 154.355 Section 154.355... Arrangements § 154.355 Bow and stern loading piping. (a) Bow and stern loading piping must: (1) Meet § 154.310... other openings to accommodation, service, or control spaces that face the bow or stern loading area must...

  12. 46 CFR 154.408 - Cargo tank external pressure load. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank external pressure load. 154.408 Section 154... Equipment Cargo Containment Systems § 154.408 Cargo tank external pressure load. For the calculation required under § 154.406 (a)(2) and (b), the external pressure load must be the difference between the...

  13. 46 CFR 154.178 - Contiguous hull structure: Heating system. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Heating system. 154.178... Equipment Hull Structure § 154.178 Contiguous hull structure: Heating system. The heating system for... the heating capacity to meet § 154.174(b)(2) or § 154.176(b)(2); (b) Have stand-by heating to provide...

  14. RBS and RNRA studies on sorption of europium by apatite

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi


    The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)

  15. Spectrofluorimetric determination of heparin using doxycycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Li Jing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Liu Jinkai [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Zhu Xiaojing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Peng Qian [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan 250014 (China)]. E-mail:


    A new spectrofluorimetric method was developed for the determination of the trace amount of heparin (Hep). Using doxycycline (DC)-europium ion (Eu{sup 3+}) as a fluorescent probe, in the buffer solution of pH=8.9, Hep can remarkably enhance the fluorescence intensity of the DC-Eu{sup 3+} complex at {lambda}=612 nm and the enhanced fluorescence intensity of Eu{sup 3+} ion is in proportion to the concentration of Hep. Optimum conditions for the determination of Hep were also investigated. The linear range and detection limit for the determination of Hep are 0.04-0.8 {mu}g/mL and 19.7 ng/mL, respectively. This method is simple, practical, and relatively free of interference from coexisting substances and can be successfully applied to assess Hep in biological samples. By the Rosenthal graphic method, the association constant and binding numbers of Hep with the probe are 6.60x10{sup 4} L/mol and 33.9. Moreover, the enhancement mechanism of the fluorescence intensity in the DC-Eu{sup 3+} system and the DC-Eu{sup 3+}-Hep-CTMAB system have been also discussed.

  16. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    Energy Technology Data Exchange (ETDEWEB)

    Babain, V.A.; Alyapyshev, M.Yu.; Karavan, M.D. [V.G. Khlopin Radium Inst., St. Petersburg (Russian Federation); Boehmer, V.; Wang, L. [Johannes Guttenberg Univ., Mainz (Germany); Shokova, E.A.; Motornaya, A.E.; Vatsouro, I.M.; Kovalev, V.V. [M. V. Lomonosov Moscow State Univ., Moscow (Russian Federation)


    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH{sub 2}){sub n}-NH-C(O)-CH{sub 2-}P(O)Ph{sub 2}] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO{sub 3} solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient D{sub Am}/D{sub Eu} for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (D{sub Am}/D{sub Eu}). (orig.)

  17. Chloride, bromide and iodide scintillators with europium doping (United States)

    Zhuravleva, Mariya; Yang, Kan


    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  18. Spectrofluorimetric determination of lecithin using a tetracycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ting [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China)]. E-mail:


    Trace amount of lecithin (PC) was determined in the buffer solution of pH 5.7, using tetracycline (TC)-europium ion (Eu{sup 3+}) as a fluorescent probe. PC can remarkably enhance the fluorescence intensity of the TC-Eu{sup 3+} complex at {lambda} = 612 nm and the enhanced fluorescence intensity of Eu{sup 3+} is in proportion to the concentration of PC. Optimum conditions for the determination of PC were also investigated. The linear range and detection limit for the determination of PC are 4.0 x 10{sup -7} to 1.4 x 10{sup -5} mol/L and 3.9 x 10{sup -8} mol/L. This method is simple, practical and relatively free of interference from coexisting substances and can be successfully applied to assess PC in serum samples. Moreover, the enhancement mechanism of the fluorescence intensity in the TC-Eu{sup 3+} system, the TC-Eu{sup 3+}-PC system, and the TC-Eu{sup 3+}-PC-sodium dodecyl benzene sulfonate (SDS) system is also discussed.

  19. Artifacts in the determination of the binding of americium and europium to an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Lead, J.R.; Hamilton-Taylor, J.; Kelly, M. [Institute of Environmental and Biological Sciences, Lancaster University, Lancaster (United Kingdom)


    The binding of europium and americium by an aquatic fulvic acid was investigated using an equilibrium ion exchange technique (Schubert`s method). The results for europium were consistent with literature data. Americium gave anomalous results for both the D{sub o} values (partition coefficient of the metal between the resin and solution phases in the absence of the fulvic acid) and D values (partition coefficient of the metal between the resin and solution phases in the presence of the fulvic acid). The values for americium were unexpectedly low and, in the case of D values, only slightly pH dependent. The cause of the discrepancy was found to be the partial dissolution of the resin or the loss of small colloidal material from the resin. The effects on the europium results were minimal due to the use of lower resin weights and higher metal concentrations

  20. Synthesis and luminescence properties of 2-(benzylcarbamoyl)phenyl derivatives and their europium complexes. (United States)

    Guo, Dongcai; He, Wei; Liu, Bang; Gou, Lining; Li, Ruixia


    Six novel 2-(benzylcarbamoyl)phenyl derivatives were synthesized and characterized by (1) H-NMR, mass spectrometry, infrared spectra and elemental analysis. Their europium complexes were prepared and characterized by elemental analysis, EDTA titrimetric analysis, IR and UV spectra as well as molar conductivity measurements. The luminescence properties of these complexes were investigated and results show that 2-(benzylcarbamoyl)phenyl derivatives possess high selectivity and good coordination with the europium ion. Complex Eu-2-(benzylcarbamoyl)phenyl-2-phenylacetate showed green luminescence that was emitted by the ligand of 2-(benzylcarbamoyl)phenyl-2-phenylacetate, while other complexes showed the characteristic red luminescence of europium ion and also possessed high luminescence intensity. Copyright © 2012 John Wiley & Sons, Ltd.

  1. Induction of Circularly Polarized Luminescence from Europium by Amino Acid Based Ionic Liquids. (United States)

    Zercher, Ben; Hopkins, Todd A


    Materials that emit circularly polarized light have application in several important industries. Because they show large optical activity and emit sharp visible light transitions, europium complexes are often exploited in applications that require circularly polarized luminescence (CPL). Chiral and coordinating ionic liquids based on prolinate, valinate, and aspartate anions are used to induce CPL from a simple achiral europium triflate salt. The sign of the induced CPL is dependent on the handedness (l vs d) of the amino acid anion. Comparison of the CPL spectra in ionic liquid with proline and valine vs aspartate shows that the number of carboxylate groups in the amino acid anion influences the europium coordination environment. DFT calculations predict a chiral eight-coordinate Eu(Pro)4- structure in the prolinate ionic liquid and a chiral seven- or eight-coordinate Eu(Asp)33- structure in the aspartate ionic liquid.

  2. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dongwook, E-mail: [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)


    A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.

  4. Europium stearate additives delay oxidation of UHMWPE for orthopaedic applications: a pilot study. (United States)

    Gallardo, Luis A; Carpentieri, Ilenia; Laurent, Michel P; Costa, Luigi; Wimmer, Markus A


    Ultrahigh-molecular-weight polyethylene (UHMWPE) is used as an articulating surface in prosthetic devices. Its failure under various mechanisms after oxidation is of utmost concern. Free radicals formed during the sterilization process using high-energy irradiation result in oxidation. Europium, an element of the lanthanide family, has a unique electron configuration with an unusual lack of preference for directional bonding and notable bonding to oxygen. Because of this, it currently is used in studies for stabilization of polymers such as polyvinyl chloride. We asked whether europium stearate could enhance the oxidation resistance after irradiation in nitrogen of UHMWPE. Conventional nonirradiated and gamma-irradiated in nitrogen UHMWPE were compared with polyethylene doped with 375 ppm and 3750 ppm europium(III) stearate under the same treatment conditions. Chemical characterization was performed by Fourier transform infrared (FTIR) microspectroscopy using 200-μm thin films. The oxidation of doped samples with time was compared with that of conventional samples using accelerated oven aging. The types of oxidation products were identified by FTIR and quantified per material and treatment condition as indications of the oxidation level and mechanism. The generation rate of hydroperoxides and ketones was decelerated proportionally with concentration of europium stearates. The oxidative mechanism appeared similar to that of conventional polyethylene with the same types of measurable end products as ketones and hydroperoxides. Yet, the rate of generation of the latter appeared to be slowed down by the action of europium stearate. Europium stearate mixed in UHMWPE decelerated the oxidation reactions triggered by gamma irradiation in nitrogen, seemingly without major alteration of the oxidation mechanism.

  5. Temperature dependent luminescence of a europium complex incorporated in poly(methyl methacrylate). (United States)

    Liang, Hao; Xie, Fang; Ren, Xiaojun; Chen, Yifa; Chen, Biao; Guo, Fuquan


    An europium β-diketonate complex with a dipyrazolyltriazine derivative ligand, Eu(TTA)3DPBT, has been incorporated into poly(methyl methacryate) (PMMA). The influence of temperature on its luminescence properties has been investigated. The fluorescence emission spectra and luminescence lifetimes showed temperature sensitivity. The analysis of the relative intensity ratio (R) of (5)D0 → (7)F2 to (5)D0 → (7)F1 transition and Judd-Ofelt experimental intensity parameters Ω2 indicated that the local structure and asymmetry in the vicinity of europium ions show no obvious change when the temperature is increased. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. 18 CFR 154.309 - Incremental expansions. (United States)


    ... Changes § 154.309 Incremental expansions. (a) For every expansion for which incremental rates are charged... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Incremental expansions... incremental facilities to be rolled-in to the pipeline's rates. For every expansion that has an at-risk...

  7. 46 CFR 154.448 - Calculations. (United States)


    ... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent... similar vessel. (d) A tank buckling analysis considering the maximum construction tolerance. (e) A finite element analysis using the loads determined under § 154.406. (f) A fracture mechanics analysis using the...

  8. 32 CFR 154.41 - Central adjudication. (United States)


    ... administrative action is contemplated under § 154.56(b), the letter of intent (LOI) to deny or revoke must be...-5. A final notification of unfavorable administrative action, subsequent to the issuance of the LOI.... A final notification of unfavorable administrative action subsequent to the issuance of the LOI must...

  9. 18 CFR 154.106 - Map. (United States)


    ....106 Map. (a) The map must show the general geographic location of the company's principal pipeline... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Map. 154.106 Section... on a single map. In addition, a separate map should be provided for each zone. (b) (c) The map must...

  10. 46 CFR 154.1345 - Gas detection. (United States)


    ...” in Table 4 must have: (1) A fixed flammable gas detection system that meets § 154.1350; and (2) Two portable gas detectors that can each measure 0 to 100% of the lower flammable limit of the cargo carried... sulfur dioxide must have a fixed gas detection system that is not located in a gas-safe space. (d) A...

  11. 33 CFR 154.1010 - Purpose. (United States)


    ... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154.1010 Purpose. This subpart establishes oil spill response plan requirements for all marine transportation... response plan prepares the facility owner or operator to respond to an oil spill. These requirements...

  12. 7 CFR 3560.154 - Tenant selection. (United States)


    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.154 Tenant... documented in the housing project's management plan and Affirmative Fair Housing Marketing Plan. (d... regardless of income. Such applicants, however, will be ranked among themselves by income level, giving...

  13. Preparation of activated carbon from doum stone and its application on adsorption of 60Co and 152+154Eu: Equilibrium, kinetic and thermodynamic studies. (United States)

    Hamed, Mostafa M; Ali, M M S; Holiel, M


    Removal of radionuclides from wastewater before discharging to environment is necessary for the safety of living beings. Activated carbon prepared from doum stone (DS), an agricultural waste by-product, has been used for the sorption of 60Co and 152+154Eu radionuclides from aqueous solutions. DS has been characterized by different analytical tools. The efficiency of the adsorbent was investigated using batch sorption technique under different experimental conditions. The equilibrium sorption data were analyzed using Freundlich and Langmuir isotherm models. The kinetic experimental data were analyzed using four kinetic models including pseudo-first order, pseudo-second order, Elovich and intraparticle diffusion model to examine the mechanism of sorption and potential rate-controlling step. The maximum capacity of DS was found to be 121 mg/g and 166 mg/g for cobalt and europium, respectively. Sorption efficiency of DS to remove 60Co, 152+154Eu and 134Cs from real radioactive wastewater and environmental (river water and sea water) samples was also investigated. The results revealed that the prepared DS as low cost could be used as a promising material for the simultaneous removal of different radionuclides such as 60Co, 152+154Eu and 134Cs, or trivalent actinides such as 241, 242m,243Am from real radioactive waste and environmental water samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Study of the europium behavior in aqueous media; Estudio sobre el comportamiento del europio en medios acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)


    Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.

  15. Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions

    Energy Technology Data Exchange (ETDEWEB)

    Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)


    Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)

  16. A novel biocompatible europium ligand for sensitive time-gated immunodetection. (United States)

    Sayyadi, Nima; Connally, Russell E; Try, Andrew


    We describe the synthesis of a novel hydrophilic derivative of a tetradentate β-diketone europium ligand that was used to prepare an immunoconjugate probe against Giardia lamblia cysts. We used a Gated Autosynchronous Luminescence Detector (GALD) to obtain high quality delayed luminescence images of cells 30-fold faster than ever previously reported.

  17. Europium-doped barium halide scintillators for x-ray and ?-ray detections

    NARCIS (Netherlands)

    Selling, J.; Birowosuto, M.D.; Dorenbos, P.; Schweizer, S.


    Single crystals of undoped or europium-doped barium chloride, bromide, and iodide were investigated under x-ray and ?-ray excitations. The Eu2+-related x-ray excited luminescence found in the Eu-doped barium halides occurs at 402, 404, and 425?nm for the chloride, bromide, and iodide, respectively.

  18. A europium luminescence assay of lactate and citrate in biological fluids† (United States)

    Pal, Robert; Costello, Leslie C.


    Ratiometric methods of analysis have been developed for the selective determination of lactate or citrate in microlitre samples of human serum, urine or prostate fluids following comparison of anion binding affinities for a family of nine luminescent europium(III) complexes. PMID:19343236

  19. Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)

    Energy Technology Data Exchange (ETDEWEB)

    Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)


    With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.

  20. Europium doped In(Zn)P/ZnS colloidal quantum dots

    NARCIS (Netherlands)

    Thuy, Ung Thi Dieu; Maurice, Axel; Liem, Nguyen Quang; Reiss, Peter


    Chemically synthesised In(Zn)P alloy nanocrystals are doped with Eu(3+) ions using europium oleate as a molecular precursor and are subsequently covered with a ZnS shell. The presence of zinc in the synthesis of the InP core nanocrystals leads to the formation of an In(Zn)P alloy structure, making

  1. NO fluorescence sensing by europium tetracyclines complexes in the presence of H2O2. (United States)

    Simões, Eliana F C; Leitão, João M M; Esteves da Silva, Joaquim C G


    The effect on the fluorescence of the europium:tetracycline (Eu:Tc), europium:oxytetracycline (Eu:OxyTc) and europium:chlortetracycline (Eu:ClTc) complexes in approximately 2:1 ratio of nitric oxide (NO), peroxynitrite (ONOO(-)), hydrogen peroxide (H2O2) and superoxide (O2 (·-)) was assessed at three ROS/RNS concentrations levels, 30 °C and pH 6.00, 7.00 and 8.00. Except for the NO, an enhancement of fluorescence intensity was observed at pH 7.00 for all the europium tetracyclines complexes-the high enhancement was observed for H2O2. The quenching of the fluorescence of the Tc complexes, without and with the presence of other ROS/RNS species, provoked by NO constituted the bases for an analytical strategy for NO detection. The quantification capability was evaluated in a NO donor and in a standard solution. Good quantification results were obtained with the Eu:Tc (3:1) and Eu:OxyTc (4:1) complexes in the presence of H2O2 200 μM with a detection limit of about 3 μM (Eu:OxyTc).

  2. Long-term tagging of elvers, Anguilla anguilla, with radioactive europium

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Fattah, A. T. A.


    -life of added europium of 1.6 .+-. 0.5 years. Thirteen hundred 155Eu-labelled elvers (50 Bq per eel), each weighing on average 0.21 g, were set out near Oskarshamn on the east coast of Sweden in June 1982. Three of these were caught nearby in May 1985 and one was caught in August 1985. They weighed...


    NARCIS (Netherlands)

    Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.


    High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.

  4. Optical and Morphological Characterization of Sonochemically Assisted Europium Doped Copper (I) Oxide Nanostructures (United States)

    Cosico, J. A. M.; Ruales, P. K.; Marquez, M. C.


    In the age where application of nanotechnology in our society has proven to be eminent, different routes of synthesizing nanoparticles have emerged. In this study nanoparticles of cuprous oxide (Cu2O) doped with different amounts of europium was prepared by using solution precursor route approach with the aid of ultrasonic sound. Copper sulphate and europium (III) nitrate pentahydrate was used as source for copper ions and europium ions respectively. X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR) were used to elucidate the cubic crystal structure and organic impurities present on Cu2Onanoparticles. UV-Vis spectroscopy was used to determine the absorption spectrum of the nanoparticles in the wavelength range of 400nm to 700nm. The bandgap of the undoped and doped Cu2O were found to fall between 2.1eV - 2.3eV. Scanning Electron Microscopy (SEM) coupled with energy dispersive x-ray was used to observe the dendritic and rodlike morphology and the presence of europium in the synthesized Cu2O nanoparticles. The observed effect on the absorbance of Cu2O upon adding Eu and a facile way of synthesizing Cu2O nanoparticles could bring a positive impact on the production of functional devices for optoelectronic and energy applications.

  5. Studies of the N=90 region: The decay of 154Eu to 154Gd

    Energy Technology Data Exchange (ETDEWEB)

    Kulp, W.D.; Wood, J.L.; Krane, K.S.; Loats, J.; Schmelzenbach, P.; Stapels, C.J.; Larimer, R.-M.; Norman, E.B.


    The decay of {sup 154}Eu {yields} {sup 154}Gd has been studied by {gamma}-ray singles and {gamma}-{gamma} coincidence spectroscopy using an array of 20 Compton-suppressed Ge detectors. The primary goal of the work was to confirm or refute a large number of questionable features in the decay scheme: the outcome is the removal of 8 levels from the previously adopted scheme, with the result that a new type of collective band is revealed. Many weak decay branches for the decay are clarified. These results are critical for understanding the structure of {sup 154}Gd and the N = 90 isotones; and the improved completeness of the decay scheme contributes to the use of {sup 154}Eu as a metrological standard.

  6. Barrier distribution from 28Si+154Sm quasielastic scattering: Coupling effects in the fusion process

    Directory of Open Access Journals (Sweden)

    Kaur Gurpreet


    Full Text Available Barrier distribution for the 28Si+154Sm system has been extracted from large angle quasielastic scattering measurement to investigate the role of various channel couplings on fusion dynamics. The coupled channel calculations, including the collective excitation of the target and projectile, are observed to reproduce the experimental BD rather well. It seems that the role of neutron transfer, relative to collective excitation, is in fact weak in the 28Si+154Sm system even though it has positive Q-value for neutron transfer channels.

  7. 46 CFR 154.411 - Cargo tank thermal loads. (United States)


    ... Containment Systems § 154.411 Cargo tank thermal loads. For the calculations required under § 154.406(a)(4... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank thermal loads. 154.411 Section 154.411... thermal loads for the cooling down periods of cargo tanks for design temperatures lower than −55 °C (−67...

  8. Application of Europium Multiwalled Carbon Nanotubes as Novel Luminophores in an Electrochemiluminescent Aptasensor for Thrombin Using Multiple Amplification Strategies. (United States)

    Wu, Dan; Xin, Xia; Pang, Xuehui; Pietraszkiewicz, Marek; Hozyst, Robert; Sun, Xian'ge; Wei, Qin


    A novel electrochemiluminescent (ECL) aptasensor was proposed for the determination of thrombin (TB) using exonuclease-catalyzed target recycling and hybridization chain reaction (HCR) to amplify the signal. The capture probe was immobilized on an Au-GS-modified electrode through a Au-S bond. Subsequently, the hybrid between the capture probe and the complementary thrombin binding aptamer (TBA) was aimed at obtaining double-stranded DNA (dsDNA). The interaction between TB and its aptamer led to the dissociation of dsDNA because TB has a higher affinity to TBA than the complementary strands. In the presence of exonuclease, aptamer was selectively digested and TB could be released for target recycling. Extended dsDNA was formed through HCR of the capture probe and two hairpin DNA strands (NH2-DNA1 and NH2-DNA1). Then, numerous europium multiwalled carbon nanotubes (Eu-MWCNTs) could be introduced through amidation reaction between NH2-terminated DNA strands and carboxyl groups on the Eu-MWCNTs, resulting in an increased ECL signal. The multiple amplification strategies, including the amplification of analyte recycling and HCR, and high ECL efficiency of Eu-MWCNTs lead to a wide linear range (1.0×10(-12)-5.0×10(-9) mol/L) and a low detection limit (0.23 pmol/L). The method was applied to serum sample analysis with satisfactory results.

  9. Occurrence of photoluminescence and onion like structures decorating graphene oxide with europium using sodium dodecyl sulfate surfactant (United States)

    Cedeño, V. J.; Rangel, R.; Cervantes, J. L.; Lara, J.; Alvarado, J. J.; Galván, D. H.


    Graphene oxide decoration with europium was carried out using SDS (sodium dodecyl sulfate) as the surfactant. The reaction was performed in a microwave oven and subsequently underwent thermal treatment under hydrogen flow. The results found in the present work demonstrate that through the use of SDS surfactant aggregates of hemi-cylindrical and onion-like structures could be obtained; which propitiate an enhanced synergistic photoluminescence located at the red wavelength. On the other hand, after thermal treatment the aggregates disappear providing a good dispersion of europium, however a decrease in the photoluminescence signal is observed. The graphene oxide decorated with europium was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier infrared transform spectroscopy (FTIR), RAMAN spectroscopy, x-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) techniques, showing the characteristic features of graphene oxide and europium.

  10. Synthesis, characterization, and properties of reduced europium molybdates and tungstates

    Energy Technology Data Exchange (ETDEWEB)

    Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)


    Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.

  11. 46 CFR 154.1435 - Medical first aid guide. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Medical first aid guide. 154.1435 Section 154.1435 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... Equipment § 154.1435 Medical first aid guide. Each vessel must have a copy of the IMO Medical First Aid...

  12. 46 CFR 154.1150 - Distribution of dry chemical. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Distribution of dry chemical. 154.1150 Section 154.1150... Firefighting System: Dry Chemical § 154.1150 Distribution of dry chemical. (a) All locations on the above deck... chemical hand hose lines; or (2) At least one dry chemical hand hose line and one dry chemical monitor. (b...

  13. 46 CFR 154.560 - Cargo hose: Prototype test. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo hose: Prototype test. 154.560 Section 154.560... Hose § 154.560 Cargo hose: Prototype test. (a) Each cargo hose must be of a type that passes a prototype test at a pressure of at least five times its maximum working pressure at or below the minimum...

  14. 46 CFR 154.802 - Alternate pressure relief settings. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Alternate pressure relief settings. 154.802 Section 154... Equipment Cargo Vent Systems § 154.802 Alternate pressure relief settings. Cargo tanks with more than one relief valve setting must have one of the following arrangements: (a) Relief valves that: (1) Are set and...

  15. 46 CFR Appendix A to Part 154 - Equivalent Stress (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equivalent Stress A Appendix A to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. A Appendix A to Part 154...

  16. 46 CFR Appendix B to Part 154 - Stress Analyses Definitions (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Stress Analyses Definitions B Appendix B to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. B Appendix B to Part 154...

  17. 46 CFR 154.1870 - Bow and stern loading. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading. 154.1870 Section 154.1870... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1870 Bow and stern loading. (a) When the bow or stern loading piping is not in use, the master shall lock closed the shut-off...

  18. 21 CFR 133.154 - High-moisture jack cheese. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false High-moisture jack cheese. 133.154 Section 133.154... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.154 High-moisture jack cheese. High-moisture jack cheese conforms to...

  19. 46 CFR 154.412 - Cargo tank corrosion allowance. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank corrosion allowance. 154.412 Section 154.412... Containment Systems § 154.412 Cargo tank corrosion allowance. A cargo tank must be designed with a corrosion...) carries a cargo that corrodes the tank material. Note: Corrosion allowance for independent tank type C is...

  20. 46 CFR 154.180 - Contiguous hull structure: Welding procedure. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Welding procedure. 154.180 Section 154.180 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.180 Contiguous hull structure: Welding procedure. Welding procedure tests for...

  1. 46 CFR 154.546 - Excess flow valve: Closing flow. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Excess flow valve: Closing flow. 154.546 Section 154.546... and Process Piping Systems § 154.546 Excess flow valve: Closing flow. (a) The rated closing flow of vapor or liquid cargo for an excess flow valve must be specially approved by the Commandant (CG-522). (b...

  2. 46 CFR 154.9 - Issuance of documents. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Issuance of documents. 154.9 Section 154.9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES General § 154.9 Issuance of documents. The...

  3. 46 CFR 154.188 - Membrane tank: Inner hull steel. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Membrane tank: Inner hull steel. 154.188 Section 154.188... Structure § 154.188 Membrane tank: Inner hull steel. For a vessel with membrane tanks, the inner hull... “Rules for Building and Classing Steel Vessels”, 1981. ...

  4. 46 CFR 154.1340 - Temperature measuring devices. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Temperature measuring devices. 154.1340 Section 154.1340... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1340 Temperature measuring devices. (a) Each cargo tank must have devices that measure the...

  5. 46 CFR 154.172 - Contiguous steel hull structure. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous steel hull structure. 154.172 Section 154.172... Structure § 154.172 Contiguous steel hull structure. (a) Except as allowed in paragraphs (b) and (c) of this... construction of the contiguous steel hull structure must meet the thickness and steel grade in Table 1 for the...

  6. 33 CFR 154.820 - Fire, explosion, and detonation protection. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Fire, explosion, and detonation protection. 154.820 Section 154.820 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Systems § 154.820 Fire, explosion, and detonation protection. (a) A vapor control system with a single...

  7. 46 CFR 154.528 - Piping joints: Flange type. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange type. 154.528 Section 154.528 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... and Process Piping Systems § 154.528 Piping joints: Flange type. (a) A flange must be one of the...

  8. 46 CFR 154.526 - Piping joints: Flange connection. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange connection. 154.526 Section 154... Equipment Cargo and Process Piping Systems § 154.526 Piping joints: Flange connection. Flange connections for pipe joints must meet § 56.30-10 and § 56.50-105 (a)(4) and (b)(4) of this chapter. ...

  9. 46 CFR 154.195 - Aluminum cargo tank: Steel enclosure. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Aluminum cargo tank: Steel enclosure. 154.195 Section 154.195 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.195 Aluminum cargo tank: Steel enclosure. (a) An aluminum cargo tank and its...

  10. 46 CFR 154.514 - Piping: Electrical bonding. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping: Electrical bonding. 154.514 Section 154.514... and Process Piping Systems § 154.514 Piping: Electrical bonding. (a) Cargo tanks or piping that are... side. (c) An electrical bond must be made by at least one of the following methods: (1) A metal bonding...

  11. 46 CFR 154.1205 - Mechanical ventilation system: Standards. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: Standards. 154.1205... Equipment Cargo Area: Mechanical Ventilation System § 154.1205 Mechanical ventilation system: Standards. (a) Each exhaust type mechanical ventilation system required under § 154.1200 (a) must have ducts for...

  12. 46 CFR 154.1702 - Materials of construction. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Materials of construction. 154.1702 Section 154.1702... § 154.1702 Materials of construction. When Table 4 references one of the following paragraphs in this section, the materials in the referenced paragraph must not be in components that contact the cargo liquid...

  13. 46 CFR 154.1145 - Dry chemical supply. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Dry chemical supply. 154.1145 Section 154.1145 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Firefighting System: Dry Chemical § 154.1145 Dry chemical supply. (a) A vessel with a cargo carrying capacity...

  14. Novel insights into anti-CD40/CD154 immunotherapy in transplant tolerance. (United States)

    Pinelli, David F; Ford, Mandy L


    Since the discovery of the CD40-CD154 costimulatory pathway and its critical role in the adaptive immune response, there has been considerable interest in therapeutically targeting this interaction with monoclonal antibodies in transplantation. Unfortunately, initial promise in animal models gave way to disappointment in clinical trials following a number of thromboembolic complications. However, recent mechanistic studies have identified the mechanism of these adverse events, as well as detailed a myriad of interactions between CD40 and CD154 on a wide variety of immune cell types and the critical role of this pathway in generating both humoral and cell-mediated alloreactive responses. This has led to resurgence in interest and the potential resurrection of anti-CD154 and anti-CD40 antibodies as clinically viable therapeutic options.

  15. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate. (United States)

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun


    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  16. CD40/CD154 Blockade Inhibits Dendritic Cell Expression of Inflammatory Cytokines but not Costimulatory Molecules1 (United States)

    Ferrer, Ivana R.; Liu, Danya; Pinelli, David F.; Koehn, Brent H.; Stempora, Linda L.; Ford, Mandy L.


    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonsim on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor antigen (OVA). Adoptive transfer of OVA-specific CD4+ and CD8+ T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c+ DC compared to untreated controls. However, DCs isolated from anti-CD154 treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of antigen-specific CD4+ and CD8+ T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival. PMID:23002440

  17. The effect of two additional Eu3+ lumophors in two novel trinuclear europium complexes on their photoluminescent properties. (United States)

    Yang, Chaolong; Xu, Jing; Ma, Jianying; Zhu, Dongyu; Zhang, Yunfei; Liang, Liyan; Lu, Mangeng


    Two novel trinuclear europium complexes based on trisphen(1,3,5-tris{4-((1,10-phenanthroline-[5,6-d]imidazol-2yl)phenoxy)methyl}-2,4,6-trimethyl-benzene) as a second ligand were designed, synthesized, and characterized by FT-IR, (1)H NMR, UV-visible, photoluminescence (PL) spectroscopy, elemental analysis (EA) and ESI-MS. The geometries of these two trinuclear europium complexes were predicted using the Sparkle/PM3 model and suggested a chemical environment of very low symmetry around the lanthanide ions (C(1)), which is in agreement with the luminescent spectra. CV analysis demonstrated that the trinuclear complexes possessed excellent electro-injection abilities. The effects of two additional Eu(3+) lumophors in these trinuclear europium complexes on their photoluminescent properties were investigated in detail. The results indicated that these trinuclear europium complexes exhibited highly luminescent quantum efficiencies and experimental intensity parameters in the solid state. Especially, due to the contribution of the two additional Eu(3+) lumophors in the trinuclear europium complexes, the quantum efficiency of the trinuclear complex Eu(3)(TTA)(9)trisphen was higher (ca. 34%) than the mononuclear europium complex Eu(TTA)(3)imidazophen.

  18. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro


    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  19. Incorporation of europium III complex into nanoparticles and films obtained by the Sol-Gel methodology

    Directory of Open Access Journals (Sweden)

    Faley Jean de Sousa


    Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.

  20. A Simple and Sensitive Method to Quantify Biodegradable Nanoparticle Biodistribution using Europium Chelates. (United States)

    Crawford, Lindsey; Higgins, Jaclyn; Putnam, David


    The biodistribution of biodegradable nanoparticles can be difficult to quantify. We report a method using time resolved fluorescence (TRF) from a lanthanide chelate to minimize background autofluorescence and maximize the signal to noise ratio to detect biodegradable nanoparticle distribution in mice. Specifically, antenna chelates containing europium were entrapped within nanoparticles composed of polylactic acid-polyethylene glycol diblock copolymers. Tissue accumulation of nanoparticles following intravenous injection was quantified in mice. The TRF of the nanoparticles was found to diminish as a second order function in the presence of serum and tissue compositions interfered with the europium signal. Both phenomena were corrected by linearization of the signal function and calculation of tissue-specific interference, respectively. Overall, the method is simple and robust with a detection limit five times greater than standard fluorescent probes.

  1. A Comprehensive Strategy to Boost the Quantum Yield of Luminescence of Europium Complexes (United States)

    Lima, Nathalia B. D.; Gonçalves, Simone M. C.; Júnior, Severino A.; Simas, Alfredo M.


    Lanthanide luminescence has many important applications in anion sensing, protein recognition, nanosized phosphorescent devices, optoelectronic devices, immunoassays, etc. Luminescent europium complexes, in particular, act as light conversion molecular devices by absorbing ultraviolet (UV) light and by emitting light in the red visible spectral region. The quantum yield of luminescence is defined as the ratio of the number of photons emitted over the number of UV photons absorbed. The higher the quantum yield of luminescence, the higher the sensitivity of the application. Here we advance a conjecture that allows the design of europium complexes with higher values of quantum yields by simply increasing the diversity of good ligands coordinated to the lanthanide ion. Indeed, for the studied cases, the percent boost obtained on the quantum yield proved to be strong: of up to 81%, accompanied by faster radiative rate constants, since the emission becomes less forbidden. PMID:23928866

  2. Assembly of europium organic framework–gold nanoparticle composite thin films on silicon substrate

    Energy Technology Data Exchange (ETDEWEB)

    Deep, Akash, E-mail: [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kaur, Rajnish [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kumar, Parveen [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Kumar, Pawan; Paul, A.K. [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India)


    Metal organic frameworks are a sub-class of coordination polymers and rapidly generating huge research interests in several technological areas. One of the emerging areas of their potential applications is the photovoltaics. The present study proposes the assembly of europium organic framework–gold nanoparticle nanocomposite thin film on silicon substrate. Microscopic, X-ray diffraction, surface area measurement and thermal studies have indicated the formation of the desired thin film. Spectral studies have been used to highlight their solid state optical property. Current–voltage studies have established semiconducting property of the above thin films. - Highlights: • Thin film of europium organic framework/gold nanoparticles is prepared on silicon. • Fairly homogeneous films with a roughness factor of 5–10 nm are obtained. • Above thin films offer solid-state photoluminescence and semiconducting properties.

  3. Synthesis and optical features of an europium organic-inorganic silicate hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Franville, A.C.; Zambon, D.; Mahiou, R.; Chou, S.; Cousseins, J.C. [Universite Blaise Pascal, Aubiere (France). Lab. des Materiaux Inorganiques; Troin, Y. [Laboratoire de Chimie des Heterocycles et des Glucides, EA 987, Universite Blaise-Pascal and ENSCCF, F-63177 Aubiere Cedex (France)


    A europium organic-inorganic silicate hybrid was synthesized by grafting a coordinative group (dipicolinic acid) to a silicate network precursor (3-aminopropyltriethoxysilane) via a covalent bonding. Sol-gel process and complexation were performed using different experimental conditions. The hybrid materials, in particular the Eu{sup 3+} coordination mode, were characterized by infrared and luminescence spectroscopies. Morphology of the materials and TG analysis showed that grafted silica enhanced thermal and mechanical resistances of the organic part. (orig.) 7 refs.

  4. Green Luminescence of Divalent Europium in the Hydride Chloride EuHCl

    NARCIS (Netherlands)

    Kunkel, Nathalie; Rudolph, Daniel; Meijerink, A; Rommel, Stefan; Weihrich, Richard; Kohlmann, Holger; Schleid, Thomas

    Luminescence properties of divalent europium in the mixed-anion hydride chloride EuHCl were studied for the first time. Olive-green single crystals of EuHCl (PbFCl-type structure: tetragonal, P4/nmm, a = 406.58(3) pm, c = 693.12(5) pm, c/a = 1.705, Z = 2) resulted from the reaction of elemental

  5. Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Stollenwerk, Tobias


    In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.

  6. Redox electrochemistry of europium fluoride complexes in an equimolar NaCl-KCl melt

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, S.A., E-mail: [Institute of Chemistry, Kola Science Centre RAS, 26 Akademgorodok., 184209 Apatity, Murmansk region (Russian Federation); Gaune-Escard, M. [Ecole Polytechnique, Mecanique Energetique, Technopole de Chateau Gombert, 5 rue Enrico Fermi, 13453 Marseille Cedex 13 (France)


    The electrochemical behavior of europium fluoride complexes was studied by different electrochemical methods at a glassy carbon electrode in the temperature range 973-1100 K in the NaCl-KCl melt. The diffusion coefficients of Eu(III) and Eu(II) were determined by linear sweep voltammetry. The standard rate constants of charge transfer for the Eu(III)/Eu(II) redox couple were found on the base cyclic voltammetry, impedance spectroscopy and chronoamperometry data. The formal standard redox potentials E{sub Eu(III)/Eu(II)}{sup *} were obtained by linear sweep and cyclic voltammetry. The electrochemical behavior of europium fluoride and europium chloride complexes in NaCl-KCl melt was compared and discussed in connection with the strength and stability of these complexes. It was shown that the formation of stronger fluoride complexes reduced values of diffusion coefficients, standard rate constants for charge transfer of the Eu(III)/Eu(II) redox couple and shifted the formal standard redox potentials to the more electronegative values.

  7. Lateral flow immunoassay using europium chelate-loaded silica nanoparticles as labels. (United States)

    Xia, Xiaohu; Xu, Ye; Zhao, Xilin; Li, Qingge


    Despite their ease of use, lateral flow immunoassays (LFIAs) often suffer from poor quantitative discrimination and low analytical sensitivity. We explored the use of a novel class of europium chelate-loaded silica nanoparticles as labels to overcome these limitations. Antibodies were covalently conjugated onto europium chelate-loaded silica nanoparticles with dextran as a linker. The resulting conjugates were used as labels in LFIA for detection of hepatitis B surface antigen (HBsAg). We performed quantification with a digital camera and Adobe Photoshop software. We also used 286 clinical samples to compare the proposed method with a quantitative ELISA. A detection limit of 0.03 microg/L was achieved, which was 100 times lower than the colloidal gold-based LFIAs and lower than ELISA. A precise quantitative dose-response curve was obtained, and the linear measurement range was 0.05-3.13 microg/L, within which the CVs were 2.3%-10.4%. Regression analysis of LFIA on ELISA results gave: log (LFIA) = -0.14 log (ELISA) + 1.03 microg/L with r = 0.99 for the quantification of HBsAg in 35 positive serum samples. Complete agreement was observed for the qualitative comparison of 286 clinical samples assayed with LFIA and ELISA. Europium chelate-loaded silica nanoparticle labels have great potential to improve LFIAs, making them useful not only for simple screening applications but also for more sensitive and quantitative immunoassays.

  8. Luminescent solutions and films of new europium complexes with chelating ligands (United States)

    Kharcheva, Anastasia V.; Ivanov, Alexey V.; Borisova, Nataliya E.; Kaminskaya, Tatiana P.; Patsaeva, Svetlana V.; Popov, Vladimir V.; Yuzhakov, Viktor I.


    The development of new complexes of rare earth elements (REE) with chelating organic ligands opens up the possibility of purposeful alteration in the composition and structure of the complexes, and therefore tuning their optical properties. New ligands possessing two pyridine rings in their structure were synthesized to improve coordination properties and photophysical characteristics of REE compounds. Complexes of trivalent europium with novel chelating ligands were investigated using luminescence and absorption spectroscopy, as well as atomic force microscopy. Luminescence properties of new compounds were studied both for solutions and films deposited on the solid support. All complexes exhibit the characteristic red luminescence of Eu (III) ion with the absolute lumenescence quantum yield in polar acetonitrile solution varying from 0.21 to 1.45 % and emission lifetime ranged from 0.1 to 1 ms. Excitation spectra of Eu coordination complexes correspond with absorption bands of chelating ligand. The energy levels of the triplet state of the new ligands were determined from the phosphorescence at 77 K of the corresponding Gd (III) complexes. The morphology of films of europium complexes with different substituents in the organic ligands was investigated by atomic force microscopy (AFM). It strongly depends both on the type of substituent in the organic ligand, and the rotation speed of the spin-coater. New europium complexes with chelating ligands containing additional pyridine fragments represent outstanding candidates for phosphors with improved luminescence properties.

  9. Hydrothermal treatment for preparation of europium-lanthanum phosphates and exploration of their fluorescence properties

    Directory of Open Access Journals (Sweden)

    Hiroaki Onoda


    Full Text Available Europium-substituted lanthanum phosphates (Eu; 5 mol% were prepared from lanthanum nitrate, europium nitrate, and sodium polyphosphate solutions by a hydrothermal process at 120 and 160 °C up to 8 h. The obtained phosphates were studied using XRD, IR spectroscopy, TG–DTA, and SEM. UV–vis absorbance and reflectance, as well as fluorescence, were estimated as functional properties of these phosphate materials. We found that samples prepared without hydrothermal treatment were amorphous (as indicated by their XRD patterns, whereas those prepared by a hydrothermal treatment contained peaks corresponding to lanthanum orthophosphate, indicating that the hydrothermal process caused the polyphosphate(s to decompose into orthophosphate(s. The TG–DTA curves of the samples prepared by a hydrothermal treatment were different from those of the samples prepared without hydrothermal treatment. All samples reported herein had no specified shape despite using prolonged hydrothermal treatment times. Although the samples prepared without hydrothermal treatment showed only weak fluorescence peaks, those prepared by a hydrothermal treatment showed strong peaks at 556, 590, 615, and 690 nm. These peaks corresponded to transitions from 5D0 to 7F0, 7F1, 7F2, and 7F4, respectively. Collectively, these results indicate that the hydrothermal treatment is a useful method of obtaining europium-substituted lanthanum phosphates with fluorescence properties.

  10. Fabrication of coated graphite electrode for the selective determination of europium (III) ions. (United States)

    Upadhyay, Anjali; Singh, Ashok Kumar; Bandi, Koteswara Rao; Jain, A K


    Preliminary complexation study showed that two ligands (ionophores) (2-((2-phenyl-2-(pyridin-2-yl)hydazono)methyl)pyridine) [L1], (2-((2-phenyl-2-(pyridin-2-yl)hydazono) methyl)phenol) [L2] can act as europium selective electrode. Europium selective coated graphite electrodes (CGE) were prepared by using ligands [L1] and [L2] and their potentiometric characteristics were determined. Membranes having different compositions of poly(vinylchloride) (PVC), the different plasticizers, anionic additives and ionophores were coated onto the graphite surface. The potential response measurements showed that the best performance was exhibited by the proposed CGE. This electrode had the widest working concentration range, Nernstian slope and fast response times of 10s. The selectivity studies showed that this electrode have higher selectivity towards Eu(3+) over a large number of cations. Furthermore, the electrode generated constant potentials in the pH range 2.7-9.0. This electrode can be used to quantify europium in soil, binary mixtures and also used as an indicator electrode in the potentiometric titration of Eu(3+) with EDTA. The proposed electrode was also successfully applied to the determination of fluoride ions in real samples. © 2013 Elsevier B.V. All rights reserved.

  11. Fluorescent Sulfur-Tagged Europium(III) Coordination Polymers for Monitoring Reactive Oxygen Species. (United States)

    Wang, Huai-Song; Bao, Wen-Jing; Ren, Shi-Bin; Chen, Ming; Wang, Kang; Xia, Xing-Hua


    Oxidative stress caused by reactive oxygen species (ROS) is harmful to biological systems and implicated in various diseases. A variety of selective fluorescent probes have been developed for detecting ROS to uncover their biological functions. Generally, the preparation of the fluorescent probes usually undergoes multiple synthetic steps, and the successful fluorescent sensing usually relies on trial-and-error tests. Herein we present a simple way to prepare fluorescent ROS probes that can be used both in biological and environmental systems. The fluorescent europium(III) coordination polymers (CPs) are prepared by simply mixing the precursors [2,2'-thiodiacetic acid and Eu(NO3)3·6H2O] in ethanol. Interestingly, with the increase of reaction temperature, the product undergoes a morphological transformation from microcrystal to nanoparticle while the structure and fluorescent properties retain. The fluorescence of the sulfur-tagged europium(III) CPs can be selectively quenched by ROS, and thus, sensitive and selective monitoring of ROS in aerosols by the microcrystals and in live cells by the nanoparticles has been achieved. The results reveal that the sulfur-tagged europium(III) CPs provide a novel sensor for imaging ROS in biological and environmental systems.

  12. Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite (United States)

    Niño-Martínez, Nereyda; Patiño-Marín, Nuria


    The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1) in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours. PMID:27965525

  13. Purification process for .sup.153Gd produced in natural europium targets (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Risher, Darrell R


    An alteration of the traditional zinc/zinc-amalgam reduction procedure which eliminates both the hazardous mercury and dangerous hydrogen gas generation. In order to avoid the presence of water and hydrated protons in the working solution, which can oxidize Eu.sup.2+ and cause hydrogen gas production, a process utilizing methanol as the process solvent is described. While methanol presents some flammability hazard in a radiological hot cell, it can be better managed and is less of a flammability hazard than hydrogen gas generation.

  14. 46 CFR 154.1854 - Methane (LNG) as fuel. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG) as fuel. 154.1854 Section 154.1854... fuel. (a) If methane (LNG) vapors are used as fuel in the main propulsion system of a vessel, the master shall ensure that the fuel oil fired pilot under § 154.705(c) is used when the vessel is on the...

  15. CD154 Is Released from T-cells by a Disintegrin and Metalloproteinase Domain-containing Protein 10 (ADAM10) and ADAM17 in a CD40 Protein-dependent Manner* (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid


    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders. PMID:24189063

  16. CD154 is released from T-cells by a disintegrin and metalloproteinase domain-containing protein 10 (ADAM10) and ADAM17 in a CD40 protein-dependent manner. (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid


    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders.

  17. Real-time in situ monitoring via europium emission of the photo-release of antitumor cisplatin from a Eu-Pt complex. (United States)

    Li, Hongguang; Lan, Rongfeng; Chan, Chi-Fai; Jiang, Lijun; Dai, Lixiong; Kwong, Daniel W J; Lam, Michael Hon-Wah; Wong, Ka-Leung


    A water-soluble light-responsive antitumor agent, PtEuL, based on a cisplatin-linked europium-cyclen complex has been synthesized and evaluated for controlled cisplatin release by linear/two-photon excitation in vitro with concomitant turn-on and long-lived europium emission as a responsive traceable signal.

  18. Europium doping induced symmetry deviation and its impact on the second harmonic generation of doped ZnO nanowires (United States)

    Dhara, Soumen; Imakita, Kenji; Mizuhata, Minoru; Fujii, Minoru


    In this work, we investigated the effects of europium doping on the second harmonic generation (SHG) of ZnO nanowires (NWs). A non-monotonic enhancement in the SHG is observed with the increase of the europium concentration. Maximum SHG is observed from the 1 at.% europium doped ZnO NWs with an enhancement factor of 4.5. To understand the underlying mechanism, the effective second order non-linear coefficient (deff) is calculated from the theoretical fitting with consideration of the absorption effect. Microstructural characterization reveals the structural deformation of the ZnO NWs caused by europium doping. We estimated the deviation in the crystal site symmetry around the Eu3+ ions (defined as the asymmetric factor) from photoluminescence measurement and it is found to be strongly correlated with the calculated deff value. A strong linear dependence between the magnitudes of deff and the asymmetric factor suggests that deviation in the local site symmetry of the ZnO crystal by europium doping could be the most probable origin of the observed large second order non-linearity.

  19. Platelet-derived or soluble CD154 induces vascularized allograft rejection independent of cell-bound CD154


    Xu, He; Zhang, Xiaojie; Mannon, Roslyn B.; Kirk, Allan D.


    CD154 is a cell surface molecule expressed on activated T cells that binds to CD40, an activating molecule on APCs. Its blockade has been shown to prevent allograft rejection, presumably by interrupting interactions between T cells and APCs. It is known that activated human platelets express and shed CD154 and can induce APC activation and other immune processes in vitro. Here we show that platelet-derived CD154 is sufficient to initiate cardiac allograft rejection independent of any cellular...

  20. Charge growth, dispersion in europium manganite (EuMnO{sub 3-{delta}}) ceramics revealed using opto-impedance probe

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, S. [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India); Jagannathan, R., E-mail: [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India)


    Highlights: > In this study, using opto-, magneto-opto impedance techniques, experimental proof for charge growth in europium manganite (EuMnO{sub 3}) near the region of its Neel temperature is presented. > This study gives data related to dielectric properties of europium manganite. > This study may open-up new avenues for investigating the dielectric characteristics of many electronic-ceramics. - Abstract: In this preliminary report, we present the impedance characteristics of poly-crystalline europium manganite, a promising colossal magneto resistance (CMR) system investigated under optical ({approx}5 eV) and magnetic (0.1 T) perturbations yielding some clues on the charge build-up and dispersion processes. This may possibly be resulting from switching between ferromagnetic and anti-ferromagnetic phases through a charge transfer transition mediated process centering Mn{sup 3+/4+} 3d spins thereby meriting a more detailed study correlating with magnetic measurements.

  1. The role of CD154 in haematopoietic development

    NARCIS (Netherlands)

    Seijkens, Tom; Engel, David; Tjwa, Marc; Lutgens, Esther


    CD154 (CD40 ligand, CD40L, gp139) is a co-stimulatory molecule of the tumour necrosis factor (TNF) family. CD154 was originally discovered on T-cells, and was found to be involved in many immune responses including B-cell activation, isotype switching, and germinal centre formation. The expression

  2. 42 CFR 483.154 - Nurse aide competency evaluation. (United States)


    ... 42 Public Health 5 2010-10-01 2010-10-01 false Nurse aide competency evaluation. 483.154 Section... Requirements That Must Be Met by States and State Agencies: Nurse Aide Training and Competency Evaluation, and Paid Feeding Assistants § 483.154 Nurse aide competency evaluation. (a) Notification to Individual. The...

  3. 76 FR 2726 - Withdrawal of Regulatory Guide 1.154 (United States)


    ... Regulatory Guide 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... Regulatory Guide (RG) 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... format and content acceptable to the NRC staff for plant-specific pressurized thermal shock (PTS) safety...

  4. 21 CFR 520.154 - Bacitracin oral dosage forms. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin oral dosage forms. 520.154 Section 520...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.154 Bacitracin oral dosage forms. ...

  5. 46 CFR 154.1808 - Limitations in the endorsement. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Limitations in the endorsement. 154.1808 Section 154... Limitations in the endorsement. No person may operate a vessel unless that person complies with all limitations in the endorsement on the vessel's Certificate of Inspection or Certificate of Compliance. ...

  6. 32 CFR Appendix G to Part 154 - [Reserved (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false G Appendix G to Part 154 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Appendix G to Part 154 ...

  7. 46 CFR 154.1735 - Methyl acetylene-propadiene mixture. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methyl acetylene-propadiene mixture. 154.1735 Section... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Special Design and Operating Requirements § 154.1735 Methyl acetylene-propadiene mixture. (a) The composition of the methyl...

  8. 43 CFR 15.4 - Refuse and polluting substances. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Refuse and polluting substances. 15.4... § 15.4 Refuse and polluting substances. No person shall dump or deposit in or on the waters of this..., boxes, cans, dirt, rubbish, waste garbage, refuse or other debris or polluting substance. ...

  9. 49 CFR 572.154 - Thorax assembly and test procedure. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.154... 12-Month-Old Infant, Alpha Version § 572.154 Thorax assembly and test procedure. (a) Thorax Assembly (refer to § 572.150(a)(1)(iv)) . The thorax consists of the part of the torso assembly shown in drawing...

  10. 33 CFR 154.810 - Vapor line connections. (United States)


    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Vapor Control Systems § 154.810 Vapor... the OCIMF International Safety Guide for Oil Tankers and Terminals (incorporated by reference; see § 154.106). (h) A vapor collection system fitted with an enriching system that operates at a positive...

  11. 46 CFR 154.174 - Transverse contiguous hull structure. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Transverse contiguous hull structure. 154.174 Section... Equipment Hull Structure § 154.174 Transverse contiguous hull structure. (a) The transverse contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the standards of...

  12. 46 CFR 154.176 - Longitudinal contiguous hull structure. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Longitudinal contiguous hull structure. 154.176 Section... Equipment Hull Structure § 154.176 Longitudinal contiguous hull structure. (a) The longitudinal contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the...

  13. 46 CFR 154.1200 - Mechanical ventilation system: General. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: General. 154.1200 Section... Equipment Cargo Area: Mechanical Ventilation System § 154.1200 Mechanical ventilation system: General. (a... cargo handling equipment must have a fixed, exhaust-type mechanical ventilation system. (b) The...

  14. 33 CFR 154.530 - Small discharge containment. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Small discharge containment. 154.530 Section 154.530 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serves one or more hoses of 6-inch inside diameter or smaller, or loading arms of 6-inch nominal pipe...

  15. 21 CFR 520.154a - Soluble bacitracin methylene disalicylate. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Soluble bacitracin methylene disalicylate. 520.154a Section 520.154a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Soluble bacitracin methylene disalicylate. (a) Specifications. Each pound of soluble powder contains the...

  16. 18 CFR 154.312 - Composition of Statements. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Composition of Statements. 154.312 Section 154.312 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... this chapter) with subtotals by functional classifications, e.g., Intangible Plant, Manufactured Gas...

  17. 24 CFR 982.154 - ACC reserve account. (United States)


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  18. 29 CFR 1926.154 - Temporary heating devices. (United States)


    ... 29 Labor 8 2010-07-01 2010-07-01 false Temporary heating devices. 1926.154 Section 1926.154 Labor... Temporary heating devices. (a) Ventilation. (1) Fresh air shall be supplied in sufficient quantities to... heating devices shall be installed to provide clearance to combustible material not less than the amount...

  19. Polystyrene latex particles containing europium complexes prepared by miniemulsion polymerization using bovine serum albumin as a surfactant for biochemical diagnosis. (United States)

    Aikawa, Tatsuo; Mizuno, Akihiro; Kohri, Michinari; Taniguchi, Tatsuo; Kishikawa, Keiki; Nakahira, Takayuki


    Luminescent particles have been attracting significant attention because they can be used in biochemical applications, such as detecting and imaging biomolecules. In this study, luminescent polystyrene latex particles were prepared through miniemulsion polymerization of styrene with dissolved europium complexes in the presence of bovine serum albumin (BSA) and poly(ethylene glycol) monomethoxy methacrylate as surfactants. The solubility of the europium complex in styrene has a strong effect on the yield of the particle. Europium tris(2-thenoyl trifluoroacetonate) di(tri-n-octyl phosphine oxide), which has a high solubility in styrene, was sufficiently incorporated into the polystyrene particles compared to europium tris(2-thenoyl trifluoroacetonate), which has a low solubility in styrene. The luminescence property of the europium complex could remain intact even after its incorporation through the miniemulsion polymerization. In the aqueous dispersion, the resulting particles could emit strong luminescence, which is a characteristic of the europium complex. The antibody fragments were covalently attached to BSA-covered particles after a reaction with a bifunctional linker, N-(6-maleimidocaproyloxy)succinimide. The time-resolved fluoroimmunoassay technique showed that 3.3pg/mL of human α-fetoproteins (AFP) can be detected by using the resulting luminescent particles. An immunochromatographic assay using the resulting particles was also performed as a convenient method to qualitatively detect biomolecules. The detection limit of AFP measured by the immunochromatographic assay was determined to be 2000pg/mL. These results revealed that the luminescent particles obtained in this study can be utilized for the highly sensitive detection of biomolecules and in vitro biochemical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)


    The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.

  1. Electron-induced desorption of europium atoms from oxidized tungsten surface: concentration dependence of low-energy peak

    CERN Document Server

    Davydov, S Y


    One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms

  2. CD154 Induces Matrix Metalloproteinase-9 Secretion in Human Podocytes. (United States)

    Rigothier, Claire; Daculsi, Richard; Lepreux, Sébastien; Auguste, Patrick; Villeneuve, Julien; Dewitte, Antoine; Doudnikoff, Evelyne; Saleem, Moin; Bourget, Chantal; Combe, Christian; Ripoche, Jean


    Matrix remodeling is a key feature of glomerulosclerosis secondary to diabetes or hypertension. Podocytes contribute to glomerular basement membrane (GBM) turnover by producing matrix components and matrix remodelling enzymes, including matrix metalloproteinases (MMPs). The CD40/CD154 signaling pathway modulates matrix remodeling through the synthesis of MMPs and tissue inhibitors of MMPs. Platelets are a primary blood reservoir of CD154. Here we studied, the impact of the CD154/CD40 pathway on MMP-9 expression by cultured human podocytes. The role of CD40/CD154 was evaluated upon exposure of podocytes to recombinant human CD154 (rhCD154) or activated platelet supernatants from healthy human subjects. We first showed by protein and mRNA expression that CD40 was synthesized by podocytes and detectable on kidney tissue sections. CD40 expression was acquired during podocyte differentiation and enhanced upon exposure to rhCD154. In podocytes, rhCD154 induced an increase of MMP-9 production as shown by RT-PCR, Western blot and and gelatin zymography. Activated platelet supernatants induced MMP-9 mRNA synthesis in podocytes, an effect reduced by anti-CD40 antibody. Our results underscore a potential role for platelets through the CD40/CD154 signaling pathway in the control of GBM synthesis and degradation, via its regulatory role on MMP-9 production. CD154 secretion by activated platelets may contribute to GBM alterations in proteinuric nephropathies. J. Cell. Biochem. 117: 2737-2747, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Optical properties of europium(III) {beta}-diketonate/polymer-doped systems using supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimova, V.I., E-mail: [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Antoshkov, A.A.; Zavorotny, Yu.S.; Rybaltovskii, A.O. [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Lemenovskii, D.A., E-mail: [Chemistry Department, Moscow State University, Leninskie Gory 1-3, GSP-1, 119991 Moscow (Russian Federation)


    The optical properties of fluoropolymers and polypropylene doped with europium(III) {beta}-diketonates Eu(L){sub 3}{center_dot}2H{sub 2}O and Eu(L){sub 3}phen (L: fod=6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato, bta=4,4,4-trifluoro-1-phenyl-1,3-butanedione, tta=4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione, and phen=1,10-phenanthroline) using supercritical carbon dioxide were investigated by absorption and emission spectra. A comparative analysis of the PL decay times of Eu{sup 3+} ions in the initial europium (III) {beta}-diketonates and impregnated fluoropolymers was carried out. The supercritical fluid (SCF) impregnation of polymer samples with europium(III) {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed differently depending on the type of ligand in the entire investigated impregnation temperature range (T{sub SCF}=50-90 Degree-Sign S). It is shown that from the variety of Eu(L){sub 3}phen only Eu(fod){sub 3}phen can be introduced into the polymer matrix by this method. - Highlights: Black-Right-Pointing-Pointer The optical properties of polymers doped with Eu{sup 3+} {beta}-diketonates using SC CO{sub 2} were investigated. Black-Right-Pointing-Pointer A comparative analysis of the PL decay times in the initial Eu{sup 3+} {beta}-diketonates and doped polymers was carried out. Black-Right-Pointing-Pointer The SC CO{sub 2} impregnation of polymers with Eu{sup 3+} {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed.

  4. Reverse lyotropic liquid crystals from europium nitrate and P123 with enhanced luminescence efficiency. (United States)

    Yi, Sijing; Li, Qintang; Liu, Hongguo; Chen, Xiao


    Fabrication of lyotropic aggregates containing the lanthanide ions is becoming a preferable way to prepare novel functional materials. Here, the lyotropic liquid crystals (LLCs) of reverse hexagonal, reverse bicontinuous cubic, and lamellar phases have been constructed in sequence directly from the mixtures of Eu(NO3)3·6H2O and Pluronic P123 amphiphilc block copolymer with increasing the salt proportion. Their phase types and structural characteristics were analyzed using polarized optical microscopy (POM) and small-angle X-ray scattering (SAXS) measurements. The driving forces of reverse LLC phase formation were investigated using Fourier-transformed infrared spectroscopy (FTIR) and rheological measurements. The hydrated europium salt was found to act not only as a solvent here, but also as the bridge to form hydrogen bonding between coordinated water molecules and PEO blocks, which played a key role in the reverse LLCs formation. Compared to those in aqueous solutions and solid state, the enhanced luminescence quantum yields and prolonged excited state lifetimes were observed in two europium containing reverse mesophases. The luminescence quenching effect of lanthanide ions was efficiently suppressed, probably due to the substitution of coordinated water molecules by oxyethyl groups of P123 and ordered phase structures of LLCs, where the coordinated europium ions were confined and isolated by PEO blocks. The optimum luminescence performance was then found to exist in the reverse hexagonal phase. The obtained results on such lanthanide-induced reverse LLCs should be referable for designing new luminescent soft materials construction to expand their application fields.

  5. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova


    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  6. Synergistic extraction of europium and americium into nitrobenzene by using hydrogen dicarbollylcobaltate and dodecaethylene glycol. (United States)

    Makrlík, Emanuel; Vaňura, Petr; Selucký, Pavel


    Extraction of microamounts of europium and americium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of dodecaethylene glycol (DDEG, L) has been investigated. The equilibrium data have been explained assuming that the species HL+, H2L2+, ML3+ and MH-1L2+ (M3+ = Eu3+, Am3+; L = DDEG) are extracted into the organic phase. The values of extraction and stability constants of the complex species in nitrobenzene saturated with water have been determined. It was found that in this nitrobenzene medium, the stability constant of the EuL3+ complex is comparable with that of AmL3+.

  7. Red/blue electroluminescence from europium-doped organic light emitting diodes (United States)

    Hagen, Joshua A.; Li, Wayne X.; Grote, James G.; Steckl, Andrew J.


    Red/Blue emitting organic light emitting diodes (OLED) devices have been obtained using a Europium-doped organic emitting layer (NPB:Eu). The Eu-doped OLEDs emit in 2 color ranges: a broad blue (~420-500nm) band due to NPB emission and a narrow red peak at 620nm due to Eu emission. The red/blue devices achieve a brightness ~13x more intense than a similarly structured green (Alq 3) emitting OLED. These NPB:Eu emitting structures also reach a maximum efficiency of 0.2 cd/A at brightnesses above 100 cd/m2.

  8. Test of zircon materials for sorption of europium; Pruebas de materiales circoniferos para sorcion de europio

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)

  9. Sol-Gel Synthesis, X-Ray Diffraction Studies, and Electric Conductivity of Sodium Europium Silicate

    Directory of Open Access Journals (Sweden)

    Ekaterina V. Borisova


    Full Text Available Sodium europium silicate, NaEu9(SiO46O2, with apatite structure has been obtained and studied using X-ray diffraction and SEM. It has been shown that sodium sublimation does not take place upon synthesis by the sol-gel method. Rietveld refinement has revealed that sodium atoms are ordered and occupy the 4f position. O(4 atoms not related to silicate ions are placed at the centers of Eu(2 triangles. DC and AC electric conductivity and activation energy have been determined for the compound studied.

  10. New Class of Bright and Highly Stable Chiral Cyclen Europium Complexes for Circularly Polarized Luminescence Applications. (United States)

    Dai, Lixiong; Lo, Wai-Sum; Coates, Ian D; Pal, Robert; Law, Ga-Lai


    High glum values of +0.30 (ΔJ = 1, 591 nm, in DMSO) and -0.23 (ΔJ = 1, 589 nm, in H2O) were recorded in our series of newly designed macrocyclic europium(III) complexes. A sterically locking approach involving a bidentate chromophore is adopted to control the formation of one stereoisomer, giving rise to extreme rigidity, high stability, and high emission intensity. The combination of a chiral substituent on a macrocyclic chelate for lanthanide ions opens up new perspectives for the further development of circulary polarized luminescent chiral tags in optical and bioapplications.

  11. A microemulsion preparation of nanoparticles of europium in silica with luminescence enhancement using silver (United States)

    Ma, Zhi Ya; Dosev, Dosi; Kennedy, Ian M


    A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core–silica shell (Ag@SiO2) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag@SiO2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability. PMID:19417456

  12. Metal Controlled Diastereoselective Self-assembly and Circularly Polarized Luminescence of a Chiral Heptanuclear Europium Wheel (United States)

    Bozoklu, Gülay; Gateau, Christelle; Imbert, Daniel; Pécaut, Jacques; Robeyns, Koen; Filinchuk, Yaroslav; Memon, Farah; Muller, Gilles


    The chiral dissymmetric tetradentate ligand SPhbipox (6’-(4-phenyloxazolin-2-yl)-2,2’-bipyridine-6-carboxylic acid) leads to the diastereoselective assembly of a homochiral Eu(III) triangle and of a highly emissive (QY=27%) heptanuclear wheel which is the largest example of chiral luminescent complex of Eu(III) reported to date. We show that the nuclearity of the assembly is controlled by the solvent and the europium cation. All the compounds show large circularly polarized luminescence with an activity which varies with the nature of the assembly (highest for the homochiral trimer). PMID:22548280

  13. A europium(III)-based PARACEST agent for sensing singlet oxygen by MRI (United States)

    Song, Bo; Wu, Yunkou; Yu, Mengxiao; Zhao, Piyu; Zhou, Cheng; Kiefer, Garry E.


    A europium (III) DOTA-tetraamide complex was designed as a MRI sensor of singlet oxygen (1O2). The water soluble, thermodynamically stable complex reacts rapidly with 1O2 to form an endoperoxide derivative that results in an ∼3 ppm shift in the position of the Eu(III)-bound water chemical exchange saturation transfer (CEST) peak. The potential of using this probe to detect accumulation of the endoperoxide derivative in biological media by ratiometric CEST imaging was demonstrated. PMID:23575743

  14. Progress on the europium neutron capture study using DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Agvaanluvsan, U. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States)]. E-mail:; Becker, J.A. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Macri, R.A. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Parker, W. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Wilk, P. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Wu, C.Y. [Lawrence Livermore National Laboratory, 7000 East Avenue, P.O. Box 808, L-414, Livermore, CA 94551 (United States); Bredeweg, T.A.; Esch, E.; Haight, R.C.; O' Donnell, J.M.; Reifarth, R.; Rundberg, R.S.; Schwantes, J.M.; Ullmann, J.L.; Vieira, D.J.; Wilhelmy, J.B.; Wouters, J.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Mitchell, G.E.; Sheets, S. [North Carolina State University, Raleigh, NC 27695 (United States)]|[Triangle Universities Nuclear Laboratory, Durham, NC 27708 (United States); Becvar, F.; Krticka, M. [Charles University in Prague, CZ 180 00 Prague 8 (Czech Republic)


    The accurate measurement of neutron capture cross sections of the Eu isotopes is important for many reasons including nuclear astrophysics and nuclear diagnostics. Neutron capture excitation functions of {sup 151,153}Eu targets were measured recently using a 4{pi} {gamma}-ray calorimeter array DANCE located at the Los Alamos Neutron Science Center for E {sub n} = 0.1-100 keV. The progress on the data analysis efforts is given in the present paper. The {gamma}-ray multiplicity distributions for the Eu targets and Be backing are significantly different. The {gamma}-ray multiplicity distribution is found to be the same for different neutron energies for both {sup 151}Eu and {sup 153}Eu. The statistical simulation to model the {gamma}-ray decay cascade is summarized.

  15. Progress on the Europium Neutron-Capture Study using DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Agvaanluvsan, U; Becker, J A; Macri, R A; Parker, W; Wilk, P; Wu, C Y; Bredeweg, T A; Esch, E; Haight, R C; O' Donnell, J M; Reifarth, R; Rundberg, R S; Schwantes, J M; Ullmann, J L; Vieira, D J; Wilhelmy, J B; Wouters, J M; Mitchell, G E; Sheets, S A; Becvar, F; Krticka, M


    The accurate measurement of neutron-capture cross sections of the Eu isotopes is important for many reasons including nuclear astrophysics and nuclear diagnostics. Neutron capture excitation functions of {sup 151,153}Eu targets were measured recently using a 4{pi} {gamma}-ray calorimeter array DANCE located at the Los Alamos Neutron Science Center for E{sub n} = 0.1-100 keV. The progress on the data analysis efforts is given in the present paper. The {gamma}-ray multiplicity distributions for the Eu targets and Be backing are significantly different. The {gamma}-ray multiplicity distribution is found to be the same for different neutron energies for both {sup 151}Eu and {sup 153}Eu. The statistical simulation to model the {gamma}-ray decay cascade is summarized.

  16. Update on CD40 and CD154 blockade in transplant models. (United States)

    Zhang, Tianshu; Pierson, Richard N; Azimzadeh, Agnes M


    Generation of an effective immune response against foreign antigens requires two distinct molecular signals: a primary signal provided by the binding of antigen-specific T-cell receptor to peptide-MHC on antigen-presenting cells and a secondary signal delivered via the engagement of costimulatory molecules. Among various costimulatory signaling pathways, the interactions between CD40 and its ligand CD154 have been extensively investigated given their essential roles in the modulation of adaptive immunity. Here, we review current understanding of the role CD40/CD154 costimulation pathway has in alloimmunity, and summarize recent mechanistic and preclinical advances in the evaluation of candidate therapeutic approaches to target this receptor-ligand pair in transplantation.

  17. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  18. Colloidal europium nanoparticles via a solvated metal atom dispersion approach and their surface enhanced Raman scattering studies. (United States)

    Urumese, Ancila; Jenjeti, Ramesh Naidu; Sampath, S; Jagirdar, Balaji R


    Chemistry of lanthanide metals in their zerovalent state at the nanoscale remains unexplored due to the high chemical reactivity and difficulty in synthesizing nanoparticles by conventional reduction methods. In the present study, europium(0) nanoparticles, the most reactive of all the rare earth metals have been synthesized by solvated metal atom dispersion (SMAD) method using hexadecyl amine as the capping agent. The as-prepared europium nanoparticles show surface Plasmon resonance (SPR) band in the visible region of the electromagnetic spectrum. This lead to the investigation of its surface enhanced Raman scattering (SERS) using visible light excitation source. The SERS activity of europium nanoparticles has been followed using 4-aminothiophenol and biologically important molecules such as hemoglobin and Cyt-c as the analytes. This is the first example of lanthanide metal nanoparticles as SERS substrate which can possibly be extended to other rare-earth metals. Since hemoglobin absorbs in the visible region, the use of visible light excitation source leads to surface enhanced resonance Raman spectroscopy (SERRS). The interaction of biomolecules with Eu(0) has been followed using FT-IR and UV-visible spectroscopy techniques. The results indicate that there is no major irreversible change in the structure of biomolecules upon interaction with europium nanoparticles. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Rapid screening of oxytetracycline residue in catfish muscle by dispersive liquid-liquid microextraction and europium-sensitized luminescence (United States)

    Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...

  20. Luminescence variations in europium-doped silicon-substituted hydroxyapatite nanobiophosphor via three different methods

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Cao Xuan; Pham, Vuong-Hung, E-mail:


    Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.

  1. Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS

    CERN Document Server

    AUTHOR|(CDS)2099873; Marsh, Bruce Alan

    The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...

  2. Structural and electrical properties of the europium-doped indium zinc oxide thin film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Chu-Chi, E-mail: [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Advanced Institute for Manufacturing with High-Tech Innovations, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Li, Wei-Yang; Wang, Ching-Hua; Yong, Hua-En [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China)


    The EuInZnO (EIZO) thin film transistor (TFT) devices were fabricated by the sol–gel spin-coating technique. The EIZO TFT operates in the n-channel depletion mode and exhibits a well-defined pinch-off and saturation region. Because europium ion possesses lower electronegativity (1.2) and standard electrode potential (− 1.991 V), it can act as the carrier suppressor to reduce the carrier concentrations of the IZO (In:Zn = 1:1) thin film. Eu{sup 3+} (13 mol%)-doped IZO TFT possesses the optimum performance, and its field-effect mobility in the saturated regime, threshold voltage, on–off ratio, and S-factor are 1.23 cm{sup 2}/Vs, 3.28 V, 1.07 × 10{sup 6}, and 2.28 V/decade, respectively. - Highlights: • Europium ions can act as the carrier suppressor in the InZnO system. • The EuInZnO forms an n-channel material for the thin film transistor (TFT) device. • The optimum performance of the EuInZnO TFT is the sample with 13 mol% Eu{sup 3+} doping.

  3. Europium phosphomolybdate and osmium metallopolymer multi-functional LbL films: redox and electrocatalytic properties. (United States)

    Fernandes, Diana M; Vos, Johannes G; Freire, Cristina


    Hybrid multilayer films composed by osmium metallopolymer [Os(bpy)2(PVP)10Cl]Cl (Os-poly) and europium phosphomolybdate, K₁₁[Eu(III)(PMo₁₁O₃₉)₂] (Eu(PMo11)2), were prepared using the electrostatic layer-by-layer (LbL) self-assembly method. The film build-up, monitored by electronic spectroscopy, showed a regular stepwise growth indicating a strong interaction between layers. The XPS measurements corroborated the successful fabrication of the hybrid films with the Os-poly/Eu(PMo11)2 composition. SEM images revealed a completely covered surface with a highly roughened texture. Electrochemical characterisation of films by cyclic voltammetry revealed three Mo-based reduction processes (Mo(VI)→Mo(V)) in the potential range between -0.4 and 0.1 V and one Os reduction process (Os(III)→Os(II)) at ≈0.270 V. The cyclic voltammograms of two electroactive probes, [Fe(CN)₆](3-/4-) and [Ru(NH₃)₆](3+/2+) on {Os-poly/Eu(PMo11)2}n modified electrodes revealed redox mediation between film and the probes. Furthermore, the {Os-poly/Eu(PMo11)2}n multilayer films also showed excellent Mo-based electrocatalytic activity towards reduction of nitrite and iodate, confirming the multi-functional properties of the hybrid europium phosphomolybdate - osmium metallopolymer LbL films. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental


    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  5. Analysis of metal surfaces coated with europium-doped titanium dioxide by laser induced breakdown spectroscopy. (United States)

    Głogocka, Daria; Noculak, Agnieszka; Pucińska, Joanna; Jopek, Wojciech; Podbielska, Halina; Langner, Marek; Przybyło, Magdalena


    The surface passivation with titanium sol-gel coatings is a frequently used technique to control the adsorption of selected biological macromolecules and to reduce the exposure of the bulk material to biological matter. Due to the increasing number of new coating-preparation methods and new gel compositions with various types of additives, the quality and homogeneity determination of the surface covering is a critical factor affecting performance of any implanted material. While coating thickness is easy to determine, the homogeneity of the surface distribution of coating materials requires more elaborate methodologies. In the paper, the laser induced breakdown spectroscopy (LIBS) based method, capable to quantitate the homogeneity and uniformity of the europium in titanium dioxide sol-gel coatings on stainless steel surfaces prepared with two different procedures: spin-coating and dip-coating, is presented. The emission intensity of titanium has been used to determine the coating thickness whereas the relative values of europium and titanium emission intensities provide data on the coating homogeneity. The obtained results show that the spin-coating technique provides better surface coverage with titanium dioxide. However, when the surface coating compositions were compared the dip-coating technique was more reliable.

  6. Europium(III) Macrocyclic Complexes with Alcohol Pendant Groups as Chemical Exchange Saturation Transfer Agents (United States)

    Woods, Mark; Woessner, Donald E.; Zhao, Piyu; Pasha, Azhar; Yang, Meng-Yin; Huang, Ching-Hui; Vasalitiy, Olga; Morrow, Janet R.; Sherry, A. Dean


    Paramagnetic lanthanide(III) complexes that contain hyperfine-shifted exchangeable protons offer considerable advantages over diamagnetic molecules as chemical exchange saturation transfer (CEST) agents for MRI. As part of a program to investigate avenues to improve the sensitivity of such agents, the CEST characteristics of europium(III) macrocyclic complexes having appended hydroxyethyl groups were investigated. The CEST spectrum of the asymmetrical complex, EuCNPHC3+, shows five distinct peaks for each magnetically nonequivalent exchangeable proton in the molecule. The CEST spectra of this complex were fitted to NMR Bloch theory to yield exchange rates between each of six exchanging proton pools (five on the agent plus bulk water). Exchange between the Eu3+-bound hydroxyl protons and bulk water protons was slow in dry acetonitrile but accelerated incrementally upon stepwise addition of water. In pure water, exchange was too fast to observe a CEST effect. The utility of this class of europium(III) complex for CEST imaging applications is ultimately limited by the small chemical shifts induced by the hydroxyl-appended ligands of this type and the resulting small Δω values for the exchangeable hydroxyl protons. PMID:16881645

  7. Red light emission from europium doped zinc sodium bismuth borate glasses (United States)

    Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.


    Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.

  8. Induced Europium Circularly Polarized Luminescence Monitors Reversible Drug Binding to Native α1 -Acid Glycoprotein. (United States)

    Jennings, Laura; Waters, Ryan S; Pal, Robert; Parker, David


    Alpha-1-acid glycoprotein (α1 -AGP) is an important blood plasma glycoprotein. Following an acute-phase reaction such as stress, inflammation, burn, or infection, the bloodstream concentration of α1 -AGP can increase up to 400 % of its normal concentration. A wide range of drugs is known to bind α1 -AGP. Increased binding of pharmacologically active compounds to α1 -AGP moderates their clinical effect by decreasing the amount of unbound drug in the bloodstream. This has important clinical ramifications for such applications as the duration of anesthesia and in determining dosage for drug therapy. In this study, the competitive binding to α1 -AGP of a dynamically racemic europium(III) complex with seven pharmacologically active drugs absorbing in the range λ 250-290 nm was monitored by following changes in europium total emission and in induced circularly polarized luminescence (CPL). Binding affinities corresponding to Kd values in the range 0.5-100 μm were measured, in good agreement with published data. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

    Directory of Open Access Journals (Sweden)

    Zhang Kui-Hua


    Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

  10. 46 CFR 154.1872 - Cargo emergency jettisoning. (United States)


    ... jettisoning. (a) The master shall ensure that emergency jettisoning piping under § 154.356, except bow and stern loading and discharging piping, is only used when an emergency exists. (b) Emergency jettisoning...

  11. "Rigid" Luminescent Soft Materials: Europium-Containing Lyotropic Liquid Crystals Based on Polyoxyethylene Phytosterols and Ionic Liquids. (United States)

    Yi, Sijing; Wang, Jiao; Feng, Zhenyu; Chen, Xiao


    Soft materials of europium β-diketonate complexes constructed in lyotropic liquid crystals (LLCs) mediated by ionic liquids (ILs) are impressive for their excellent luminescence performance and stability. For the aim to further improve their mechanical processability and luminescent tunablility, the polyoxyethylene phytosterols (BPS-n) were introduced here as structure directing agents to prepare relatively "rigid" lamellar luminescent LLCs in 1-butyl-3-methyl-imidazolium hexafluorophosphate by doping europium β-diketonate complexes with different imidazolium counterions. As a result of the solvophobic sterol ring structure of BPS-n, the more effective isolation and confinement effects of europium complexes could be achieved. The longest fluorescence lifetime and the highest quantum efficiency reported so far for europium containing lyotropic organized soft materials were thus obtained. Changing the molecular structures of BPS-n with different oxyethylene chains or doped complexes with imidazolium counterions of different alkyl chain lengths, the spacings of lamellar LLC matrixes and position of dispersed complexes became tunable. The measured luminescent and rheological properties for such composite LLCs showed a dependence on the rigidity and isolation capability afforded by sterol molecules. It was also found that the increase of counterion alkyl chain length would weaken the LLC matrix's confinement and isolation effects and therefore exhibit the deteriorated luminescence performance. The enhanced luminescence efficiency and stability of doped BPS-n LLCs reflected the excellent segregation of europium complexes from each other and therefore the reduced self-quenching process. The obtained results here present the designability of LLC matrixes and their great potential to promote achieving the luminescence tunability of soft materials.

  12. Preparation and photoluminescence of some europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dunjia, E-mail:; Pi, Yan; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Wei, Xianhong


    Highlights: •Preparation of europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands. •Photoluminescence behavior of europium (III) ternary complexes. •Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), the lifetime (τ) and the luminescent quantum yield (η). -- Abstract: Preparation and photoluminescence behavior of four new europium (III) ternary complexes with β-diketones (1-(6-methoxy-naphthalen-2-yl)-3-phenyl-propane-1,3-dione (MNPPD) and 1-(4-tert-butyl-phenyl)-3-(6-methoxy-naphthalen-2-yl)-propane-1,3-dione (BPMPD)) and 2,2-dipyridine (Bipy) or 1,10-phenanthroline (Phen) were reported, in the solid state. Complexes Eu(MPPD){sub 3}·Bipy, Eu(BMPD){sub 3}·Bipy, Eu(MPPD){sub 3}·Phen and Eu(BMPD){sub 3}·Phen were characterized by elemental analysis, FT-IR, {sup 1}H NMR, UV–vis absorption. The emission spectra show narrow emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion. Based on the emission spectra and luminescence decay curves in solid state, the intensity parameters (Ω{sub t}), lifetime (τ) and emission quantum efficiency (η) were determined. The Ω{sub 2} values indicate that the Eu(III) ion in these complexes is in a highly polarizable chemical environment. Complexes Eu(MPPD){sub 3}·Bipy and Eu(MPPD){sub 3}·Phen showed a longer lifetime (τ) and a higher luminescence quantum efficiency (η), which indicated that the energy transfer to the europium ion from MNPPD ligand is more efficient than that from BPMPD ligand.

  13. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  14. Syntheses and electroluminescent properties of two europium ternary complexes Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT)

    Energy Technology Data Exchange (ETDEWEB)

    Guan Min [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Gao Lihua [Department of Chemistry, Beijing Normal University, Beijing 100875 (China); Wang Shanshan [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Huang Chunhui [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China)], E-mail:; Wang Kezhi [Department of Chemistry, Beijing Normal University, Beijing 100875 (China)


    Two europium complexes, Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT) (DBM=dibenzoylmethanato, PBO=2-(2-pyridyl)benzoxazole, PBT=2-(2-pyridyl)benzothiazole), were prepared and used as emitting materials in organic electroluminescent (EL) devices. The devices with the structures ITO/TPD/Eu(DBM){sub 3}(PBO) (or Eu(DBM){sub 3}(PBT)/BCP/Alq{sub 3}/Mg:Ag/Ag emit red light originating from the europium complexes.

  15. Exploratory computational assessment of possible binding modes for small molecule inhibitors of the CD40-CD154 co-stimulatory interaction. (United States)

    Ganesan, L; Vidović, D; Schürer, S C; Buchwald, P


    Protein-protein interactions (PPI) tend to involve extensive, flat, and featureless interfaces that are difficult to disrupt by small molecule binding. However, recently, PPIs are being recognized as increasingly valuable 'druggable' targets. We have identified several small molecule inhibitors of the immunologically relevant CD40-CD154 co-stimulatory interaction that bind to the homotrimeric CD154, a member of the tumor necrosis factor superfamily (TNFSF). Recently, on the basis of the co-crystal structure of CD154 with another small molecule (BIO8898), it has been suggested that these PPIs could be particularly susceptible to small molecule blockade due to a subunit fracture mechanism resulting in a distortion of the trimeric structure. To investigate whether this mechanism can occur with our organic dye-related inhibitors, we performed exploratory computational docking experiments. Possible druggable pockets that can serve as binding sites for small molecule inhibitors were identified with the FFT map algorithm both along the CD154-CD40 binding interface (competitive, orthosteric model) and in the interior core of the CD154 trimer corresponding to the BIO8898 binding site (allosteric model). Docking experiments (using Glide) were performed at these sites using the PDB ID: 3QD6 (CD40-CD154) and 3LKJ (BIO8898-CD154) co-crystal structures, respectively. The docking algorithm was able to better discriminate binders from non-binders at the deeper allosteric site than at the competitive site. Accordingly, an allosteric inhibitory mechanism that involves intercalation between monomeric subunits seems feasible for our small molecules making the constitutively trimeric CD154 a likely druggable target.

  16. Reduced Lentivirus Susceptibility in Sheep with TMEM154 Mutations (United States)

    Heaton, Michael P.; Clawson, Michael L.; Chitko-Mckown, Carol G.; Leymaster, Kreg A.; Smith, Timothy P. L.; Harhay, Gregory P.; White, Stephen N.; Herrmann-Hoesing, Lynn M.; Mousel, Michelle R.; Lewis, Gregory S.; Kalbfleisch, Theodore S.; Keen, James E.; Laegreid, William W.


    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10−9). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection. PMID:22291605

  17. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))


    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  18. Stability constants of europium complexes with a nitrogen heterocycle substituted methane-1,1-diphosphonic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, M.P.; Rickert, P.G.; Schmidt, M.A.; Nash, K.L.


    Even in moderately acidic solutions ([H{sup +}] > 0.01 M), N-piperidinomethane-1,1-diphosphonic acid (H{sub 4}PMDPA) is a strong complexant of trivalent lanthanide ions that shows enhanced complex solubility over previously studied 1,1-diphosphonic acids. The protonation constants of PMDPA in 2.0 M H/NaClO{sub 4} were determined by potentiometric and NMR titrations, and the stability constants for formation of complexes with Eu{sup 3+} were determined by solvent extraction. Difference in protonation equilibria induced by addition of the nitrogen heterocycle results in an increase in the complexation strength of PMDPA. In solutions containing 0.1 M H{sup +} and ligand concentrations greater than 0.02 M, PMDPA is the most effective 1,1-diphosphonic acid for europium complexation studied thus far.

  19. Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio

    Energy Technology Data Exchange (ETDEWEB)

    Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)

  20. First principles description of the insulator-metal transition in europium monoxide

    KAUST Repository

    Wang, Hao


    Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.

  1. Development of europium doped BaSO4 TL OSL dual phosphor for radiation dosimetry applications (United States)

    Patle, Anita; Patil, R. R.; Kulkarni, M. S.; Bhatt, B. C.; Moharil, S. V.


    This paper presents the results on the preparation and characterization of Europium-doped Barium sulfate (BaSO4: Eu) TL /OSL dual phosphor. The OSL sensitivity was found to be 11% of the commercially available Al2O3: C, using area integration method. The sample also shows good TL sensitivity and the dosimetric peak appears around 190°C with a shoulder at 282°C. After OSL readout, No change in the TL glow curve is observed. Since the observed TL peaks are not responsible for the observed OSL, good OSL as well as TL sensitivity and low fading will make this phosphor suitable for applications in radiation dosimetry using OSL as well as TL.

  2. Chemiluminescence determination of tetracyclines using Fenton system in the presence europium(III) ions

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan, E-mail: [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)


    A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.

  3. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A., E-mail: [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803-1804 (United States)


    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  4. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics. (United States)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A


    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  5. Electrochemiluminescence Study of Europium (III Complex with Coumarin3-Carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Stefan Lis


    Full Text Available The europium (III complex of coumarin-3-carboxylic acid (C3CA has been prepared and characterized on the basis of elemental analysis, IR, and emission (photoluminescence and electrochemiluminescence spectroscopy. The synthesised complex having a formula Eu(C3CA2(NO3(H2O2 was photophysically characterized in solution and in the solid state. Electrochemiluminescence, ECL, of the system containing the Eu(III/C3CA complex was studied using an oxide-covered aluminium electrode. The goal of these studies was to show the possibility of the use of electrochemical excitation of the Eu(III ion in aqueous solution for emission generation. The generated ECL emission was very weak, and therefore its measurements and spectral analysis were carried out with the use of cut-off filters method. The studies proved a predominate role of the ligand-to-metal energy transfer (LMET in the generated ECL.

  6. Europium incorporated in silica matrix obtained by sol-gel: luminescent materials

    Directory of Open Access Journals (Sweden)

    Nassar Eduardo José


    Full Text Available In this work we report some aspects of the chemistry involved in the preparation of modified silicon oxide by the sol-gel process. Europium III compounds were used as luminescent probe. An organic-inorganic hybrid was obtained by hydrolysis of tetraethylorthosilicate (TEOS and 3-aminopropyltriethoxysilane (APTS. The Eu III compounds were added in different ways. In the first, silica was prepared in the presence of Eu III, and in the second, Eu III was added on the silica surface. These materials were studied by luminescence, infrared spectroscopy and termogravimetric analysis. The results obtained for the hybrid material show different behavior for Eu III emission, which could be excited by the antenna effect and the influence of the surrounding in the luminescence quenching. The thermogravimetric data present different mass loss in samples to range temperature 50 - 150 °C. Thermogravimetric and infrared spectra showed that inorganic polymers incorporated the organic part.

  7. Europium as an inhibitor of Amyloid-β(1-42) induced membrane permeation. (United States)

    Williams, Thomas L; Urbanc, Brigita; Marshall, Karen E; Vadukul, Devkee M; Jenkins, A Toby A; Serpell, Louise C


    Soluble Amyloid-beta (Aβ) oligomers are a source of cytotoxicity in Alzheimer's disease (AD). The toxicity of Aβ oligomers may arise from their ability to interact with and disrupt cellular membranes mediated by GM1 ganglioside receptors within these membranes. Therefore, inhibition of Aβ-membrane interactions could provide a means of preventing the toxicity associated with Aβ. Here, using Surface Plasmon field-enhanced Fluorescence Spectroscopy, we determine that the lanthanide, Europium III chloride (Eu(3+)), strongly binds to GM1 ganglioside-containing membranes and prevents the interaction with Aβ42 leading to a loss of the peptides ability to cause membrane permeation. Here we discuss the molecular mechanism by which Eu(3+) inhibits Aβ42-membrane interactions and this may lead to protection of membrane integrity against Aβ42 induced toxicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Radiation effects on beta /10.6/ of pure and europium doped KCl (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.


    Changes in the optical absorption coefficient as the result of X-ray and electron bombardment of pure monocrystalline and polycrystalline KCl and of divalent europium doped polycrystalline KCl were determined. A constant heat flow calorimetric method was used to measure the optical absorption coefficients. Both 300 kV X-ray irradiation and 2 MeV electron irradiation produced increases in the optical absorption coefficient at room temperature. X-ray irradiation produced more significant changes in pure monocrystalline KCl than equivalent amounts of electron irradiation. Electron irradiation of pure and Eu-doped polycrystalline KCl produced increases in the absorption by as much as a factor of 20 over untreated material. Bleaching of the electron-irradiated doped KCl with 649 millimicron light produced a further increase.

  9. Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Klobes, B., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail:; Neumeier, S., E-mail: [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail:; Jafari, A., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)


    Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.

  10. Posttranscriptional Regulation in Lymphocytes: The case of CD154 (United States)

    Vavassori, Stefano; Covey, Lori R.


    The control of mRNA decay is emerging as an important control point and a major contributor to gene expression in both immune and non-immune cells. The identification of protein factors and cis-acting elements responsible for transcript degradation has illuminated a comprehensive picture of precisely orchestrated events required to both regulate and establish the decay process. One gene that is highly regulated at the posttranscriptional level is CD40 ligand (CD154 or CD40L). CD154 on CD4+ T cells is tightly controlled by an interacting network of transcriptional and posttranscriptional processes that result in precise surface levels of protein throughout an extended time course of antigen stimulation. The activation-induced stabilization of the CD154 transcript by a polypyrimidine tract-binding protein (PTB)-complex is a key event that corresponds to the temporal expression of CD154. In this review, we discuss known and potential roles of major mRNA decay pathways in lymphocytes and focus on the unique posttranscriptional mechanisms leading to CD154 expression by activated CD4+ T cells. PMID:19395873

  11. Photoluminescent polymer electrolyte based on agar and containing europium picrate for electrochemical devices

    Energy Technology Data Exchange (ETDEWEB)

    Lima, E. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Raphael, E.; Sentanin, F. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil); Rodrigues, L.C. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Ferreira, R.A.S.; Carlos, L.D. [Departamento de Fisica, CICECO, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Silva, M.M., E-mail: [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Pawlicka, A. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil)


    Highlights: Black-Right-Pointing-Pointer We prepared ionic conducting membranes for the specific requirements of the device. Black-Right-Pointing-Pointer Luminescent reporter groups, with many applications in biotechnology. Black-Right-Pointing-Pointer Thermal and electrochemical stability of electrolytes is adequate for application. - Abstract: Dispersion of photoluminescent rare earth metal complexes in polymer matrices is of great interest due to the possibility of avoiding the saturation of the photoluminescent signal. The possibility of using a natural ionic conducting polymer matrix was investigated in this study. Samples of agar-based electrolytes containing europium picrate were prepared and characterized by physical and chemical analyses. The FTIR spectra indicated strong interaction of agar O-H and 3,6-anhydro-galactose C-O groups with glycerol and europium picrate. The DSC analyses revealed no glass transition temperature of the samples in the -60 to 250 Degree-Sign C range. From the thermogravimetry (TG), a thermal stability of the samples of up to 180 Degree-Sign C was stated. The membranes were subjected to ionic conductivity measurement, which provided the values of 2.6 Multiplication-Sign 10{sup -6} S/cm for the samples with acetic acid and 1.6 Multiplication-Sign 10{sup -5} S/cm for the samples without acetic acid. Moreover, the temperature-dependent ionic conductivity measurements revealed both Arrhenius and VTF models of the conductivity depending on the sample. Surface visualization through scanning electron microscopy (SEM) demonstrated good uniformity. The samples were also applied in small electrochromic devices and showed good electrochemical stability. The present work confirmed that these materials may perform as satisfactory multifunctional component layers in the field of electrochemical devices.

  12. Spectroscopic investigation on europium doped heavy metal borate glasses for red luminescent application

    Energy Technology Data Exchange (ETDEWEB)

    Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)


    The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)

  13. Europium nanoparticle-based high performing immunoassay for the screening of treponemal antibodies.

    Directory of Open Access Journals (Sweden)

    Sheikh M Talha

    Full Text Available Treponema pallidum subspecies pallidum (Tp is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co ratios obtained with the two immunoassays (p=0.06. Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood

  14. Visible-light-excited and europium-emissive nanoparticles for highly-luminescent bioimaging in vivo. (United States)

    Wu, Yongquan; Shi, Mei; Zhao, Lingzhi; Feng, Wei; Li, Fuyou; Huang, Chunhui


    Europium(III)-based material showing special milliseconds photoluminescence lifetime has been considered as an ideal time-gated luminescence probe for bioimaging, but is still limited in application in luminescent small-animal bioimaging in vivo. Here, a water-soluble, stable, highly-luminescent nanosystem, Ir-Eu-MSN (MSN = mesoporous silica nanoparticles, Ir-Eu = [Ir(dfppy)2(pic-OH)]3Eu·2H2O, dfppy = 2-(2,4-difluorophenyl)pyridine, pic-OH = 3-hydroxy-2-carboxypyridine), was developed by an in situ coordination reaction to form an insoluble dinuclear iridium(III) complex-sensitized-europium(III) emissive complex within mesoporous silica nanoparticles (MSNs) which had high loading efficiency. Compared with the usual approach of physical adsorption, this in-situ reaction strategy provided 20-fold the loading efficiency (43.2%) of the insoluble Ir-Eu complex in MSNs. These nanoparticles in solid state showed bright red luminescence with high quantum yield of 55.2%, and the excitation window extended up to 470 nm. These Ir-Eu-MSN nanoparticles were used for luminescence imaging in living cells under excitation at 458 nm with confocal microscopy, which was confirmed by flow cytometry. Furthermore, the Ir-Eu-MSN nanoparticles were successfully applied into high-contrast luminescent lymphatic imaging in vivo under low power density excitation of 5 mW cm(-2). This synthetic method provides a universal strategy of combining hydrophobic complexes with hydrophilic MSNs for in vivo bioimaging. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Europium Nanoparticle-Based High Performing Immunoassay for the Screening of Treponemal Antibodies (United States)

    Talha, Sheikh M.; Hytönen, Jukka; Westhorpe, Adam; Kumar, Sushil; Khanna, Navin; Pettersson, Kim


    Treponema pallidum subspecies pallidum (Tp) is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF) immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co) ratios obtained with the two immunoassays (p = 0.06). Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood-bank settings as a

  16. Semiconducting polymer encapsulated mesoporous silica particles with conjugated Europium complexes: toward enhanced luminescence under aqueous conditions. (United States)

    Zhang, Jixi; Prabhakar, Neeraj; Näreoja, Tuomas; Rosenholm, Jessica M


    Immobilization of lanthanide organic complexes in meso-organized hybrid materials for luminescence applications have attracted immense interest due to the possibility of controlled segregation at the nanoscopic level for novel optical properties. Aimed at enhancing the luminescence intensity and stability of the hybrid materials in aqueous media, we developed polyvinylpyrrolidone (PVP) stabilized, semiconducting polymer (poly(9-vinylcarbazole), PVK) encapsulated mesoporous silica hybrid particles grafted with Europium(III) complexes. Monosilylated β-diketonate ligands (1-(2-naphthoyl)-3,3,3-trifluoroacetonate, NTA) were first co-condensed in the mesoporous silica particles as pendent groups for bridging and anchoring the lanthanide complexes, resulting in particles with an mean diameter of ∼ 450 nm and a bimodal pore size distribution centered at 3.5 and 5.3 nm. PVK was encapsulated on the resulted particles by a solvent-induced surface precipitation process, in order to seal the mesopores and protect Europium ions from luminescence quenching by producing a hydrophobic environment. The obtained polymer encapsulated MSN-EuLC@PVK-PVP particles exhibit significantly higher intrinsic quantum yield (Φ(Ln) = 39%) and longer lifetime (τ(obs) = 0.51 ms), as compared with those without polymer encapsulation. Most importantly, a high luminescence stability was realized when MSN-EuLC@PVK-PVP particles were dispersed in various aqueous media, showing no noticeable quenching effect. The beneficial features and positive attributes of both mesoporous silica and semiconducting polymers as lanthanide-complex host were merged in a single hybrid carrier, opening up the possibility of using these hybrid luminescent materials under complex aqueous conditions such as biological/physiological environments.

  17. Modified magnetic and optical properties of manganese nanoparticles incorporated europium doped magnesium borotellurite glass

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, Siti Maisarah; Sahar, M.R., E-mail:; Ghoshal, S.K.


    This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)

  18. Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yu, E-mail: [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Wang, Yafei [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Li, Chun [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China); Huang, Ying; Dang, Dongfeng; Zhu, Meixiang [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Zhu, Weiguo, E-mail: [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Cao, Yong, E-mail: [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China)


    A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM){sub 3}(BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM){sub 3}(BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu{sup 3+} ion emission, based on the {sup 5}D{sub 0} → {sup 7}F{sub 2} transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE{sub ext}) of 1.26% at current density of 1.65 mA cm{sup −2}, with a maximum brightness of 568 cd m{sup −2} at 137.8 mA cm{sup −2} was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM){sub 3}(BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM){sub 3}(BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices.

  19. The Interaction of CD154 with the α5β1 Integrin Inhibits Fas-Induced T Cell Death.

    Directory of Open Access Journals (Sweden)

    Meriem Bachsais

    Full Text Available CD154, a critical regulator of the immune response, is usually associated with chronic inflammatory, autoimmune diseases as well as malignant disorders. In addition to its classical receptor CD40, CD154 is capable of binding other receptors, members of the integrin family, the αIIbβ3, αMβ2 and α5β1. Given the role attributed to integrins and particularly the β1 integrins in inhibiting apoptotic events in normal as well as malignant T cells, we were highly interested in investigating the role of the CD154/α5β1 interaction in promoting survival of malignant T cells contributing as such to tumor development and/or propagation. To support our hypothesis, we first show that soluble CD154 binds to the T-cell acute lymphoblastic leukemia cell line, Jurkat E6.1 in a α5β1-dependent manner. Binding of soluble CD154 to α5β1 integrin of Jurkat cells leads to the activation of key survival proteins, including the p38 and ERK1/2 mitogen-activated protein kinases (MAPKs, phosphoinositide 3 kinase (PI-3K, and Akt. Interestingly, soluble CD154 significantly inhibits Fas-mediated apoptosis in T cell leukemia-lymphoma cell lines, Jurkat E6.1 and HUT78 cells, an important hallmark of T cell survival during malignancy progression. These anti-apoptotic effects were mainly mediated by the activation of the PI-3K/Akt pathway but also involved the p38 and the ERK1/2 MAPKs cascades. Our data also demonstrated that the CD154-triggered inhibition of the Fas-mediated cell death response was dependent on a suppression of caspase-8 cleavage, but independent of de novo protein synthesis or alterations in Fas expression on cell surface. Together, our results highlight the impact of the CD154/α5β1 interaction in T cell function/survival and identify novel targets for the treatment of malignant disorders, particularly of T cell origin.

  20. CD154: the atherosclerotic risk factor in rheumatoid arthritis? (United States)


    Atherosclerosis, now regarded as a chronic inflammatory disease of the arterial wall, and its clinical manifestations have increasingly been associated with rheumatoid arthritis (RA), supporting the notion that autoimmune diseases and vascular disorders share common etiological features. Indeed, evidence pertaining to this matter indicates that inflammation and its multiple components are the driving force behind the pathogenesis of these disorders. Interestingly, CD154 and its receptors have emerged as major players in the development of RA and atherosclerosis, which raises the possibility that this axis may represent an important biological link between both complications. Indeed, CD154 signaling elicits critical inflammatory responses that are common to the pathogenesis of both diseases. Here, we provide an overview of the traditional and disease-related interrelations between RA and vascular abnormalities, while focusing on CD154 as a potential mediator in the development of atherosclerotic events in RA patients. PMID:23433179

  1. Electron paramagnetic resonance and photoluminescence investigation of europium local structure in oxyfluoride glass ceramics containing SrF2 nanocrystals (United States)

    Antuzevics, A.; Kemere, M.; Krieke, G.; Ignatans, R.


    Different compositions of europium doped aluminosilicate oxyfluoride glass ceramics prepared in air atmosphere have been studied by electron paramagnetic resonance (EPR) and optical spectroscopy methods. X-ray diffraction (XRD) and transmission electron microscopy (TEM) measurements show presence of homogenously distributed SrF2 nanocrystals after the heat treatment of the precursor glass. Efficient Eu3+ incorporation in the high symmetry environment of glass ceramics is observed from the photoluminescence spectra. EPR spectra indicate Eu3+ → Eu2+ reduction upon precipitation of crystalline phases in the glass matrix. For composition abundant with Eu2+ in the glassy state such behaviour is not detected. Local structure around europium ions is discussed based on differences in chemical compositions.

  2. Bright, highly water-soluble triazacyclononane europium complexes to detect ligand binding with time-resolved FRET microscopy. (United States)

    Delbianco, Martina; Sadovnikova, Victoria; Bourrier, Emmanuel; Mathis, Gérard; Lamarque, Laurent; Zwier, Jurriaan M; Parker, David


    Luminescent europium complexes are used in a broad range of applications as a result of their particular emissive properties. The synthesis and application of bright, highly water-soluble, and negatively charged sulfonic- or carboxylic acid derivatives of para-substituted aryl-alkynyl triazacyclononane complexes are described. Introduction of the charged solubilizing moieties suppresses cellular uptake or adsorption to living cells making them applicable for labeling and performing assays on membrane receptors. These europium complexes are applied to monitor fluorescent ligand binding on cell-surface proteins with time-resolved Förster resonance energy transfer (TR-FRET) assays in plate-based format and using TR-FRET microscopy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Optical and spectral studies on pure and europium doped olgite type Na(Sr,Ba)PO4 ceramics. (United States)

    Jawaher, K Rackesh; Jagannathan, R; Das, S Jerome; Krishnan, S


    Europium ion doped olgite type Na(Sr,Ba)PO4 ceramics, a new generation of light emitting bulb, was prepared by a high temperature solid-state reaction method. The synthesized materials were subjected to various characterizations such as X-ray powder diffraction, Scanning electron microscopy and FT-IR spectra measurements. The EPR spectrum of the sample exhibits a well-resolved hyperfine structure of 151Eu2+ and 153Eu2+ isotopes and the g value has been calculated. Fluorescence spectra revealed that europium ions were present in divalent as well as in the trivalent oxidation states. The critical distance for energy transfer between Eu2+ and Eu2+ ion is calculated as 20Å, which is in good agreement with that of experimental data. The FTIR analysis reveals all the vibrations of PO4(3-) ions. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. A highly sensitive europium nanoparticle-based immunoassay for detection of influenza A/B virus antigen in clinical specimens. (United States)

    Zhang, Panhe; Vemula, Sai Vikram; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L; Hewlett, Indira


    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Semiconducting polymer dots doped with europium complexes showing ultranarrow emission and long luminescence lifetime for time-gated cellular imaging. (United States)

    Sun, Wei; Yu, Jiangbo; Deng, Ruiping; Rong, Yu; Fujimoto, Bryant; Wu, Changfeng; Zhang, Hongjie; Chiu, Daniel T


    Bright dots: Semiconducting polymer dots (Pdots) doped with europium complexes possess line-like fluorescence emission, high quantum yield, and long fluorescence lifetime. The Pdots successfully labeled receptors on cells. The long fluorescence lifetime of the Pdots was used to distinguish them from other red fluorescence emitting nanoparticles, and improve the signal-to-noise ratio for time-gated cellular imaging. PVK=poly(9-vinylcarbazole). Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Translocation and biokinetic behavior of nanoscaled europium oxide particles within 5 days following an acute inhalation in rats. (United States)

    Creutzenberg, Otto; Kock, Heiko; Schaudien, Dirk


    Nanoscaled europium oxide (Eu2O3) particles were inhaled by rats after acute exposure and the potential translocation of particles followed by chemical analysis and transmission electron microscopy (TEM) was investigated. An aqueous dispersion (phosphate buffer/bovine serum albumin) of a commercially available Eu2O3 particle fraction consisting partially of nanoscaled particles was aerosolized with pressurized air. After rapid evaporation, rats inhaled the dry aerosol for 6 h in a single exposure resulting in an alveolar calculated dose of approximately 39.5 μg Eu2O3. Using chemical analysis, 36.8 μg Eu2O3 was detected 1 h after lung inhalation. The amount declined slightly to 34.5 μg after 1 day and 35.0 μg after 5 days. The liver showed an increase of Eu2O3 from 32.3 ng 1 h up to 294 ng 5 days after inhalation. Additionally, lung-associated lymph nodes, thymus, kidneys, heart and testis exhibited an increase of europium over the period investigated. In the blood, the highest amount of europium was found 1 h after treatment whereas feces, urine and mesenteric lymph nodes revealed the highest amount 1 day after treatment. Using TEM analysis, particles could be detected only in lungs, and in the liver, no particles were detectable. In conclusion, the translocation of Eu2O3 within 5 days following inhalation could be determined very precisely by chemical analysis. A translocation of Eu2O3 particulate matter to liver was not detectable by TEM analysis; thus, the overproportional level of 0.8% of the lung load observed in the liver after 5 days suggests a filtering effect of dissolved europium with accumulation. Copyright © 2015 John Wiley & Sons, Ltd.

  7. A Highly Sensitive Europium Nanoparticle-Based Immunoassay for Detection of Influenza A/B Virus Antigen in Clinical Specimens (United States)

    Zhang, Panhe; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L.


    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. PMID:25297327

  8. Nature of the concentration thresholds of europium atom yield from the oxidized tungsten surface under electron stimulated desorption

    CERN Document Server

    Davydov, S Y


    The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level

  9. Ultrasmall Superparamagnetic Iron Oxide Nanoparticles with Europium(III) DO3A as a Bimodal Imaging Probe. (United States)

    Carron, Sophie; Bloemen, Maarten; Vander Elst, Luce; Laurent, Sophie; Verbiest, Thierry; Parac-Vogt, Tatjana N


    A new prototype consisting of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles decorated with europium(III) ions encapsulated in a DO3A organic scaffold was designed as a platform for further development of bimodal contrast agents for MRI and optical imaging. The USPIO nanoparticles act as negative MRI contrast agents, whereas the europium(III) ion is a luminophore that is suitable for use in optical imaging detection. The functionalized USPIO nanoparticles were characterized by TEM, DLS, XRD, FTIR, and TXRF analysis, and a full investigation of the relaxometric and optical properties was conducted. The typical luminescence emission of europium(III) was observed and the main red emission wavelength was found at 614 nm. The relaxometric study of these ultrasmall nanoparticles showed r2 values of 114.8 mM(-1) Fes(-1) at 60 MHz, which is nearly double the r2 relaxivity of Sinerem(®). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Mössbauer spectroscopy of europium-doped fluorochlorozirconate glasses and glass ceramics: optimization of storage phosphors in computed radiography. (United States)

    Pfau, C; Paßlick, C; Gray, S K; Johnson, J A; Johnson, C E; Schweizer, S


    Eu(2+)-doped fluorochlorozirconate (FCZ) glasses and glass ceramics, which are being developed for medical and photovoltaic applications, have been analysed by Mössbauer spectroscopy. The oxidation state and chemical environment of the europium ions, which are important for the performance of these materials, were investigated. Routes for maximizing the divalent europium content were also investigated. By using EuCl2 instead of EuF2 in the starting material a fraction of about 90% of the europium was maintained in the Eu(2+) state as opposed to about 70% when using EuF2. The glass ceramics produced by subsequent thermal processing contain BaCl2 nanocrystals in which Eu(2+) is incorporated, as shown by the narrower linewidth in the Mössbauer spectrum. Debye temperatures of 147 K and 186 K for Eu(2+) and Eu(3+), respectively, were determined from temperature dependent Mössbauer measurements. The f-factors were used to obtain the Eu(2+)/Eu(3+) ratio from the area ratio of the corresponding absorption lines.

  11. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events (United States)

    Benslimane, Nadir; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid


    Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production. PMID:22905203

  12. Requirement of transmembrane domain for CD154 association to lipid rafts and subsequent biological events.

    Directory of Open Access Journals (Sweden)

    Nadir Benslimane

    Full Text Available Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production.

  13. Enfoque terapéutico en 154 pacientes con acromegalia Therapeutic management in 154 acromegalic patients

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela


    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.Acromegaly is a chronic, invalidating disease due in over 95% of cases to a growth hormone (GH secreting pituitary adenoma. Its clinical manifestations are associated to local complications related to the tumor growth and/or to the metabolic consequences of GH excess. We report here our experience on 154 acromegalic patients. Surgical remission rate using stringent biochemical criteria was 32%, a figure relatively low due to the great number of patients bearing

  14. Phenotype abnormality: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 154 decreased efficiency...ent of blue light regimen root ... decreased efficiency ...

  15. Requirement for CD154 in the progression of atherosclerosis

    NARCIS (Netherlands)

    Lutgens, E.; Gorelik, L.; Daemen, M. J.; de Muinck, E. D.; Grewal, I. S.; Koteliansky, V. E.; Flavell, R. A.


    Atherosclerosis is a systemic disease of the large arteries, and activation of inflammatory pathways is important in its pathogenesis. Increasing evidence supports the importance of CD40-CD154 interactions in atherosclerosis, interactions originally known to be essential in major immune reactions

  16. 46 CFR 154.438 - Design vapor pressure. (United States)


    ... Independent Tank Type A § 154.438 Design vapor pressure. (a) If the surface of an independent tank type A are mostly flat surfaces,the Po must not exceed 69 kPa gauge (10 psig). (b) If the surfaces of an independent tank type A are formed by bodies of revolution, the design calculation of the Po must be specially...

  17. 32 CFR 154.42 - Evaluation of personnel security information. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Evaluation of personnel security information... SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Adjudication § 154.42 Evaluation of personnel security information. (a) The criteria and adjudicative policy to be used in applying the...

  18. 32 CFR 154.15 - Military appointment, enlistment, and induction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Military appointment, enlistment, and induction... Requirements § 154.15 Military appointment, enlistment, and induction. (a) General. The appointment, enlistment, and induction of each member of the Armed Forces or their Reserve Components shall be subject to the...

  19. 29__154 -158_ _Galadanci_ANALYSIS OF AURORAL

    African Journals Online (AJOL)


    Bayero Journal of Pure and Applied Sciences, 9(2): 154 - 158. Received: April, 2016. Accepted: August, 2016 ... 1Department of Physics, Bayero University, Kano. NIGERIA. 2Department of Mathematical Sciences, Bayero ... first described by a Japanese geophysicist named. Syun-IchiAkasofu in 1964 (Sarris and Li, 2005).

  20. 27 CFR 44.154 - Claim for refund of tax. (United States)


    ..., WITHOUT PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Claims § 44.154... refunded (without interest) to an export warehouse proprietor on proof satisfactory to the appropriate TTB... ownership of such export warehouse proprietor, or withdrawn by him from the market. Any claim for refund...

  1. 21 CFR 146.154 - Concentrated orange juice with preservative. (United States)


    ... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... ingredients prescribed for concentrated orange juice for manufacturing by § 146.153, except that a...

  2. 154.pdf | 25jan2011 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; currsci; 25jan2011; 154.pdf. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube · Twitter · Facebook · Blog. Academy News. IAS Logo. Ethical Guidelines and Procedures document. Posted on 17 January 2017. A revised version of the ...

  3. 46 CFR 154.1350 - Flammable gas detection system. (United States)


    ... compressor room; (3) Each motor room for cargo handling machinery; (4) Each cargo control station that is not... the space where the gas detection system's readout is located and must meet § 154.1365. (h) Remote... away from all ignition sources. (o) Each flammable gas detection system must not have common sampling...

  4. 33 CFR 154.1125 - Additional response plan requirements. (United States)


    ...) for exercises that test either the entire appendix or individual components(s). (3) Testing... Prince William Sound, Alaska § 154.1125 Additional response plan requirements. (a) The owner or operator of a TAPAA facility shall include the following information in the Prince William Sound appendix to...

  5. 18 CFR 154.401 - RD&D expenditures. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false RD&D expenditures. 154....401 RD&D expenditures. (a) Requirements. Upon approval by the Commission, a natural gas company may file to recover research, development, and demonstration (RD&D) expenditures in its rates under this...

  6. 20 CFR 655.154 - Additional positive recruitment. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Additional positive recruitment. 655.154... recruitment. (a) Where to conduct additional positive recruitment. The employer must conduct positive recruitment within a multistate region of traditional or expected labor supply where the CO finds that there...

  7. 33 CFR 154.545 - Discharge containment equipment. (United States)


    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154... chapter may be utilized in the planning requirements of subpart F and subpart H of this part. ... material and equipment to contain any oil or hazardous material discharged on the water from operations at...

  8. 33 CFR 154.1210 - Purpose and applicability. (United States)


    ... planning requirements for an owner or operator of a facility that handles, stores, or transports animal... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Animal Fats and Vegetable Oils Facilities § 154.1210 Purpose and applicability. (a) The requirements of this...

  9. 33 CFR 154.1110 - Purpose and applicability. (United States)


    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Additional Response Plan Requirements for a Trans-Alaska Pipeline Authorization Act (TAPAA) Facility Operating in Prince William Sound, Alaska § 154.1110 Purpose and applicability. (a) This subpart establishes oil spill response planning...

  10. Method for the validation of immunohistochemical staining using SCID mouse xenografts: expression of CD40 and CD154 in human non-small cell lung cancer. (United States)

    Ishikawa, Keidai; Miyamoto, Masaki; Yoshioka, Tatsuya; Kadoya, Masatoshi; Li, Li; Mishra, Roshan; Ichinokawa, Kazuomi; Shoji, Yasuhito; Matsumura, Yoshiyuki; Hida, Yasuhiro; Kaga, Kichizo; Kato, Tatsuya; Kaji, Mitsuhito; Ohbuchi, Toshiro; Itoh, Tomoo; Dosaka-Akita, Hirotoshi; Matsui, Yoshiro; Hirano, Satoshi


    This report proposes a concept for the standardization of immunohistochemical evaluation. Immunohistochemical staining has several problems associated with the sensitivity of the technical process and standardization of the assessment of potent staining. We provided data focusing on this concept through immunostaining for CD154 in non-small cell lung cancer (NSCLC). We used two types of anti-CD154 antibody as primary antibodies in immunohistochemical staining, as previously reported. Western blot analysis confirmed strong CD154 expression in the cultured cell line PC10, but not in LK2. We also assessed CD154 expression in SCID mouse xenografts of these cell lines. SCID xenograft data on western blot analysis were consistent with those of cultured cell lines. These xenografts could thus be used as positive or negative tissue controls for CD154 immunostaining. Primary antibodies should therefore be confirmed as recognizing target lesions, while control tissue specimens should be objectively confirmed as having target products using another experimental method. Our method would allow results to be unified at more than one laboratory and could act as an objective control assessment method in immunohistochemistry.

  11. Immunotargeting with CD154 (CD40 Ligand) Enhances DNA Vaccine Responses in Ducks


    Sheryl L. Gares; Karl P Fischer; Congly, Stephen E.; Lacoste, Stacey; Addison, William R.; Tyrrell, D Lorne; Gutfreund, Klaus S.


    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated du...

  12. Counteractive functions are encrypted in the residues of CD154. (United States)

    Bandyopadhyay, Syamdas; Chandel, Himanshu Singh; Singh, Shailza; Roy, Somenath; Krishnasastry, M V; Saha, Bhaskar


    CD40, as a single receptor that binds CD154 (CD40-ligand or CD40L), regulates counteractive effector functions such as production of pro- and anti-inflammatory cytokines. Therefore, we examined whether such dual messages are encrypted in CD40L. As such message encryption was never investigated, we hypothesized that mutation of certain amino acid residues should in principle enhance pro-inflammatory cytokine production whereas mutation of some others would enhance anti-inflammatory cytokine secretion. We mutated six such residues, which were previously showed to participate in CD40L function. Here, we report that the mutant CD154 129E→V was superior to the wild-type CD154 in killing of Leishmania donovani, induction of inducible nitric oxide synthase (iNOS) and production of IL-12 and relative phosphorylation of p38MAPK and ERK-1/2 in PBMC-derived macrophages. By contrast, 128S→V promoted L. donovani survival, reducing iNOS, but increasing IL-10 expression and predominant ERK-1/2 phosphorylation. The mutant 144G→V did not have significant effects. Other mutants (142E→V, 143K→A, 145Y→F) mimicked the wild-type CD154. Molecular dynamics simulation suggested that these mutations induced differential conformational changes in the CD40-CD154 complex. Therefore, assortment of the contrasting messages encrypted in a given ligand performing counteractive functions presents a novel fundamental biological principle that can be used for devising various therapies. Copyright © 2015. Published by Elsevier Inc.

  13. Fast and Selective Preconcentration of Europium from Wastewater and Coal Soil by Graphene Oxide/Silane@Fe3O4 Dendritic Nanostructure. (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K


    In this study, nanocomposite of graphene oxide and silane modified magnetic nanoparticles (silane@Fe3O4) were synthesized in a form of dendritic structure. For this, silane@Fe3O4 nanoparticle gets sandwiched between two layers of graphene oxide by chemical synthesis route. The synthesized dendritic structure was used as a monomer for synthesis of europium ion imprinted polymer. The synthesis of imprinted polymer was contemplated onto the surface of the vinyl group modified silica fiber by activated generated free radical atom-transfer radical polymerization, that is, AGET-ATRP technique. The synthesized dendritic monomer was characterized by XRD, FT-IR, VSM, FE-SEM, and TEM analyses. The imprinted polymer modified silica fiber was first validated in the aqueous and blood samples for successful extraction and detection of europium ion with limit of detection = 0.050 pg mL(-1) (signal/noise = 3). The imprinted polymer modified silica fiber was also used for preconcentration and separation of europium metal ion from various soil samples of coal mine areas. However, the same silica fiber was also used for wastewater treatment and shows 100% performance for europium removal. The findings herein suggested that dendritic nanocomposite could be potentially used as a highly effective material for the enrichment and preconcentration of europium or other trivalent lanthanides/actinides in nuclear waste management.

  14. 46 CFR 154.1836 - Vapor venting as a means of cargo tank pressure and temperature control. (United States)


    ... LIQUEFIED GASES Operations § 154.1836 Vapor venting as a means of cargo tank pressure and temperature... temperature control. 154.1836 Section 154.1836 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... cargo pressure and temperature control system under §§ 154.701 through 154.709 is operating and that...

  15. ZNT7 binds to CD40 and influences CD154-triggered p38 MAPK activity in B lymphocytes-a possible regulatory mechanism for zinc in immune function (United States)

    Zinc deficiency impairs immune system leading to frequent infections. Although it is known that zinc plays critical roles in maintaining healthy immune function, the underlying molecular targets are largely unknown. In this study, we showed that zinc is important for the CD154-CD40-mediated activati...

  16. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  17. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates (United States)

    Bicho, Rita C.; Soares, Amadeu M. V. M.; Nogueira, Helena I. S.; Amorim, Mónica J. B.


    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of "no effect" are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  18. Spectral Interferences Manganese (Mn) - Europium (Eu) Lines in X-Ray Fluorescence Spectrometry Spectrum (United States)

    Tanc, Beril; Kaya, Mustafa; Gumus, Lokman; Kumral, Mustafa


    X-ray fluorescence (XRF) spectrometry is widely used for quantitative and semi quantitative analysis of many major, minor and trace elements in geological samples. Some advantages of the XRF method are; non-destructive sample preparation, applicability for powder, solid, paste and liquid samples and simple spectrum that are independent from chemical state. On the other hand, there are some disadvantages of the XRF methods such as poor sensitivity for low atomic number elements, matrix effect (physical matrix effects, such as fine versus course grain materials, may impact XRF performance) and interference effect (the spectral lines of elements may overlap distorting results for one or more elements). Especially, spectral interferences are very significant factors for accurate results. In this study, semi-quantitative analyzed manganese (II) oxide (MnO, 99.99%) was examined. Samples were pelleted and analyzed with XRF spectrometry (Bruker S8 Tiger). Unexpected peaks were obtained at the side of the major Mn peaks. Although sample does not contain Eu element, in results 0,3% Eu2O3 was observed. These result can occur high concentration of MnO and proximity of Mn and Eu lines. It can be eliminated by using correction equation or Mn concentration can confirm with other methods (such as Atomic absorption spectroscopy). Keywords: Spectral Interferences; Manganese (Mn); Europium (Eu); X-Ray Fluorescence Spectrometry Spectrum.

  19. Performance of fluorescent europium(III) nanoparticles and colloidal gold reporters in lateral flow bioaffinity assay. (United States)

    Juntunen, Etvi; Myyryläinen, Tiina; Salminen, Teppo; Soukka, Tero; Pettersson, Kim


    Lateral flow (LF) immunoassays (i.e., immunochromatographic assays) have traditionally been applied to analytes that do not require very high analytical sensitivity or quantitative results. The selection of potential analytes is often limited by the performance characteristics of the assay technology. Analytes with more demanding sensitivity requirements call for reporter systems enabling high analytical sensitivity. In this study, we systematically compared the performance of fluorescent europium(III) [Eu(III)] chelate dyed polystyrene nanoparticles and colloidal gold particles in lateral flow assays. The effect of time-resolved measurement mode was also studied. Because binder molecules used in immunoassays might not behave similarly when conjugated to different reporter particles, two model assays were constructed to provide reliable technical comparison of the two reporter systems. The comparative experiment demonstrated that the fluorescent nanoparticles yielded 7- and 300-fold better sensitivity compared with colloidal gold in the two test systems, respectively. Although the two reporter particles may induce variable effects using individual binders, overall the high specific activity of Eu(III) nanoparticles has superior potential over colloidal gold particles for the development of robust high-sensitivity bioaffinity assays. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Carbon nanotube-loaded Nafion film electrochemical sensor for metal ions: europium. (United States)

    Wang, Tingting; Zhao, Daoli; Guo, Xuefei; Correa, Jaime; Riehl, Bill L; Heineman, William R


    A Nafion film loaded with novel catalyst-free multiwalled carbon nanotubes (MWCNTs) was used to modify a glassy carbon (GC) electrode to detect trace concentrations of metal ions, with europium ion (Eu(3+)) as a model. The interaction between the sidewalls of MWCNTs and the hydrophobic backbone of Nafion allows the MWCNTs to be dispersed in Nafion, which was then coated as a thin film on the GC electrode surface. The electrochemical response to Eu(3+) was found to be ∼10 times improved by MWCNT concentrations between 0.5 and 2 mg/mL, which effectively expanded the electrode surface into the Nafion film and thereby reduced the diffusion distance of Eu(3+) to the electrode surface. At low MWCNT concentrations of 0.25 and 0.5 mg/mL, no significant improvement in signal was obtained compared with Nafion alone. Scanning electron microscopy and electrochemical impedance spectroscopy were used to characterize the structure of the MWCNT-Nafion film, followed by electrochemical characterization with Eu(3+) via cyclic voltammetry and preconcentration voltammetry. Under the optimized conditions, a linear range of 1-100 nM with a calculated detection limit of 0.37 nM (signal/noise = 3) was obtained for determination of Eu(3+) by Osteryoung square-wave voltammetry after a preconcentration time of 480 s.

  1. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Energy Technology Data Exchange (ETDEWEB)

    Bicho, Rita C., E-mail:; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)


    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.


    Directory of Open Access Journals (Sweden)

    R. O. Pysh'ev


    Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.

  3. Nanoparticles in the zirconia-europium niobate system via hydrothermal route. (United States)

    Hirano, Masanori; Dozono, Hayato


    The effect of the composition on the hydrothermal formation, structure, and properties of nanocrystalline luminescent materials in the zirconia (ZrO2)-europium niobate 1/4(Eu3NbO7) system was investigated. In the composition range 40 particles with crystallite size 6.0-7.6 nm that were hydrothermally formed from the precursor solutions of NbCl5, ZrOCI2, and EuCl3 under weakly basic conditions at 240 degrees C showed cubic structure. The lattice parameter when estimated as a single cubic phase linearly decreased as the concentration of ZrO2 increased. The presence of zirconia component effectively promoted the formation of nanocrystals containing the niobate, Eu3NbO7 under hydrothermal condition. The nanocrystalline particles could be excited by ultraviolet light 395 nm (f-f transition) and emitted orange (590 nm) and red light (610 nm) corresponding to 5D0 --> 7F1 and 5D0 --> 7F2 transitions of Eu3+, respectively. The intensity of the electric dipole transition (5D0 --> 7F2) that was expressed in values relative to the magnetic dipole transition (5D0 --> 7F1) increased with increased heat-treatment temperature in the range from 950 to 1200 degrees C.

  4. Photoluminescence of monocrystalline and stain-etched porous silicon doped with high temperature annealed europium

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Lemus, R; Montesdeoca-Santana, A; Gonzalez-Diaz, B; Diaz-Herrera, B; Hernandez-Rodriguez, C; Jimenez-Rodriguez, E [Departamento de Fisica Basica, Universidad de La Laguna (ULL), Avenida AstrofIsico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain); Velazquez, J J, E-mail: [Departamento de Fisica Fundamental y Experimental, Electronica y Sistemas, Universidad de La Laguna (ULL), Avenida Astrofisico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain)


    In this work, for the first time, the photoluminescent emission and excitation spectra of non-textured layers and stain-etched porous silicon layers (PSLs) doped with high temperature annealed europium (Eu) are evaluated. The PSLs are evaluated as a host for rare earth ions and as an antireflection coating. The applied doping process, which consists in a simple impregnation method followed by a high-temperature annealing step, is compatible with the standard processes in the fabrication of solar cells. The results show down-shifting processes with a maximum photoluminescent intensity at 615 nm, related to the transition {sup 5}D{sub 0} {yields} {sup 7}F{sub 2}. Different initial concentrations of Eu(NO{sub 3}){sub 3} are evaluated to study the influence of the rare earth concentration on the photoluminescent intensity. The chemical composition and the morphology of Eu-doped PSLs are examined by means of x-ray dispersion spectroscopy, Fourier-transform infrared spectroscopy and scanning electron microscopy. These Eu-doped layers are considered to be applied as energy converters in silicon-based third generation solar cells.

  5. Europium (III) and Uranium (VI) complexation by natural organic matter (NOM): Effect of source. (United States)

    Kautenburger, Ralf; Sander, Jonas M; Hein, Christina


    For the safe long-term storage of high-level radioactive waste (HLW), detailed information about geo-chemical behavior of radioactive and toxic metal ions under environmental conditions is important. Natural organic matter (NOM) can play a crucial role in the immobilization or mobilization of these metal ions due to its complexation and colloid formation tendency. In this study, the complexation of europium (as chemical homologue of trivalent actinides such as americium) and uranium (as main component of HLW) by ten humic acids (HA) from different sources and Suwannee NOM river extract has been analyzed. Capillary electrophoresis in combination with inductively coupled plasma mass spectrometry has been used for the evaluation of complex stability constants log β. In order to determine the complex stability constants a conservative single site model was used in this study. In dependence of their source and thus of NOM structure the log β values for the analyzed humic acids are in the range of 6.1-7.0 for Eu(III) and 5.2-6.4 for U(VI) (UO 2 2+ ), respectively. In contrast to the results for HA the used Suwannee river NOM reveals log β values in the range of nearly two orders of magnitude lower (4.6 for Eu 3+ and 4.5 for UO 2 2+ ) under the geochemical conditions applied in this study. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Europium incorporated into titanium oxide by the sol-gel method

    Directory of Open Access Journals (Sweden)

    Lucas Alonso Rocha


    Full Text Available In this work titanium sol was prepared from tetraethylorthotitanate (TEOT in ethanol, stabilized with beta-diketonate 2,4 pentanedione in molar ratio 1:1 homogenized by magnetic stirring, europium ion was add as structural probe. The xerogels were heat treated at 500, 750 and 1000 °C and the characterization was realized by x-ray diffraction (XRD, transmission electron microscopy (TEM, thermogravimetric analysis (TGA/DSC and photoluminescence (PL. The excitation spectra of Eu (III ion present maximum in 394 nm correspondent to 5L6 level and emission spectra present bands characteristic transitions arising from the 5 D0 -> 7F J (J = 0, 1, 2, 3, 4 manifolds to samples treat at 500 and 750 °C. The Eu (III emission disappear, when heated at 1000 °C, probably due to phase transition anatase to rutile and migrations of ions to the external surface that was proved by x-ray diffraction, transmission electronic microscopy and the thermogravimetric analyses of xerogels.

  7. Luminescence studies on the europium doped strontium metasilicate phosphor prepared by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available Europium doped strontium meta-silicate (namely SrSiO3:Eu3+ phosphor was prepared by a high temperature solid state reaction method. The sintered SrSiO3:Eu3+ phosphor possesses a monoclinic structure by the XRD. Energy dispersive X-ray spectrum (EDS confirms the presence of elements in the desired sample. Thermoluminescence (TL kinetic parameters such as activation energy (E, order of kinetics (b, and frequency factor (s were calculated by the peak shape method. The orange–red emission was shown to originate from the 5D0–7FJ (J = 0, 1, 2, 3, 4 transitions of Eu3+ ions as the sample was excited at 396 nm. The SrSiO3:Eu3+ phosphor with almost pure orange-red color purity (99.62% shows the quantum efficiency of 10.2% (excited by 396 nm, which is higher than those of commercial red phosphors Y2O3:Eu3+ and Y2O2S:Eu3+ with quantum efficiencies of 9.6% (excited by 394 nm and 4.2% (excited by 395 nm, respectively. Mechanoluminescence (ML intensity of the SrSiO3:Eu3+ phosphor was also found to increase linearly with increasing the impact velocity of the moving piston, suggesting that the discussed phosphor can be used as a stress sensor.

  8. Europium Luminescence Used for Logic Gate and Ions Sensing with Enoxacin As the Antenna. (United States)

    Lu, Lixia; Chen, Chuanxia; Zhao, Dan; Sun, Jian; Yang, Xiurong


    Luminescent lanthanide ion complexes have received increasing attention because of their unique optical properties. Herein, we discovered that the luminescence of europium(III) (Eu(3+)) could be regulated by Ag(+) and SCN(-) in seconds with enoxacin (ENX) as the antenna. Under given conditions, only the simultaneous introduction of Ag(+) and SCN(-) could remarkably enhance the luminescence intensity of Eu(3+)-ENX complexes. This phenomenon has been exploited to design an "AND" logic gate and specific luminescence turn-on assays for sensitively sensing Ag(+) and SCN(-) for the first time. Furthermore, the addition of S(2-) resulted in efficient luminescence quenching of the Eu(3+)/ENX/Ag(+)/SCN(-) system due to the strong affinity between Ag(+) and S(2-). Thus, a new luminescent sensing platform for S(2-) was established, which exhibited excellent selectivity and high sensitivity. S(2-) could be detected within the concentration range of 100 nM to 12.5 μM with a detection limit of 60 nM. Such sensing system features simplicity, rapidity, and flexibility. Moreover, this proposed Eu(3+)-based luminescent assay could be successfully applied in the real environmental water sample analysis.

  9. Radiation effects on beta 10.6 of pure and europium doped KCl (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.


    Changes in the optical absorption coefficient as a result of X-ray and electron bombardment of pure KCl (monocrystalline and polycrystalline), and divalent europium doped polycrystalline KCl were determined. The optical absorption coefficients were measured by a constant heat flow calorimetric method. Both 300 KV X-irradiation and 2 MeV electron irradiation produced significant increases in beta 10.6, measured at room temperature. The X-irradiation of pure moncrystalline KCl increased beta 10.6 by 0.005/cm for a 113 MR dose. For an equivalent dose, 2 MeV electrons were found less efficient in changing beta 10.6. However, electron irradiation of pure and Eu-doped polycrystalline KCl produced marked increases in adsorption. Beta increased to over 0.25/cm in Eu-doped material for a 30 x 10 to the 14th power electrons/sq cm dose, a factor of 20 increase over unirradiated material. Moreover, bleaching the electron irradiated doped KCl with 649 m light produced and additional factor of 1.5 increase. These findings will be discussed in light of known defect-center properties in KCl.

  10. Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods. (United States)

    Wei, Peng-Fei; Zhang, Li; Nethi, Susheel Kumar; Barui, Ayan Kumar; Lin, Jun; Zhou, Wei; Shen, Yi; Man, Na; Zhang, Yun-Jiao; Xu, Jing; Patra, Chitta Ranjan; Wen, Long-Ping


    Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. High-resolution Thermal Micro-imaging Using Europium Chelate Luminescent Coatings. (United States)

    Benseman, Timothy M; Hao, Yang; Vlasko-Vlasov, Vitalii K; Welp, Ulrich; Koshelev, Alexei E; Kwok, Wai-Kwong; Divan, Ralu; Keiser, Courtney; Watanabe, Chiharu; Kadowaki, Kazuo


    Micro-electronic devices often undergo significant self-heating when biased to their typical operating conditions. This paper describes a convenient optical micro-imaging technique which can be used to map and quantify such behavior. Europium thenoyltrifluoroacetonate (EuTFC) has a 612 nm luminescence line whose activation efficiency drops strongly with increasing temperature, due to T-dependent interactions between the Eu3+ ion and the organic chelating compound. This material may be readily coated on to a sample surface by thermal sublimation in vacuum. When the coating is excited with ultraviolet light (337 nm) an optical micro-image of the 612 nm luminescent response can be converted directly into a map of the sample surface temperature. This technique offers spatial resolution limited only by the microscope optics (about 1 micron) and time resolution limited by the speed of the camera employed. It offers the additional advantages of only requiring comparatively simple and non-specialized equipment, and giving a quantitative probe of sample temperature.

  12. In vivo synthesis of europium selenide nanoparticles and related cytotoxicity evaluation of human cells. (United States)

    Kim, Eun Bee; Seo, Ji Min; Kim, Gi Wook; Lee, Sang Yup; Park, Tae Jung


    Nanotechnology strives to combine new materials for development of noble nanoparticles. As the nanoparticles exhibit unique optical, electronic, and magnetic properties depending on their composition, developing safe, cost-effective and environmentally friendly technologies for the synthesis have become an important issue. In this study, in vivo synthesis of europium selenide (EuSe) nanoparticles was performed using recombinant Escherichia coli cells expressing heavy-metal binding proteins, phytochelatin synthase and metallothionein. The formation of EuSe nanoparticles was confirmed by using UV-vis spectroscopy, spectrofluorometry, X-ray diffraction, energy dispersive X-ray and transmission electron microscopy. The synthesized EuSe nanoparticles exhibited high fluorescence intensities as well as strong magnetic properties. Furthermore, anti-cancer effect of EuSe nanoparticles against cancer cell lines was investigated. This strategy for the biogenic synthesis of nanoparticles has a great potential as bioimaging tools and drug carrying agents in biomedical fields due to its simplicity and nontoxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  14. Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes. (United States)

    Taha, Mohamed; Khan, Imran; Coutinho, João A P


    With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Europium(III) DOTA-derivatives having ketone donor pendant arms display dramatically slower water exchange (United States)

    Green, Kayla N.; Viswanathan, Subha; Rojas-Quijano, Federico A.; Kovacs, Zoltan; Sherry, A. Dean


    A series of new 1,4,7,10-tetraazacyclododecane-derivatives having a combination of amide and ketone donor groups as side-arms were prepared and their complexes with europium(III) studied in detail by high resolution NMR spectroscopy. The chemical shift of the Eu3+-bound water resonance, the chemical exchange saturation transfer (CEST) characteristics of the complexes, and the bound water residence lifetimes (τm) were found to vary dramatically with the chemical structure of the side-arms. Substitution of ketone oxygen donor atoms for amide oxygen donor atoms resulted in an increase in residence water lifetimes (τm) and a decrease in chemical shift of the Eu3+-bound water molecule (Δω). These experimental results along with density functional theory (DFT) calculations demonstrate that introduction of weakly donating oxygen atoms in these complexes results in a much weaker ligand field, more positive charge on the Eu3+ ion and an increased water residence lifetime as expected for a dissociative mechanism. These results provide new insights into the design of paramagnetic CEST agents with even slower water exchange kinetics that will make them more efficient for in vivo imaging applications. PMID:21306137

  16. Urinary monitoring of exposure to yttrium, scandium, and europium in male Wistar rats. (United States)

    Kitamura, Yasuhiro; Usuda, Kan; Shimizu, Hiroyasu; Fujimoto, Keiichi; Kono, Rei; Fujita, Aiko; Kono, Koichi


    On the assumption that rare earth elements (REEs) are nontoxic, they are being utilized as replacements of toxic heavy metals in novel technological applications. However, REEs are not entirely innocuous, and their impact on health is still uncertain. In the past decade, our laboratory has studied the urinary excretion of REEs in male Wistar rats given chlorides of europium, scandium, and yttrium solutions by one-shot intraperitoneal injection or oral dose. The present paper describes three experiments for the suitability and appropriateness of a method to use urine for biological monitoring of exposure to these REEs. The concentrations of REEs were determined in cumulative urine samples taken at 0-24 h by inductively coupled plasma atomic emission spectroscopy, showing that the urinary excretion of REEs is <2 %. Rare earth elements form colloidal conjugates in the bloodstream, which make high REEs accumulation in the reticuloendothelial system and glomeruli and low urinary excretion. The high sensitivity of inductively coupled plasma-argon emission spectrometry analytical methods, with detection limits of <2 μg/L, makes urine a comprehensive assessment tool that reflects REE exposure. The analytical method and animal experimental model described in this study will be of great importance and encourage further discussion for future studies.

  17. Europium Luminescence: Electronic Densities and Superdelocalizabilities for a Unique Adjustment of Theoretical Intensity Parameters (United States)

    Dutra, José Diogo L.; Lima, Nathalia B. D.; Freire, Ricardo O.; Simas, Alfredo M.


    We advance the concept that the charge factors of the simple overlap model and the polarizabilities of Judd-Ofelt theory for the luminescence of europium complexes can be effectively and uniquely modeled by perturbation theory on the semiempirical electronic wave function of the complex. With only three adjustable constants, we introduce expressions that relate: (i) the charge factors to electronic densities, and (ii) the polarizabilities to superdelocalizabilities that we derived specifically for this purpose. The three constants are then adjusted iteratively until the calculated intensity parameters, corresponding to the 5D0→7F2 and 5D0→7F4 transitions, converge to the experimentally determined ones. This adjustment yields a single unique set of only three constants per complex and semiempirical model used. From these constants, we then define a binary outcome acceptance attribute for the adjustment, and show that when the adjustment is acceptable, the predicted geometry is, in average, closer to the experimental one. An important consequence is that the terms of the intensity parameters related to dynamic coupling and electric dipole mechanisms will be unique. Hence, the important energy transfer rates will also be unique, leading to a single predicted intensity parameter for the 5D0→7F6 transition.

  18. Structural and spectroscopic analyses of europium doped yttrium oxyfluoride powders prepared by combustion synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Rakov, Nikifor [PG-Ciência dos Materiais, Universidade Federal do Vale do São Francisco, 48902-300 Juazeiro, BA (Brazil); Guimarães, R. B.; Maciel, Glauco S. [Instituto de Física, Universidade Federal Fluminense, 24210-346 Niterói, RJ (Brazil); Lozano B, W. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    A facile widely spread technique employed to produce low-cost high-yield oxide powders, combustion synthesis, was used to prepare yttrium oxyfluoride crystalline ceramic powders. The structure of the powders was analyzed by X-ray powder diffraction and Rietveld refinement. Samples heat treated at 700 °C had a predominance of vernier orthorhombic Y{sub 6}O{sub 5}F{sub 8} phase, while samples heat treated at 800 °C crystallized in stoichiometric rhombohedral YOF phase. The samples were doped with luminescent europium trivalent ions (Eu{sup 3+}) in different concentrations (1–15 wt.%) and Judd-Ofelt theory was used to probe the distortion from the inversion symmetry of the local crystal field and the degree of covalency between the rare-earth ion and the surrounding ligands. The luminescence lifetime was measured and the luminescence quantum efficiency (LQE) was estimated. We observed that Eu{sup 3+}:Y{sub 6}O{sub 5}F{sub 8} samples presented higher LQE in spite of the larger local crystal field anisotropy found for Eu{sup 3+}:YOF samples.

  19. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation


    Ali H. Charafeddine; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.


    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by ...

  20. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events


    Benslimane, Nadir,; Hassan, Ghada,; Yacoub, Daniel; Mourad, Walid,


    International audience; Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressi...

  1. Vaccination Produces CD4 T Cells with a Novel CD154-CD40-Dependent Cytolytic Mechanism. (United States)

    Coler, Rhea N; Hudson, Thomas; Hughes, Sean; Huang, Po-Wei D; Beebe, Elyse A; Orr, Mark T


    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust Th1 responses to a variety of vaccine Ags and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein Ag and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly, these in vivo CTLs were CD4 T cells, not CD8 T cells, and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs, the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the Fas ligand-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40L) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs, which kill through a previously unknown CD154-dependent mechanism. Copyright © 2015 by The American Association of Immunologists, Inc.

  2. 46 CFR 154.1015 - Lighting in gas-dangerous space. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Lighting in gas-dangerous space. 154.1015 Section 154... Equipment Electrical § 154.1015 Lighting in gas-dangerous space. (a) Each gas-dangerous space that has... protective device for any lighting circuit that is in a gas-dangerous space must open each conductor of the...

  3. 46 CFR 154.706 - Cargo boil-off as fuel: Fuel lines. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo boil-off as fuel: Fuel lines. 154.706 Section 154... Equipment Cargo Pressure and Temperature Control § 154.706 Cargo boil-off as fuel: Fuel lines. (a) Gas fuel lines must not pass through accommodation, service, or control spaces. Each gas fuel line passing...

  4. 29 CFR 780.154 - Delivery “to market.” (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false Delivery âto market.â 780.154 Section 780.154 Labor... of Agriculture Specified Delivery Operations § 780.154 Delivery “to market.” The term “delivery * * * to market” includes taking agricultural or horticultural commodities, dairy products, livestock, bees...

  5. 46 CFR 154.300 - Segregation of hold spaces from other spaces. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from other spaces. 154.300 Section 154.300 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.300 Segregation of hold spaces from other spaces. Hold spaces must be...

  6. 46 CFR 154.305 - Segregation of hold spaces from the sea. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from the sea. 154.305 Section 154.305 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.305 Segregation of hold spaces from the sea. In vessels having cargo...

  7. 37 CFR 1.54 - Parts of application to be filed together; filing receipt. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Parts of application to be filed together; filing receipt. 1.54 Section 1.54 Patents, Trademarks, and Copyrights UNITED STATES... Processing Provisions The Application § 1.54 Parts of application to be filed together; filing receipt. (a...

  8. M1 spin strength distribution in [sup 154]Sm

    Energy Technology Data Exchange (ETDEWEB)

    Sarriguren, P.; Guerra, E.M. de (Consejo Superior de Investigaciones Cientificas, Madrid (Spain). Inst. Estructura de la Materia); Nojarov, R.; Faessler, Amand (Tuebingen Univ. (Germany). Inst. fuer Theoretische Physik)


    The effect of the residual spin-spin interaction on the M1 spin-flip strength distribution in [sup 154]Sm is studied within the quasi-particle random phase approximation. The double-peaked structure found experimentally is reproduced. A new interpretation for the origin of the two peaks emerges from an analysis of our results. We identify these peaks as isoscalar and isovector and discuss previous theoretical interpretations. (Author).

  9. Sorption behavior of cesium, cobalt and europium radionuclides onto hydroxyl magnesium silicate

    Energy Technology Data Exchange (ETDEWEB)

    Hamed, Mostafa M.; Holiel, M.; Ahmed, I.M. [Atomic Energy Authority, Cairo (Egypt). Hot Laboratories and Waste Management Center


    The radioactive wastes from different activities have to be safely disposed of and isolated from the human environment. The retardation of radioactive materials by designed barriers is originally controlled by the sorption ability of the mineral compositions. In this work, a naturally available mineral composite, a hydroxyl magnesium silicate (HMS) was investigated as potential natural inorganic sorbent for the retention of long-lived radionuclides ({sup 134}Cs, {sup 60}Co and {sup 152+154}Eu) from aqueous solutions. The factors affecting the sorption process, such as contact time and pH were evaluated. Furthermore X-ray fluorescence (XRF), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), X-ray diffraction (XRD), differential thermal and thermogravimetry analyses (DTA/TGA) measurements were examined in order to assess the physicochemical properties of the magnesium silicate mineral. Langmuir and Freundlich isotherms fitted the result s substantially better than the Flory-Huggins isotherm and the sorption was found to follow pseudo-first order kinetic model. The proposed mineral has been successfully applied for the sorption of {sup 134}Cs, {sup 60}Co and {sup 152+154}Eu radionuclides from real radioactive waste. The results indicated that about 97.4-99% of {sup 134}Cs, {sup 60}Co and {sup 152+154}Eu radionuclides were efficiently retained onto the HMS mineral. Based on the results obtained, it can be concluded that the HMS mineral is an economic and efficient retaining material for environmental hazardous migration and/or leakage of some radionuclides such as {sup 134}Cs, {sup 60}Co and {sup 152+154}Eu and trivalent actinide ({sup 241}Am, {sup 242m}Am and {sup 243}Am) ions. Therefore, this study could be used as a starting point to establish and consider that mineral as an engineered barrier around the disposal facilities at the nuclear activity centres.

  10. Synthesis, photophysics, electrochemistry, thermal stability and electroluminescent performances of a new europium complex with bis(β-diketone) ligand containing carbazole group. (United States)

    Liu, Jian; Liang, Quan-Bin; Wu, Hong-Bin


    We synthesized a new europium complex [Eu(ecbpd)3 (Phen)] with bis(β-diketone) ligand containing a carbazole group, in which ecbpd and Phen are dehydro-3,3'-(9-ethyl-9H-carbazole-3,6-diyl)bis(1-phenylpropane-1,3-dione) and 1,10-phenanthroline, respectively. Its UV/vis and photoluminescent spectra, quantum yield, luminescence lifetime, electrochemistry, thermal stability and electroluminescent performances were studied. This europium complex showed low efficiency luminescence, which is probably due to the mismatching energy levels of its ligand and Eu3+ , as well as the double Eu3+ core resonance. Copyright © 2016 John Wiley & Sons, Ltd.

  11. IL-15 prolongs CD154 expression on human CD4 T cells via STAT5 binding to the CD154 transcriptional promoter


    Lowe, RM; Genin, A; Orgun, N; Cron, RQ


    Activation induced CD154 expression on CD4 T cells is prolonged in systemic lupus erythematosus but the mechanism(s) for its dysregulation are unknown. The studies reported herein demonstrate that IL-15 is capable of prolonging CD154 expression on PHA activated CD4 T cells. Since IL-15 signals through STAT5, predicted STAT5 binding sites in the human CD154 transcriptional promoter were identified, and STAT5 binding to the proximal CD154 promoter in vitro and in vivo following primary CD4 T ce...

  12. Europium (III) PVC membrane sensor based on N-pyridine-2-carboxamido-8-aminoquinoline as a sensing material

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)


    Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.

  13. A novel tridentate bis(phosphinic acid)phosphine oxide based europium(III)-selective Nafion membrane luminescent sensor. (United States)

    Sainz-Gonzalo, F J; Popovici, C; Casimiro, M; Raya-Barón, A; López-Ortiz, F; Fernández, I; Fernández-Sánchez, J F; Fernández-Gutiérrez, A


    A new europium(III) membrane luminescent sensor based on a new tridentate bis(phosphinic acid)phosphine oxide (3) system has been developed. The synthesis of this new ligand is described and its full characterization by NMR, IR and elemental analyses is provided. The luminescent complex formed between europium(III) chloride and ligand 3 was evaluated in solution, observing that its spectroscopic and chemical characteristics are excellent for measuring in polymer inclusion membranes. Included in a Nafion membrane, all the parameters (ligand and ionic additives) that can affect the sensitivity and selectivity of the sensing membrane as well as the instrumental conditions were carefully optimized. The best luminescence signal (λexc = 229.06 nm and λem = 616.02 nm) was exhibited by the sensing film having a Nafion : ligand composition of 262.3 : 0.6 mg mL(-1). The membrane sensor showed a short response time (t95 = 5.0 ± 0.2 min) and an optimum working pH of 5.0 (25 mM acetate buffer solution). The membrane sensor manifested a good selectivity toward europium(III) ions with respect to other trivalent metals (iron, chromium and aluminium) and lanthanide(III) ions (lanthanum, samarium, terbium and ytterbium), although a small positive interference of terbium(III) ions was observed. It provided a linear range from 1.9 × 10(-8) to 5.0 × 10(-6) M with a very low detection limit (5.8 × 10(-9) M) and sensitivity (8.57 × 10(-7) a.u. per M). The applicability of this sensing film has been demonstrated by analyzing different kinds of spiked water samples obtaining recovery percentages of 95-97%.

  14. A Responsive Europium(III) Chelate that Provides a Direct Readout of pH by MRI (United States)

    Wu, Yunkou; Soesbe, Todd C.; Kiefer, Garry E.; Zhao, Piyu; Sherry, A. Dean


    A europium(III) DO3A-tris(amide) complex is reported for imaging pH by MRI using ratiometric CEST principles. Deprotonation of a single phenolic proton between pH 6 and 7.6 results in an ~5 ppm shift in the water exchange CEST peak that is easily detected by MRI. Collection of two CEST images at two slightly different activation frequencies provides a direct readout of solution pH without the need of a concentration marker. PMID:20853833

  15. Identification and characterization of functional CD154 (CD40 ligand) in the Pekin duck. (United States)

    Fischer, Karl P; Gares, Sheryl L; Wang, Dakun; Lorne Tyrrell, D; Gutfreund, Klaus S


    Binding of CD154, a member of the TNF ligand superfamily, to its receptor CD40 is essential for the development and regulation of adaptive immune responses in mammals. The duck CD154 (DuCD154) encoding gene was isolated from activated splenocytes using RT-PCR. Sequence analysis of the cloned DuCD154 gene revealed an open reading frame of 819 base pairs encoding a 272 amino acid protein. The extracellular domain of DuCD154 was identified and expressed for characterization and generation of antibodies. DuCD154 mRNA was predominantly expressed in spleen, thymus and duodenum. DuCD154 protein generated in cell culture was secreted and formed dimers. DuCD154 markedly enhanced proliferative responses in duck splenocytes when used alone or in conjunction with LPS or PHA. These observations suggest that DuCD154 has functional equivalence with mammalian CD154 and that the central role of CD154 as an immunoregulatory protein had already evolved before the divergence of birds and mammals.

  16. Allospecific CD154 + T-cytotoxic memory cells as potential surrogate for rejection risk in pediatric intestine transplantation. (United States)

    Sindhi, Rakesh; Ashokkumar, Chethan; Higgs, Brandon W; Gilbert, P B; Sun, Qing; Ranganathan, Sarangarajan; Jaffe, Ron; Snyder, Sara; Ningappa, Mylarappa; Soltys, Kyle A; Bond, Geoffrey J; Mazariegos, George V; Abu-Elmagd, Kareem; Zeevi, Adriana


    Clinical end-points dictate large trial enrollments and exclude children with the rare intestine transplant procedure (ITx), who experience higher drug-related morbidity. We evaluate the novel rejection-risk parameter, allo-(antigen)-specific CD154 + TcMs (i) as surrogates for ACR using Prentice's criteria, (ii) for association with immunosuppression targets to determine Fleming's surrogate end-point designation, and (iii) as time-to-event end-point in a simulated comparison of alemtuzumab (NCT#01208337, n = 14) and rabbit anti-human thymocyte globulin (rATG, n = 16) among 30 children with ITx. CD154 + TcM were measured in MLR before, and at 1-60 and 61-200 days after ITx (NCT#01163578). CD154 + TcM correlate significantly with rejection severity (Spearman r = 0.685, p = 2.03E-5) and associate with biopsy-proven ITx rejection with sensitivity/specificity of 94%/84% [corrected] independent of immunosuppressant. Previously stated sensitivity of 90% is incorrect. [corrected]. The rejection-risk threshold of CD154 + TcM resolves rapidly in 200-day follow-up (46 ± 20 vs. 158 ± 59 days, p = 0.009, K-M) with alemtuzumab, which demonstrates lower 90-day ACR incidence (50% vs. 69%, p=NS, Fisher's exact), and is associated with accelerated prednisone minimization to ≤2.5 mg/day, compared with rATG (120 ± 28 vs. 180 ± 30 days, p = 0.027, K-M). As a surrogate end-point, time-to-rejection-risk resolution measured with CD154 + TcM portends 50% reduction in sample sizes in a simulated trial of alemtuzumab vs. rATG. Rejection-risk assessment with CD154 + TcM may enable informed immunosuppression minimization, and preliminary efficacy comparisons in pediatric ITx. © 2011 John Wiley & Sons A/S.

  17. Spectroscopic properties and luminescence behaviour of europium doped lithium borate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Anjaiah, J., E-mail: [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Department of Physics, Geethanjali College of Engineering and Technology, Keesara, RR Dist., Hyderabad 501 301 (India); Laxmikanth, C. [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Veeraiah, N. [Department of Physics, Acharya Nagarjuna University, Nagarjuna Nagar, Guntur 522 510, AP. (India)


    Li{sub 2}O–MO–B{sub 2}O{sub 3} (MO=ZnO, CaO and CdO) glasses doped with europium are prepared by using the melt quenching technique to study their absorption and luminescence properties to understand their lasing potentialities. The XRD pattern of the glasses confirmed the amorphous nature and the IR spectra reveal the presence of BO{sub 3} and BO{sub 4} units in the glass network. Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) are evaluated from the intensities of various absorption bands of optical absorption spectra. The J–O parameters have been used to calculate transition probabilities (A), lifetime (τ{sub R}), branching ratios (β{sub R}) and stimulated emission cross-section (σ{sub P}) for the {sup 5}D{sub 0}→{sup 7}F{sub J} (J=1–4) transitions of the Eu{sup 3+} ions. The decay from the {sup 5}D{sub 0} level of Eu{sup 3+} ions in these glasses has been measured and analysed. Branching ratios and stimulated emission cross-sections measured for all these glasses show that the {sup 5}D{sub 0}→{sup 7}F{sub 1} transition under investigation has the potential for laser applications. The high stimulated emission cross-section and branching ratios from the present glasses suggests their potential for infra red lasers. The study of the thermoluminescence is also carried out and the data suggests that the CdBEu glass is suitable for thermoluminescence emission output among the three Eu{sup 3+} doped glasses.

  18. Size-dependent cytotoxicity of europium doped NaYF{sub 4} nanoparticles in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang, E-mail:; Zhang, Jinchao, E-mail:


    Lanthanide-doped sodium yttrium fluoride (NaYF{sub 4}) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF{sub 4} (NaYF{sub 4}:Eu{sup 3+}) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF{sub 4}:Eu{sup 3+} nanoparticles with three diameters have been synthesized. • NaYF{sub 4}:Eu{sup 3+} nanoparticles could be uptaken by endothelial cells (ECs). • NaYF{sub 4}:Eu{sup 3+} nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF{sub 4}:Eu{sup 3+} nanoparticles may be important to their toxicology effect.

  19. Two-dimensional high spatial-resolution dosimeter using europium doped potassium chloride: a feasibility study (United States)

    Li, H. Harold; Driewer, Joseph P.; Han, Zhaohui; Low, Daniel A.; Yang, Deshan; Xiao, Zhiyan


    Recent research has shown that KCl:Eu2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had completed been incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl-) centers were the electron storage centers post×ray irradiation and that Eu2+ cations acted as luminescence centers in the photostimulation process. The 150-µm thick casted KCl:Eu2+ SPF showed sub-millimeter spatial resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu2+ and 80% low Z polymer binder exhibited almost no energy dependence in a 6 MV beam. KCl:Eu2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl’s intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu2+ based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. PMID:24651448

  20. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay (United States)

    Shen, Yifeng; Xu, Shaohan; He, Donghua


    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0) respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5μg/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145μg/L). We propose that it can fulfill clinical applications. PMID:26056826

  1. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay.

    Directory of Open Access Journals (Sweden)

    Yifeng Shen

    Full Text Available A novel europium ligand 2,2',2'',2'''-(4,7-diphenyl-1,10-phenanthroline-2,9-diyl bis (methylene bis (azanetriyl tetra acetic acid (BC-EDTA was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm. It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0 respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5 μg/L. It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA reagents (0.2-145 μg/L. We propose that it can fulfill clinical applications.

  2. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  3. Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)


    Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)

  4. Phase Transitions above the Yrast Line in {sup 154}Dy

    Energy Technology Data Exchange (ETDEWEB)

    Ma, W. C. [Mississippi State University, Mississippi State, Mississippi 39762 (United States); Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid, (Spain); Khoo, T. L. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Egido, J. L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid, (Spain); Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Bhattacharyya, P. [Purdue University, West Lafayette, Indiana 47907 (United States); Carpenter, M. P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Daly, P. J. [Purdue University, West Lafayette, Indiana 47907 (United States); Grabowski, Z. W. [Purdue University, West Lafayette, Indiana 47907 (United States)] (and others)


    Spectra of the E2 quasicontinuum {gamma} rays feeding different spin regions of the {sup 154}Dy yrast line have been extracted. These are compared with corresponding theoretical spectra obtained by numerical simulations based on temperature-dependent Hartree-Fock theory, with thermal shape fluctuations. In this manner, different regions of the spin-energy plane can be examined. The results support the predictions of a smeared-out phase transition at high spin above the yrast line. (c) 2000 The American Physical Society.

  5. Synthesis and characterization of barium titanate, doped with europium and neodymium; Sintese e caracterizacao de titanato de bario, dopados com europio e neodimio

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica


    This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.

  6. Stability constants of the Europium complexes with the chloride ions; Constantes de estabilidad de los complejos del europio con los iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)


    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  7. LA-ICP-MS Allows Quantitative Microscopy of Europium-Doped Iron Oxide Nanoparticles and is a Possible Alternative to Ambiguous Prussian Blue Iron Staining. (United States)

    Scharlach, Constantin; Müller, Larissa; Wagner, Susanne; Kobayashi, Yuske; Kratz, Harald; Ebert, Monika; Jakubowski, Norbert; Schellenberger, Eyk


    The development of iron oxide nanoparticles for biomedical applications requires accurate histological evaluation. Prussian blue iron staining is widely used but may be unspecific when tissues contain substantial endogenous iron. Here we tested whether microscopy by laser ablation coupled to inductively coupled plasma mass spectrometry (LA-ICP-MS) is sensitive enough to analyze accumulation of very small iron oxide particles (VSOP) doped with europium in tissue sections. For synthesis of VSOP, a fraction of Fe3+ (5 wt%) was replaced by Eu3+, resulting in particles with 0.66 mol% europium relative to iron (Eu-VSOP) but with otherwise similar properties as VSOP. Eu-VSOP or VSOP was intravenously injected into ApoE-/- mice on Western cholesterol diet and accumulated in atherosclerotic plaques of these animals. Prussian blue staining was positive for ApoE-/- mice with particle injection but also for controls. LA-ICP-MS microscopy resulted in sensitive and specific detection of the europium of Eu-VSOP in liver and atherosclerotic plaques. Furthermore, calibration with Eu-VSOP allowed calculation of iron and particle concentrations in tissue sections. The combination of europium-doped iron oxide particles and LA-ICP-MS microscopy provides a new tool for specific and quantitative analysis of particle distribution at the tissue level and allows correlation with other elements such as endogenous iron.

  8. Novel Time-Resolved Fluorescence Europium Nanoparticle Immunoassay for Detection of Human Immunodeficiency Virus-1 Group O Viruses Using Microplate and Microchip Platforms. (United States)

    Haleyur Giri Setty, Mohan Kumar; Liu, Jikun; Mahtani, Prerna; Zhang, Panhe; Du, Bingchen; Ragupathy, Viswanath; Devadas, Krishnakumar; Hewlett, Indira K


    Accurate detection and quantification of HIV-1 group O viruses have been challenging for currently available HIV assays. We have developed a novel time-resolved fluorescence (TRF) europium nanoparticle immunoassay for HIV-1 group O detection using a conventional microplate enzyme-linked immunosorbent assay (ELISA) and a microchip platform. We screened several antibodies for optimal reactivity with several HIV-1 group O strains and identified antibodies that can detect all the strains of HIV-1 group O that were available for testing. The antibodies were used to develop a conventional ELISA format assay and an in-house developed europium nanoparticle-based assay for sensitivity. The method was evaluated on both microwell plate and microchip platforms. We identified two specific and sensitive antibodies among the six we screened. The antibodies, C65691 and ANT-152, were able to quantify 15 and detect all 17 group O viruses, respectively, as they were broadly cross-reactive with all HIV-1 group O strains and yielded better signals compared with other antibodies. We have developed a sensitive assay that reflects the actual viral load in group O samples by using an appropriate combination of p24 antibodies that enhance group O detection and a highly sensitive TRF-based europium nanoparticle for detection. The combination of ANT-152 and C65690M in the ratio 3:1 was able to give significantly higher signals in our europium-based assay compared with using any single antibody.

  9. Lanthanide-to-lanthanide energy-transfer processes operating in discrete polynuclear complexes: can trivalent europium be used as a local structural probe? (United States)

    Zaïm, Amir; Eliseeva, Svetlana V; Guénée, Laure; Nozary, Homayoun; Petoud, Stéphane; Piguet, Claude


    This work, based on the synthesis and analysis of chemical compounds, describes a kinetic approach for identifying intramolecular intermetallic energy-transfer processes operating in discrete polynuclear lanthanide complexes, with a special emphasis on europium-containing entities. When all coordination sites are identical in a (supra)molecular complex, only heterometallic communications are experimentally accessible and a Tb → Eu energy transfer could be evidenced in [TbEu(L5)(hfac)6] (hfac = hexafluoroacetylacetonate), in which the intermetallic separation amounts to 12.6 Å. In the presence of different coordination sites, as found in the trinuclear complex [Eu3(L2)(hfac)9], homometallic communication can be induced by selective laser excitation and monitored with the help of high-resolution emission spectroscopy. The narrow and non-degenerated character of the Eu((5)D0 ↔ (7)F0) transition excludes significant spectral overlap between donor and acceptor europium cations. Intramolecular energy-transfer processes in discrete polynuclear europium complexes are therefore limited to short distances, in agreement with the Fermi golden rule and with the kinetic data collected for [Eu3(L2)(hfac)9] in the solid state and in solution. Consequently, trivalent europium can be considered as a valuable local structural probe in discrete polynuclear complexes displaying intermetallic separation in the sub-nanometric domain, a useful property for probing lanthanido-polymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide coordinated to europium(III) ions as reliable circularly polarized luminescence calibration standards† (United States)

    Bonsall, Steven D.; Houcheime, Mona; Straus, Daniel A.; Muller, Gilles


    The synthesis of two optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide and the constant circularly polarized luminescence (CPL) activity of their acetonitrile trivalent europium complex solutions over a long period of time open new perspectives for performing accurate routine CPL calibration tests at low cost. PMID:17728891

  11. Photoluminescence behavior of europium (III) complexes containing 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione ligand. (United States)

    Wang, Dunjia; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Zheng, Jing


    Three novel europium complexes with 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione (TNPD) and 2,2-dipyridine (Bipy) or 1,10-phenan-throline (Phen) were synthesized and confirmed by FT-IR, (1)H NMR, UV-vis absorption and elemental analysis. Photoluminescence behavior of complexes Eu(TNPD)3, Eu(TNPD)3·Bipy and Eu(TNPD)3·Phen were investigated in detail. Their emission spectra exhibited the characteristic emission bands that arise from the (5)D0→(7)FJ (J=0-4) transitions of the europium ion in solid state. Meanwhile, the results of their lifetime decay curves indicated that only one chemical environment existed around the europium ion. The intrinsic luminescence quantum efficiency (η) and the experimental intensity parameters (Ωt) of europium complexes were determined according to the emission spectra and luminescence decay curves in solid state. The complex Eu(TNPD)3·Phen showed much longer lifetime (τ) and higher luminescence quantum efficiency (η) than complexes Eu(TNPD)3 and Eu(TNPD)3·Bipy. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  13. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  14. Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles (United States)

    Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.


    The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

  15. A microwave-assisted solution combustion synthesis to produce europium-doped calcium phosphate nanowhiskers for bioimaging applications. (United States)

    Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B


    Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  16. Europium nanoparticle-based simple to perform dry-reagent immunoassay for the detection of hepatitis B surface antigen. (United States)

    Talha, Sheikh M; Salminen, Teppo; Juntunen, Etvi; Spangar, Anni; Gurramkonda, Chandrasekhar; Vuorinen, Tytti; Khanna, Navin; Pettersson, Kim


    Hepatitis B infection, caused by hepatitis B virus (HBV), presents a huge global health burden. Serological diagnosis of HBV mainly relies on the detection of hepatitis B surface antigen (HBsAg). Although there are high sensitivity commercial HBsAg enzyme immunoassays (EIAs) available, many low-resource laboratories lacking trained technicians continue to use rapid point-of-care assays with low sensitivities for HBsAg detection, due to their simplicity to operate. We developed a time-resolved fluorometric dry-reagent HBsAg immunoassay which meets the detection limit of high sensitivity EIAs but is simple to operate. To develop the assay, anti-HBsAg monoclonal antibody coated on europium nanoparticles was dried atop of biotinylated anti-HBsAg polyclonal antibody immobilized on streptavidin-coated microtiter wells. To test a sample in dry-reagent assay, serum sample and assay buffer were added to the wells, incubated, washed and europium signals were measured. The assay showed a detection limit of 0.25 ng/ml using HBsAg spiked in serum sample. When evaluated with 24 HBV positive and 37 negative serum samples, assay showed 100% sensitivity and specificity. Assay wells are stable for at least 26 weeks when stored at 4°C, and can tolerate elevated temperatures of up to 35°C for two weeks. The developed assay has high potential to be used in low-resource laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Bright mono-aqua europium complexes based on triazacyclononane that bind anions reversibly and permeate cells efficiently. (United States)

    Butler, Stephen J; McMahon, Brian K; Pal, Robert; Parker, David; Walton, James W


    A series of five europium(III) complexes has been prepared from heptadentate N5O2 ligands that possess a brightness of more than 10 mM(-1) cm(-1) in water, following excitation over the range λ=330-355 nm. Binding of several oxy anions has been assessed by emission spectral titrimetric analysis, with the binding of simple carboxylates, lactate and citrate involving a common ligation mode following displacement of the coordinated water. Selectivity for bicarbonate allows the rapid determination of this anion in human serum, with K(d)=37 mM (295 K). The complexes are internalised quickly into mammalian cells and exhibit a mitochondrial localisation at early time points, migrating after a few hours to reveal a predominant lysosomal distribution. Herein, we report the synthesis and complexation behaviour of strongly emissive europium (III) complexes that bind oxy-anions in aqueous media with an affinity and selectivity profile that is distinctively different from previously studied systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  19. Highly Sensitive Luminescence Assessment of Bile Acid Using a Balofloxacin-Europium(III) Probe in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong [Shihezi Univ., Shihezi (China)


    A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10{sup -9} - 7.0 Χ 10{sup -7} mol L{sup -1} with a detection limit of 1.3 Χ 10{sup -9} mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10{sup -8} mol L{sup -1} bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly.

  20. Investigation of the influence of silver and tin on the luminescence of trivalent europium ions in glass

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.A. [Department of Chemistry, University of Puerto Rico, Mayagueez, PR 00681 (United States); Lysenko, S. [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Liu, H., E-mail: hliu@uprm.ed [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Fachini, E.; Cabrera, C.R. [Center for Nanoscale Materials, University of Puerto Rico, Rio Piedras, PR 00931 (Puerto Rico)


    Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu{sup 3+} ions luminescence have been assessed. For the glass system containing only europium, Eu{sup 3+} PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu{sup 3+} PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag{sup +} ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu{sup 3+} PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu{sup 3+}->Eu{sup 2+} reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu{sup 3+} PL.

  1. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation (United States)

    Charafeddine, Ali H.; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A.; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.


    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by platelets obtained from normal individuals, and patients with two genetic defects that influence platelet granule development. Using these unique patient populations and immune-electron microscopy, we confirmed that CD154 was an alpha granule and not a cell surface protein, and thereafter optimized the methods for its in vivo measurement in humans. We then investigated plasma CD154 levels in kidney and liver transplant recipients and found no evidence that CD154 levels fluctuated systemically as a result of kidney or liver transplant procedures. Paradoxically, we found that kidney transplant patients had significantly lower systemic CD154 levels during episodes of rejection. These data suggest that the immune effects of CD154 are likely mediated through local and not systemic mechanisms, and discourage the use of CD154 as a peripheral biomarker in organ transplantation. PMID:22947105

  2. Behaviour of europium (III) and its hydroxo and carbonate complexes in a solvent extraction system with HDBM in 2 M NaCl at 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico); Solache-Rios, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Rojas-Hernandez, A. [Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico)


    The behaviour of europium in the solvent extraction system Eu{sup 3+}-water-2 M NaCl-HDBM-benzene was studied, taking into account the pC{sub H} and the carbonate ion concentration in the solutions. The stability constants for the hydrolysis and carbonate complexes of europium were determined at 303 K in the same medium by pH titration followed by a computational refinement. The obtained data were: log {beta}{sub Eu,H} = -8.29 {+-} 0.02, log {beta}{sub Eu,2H} = -16.37 {+-} 0.02, log {beta}{sub Eu,3H} = -24.54 {+-} 0.11, log {beta}{sub Eu,4H} = -34.91 {+-} 0.26, log {beta}{sub CO{sub 2}{sup 2-},H} = 9.30 {+-} 0.05, log {beta}{sub Eu,CO{sub 3}{sup 2-}} = 5.96 {+-} 0.03, log {beta}{sub Eu,CO{sub 3}{sup 2-},H} = -1.24 {+-} 0.05 and log {beta}{sub Eu,CO{sub 3}{sup 2-},2H} = -11.39 {+-} 0.11. Log K{sub W} was -13.78 {+-} 0.06. The behaviour of europium in this solvent extraction system was simulated, taking into account the hydrolysis and carbonate complexes plus the formation of Eu(DBM){sub 3}(OH){sup 1-} and Eu(DBM){sub 3}(CO{sub 3}){sup 2-} in the aqueous phase. The only europium species considered in the organic phase was Eu(DBM){sub 3}. The first hydrolysis constant of europium was also determined by using this solvent extraction system under the same conditions. A good conformity was found with the results obtained by both techniques. (orig.)

  3. Bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex a new apoptotic agent through Flk-1 down regulation, caspase-3 activation and oligonucleosomes DNA fragmentation. (United States)

    Azab, Hassan A; Hussein, Belal H M; El-Azab, Mona F; Gomaa, Mohamed; El-Falouji, Abdullah I


    New bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex was synthesized and characterized. In vivo anti-angiogenic activities of bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex against Ehrlich ascites carcinoma (EAC) cells are described. The newly synthesized complex resulted in inhibition of proliferation of EAC cells and ascites formation. The anti-tumor effect was found to be through anti-angiogenic activity as evident by the reduction of microvessel density in EAC solid tumors. The anti-angiogenic effect is mediated through down-regulation of VEGF receptor type-2 (Flk-1). The complex was also found to significantly increase the level of caspase-3 in laboratory animals compared to the acridine ligand and to the control group. This was also consistent with the DNA fragmentation detected by capillary electrophoresis that proved the apoptotic effect of the new complex. Our complex exhibited anti-angiogenic and apoptotic activity in vivo, a thing that makes it a potential effective chemotherapeutic agent. The interaction of calf thymus DNA (ct-DNA) with bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex has been investigated using fluorescence technique. A competitive experiment of the europium(III)-acridine complex with ethidium bromide (EB) to bind DNA revealed that interaction between the europium(III)-acridine and DNA was via intercalation. The interaction of the synthesized complex with tyrosine kinases was also studied using molecular docking simulation to further substantiate its mode of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Europium(III) reduction and speciation within a Wells-Dawson heteropolytungstate. (United States)

    Jing, Jing; Burton-Pye, Benjamin P; Francesconi, Lynn C; Antonio, Mark R


    The redox speciation of Eu(III) in the 1:1 stoichiometric complex with the alpha-1 isomer of the Wells-Dawson anion, [alpha-1-P 2W 17O 61] (10-), was studied by electrochemical techniques (cyclic voltammetry and bulk electrolysis), in situ XAFS (X-ray absorption fine structure) spectroelectrochemistry, NMR spectroscopy ( (31)P), and optical luminescence. Solutions of K 7[(H 2O) 4Eu(alpha-1-P 2W 17O 61)] in a 0.2 M Li 2SO 4 aqueous electrolyte (pH 3.0) show a pronounced concentration dependence to the voltammetric response. The fully oxidized anion and its reduced forms were probed by Eu L 3-edge XANES (X-ray absorption near edge structure) measurements in simultaneous combination with controlled potential electrolysis, demonstrating that Eu(III) in the original complex is reduced to Eu(II) in conjunction with the reduction of polyoxometalate (POM) ligand. After exhaustive reduction, the heteropoly blue species with Eu(II) is unstable with respect to cluster isomerization, fragmentation, and recombination to form three other Eu-POMs as well as the parent Wells-Dawson anion, alpha-[P 2W 18O 62] (6-). EXAFS data obtained for the reduced, metastable Eu(II)-POM before the onset of Eu(II) autoxidation provides an average Eu-O bond length of 2.55(4) A, which is 0.17 A longer than that for the oxidized anion, and consistent with the 0.184 A difference between the Eu(II) and Eu(III) ionic radii. The reduction of Eu(III) is unusual among POM complexes with Lindqvist and alpha-2 isomers of Wells-Dawson anions, that is, [Eu(W 5O 18) 2] (9-) and [Eu(alpha-2-As 2W 17O 61) 2] (17-), but not to the Preyssler complex anion, [EuP 5W 30O 110] (12-), and fundamental studies of materials based on coupling Eu and POM redox properties are still needed to address new avenues of research in europium hydrometallurgy, separations, and catalysis sciences.

  5. Structural, optical and electrical properties of europium picrate tetraethylene glycol complex as emissive material for OLED

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I.; Adnan, Rohana [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Sha Shiong, Ng; Fun, H.K. [School of Physics, Universiti Sains Malaysia, 11800 Penang (Malaysia); Adhha Abdullah, M.A.; Mamat, Mazidah [Department of Chemical Sciences, Faculty of Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu Darul Iman (Malaysia); Za' aba, N.K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)


    A new europium complex [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O was synthesized and used as the emission material for the single layer device structure of ITO/EO4-Eu-Pic/Al, using a spin-coating technique. Study on the optical properties of the [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O complex where EO4=tetraethylene glycol and Pic=picrate anion, had to be undertaken before being applicable to the study of an organic light emitting diode (OLED). The electrical property of an OLED using current-voltage (I-V) measurement was also studied. In complex, the Eu(III) ion was coordinated with the EO4 ligand as a pentadentate mode, one water molecule, and with two Pic anions as bidentate and monodentate modes, forming a nine-coordination number. The photoluminescence (PL) spectra of the crystalline complex in the solid state and its thin film showed a hypersensitive peak at 613.5-614.9 nm that assigned to the {sup 5}D{sub 0}{yields}{sup 7}F{sub 2} transition. A narrow band emission from the thin film EO4-Eu-Pic was obtained. The typical semiconductor I-V curve of device ITO/EO4-Eu-Pic/Al showed the threshold and turn on voltages at 1.08 and 4.6 V, respectively. The energy transfer process from the ligand to the Eu(III) ion was discussed by investigating the excitation and PL characteristics. Effect of the picrate anion on the device performance was also studied. - Highlights: > The [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75(H{sub 2}O) is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in single layer device structure of ITO/EO4-Eu-Pic/Al. > The complex displays a red luminescence in both the crystalline complex and its thin film state. > The low turn on voltage of the device (4.6 V), indicating that this material is suitable for OLED. > The roughness and morphology of the thin film affects luminance and electrical properties of OLED.

  6. The role of CD154 in organ transplant rejection and acceptance.


    Kirk, A. D.; Blair, P.J.; Tadaki, D K; Xu, H; Harlan, D. M.


    CD154 plays a critical role in determining the outcome of a transplanted organ. This simple statement is amply supported by experimental evidence demonstrating that anti-CD154 antibodies are potent inhibitors of allograft rejection in many rigorous transplant models. Unfortunately, despite intensive investigation over the past ten years, the precise mechanisms by which antibodies against CD154 exert their anti-rejection effects have remained less obvious. Though originally classified with ref...

  7. Cloning, sequence analysis and expression of ovine CD154 (CD40 ligand). (United States)

    Oledzka, Gabriela; Li, Bo; William Kay, Graham; Chomicz, Lidia; Stankiewicz, Miroslaw


    The CD154 (CD40 ligand) molecule is a member of the tumor necrosis factor (TNF) family and plays an important role in the interaction between antigen-specific lymphocytes and antigen-presenting cells. In this study, reverse transcription-PCR cloning was used to derive the sequence encoding ovine CD154. Sequence analysis of the cloned CD154 gene showed a similarity of 97%, 89%, and 88% with the bovine, porcine and human sequences, respectively, at the nucleic acid level. The deduced amino acid sequence for the ovine CD154 shared 97%, 91%, and 87% similarity with the CD154 protein of bovine, porcine and human. The cysteine residues characteristic of the TNF family and N-linked glycosylation sites are conserved although one of the cysteine residues (Cys9) appeared only in ovine CD154. The isolated CD154 sequence was expressed as a mature protein in Chinese hamster ovary (CHO) cells. The analysis of expression of ovine CD154 in mammalian cells by Western blot confirmed the cross reactivity with anti-CD154 antibody.

  8. Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

    Directory of Open Access Journals (Sweden)

    Sujeong Yang


    Full Text Available Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie.

  9. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F


    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  10. Synthesis of Luminescent Ink from Europium-Doped Y2O3 Dispersed in Polyvinyl Alcohol Solution

    Directory of Open Access Journals (Sweden)



    Full Text Available Luminescent ink from europium-doped Y2O3 ( Y2O3:Eu has been synthesized by two steps method: first, synthesis of luminescent powder of Y2O3:Eu by simple heating of metallic nitrates in a polymer solution and second, dispersing the powder in a polyvinyl alcohol (PVA solution. The stability of the ink (luminescent colloid was strongly affected by mixing process of the powder and the solution. Mixing process must be performed for a long time (about 8 hours at above room temperature to product stable colloids. We observed that mixing at 30–40∘C resulted in a stable and highly dispersed colloid. The writing test was performed on a white paper to show the potential use of the colloid for making security codes.

  11. Induced europium CPL for the selective signalling of phosphorylated amino-acids and O-phosphorylated hexapeptides. (United States)

    Neil, Emily R; Fox, Mark A; Pal, Robert; Parker, David


    Two bright, europium(iii) complexes based on an achiral heptadentate triazacyclononane ligand bearing two strongly absorbing chromophores have been evaluated for the selective emission and CPL signalling of various chiral O-phosphono-anions. Binding of O-phosphono-Ser and Thr gives rise to a strong induced CPL signature and a favoured Δ complex configuration is adopted. A similarly large induced CPL signal arises when [Eu·](2+) binds to lysophosphatidic acid (LPA), where the strong binding (log K 5.25 (295 K)) in methanol allowed its detection over the range 5 to 40 μM. Strong and chemoselective binding to the phosphorylated amino-acid residues was also observed with a set of four structurally related hexapeptides: in one case, the sign of the gem value in the ΔJ = 1 transition allowed differentiation between the binding to O-P-Ser and O-P-Tyr residues.

  12. Regiospecific synthesis of 15-(4-[{sup 123}I]iodophenyl)pentadecanoic acid-IPPA via methyl 15-(4-trimethylstannylphenyl)pentadecanoate

    Energy Technology Data Exchange (ETDEWEB)

    Culbert, P.A. [Glaxo Wellcome Inc., Mississauga, ON (Canada); Jianming Lu; Adam, M.J. [TRIUMF, Vancouver, BC (Canada)


    The synthesis of methyl 15-(4-trimethylstannylphenyl)pentadecanoate (p-SnPPA), a precursor for the regiospecific production of 15-(4-[{sup 123}I]-iodophenyl)pentadecanoic acid, is described. The stannylated precursor is synthesized in six steps from 4-bromophenylacetylene in an overall yield of 16%. p-SnPPA reacts with N.C.A. [{sup 123}I]NaI in the presence of peracetic acid to yield IPPA in 62% radiochemical yield following hydrolysis. (author).

  13. A new europium(III)-β-diketonate complex based on diphenylethyne as red phosphors applied in LED

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guang, E-mail: [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Na; Lin, Duan [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Feng, Kenjun [Department of Chemical Engineering, Hui-Zhou University, Huizhou 516007 (China); Cao, Rihui, E-mail: [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Gong, Menglian [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China)


    A new europium(III) ternary complex based on a fluorinated β-diketonate ligand and 1,10-phenanthroline as an ancillary ligand has been prepared and evaluated as a candidate for light-emitting diode (LED). The complex exhibits a high decomposition temperature (316 °C). Photophysical properties such as FT-IR spectra, UV–vis absorption spectra, excitation and emission spectra, luminescence decay curve and quantum yield were investigated. The excitation band is well matched with the characteristic emission of 395 nm-emitting InGaN chips. The complex exhibits an efficient energy transfer pathway from the ligands to the central Eu{sup 3+} ion via a ligand-sensitized luminescence process. An intense red-emitting LED was fabricated by coating the complex onto a 395 nm-emitting InGaN chip, and its Commission International de I'Eclairage (CIE) chromaticity coordinate (x=0.6389, y=0.3255) is close to the National Television Standard Committee (NTSC) standard value for red color. Meanwhile, the energy transfer from the InGaN chip to the complex is very efficient. All the findings demonstrate the potential application of the Eu(III) complex as red-emitting phosphors for UV-based white LEDs. -- Highlights: ► A new europium(III)-β-diketonate complex was synthesized and characterized. ► Thermal stability and photophysical properties were investigated in detail. ► PL mechanism was proposed to involve a ligand-sensitized luminescence process. ► An intense red-emitting LED was fabricated by using the complex. ► CIE chromaticity coordinate is close to NTSC standard value for red color.

  14. 46 CFR 154.650 - Cargo tank and process pressure vessel welding. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank and process pressure vessel welding. 154.650... Equipment Construction § 154.650 Cargo tank and process pressure vessel welding. (a) Cargo tank and process pressure vessel welding must meet Subpart 54.05 and Part 57 of this chapter. (b) Welding consumables used...

  15. 32 CFR 536.154 - Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management... (United States)


    ... 32 National Defense 3 2010-07-01 2010-07-01 true Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management program (RIMP) claims. 536.154 Section 536.154 National... nonappropriated fund employees: NAFI risk management program (RIMP) claims. The risk management program (RIMP) is...

  16. Elevated serum levels of soluble CD154 in children with juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Zeft Andrew S


    Full Text Available Abstract Objective Cytokines play important roles in mediating inflammation in autoimmunity. Several cytokines are elevated in serum and synovial fluid samples from children with Juvenile Idiopathic Arthritis (JIA. Soluble CD154 (sCD154 is elevated in other autoimmune disorders, but has not been characterized in JIA. Our objectives were to determine if sCD154 is elevated in JIA, and to examine correlations between sCD154 and other inflammatory cytokines. Methods Serum from 77 children with JIA and 81 pediatric controls was analyzed for interleukin (IL1β, IL2, IL4, IL5, IL6, IL8, IL10, IL12, IL13, sCD154, interferon-γ (IFNγ, soluble IL2 receptor (sIL2R, and tumor necrosis factor-α (TNFα, using the Luminex Multi-Analyte Profiling system. Differences in levels of cytokines between cases and controls were analyzed. Logistic regression was also performed. Results sCD154 was significantly elevated in cases compared to controls (p Conclusion Serum levels of sCD154, IL1β, IL6, IL8, sIL2R and TNFα are elevated in most JIA subtypes, suggesting a major role for sCD154, and these cytokines and cytokine receptors in the pathogenesis of JIA.

  17. 46 CFR 154.1730 - Ethylene oxide: Loading and off loading. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide: Loading and off loading. 154.1730... Operating Requirements § 154.1730 Ethylene oxide: Loading and off loading. (a) The master shall ensure that before ethylene oxide is loaded into a cargo tank: (1) The tank is thoroughly clean, dry, and free of...

  18. 21 CFR 520.154b - Bacitracin methylene disalicylate and streptomycin sulfate powder. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin methylene disalicylate and streptomycin sulfate powder. 520.154b Section 520.154b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... bacterial enteritis caused by pathogens susceptible to bacitracin and streptomycin such as Escherichia coli...

  19. 7 CFR 1900.154 - Determining the need for special handling. (United States)


    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Determining the need for special handling. 1900.154 Section 1900.154 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... OF AGRICULTURE PROGRAM REGULATIONS GENERAL Processing and Servicing FmHA or Its Successor Agency...

  20. 46 CFR 154.701 - Cargo pressure and temperature control: General. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo pressure and temperature control: General. 154.701... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Cargo Pressure and Temperature Control § 154.701 Cargo pressure and temperature control: General...

  1. 46 CFR 154.1375 - Readout for temperature measuring device: Marking. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Readout for temperature measuring device: Marking. 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1375 Readout for temperature measuring device: Marking. Each...

  2. 17 CFR 230.154 - Delivery of prospectuses to investors at the same address. (United States)


    ... investors at the same address. 230.154 Section 230.154 Commodity and Securities Exchanges SECURITIES AND... prospectuses to investors at the same address. (a) Delivery of a single prospectus. If you must deliver a... all of the following conditions are met: (1) The investor has the same last name as the other...

  3. The relationship between hepatic immunoglobulin production and CD154 expression in chronic liver diseases. (United States)

    Mayo, Marlyn J; Mosby, James M; Jeyarajah, Rohan; Combes, Burton; Khilnani, Smina; Al-halimi, Maha; Handem, Iorna; Grammer, Amrie C; Lipsky, Peter E


    CD40-CD154 is a receptor-ligand pair that provides key communication signals between cells of the adaptive immune system in states of inflammation and autoimmunity. The CD40 receptor is expressed constitutively on B lymphocytes, for which it provides important signals regulating clonal expansion and antibody production. CD154 is a member of the tumor necrosis factor superfamily, which is primarily expressed by activated T cells. Because many chronic liver diseases are characterized by lymphocytic infiltration of the liver and several have increased immunoglobulin (Ig) production, the role of CD40-CD154 in hepatic Ig production was investigated in patients with primary biliary cirrhosis (PBC), primary sclerosing cholangitis, autoimmune hepatitis (AIH), hepatitis C, hepatitis B, alcoholic and non-alcoholic steatohepatitis, as well as normal controls. Soluble CD154 levels in the serum were found to be no different in chronic liver diseases vs normal controls. Likewise, CD154 mRNA levels in peripheral blood mononuclear cells did not differ. However, mRNA for CD154 was significantly increased in the liver of individuals with PBC and AIH as compared with the other groups. The quantity of CD154 mRNA in the liver correlated positively with the quantity of mRNA for secretory Ig. These findings suggest that CD40-CD154 signals may be involved in Ig production within the liver of autoimmune liver diseases.

  4. Excitation energy transfer in europium chelate with doxycycline in the presence of a second ligand in micellar solutions of nonionic surfactants (United States)

    Smirnova, T. D.; Shtykov, S. N.; Kochubei, V. I.; Khryachkova, E. S.


    The complexation of Eu3+ with doxycycline (DC) antibiotic in the presence of several second ligands and surfactant micelles of different types is studied by the spectrophotometric and luminescence methods. It is found that the efficiency of excitation energy transfer in Eu3+-DC chelate depends on the nature of the second ligand and surfactant micelles. Using thenoyltrifluoroacetone (TTA) as an example, it is shown that the second ligand additionally sensitizes the europium fluorescence, and the possibility of intermediate sensitization of DC and then of europium is shown by the example of 1,10-phenanthroline. In all cases, the excitation energy transfer efficiency was increased due to the so-called antenna effect. The decay kinetics of the sensitized fluorescence of the binary and mixed-ligand chelates in aqueous and micellar solutions of nonionic surfactants is studied and the relative quantum yields and lifetimes of fluorescence are determined.

  5. A Smart Europium-Ruthenium Complex as Anticancer Prodrug: Controllable Drug Release and Real-Time Monitoring under Different Light Excitations. (United States)

    Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung


    A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λirr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.

  6. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation (United States)

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh


    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were correlated with proliferative alloresponses measured by CFSE-dye dilution (n=23), and CTLA4, a negative T-cell costimulator, which antagonizes CD154-mediated effects (n=31). In cross-sectional observations, logistic regression and leave-one-out cross-validation identified donor-specific, CD154+T-cytotoxic (Tc)-memory cells as best associated with rejection outcomes. In the longitudinal cohort, 1) the association between CD154+Tc-memory cells and rejection outcomes was replicated with sensitivity/specificity 92.3%/84.6% for observations at 1–60 days, and 2) elevated pre-LTx CD154+Tc-memory cell responses were associated with significantly increased incidence (p=0.02) and hazard (HR=7.355) of rejection in survival/proportional hazard analysis. CD154 expression correlated with proliferative alloresponses (r=0.835, p=7.1e-07), and inversely with CTLA4 expression of allospecific CD154+Tc-memory cells (r=−0.706, p=3.0e-05). Allospecific CD154+T-helper-memory cells, not CD154+Tc-memory, were inhibited by increasing Tacrolimus concentrations (p=0.026). Collectively, allospecific CD154+T-cells provide an estimate of rejection risk in children with LTx. PMID:18976293

  7. Structural and optical analysis on europium doped AZrO{sub 3} (A=Ba, Ca, Sr) phosphor for display devices application

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, Vikas, E-mail: [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)


    Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.

  8. Metal-organic framework luminescence in the yellow gap by codoping of the homoleptic imidazolate ∞(3)[Ba(Im)2] with divalent europium. (United States)

    Rybak, Jens-Christoph; Hailmann, Michael; Matthes, Philipp R; Zurawski, Alexander; Nitsch, Jörn; Steffen, Andreas; Heck, Joachim G; Feldmann, Claus; Götzendörfer, Stefan; Meinhardt, Jürgen; Sextl, Gerhard; Kohlmann, Holger; Sedlmaier, Stefan J; Schnick, Wolfgang; Müller-Buschbaum, Klaus


    The rare case of a metal-triggered broad-band yellow emitter among inorganic-organic hybrid materials was achieved by in situ codoping of the novel imidazolate metal-organic framework ∞(3)[Ba(Im)2] with divalent europium. The emission maximum of this dense framework is in the center of the yellow gap of primary light-emitting diode phosphors. Up to 20% Eu2+ can be added to replace Ba2+ as connectivity centers without causing observable phase segregation. High-resolution energy-dispersive X-ray spectroscopy showed that incorporation of even 30% Eu2+ is possible on an atomic level, with 2-10% Eu2+ giving the peak quantum efficiency (QE = 0.32). The yellow emission can be triggered by two processes: direct excitation of Eu2+ and an antenna effect of the imidazolate linkers. The emission is fully europium-centered, involving 5d → 4f transitions, and depends on the imidazolate surroundings of the metal ions. The framework can be obtained by a solvent-free in situ approach starting from barium metal, europium metal, and a melt of imidazole in a redox reaction. Better homogeneity for the distribution of the luminescence centers was achieved by utilizing the hydrides BaH2 and EuH2 instead of the metals.

  9. α-Titanium phosphate intercalated with propylamine: An alternative pathway for efficient europium(III uptake into layered tetravalent metal phosphates

    Directory of Open Access Journals (Sweden)

    Jorge García-Glez


    Full Text Available α-Ti(HPO42·H2O (α-TiP and its propylamine intercalation product, Ti(HPO42·2C3H7NH2·H2O (α-TiPPr, have been synthesized and characterized. Later, their sorption capacity for europium(III was investigated, and this purpose was accomplished by treating α-TiP and α-TiPPr with europium(III nitrate solutions at different concentrations until the equilibrium is reached. All samples were characterized, among others, by powder X-ray diffraction (PXRD, scanning and transmission electron microscopies (SEM, TEM, STEM-EDX, SAED, thermogravimetric analysis (TGA, and photoluminescence (PL measurements. The results show that the Eu3+ uptake is limited to surface when α-TiP is used as sorbent. Nevertheless, the Eu-retention is considerably enhanced with α-TiPPr as a consequence of an ion-exchange process into the interlayer space of the layered titanium phosphate (involving propylammonium cations, C3H7NH3+, and hexahydrate europium(III species, [Eu(H2O6]3+, and the crystal structure of a hypothetical final product, α-[Eu(H2O6]2/3Ti(PO42·[(H2O6]1/3, has been proposed by using DFT calculations.

  10. BRCA2 Mutations in 154 Finnish Male Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Kirsi Syrjäkoski


    Full Text Available The etiology and pathogenesis of male breast cancer (MBC are poorly known. This is due to the fact that the disease is rare, and large-scale genetic epidemiologic studies have been difficult to carry out. Here, we studied the frequency of eight recurrent Finnish BRCA2 founder mutations in a large cohort of 154 MBC patients (65% diagnosed in Finland from 1967 to 1996. Founder mutations were detected in 10 patients (6.5%, eight of whom carried the 9346(-2 A>G mutation. Two novel mutations (4075 delGT and 5808 del5 were discovered in a screening of the entire BRCA2 coding region in 34 samples. However, these mutations were not found in the rest of the 120 patients studied. Patients with positive family history of breast and/or ovarian cancer were often BRCA2 mutation carriers (44%, whereas those with no family history showed a low frequency of involvement (3.6%; P < .0001. Finally, we found only one Finnish MBC patient with 999 dell, the most common founder mutation in Finnish female breast cancer (FBC patients, and one that explains most of the hereditary FBC and MBC cases in Iceland. The variation in BRCA2 mutation spectrum between Finnish MBC patients and FBC patients in Finland and breast cancer patients in Iceland suggests that modifying genetic and environmental factors may significantly influence the penetrance of MBC and FBC in individuals carrying germline BRCA2 mutations in some populations.

  11. AGR-2 Data Qualification Report for ATR Cycle 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh Pham; Jeff Einerson


    This report provides the data qualification status of Advanced Gas Reactor-2 (AGR-2) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycle 154B as recorded in the Nuclear Data Management and Analysis System (NDMAS). This is the last cycle of AGR-2 irradiation, as the test train was pulled from the ATR core during the outage portion of ATR Cycle 155A. The AGR-2 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates including new Fission Product Monitoring (FPM) downstream flows from Fission Product Monitoring System (FPMS) detectors, pressure, and moisture content), and FPMS data (release rates and release-to-birth rate ratios [R/Bs]) for each of the six capsules in the AGR-2 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) comprised of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The Data Review Committee reviewed the data acquisition process, considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) data collection plans, examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  12. Metal oxide targets produced by the polymer-assisted deposition method

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Mitch A., E-mail: mitch@berkeley.ed [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Ali, Mazhar N.; Chang, Noel N.; Parsons-Moss, T. [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Ashby, Paul D. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gates, Jacklyn M. [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Stavsetra, Liv [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gregorich, Kenneth E.; Nitsche, Heino [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)


    The polymer-assisted deposition (PAD) method was used to create crack-free homogenous metal oxide films for use as targets in nuclear science applications. Metal oxide films of europium, thulium, and hafnium were prepared as models for actinide oxides. Films produced by a single application of PAD were homogenous and uniform and ranged in thickness from 30 to 320 nm. Reapplication of the PAD method (six times) with a 10% by weight hafnium(IV) solution resulted in an equally homogeneous and uniform film with a total thickness of 600 nm.

  13. CD154-CD40 interactions in the control of murine B cell hematopoiesis (United States)

    Carlring, Jennifer; Altaher, Hala M.; Clark, Susan; Chen, Xi; Latimer, Sarah L.; Jenner, Tracey; Buckle, Anne-Marie; Heath, Andrew W.


    Interactions between CD40 and CD154 play a very important role in control of immune responses, including the delivery of T cell help to B cells and other APCs. Thus far, there has been no role postulated for CD40-CD154 interactions in hematopoiesis. We show here that CD40 is expressed on murine pro-B cells and that its ligation enhances pro-B cell proliferation in vitro and in vivo. In addition, CD154 mRNA is present in the BM. Moreover, we show that a deficiency in CD154 expression has effects on B cell hematopoiesis. Aged, CD154-deficient mice have significantly lower levels of B hematopoietic subsets downstream of pro-B cells in the BM. In addition, B lineage cells reconstitute more slowly following BMT into CD154-deficient recipients. We hypothesize that CD154 is expressed by radio-resistant cells in the BM and plays a role in fine-tuning B cell hematopoiesis. PMID:21330346

  14. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation. (United States)

    Villeneuve, Julien; Desmoulière, Alexis; Dewitte, Antoine; Bordeau, Nelly; Costet, Pierre; Bassaganyas, Laia; Fricain, Jean-Christophe; Ripoche, Jean; Lepreux, Sébastien


    Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  15. The role of platelets CD40 ligand (CD154) in acute coronary syndromes. (United States)

    Abu el-Makrem, Mona A; Mahmoud, Yehia Z; Sayed, Douaa; Nassef, Noussa M; Abd el-Kader, Samir S; Zakhary, Madiha; Ghazaly, Taghreed; Matta, Ragaa


    Despite of the proof of the biological function of CD154 on platelets, there has been little information about its role either in patients with stable angina or in those with acute coronary syndrome (ACS). This study aimed to investigate the expression of CD154 on platelets and its role in ACS. The study included 50 patients with ACS (24 patients with acute myocardial infarction (AMI) and 26 patients with unstable angina (UA)), 20 patients with stable angina (SA) and 18 healthy volunteers. CD154 and CD62 expression on platelets were analyzed by flow cytometry. Their relations to the clinical and laboratory data were assessed in the studied group. Patients with AMI and UA had higher levels of platelets CD154 and CD62 as compared to those with SA and among patients with AMI, UA and SA versus healthy volunteers. Platelets CD154 showed significant positive correlations with the studied pro-inflammatory markers (Ox-LDL, CRP and fibrinogen), segmental wall motion score and the studied risk factors. There were significant negative correlations between platelet CD154 and serum nitric oxide among patients. CD154 may be used as a marker of thrombo-embolic events. Nitric oxide may have an anti-atherogenic effect. There is an association between platelet activation and severity of coronary artery disease among patients with ACS.

  16. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation

    Directory of Open Access Journals (Sweden)

    Julien Villeneuve


    Full Text Available Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  17. Vaccination produces CD4 T cells with a novel CD154-CD40 dependent cytolytic mechanism ¶ (United States)

    Coler, Rhea N.; Hudson, Thomas; Hughes, Sean; Huang, Po-wei D.; Beebe, Elyse A.; Orr, Mark T.


    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust TH1 responses to a variety of vaccine antigens and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein antigen and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly these in vivo CTLs were CD4 T cells, not CD8 T cells and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the FasL-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40 ligand) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs which kill through a previously unknown CD154-dependent mechanism. PMID:26297758

  18. Patients with acute coronary syndromes express enhanced CD40 ligand/CD154 on platelets. (United States)

    Garlichs, C D; Eskafi, S; Raaz, D; Schmidt, A; Ludwig, J; Herrmann, M; Klinghammer, L; Daniel, W G; Schmeisser, A


    To investigate whether CD40L/CD154 on platelets and soluble CD40L/CD154 may play a role in the inflammatory process of acute coronary syndromes. Observational study in a university hospital. 15 patients with acute myocardial infarction, 25 patients with unstable angina, 15 patients with stable angina, and 12 controls. CD40L/CD154 on platelets, P-selectin/CD62P on platelets, soluble CD40L/CD154 serum concentrations. Mean (SD) CD40L/CD154 expression on platelets was 6.2 (2.8) MFI (mean fluorescence intensity) in the infarct group, 11 (3.3) MFI in the unstable angina group (p angina group (p angina), and 3.2 (1.0) MFI in the controls (p angina; NS v stable angina). Soluble CD40L/CD154 concentration was 5.2 (1.1) ng/ml in the infarct group, 4.2 (0.7) ng/ml in the unstable angina group (p angina group (p angina), and 3.0 (0.5) ng/ml in the controls (p angina; NS v stable angina). At a six months follow up, there was lower expression of CD40L/CD154 on platelets in patients with unstable angina (12.3 (3.6) v 3.8 (1.2) MFI, p angina who needed redo coronary angioplasty (PTCA) or who had recurrence of angina were characterised by increased CD40L/CD154 expression on platelets compared with the remainder of the study group (recurrence of angina: 12.7 (3.2) v 9.7 (1.6) MFI, p angina and myocardial infarction. These findings suggest that CD40-CD40L/CD154 interactions may play a pathogenic role in triggering and propagation of acute coronary syndromes.

  19. 33 CFR 154.106 - Incorporation by reference: Where can I get a copy of the publications incorporated by reference... (United States)


    ... approved for § 154.735. (2) NFPA 70, National Electrical Code, 2008, IBR approved for § 154.812. (h) Oil..., IBR approved for § 154.812. (f) National Electrical Manufacturers Association (NEMA), 1300 North 17th... the public. All approved material is available for inspection at the National Archives and Records...

  20. CD154 is a negative regulator of autoaggressive CD8+ T cells in type 1 diabetes


    McGregor, Catrin M.; Schoenberger, Stephen P.; Green, E. Allison


    TNF/CD80 mice, a CD8+ T cell-mediated model for type 1 diabetes, transgenically express tumor necrosis factor α (TNF-α) and the costimulatory molecule CD80 in their pancreatic islets. Here we show that these molecules bypass the need for CD40–CD154 costimulatory interactions in activation of CD8+ T cells, allowing us to determine the role of CD40–CD154 signals in regulation of autoaggressive CD8+ T cells after their in vivo priming. TNF/CD80 CD154-deficient mice rapidly develop diabetes, wher...

  1. Electron tunneling transport across heterojunctions between europium sulfide and indium arsenide (United States)

    Kallaher, Raymond L.

    This dissertation presents research done on utilizing the ferromagnetic semiconductor europium sulfide (EuS) to inject spin polarized electrons into the non-magnetic semiconductor indium arsenide (InAs). There is great interest in expanding the functionality of modern day electronic circuits by creating devices that depend not only on the flow of charge in the device, but also on the transport of spin through the device. Within this mindset, there is a concerted effort to establish an efficient means of injecting and detecting spin polarized electrons in a two dimensional electron system (2DES) as the first step in developing a spin based field effect transistor. Thus, the research presented in this thesis has focused on the feasibility of using EuS, in direct electrical contact with InAs, as a spin injecting electrode into an InAs 2DES. Doped EuS is a concentrated ferromagnetic semiconductor, whose conduction band undergoes a giant Zeeman splitting when the material becomes ferromagnetic. The concomitant difference in energy between the spin-up and spin-down energy bands makes the itinerant electrons in EuS highly spin polarized. Thus, in principle, EuS is a good candidate to be used as an injector of spin polarized electrons into non-magnetic materials. In addition, the ability to adjust the conductivity of EuS by varying the doping level in the material makes EuS particularly suited for injecting spins into non-magnetic semiconductors and 2DES. For this research, thin films of EuS have been grown via e-beam evaporation of EuS powder. This growth technique produces EuS films that are sulfur deficient; these sulfur vacancies act as intrinsic electron donors and the resulting EuS films behave like heavily doped ferromagnetic semiconductors. The growth parameters and deposition procedures were varied and optimized in order to fabricate films that have minimal crystalline defects. Various properties and characteristics of these EuS films were measured and compared to

  2. CD40 ligand (CD154) involvement in platelet transfusion reactions. (United States)

    Sahler, J; Spinelli, S; Phipps, R; Blumberg, N


    Platelet transfusions are commonly used treatments that occasionally lead to adverse reactions. Clinical trials, in vitro and animal studies have been performed to try to understand the causes of such reactions. Multiple studies have shown that the supernatant fraction of platelet concentrates contain prothrombotic and pro-inflammatory mediators. The origin of these mediators was first ascribed to white blood cells contaminating the platelet preparation. However, the accumulation of bioactive mediators after leukoreduction focused attention on platelets themselves during storage. Numerous cytokines, chemokines and prostaglandins are released in stored platelet concentrates. We have focused on a powerful mediator called soluble CD40 ligand (sCD40L, formally known as CD154) as a seminal contributor to adverse reactions. sCD40L can bind and signal the surface receptor, CD40, which is present on various types of human cells including white blood cells, vascular cells and fibroblasts. Downstream results of sCD40L/CD40 signaling include pro-inflammatory cytokine and chemokine production, prothrombotic mediator release, adherence and transmigration of leukocytes to endothelium and other undesirable vascular inflammatory events. Increased plasma levels of sCD40L can be detected in conditions such as myocardial infarction, stroke, unstable angina, high cholesterol, or other cardiovascular conditions. In retrospective studies, correlations were made between increased sCD40L levels of platelet concentrates and adverse transfusion reactions. We hypothesize that transfusion of partially activated, CD40L-expressing platelets along with sCD40L into a recipient with damaged or dysfunctional vascular tissue results in a "double-hit", thus inciting inflammation and vascular damage in the recipient. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. Enfoque terapéutico en 154 pacientes con acromegalia

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela


    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.

  4. Synthesis, Optical Investigation and Biological Properties of Europium(III) Complexes with 2-(4-Chlorophenyl)-1-(2-Hydroxy-4-Methoxyphenyl)Ethan-1-one and Ancillary Ligands. (United States)

    Nandal, Poonam; Khatkar, S P; Kumar, Rajesh; Khatkar, Avni; Taxak, V B


    Synthesis and photoluminescence behaviour of six novel europium complexes with novel β-hydroxyketone ligand, 2-(4-chlorophenyl)-1-(2-hydroxy-4-methoxyphenyl)ethan-1-one (CHME) and 2,2'-bipyridine (bipy) or neocuproine (neo) or 1,10-phenanthroline (phen) or 5,6-dimethyl-1,10-phenanthroline (dmphen) or bathophenanthroline (bathophen) were reported in solid state. The free ligand CHME and europium complexes, Eu(CHME)3.2H2O [1] Eu(CHME)3.bipy [2], Eu(CHME)3.neo [3], Eu(CHME)3.phen [4], Eu(CHME)3.dmphen [5] and Eu(CHME)3.bathophen [6]were characterized by elemental analysis, FT-IR and 1H-NMR. The photoluminescence emission spectra exhibited four characteristic peaks arising from the 5D0 → 7FJ (J = 1-4) transitions of the europium ion in the solid state on monitoring excitation at λex = 395 nm. The luminescence decay curves of these europium complexes possess single exponential behaviour indicating the presence of a single luminescent species and having only one site symmetry in the complexes. The luminescence quantum efficiency (η) and the experimental intensity parameters, Ω 2 and Ω 4 of europium complexes have also been calculated on the basis of emission spectra and luminescence decay curves. In addition, the antimicrobial and antioxidant activities were also studied of the investigated complexes.

  5. Highly luminescent pure-red-emitting fluorinated β-diketonate europium(III) complex for full solution-processed OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)


    Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.

  6. Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Kautenburger, R.; Nowotka, K.; Beck, H.P. [Institut fuer Anorganische und Analytische Chemie und Radiochemie, Universitaet des Saarlandes, P.O. Box 151150, 66041 Saarbruecken (Germany)


    Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu{sup 3+}) and gadolinium (Gd{sup 3+}) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 {mu}l nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for {sup 153}Eu and 125 ppt for {sup 158}Gd. With this optimized CE

  7. Temperature effects on the interaction mechanisms between the europium (III) and uranyl ions and zirconium diphosphate; Effets de la temperature sur les mecanismes d'interaction entre les ions europium (3) et uranyle et le diphosphate de zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Finck, N


    Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)

  8. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis (United States)

    Alaaeddine, Nada; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid


    Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2) for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed. PMID:22110533

  9. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Nada Alaaeddine


    Full Text Available Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2 for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed.

  10. Abnormal CD40 Ligand (CD154) Expression in Human Immunodeficiency Virus-Infected Children (United States)

    O'Gorman, Maurice R. G.; DuChateau, Brian; Paniagua, Mary; Hunt, Janelle; Bensen, Nicolas; Yogev, Ram


    The CD40 ligand (CD154), expressed primarily on activated CD4-positive T cells, is a costimulatory molecule involved in B-cell proliferation, germinal center formation, and immunoglobulin class switching. Since B-cell abnormalities including hypergammaglobulinemia and abnormal antibody-specific immune responses are prominent and occur early during the course of pediatric human immunodeficiency virus (HIV) infection, we measured the baseline levels and the induced levels of expression of CD154 on CD3+ CD8− (T helper cells) in HIV-infected children and uninfected children born to HIV-positive mothers. The percentage of CD154+ T helper cells activated in vitro and the level of CD154 expressed per T helper cell (mean fluorescent channel [MFC]) were significantly lower in the HIV-infected children than in the uninfected control group (77% ± 3% versus 89% ± 1%, respectively [P CD154 expressed on resting T helper cells in the HIV-infected group were not significantly different from the levels observed in the control group. In the HIV-infected children, the level of CD154 on activated T helper cells correlated with the level of immunodeficiency, as assessed by the CD4 T-cell levels (correlation coefficient [r] = 0.707, P = 0.003), but did not correlate with the viral load or with any of the serum immunoglobulin concentrations measured in this group of HIV-infected children. The baseline level of CD154 expressed on T helper cells did, however, correlate with the concentration of immunoglobulin A in serum. We conclude that HIV-infected children have impaired regulation of CD154 expression which may contribute to the immune dysregulation commonly observed. PMID:11687447

  11. The CD40-CD154 co-stimulation pathway mediates innate immune injury in adriamycin nephrosis. (United States)

    Lee, Vincent W S; Qin, Xiaohong; Wang, Yiping; Zheng, Guoping; Wang, Ya; Wang, Ying; Ince, Jon; Tan, Thian K; Kairaitis, Lukas K; Alexander, Stephen I; Harris, David C H


    Blockade of CD40-CD40 ligand (CD154) interactions protects against renal injury in adriamycin nephropathy (AN) in immunocompetent mice. To investigate whether this protection relied on adaptive or cognate immunity, we tested the effect of CD40-CD154 blockade in severe combined immunodeficient (SCID) mice. SCID mice were divided into three groups: normal, AN + hamster IgG (ADR+IgG group) and AN + anti-CD154 antibody (MR1) (ADR+MR1 group). AN was induced by tail vein injection of 5.2 mg/kg of adriamycin (ADR). Hamster IgG (control Ab) or MR1 was administered intraperitoneally on days 5, 7, 9 and 11 after ADR injection. Histological and functional data were collected 4 weeks after ADR injection. In vitro experiments tested the effect of soluble and cell-bound CD154 co-cultured with CD40-expressing cells [macrophages, mesangial cells and renal tubular epithelial cells (RTEC)]. All experimental animals developed nephropathy. Compared to the ADR+IgG group, ADR+MR1 animals had significantly less histological injury (glomerulosclerosis and tubular atrophy) and functional injury (creatinine clearance). Kidneys of ADR+MR1 animals had significantly less macrophage infiltration than those of ADR+IgG animals. Interestingly, expression of CD40 and CD41 (a platelet-specific marker) was significantly less in ADR+MR1 animals compared to ADR+IgG animals. In vitro, CD154 blockade significantly attenuated upregulation of CCL2 gene expression by RTEC stimulated by activated macrophage-conditioned medium. In contrast, platelet-induced upregulation of macrophage and mesangial cell proinflammatory cytokine gene expression were not CD154-dependent. CD40-CD154 blockade has a significant innate renoprotective effect in ADR nephrosis. This is potentially due to inhibition of macrophage-derived soluble CD154.

  12. Deficiencies in the CD40 and CD154 receptor-ligand system reduce experimental lung metastasis. (United States)

    Ingersoll, Susan Blaydes; Langer, Florian; Walker, Jamie M; Meyer, Todd; Robson, Theresa; Amaya, Mildred; Desai, Hina; Francis, John L; Amirkhosravi, Ali


    It is established that experimental metastasis requires platelet activity. CD154 expressed on and released from activated platelets induces an inflammatory response in endothelial cells and monocytes, including tissue factor production. CD154 has also been shown to activate platelets in vitro and promote thrombus stability in vivo. These CD154 effects may be mediated, at least in part, by CD40 signaling on platelets and vascular endothelial cells. We have previously demonstrated prolonged bleeding and PFA-100 closure times in mice deficient for Cd154 or its receptor Cd40. In the present study, we hypothesized that Cd40 and Cd154 promote lung tumor formation in experimental metastasis in mice. We created mice doubly deficient in Cd40 and Cd154 (Dbl KO) and found them to be both fertile and viable. Injected tumor cells seeded poorly in mice deficient in Cd40 or Cd154, as well as Dbl KO, compared to wild-type mice. We sought to determine whether blood-borne Cd40 versus endothelial Cd40 contribute differentially to reduced experimental lung metastasis, as observed in Cd40 deficient mice. By bone marrow transplantation, we created mice deficient for Cd40 either in the blood compartment but not in the endothelium, or vice versa. We found that mice deficient in blood compartment Cd40 had fewer lung nodules compared to wild-type mice and mice deficient in endothelial Cd40. Our findings suggest an important contribution of the Cd40-Cd154 pathway to experimental lung metastasis. Furthermore, the data points to a selective role for peripheral blood cell Cd40 in this process.

  13. Optical amplification and electroluminescence at 1.54 μm in Er-doped zinc silicate germanate on silicon (United States)

    Baker, C. C.; Heikenfeld, J.; Yu, Z.; Steckl, A. J.


    Optical amplification and electroluminescence at 1.5 μm is reported in Er-doped Zn2Si0.5Ge0.5O4 (ZSG:Er) on silicon. ZSG:Er films were deposited by rf sputtering from a composite target in Ar/O2 mixtures. Channel waveguides were fabricated by plasma etching with Cl/Ar. The refractive index of ZSG:Er was found to be 1.75 at 1.54 μm. Signal enhancement greater than 13 dB and an internal gain of ˜2 dB have been achieved by optically pumping a 4.7 cm ZSG:Er amplifier. Electroluminescence at 1.5 μm was achieved using an ac device structure with a ZSG:Er central layer and upper and lower dielectric layers.

  14. Quantum dot based on tin/titanium mixed oxide doped with europium synthesized by protein sol-gel method

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f


    Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)

  15. 340nm UV LED excitation in time-resolved fluorescence system for europium-based immunoassays detection (United States)

    Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian


    In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.

  16. Interaction of europium and nickel with calcite studied by Rutherford Backscattering Spectrometry and Time-Resolved Laser Fluorescence Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sabau, A. [Agence Nationale pour la gestion des Déchets RAdioactifs, 1-7 rue J. Monnet, Parc de la Croix Blanche, 92298 Châtenay-Malabry Cedex (France); Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Pipon, Y., E-mail: [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Institut Universitaire de Technologie (IUT) Lyon-1, Université Claude Bernard Lyon 1, 69 622 Villeurbanne Cedex (France); Toulhoat, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); CEA/DEN, Saclay, 91191 Gif sur Yvette (France); Lomenech, C. [Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Jordan, N. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); Moncoffre, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Barkleit, A. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); and others


    This study aims at elucidating the mechanisms regulating the interaction of Eu and Ni with calcite (CaCO{sub 3}). Calcite powders or single crystals (some mm sized) were put into contact with Eu or Ni solutions at concentrations ranging from 10{sup −3} to 10{sup −5} mol L{sup −1} for Eu and 10{sup −3} mol L{sup −1} for Ni. The sorption durations ranged from 1 week to 1 month. Rutherford Backscattering Spectrometry (RBS) well adapted to discriminate incorporation processes such as: (i) adsorption or co precipitation at the mineral surfaces or, (ii) incorporation into the mineral structure (through diffusion for instance), has been carried out. Moreover, using the fluorescence properties of europium, the results have been compared to those obtained by Time-Resolved Laser Fluorescence Spectroscopy (TRLFS) on calcite powders. For the single crystals, complementary SEM observations of the mineral surfaces at low voltage were also performed. Results showed that Ni accumulates at the calcite surface whereas Eu is also incorporated at a greater depth. Eu seems therefore to be incorporated into two different states in calcite: (i) heterogeneous surface accumulation and (ii) incorporation at depth greater than 160 nm after 1 month of sorption. Ni was found to accumulate at the surface of calcite without incorporation.

  17. Orange-red emitting europium doped strontium ortho-silicate phosphor prepared by a solid state reaction method. (United States)

    Sahu, Ishwar Prasad


    In the present article we report europium-doped strontium ortho-silicates, namely Sr 2 SiO 4 :xEu 3+ (x = 1.0, 1.5, 2.0, 2.5 or 3.0 mol%) phosphors, prepared by solid state reaction method. The crystal structures of the sintered phosphors were consistent with orthorhombic crystallography with a Pmna space group. The chemical compositions of the sintered phosphors were confirmed by energy dispersive X-ray spectroscopy (EDS). Thermoluminescence (TL) kinetic parameters such as activation energy, order of kinetics and frequency factors were calculated by the peak shape method. Orange-red emission originating from the 5 D 0 - 7 F J (J = 0, 1, 2, 3) transitions of Eu 3+ ions could clearly be observed after samples were excited at 395 nm. The combination of these emissions constituted orange-red light as indicated on the Commission Internationale de l'Eclairage (CIE) chromaticity diagram. Mechanoluminescence (ML) intensity of the prepared phosphor increased linearly with increasing impact velocity of the moving piston that suggests that these phosphors can also be used as sensors to detect the stress of an object. Thus, the present investigation indicates that the piezo-electricity was responsible for producing ML in the prepared phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Spectrophotometric Determination and Removal of Unchelated Europium Ions from Solutions Containing Eu-Diethylenetriaminepentaacetic Acid Chelate-Peptide Conjugates1 (United States)

    Dayan Elshan, N. G. R.; Patek, Renata; Vagner, Josef; Mash, Eugene A.


    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination, as well as the success of metal ion removal upon attempted purification. We compared the use of Empore™ chelating disks and Chelex® 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore™ chelating disks were found to give much higher recoveries of the probes under the conditions utilized. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. PMID:25058927

  19. Reusable temperature-sensitive luminescent material based on vitrified film of europium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Lobkov, Vladimir S.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    We have proposed a novel temperature-sensitive luminescent material which is a 20 μm thick vitrified film (sandwiched between two quartz plates) fabricated from an amorphous powder of a mesogenic europium(III) β-diketonate complex through a melt-processing technique. The film photoexcited by a 337 nm pulsed nitrogen laser displays a typical Eu3+ ion luminescence bands with the strongest peak at 612 nm and with the decay time of 537 μs at 298 K. It is obtained that both the mean luminescence intensity and the luminescence decay time at 612 nm decrease significantly with temperature increasing from 298 to 348 K; the average values of the relative and absolute temperature sensitivities of the luminescence decay time in the range of 298-348 K are -1.2%·K-1 and -6.5 μs·K-1, respectively. The thermal quenching mechanism of the luminescent properties was analyzed and discussed. The experiments showed that, the luminescent properties of the film is insensitive to oxygen, the film is photostable under UV light, there is full reversibility of the temperature-dependent luminescence intensity and the decay time, and the high luminescence brightness of the film can be observed with violet light excitation. These factors indicated that the film is promising material for reusable luminescent thermometers, suitable for long-term monitoring in the range of 298-348 K.

  20. Differential ERK activation during autophagy induced by europium hydroxide nanorods and trehalose: Maximum clearance of huntingtin aggregates through combined treatment. (United States)

    Wei, Peng-Fei; Jin, Pei-Pei; Barui, Ayan Kumar; Hu, Yi; Zhang, Li; Zhang, Ji-Qian; Shi, Shan-Shan; Zhang, Hou-Rui; Lin, Jun; Zhou, Wei; Zhang, Yun-Jiao; Ruan, Ren-Quan; Patra, Chitta Ranjan; Wen, Long-Ping


    Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Synthesis of europium-doped VSOP, customized enhancer solution and improved microscopy fluorescence methodology for unambiguous histological detection. (United States)

    de Schellenberger, Angela Ariza; Hauptmann, Ralf; Millward, Jason M; Schellenberger, Eyk; Kobayashi, Yuske; Taupitz, Matthias; Infante-Duarte, Carmen; Schnorr, Jörg; Wagner, Susanne


    Intrinsic iron in biological tissues frequently precludes unambiguous the identification of iron oxide nanoparticles when iron-based detection methods are used. Here we report the full methodology for synthesizing very small iron oxide nanoparticles (VSOP) doped with europium (Eu) in their iron oxide core (Eu-VSOP) and their unambiguous qualitative and quantitative detection by fluorescence. The resulting Eu-VSOP contained 0.7 to 2.7% Eu relative to iron, which was sufficient for fluorescent detection while not altering other important particle parameters such as size, surface charge, or relaxivity. A customized enhancer solution with high buffer capacity and nearly neutral pH was developed to provide an antenna system that allowed fluorescent detection of Eu-VSOP in cells and histologic tissue slices as well as in solutions even under acidic conditions as frequently obtained from dissolved organic material. This enhancer solution allowed detection of Eu-VSOP using a standard fluorescence spectrophotometer and a fluorescence microscope equipped with a custom filter set with an excitation wavelength (λex) of 338 nm and an emission wavelength (λem) of 616 nm. The fluorescent detection of Eu-doped very small iron oxide nanoparticles (Eu-VSOP) provides a straightforward tool to unambiguously characterize VSOP biodistribution and toxicology at tissue, and cellular levels, providing a sensitive analytical tool to detect Eu-doped IONP in dissolved organ tissue and biological fluids with fluorescence instruments.

  2. Efficient solution-processed double-layer red OLEDs based on a new europium complex with a carbazole group. (United States)

    Liu, Jian; Miao, Jing-Sheng; Wu, Hong-Bin


    A new europium complex EuL3 (Phen) was used as guest dopant, and a blend of Polyvinylcarbazole and 2-(biphenyl-4-yl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole (PVK and PBD) as host matrix. Efficient red organic light-emitting devices (OLEDs) with double-layer structures were manufactured via a solution-processed technique. The guest-doped levels were 1, 3 and 5 wt% relative to the blend mass, respectively. For the 1 wt% doping-level device, the luminous efficiency and luminance were up to 2.96 cd/A and 635.78 cd/m(2) with emissions from both EuL3 (Phen) and from the host; for the 3 wt% doping-level device, the maximum luminous efficiency and luminance were 1.01 cd/A and 370.91 cd/m(2) for the single emission from EuL3 (Phen) only. Copyright © 2014 John Wiley & Sons, Ltd.

  3. Europium Nanospheres-Based Time-Resolved Fluorescence for Rapid and Ultrasensitive Determination of Total Aflatoxin in Feed. (United States)

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen


    Immunochromatographic (IC) assays are considered suitable diagnostic tools for the determination of mycotoxins. A europium nanospheres-based time-resolved fluorescence immunoassay (Eu-Nano-TRFIA), based on a monoclonal antibody and a portable TRFIA reader, was developed to determine total aflatoxin (including aflatoxins B1, B2, G1, and G2) levels in feed samples. Under optimized conditions, the Eu-Nano-TRFIA method detected total aflatoxin within 12 min. It showed good linearity (R(2) > 0.985), LOD of 0.16 μg/kg, a wide dynamic range of 0.48-30.0 μg/kg, recovery rates of 83.9-113.9%, and coefficients of variation (CVs) of 3.5-8.8%. In the 397 samples from company and livestock farms throughout China, the detection rate was 78.3%, concentrations were 0.50-145.30 μg/kg, the highest total aflatoxin content was found in cottonseed meal, and corn was found to be the most commonly contaminated feed. This method could be a powerful alternative for the rapid and ultrasensitive determination of total aflatoxin in quality control and meet the required Chinese maximum residue limits.

  4. Spectrophotometric determination and removal of unchelated europium ions from solutions containing Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. (United States)

    Elshan, N G R Dayan; Patek, Renata; Vagner, Josef; Mash, Eugene A


    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination as well as the success of metal ion removal on attempted purification. We compared the use of Empore chelating disks and Chelex 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore chelating disks were found to give much higher recoveries of the probes under the conditions used. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Formation and structural characterization of a europium(II mono(scorpionate complex and a sterically crowded pyrazabole

    Directory of Open Access Journals (Sweden)

    Phil Liebing


    Full Text Available The reaction of EuI2(THF2 with potassium hydrotris(3,5-diisopropylpyrazolylborate (K[HB(3,5-iPr2pz3] (= KTpiPr2, pz = pyrazolyl in a molar ratio of 1:1.5 resulted in extensive ligand fragmentation and formation of the europium(II mono(scorpionate complex bis(3,5-diisopropyl-1H-pyrazole[hydrotris(3,5-diisopropylpyrazolylborato]iodidoeuropium(II, [Eu(C27H46BN6I(C9H16N22] or (TpiPr2(3,5-iPr2pzH2EuIII, 1, in high yield (78%. As a typical by-product, small amounts of the sterically crowded pyrazabole derivative trans-4,8-bis(3,5-diisopropylpyrazol-1-yl-1,3,5,7-tetraisopropylpyrazabole, C36H62B2H8 or trans-{(3,5-iPr2pzHB(μ-3,5-iPr2pz}2, 2, were formed. Both title compounds have been structurally characterized through single-crystal X-ray diffraction. In 1, two isopropyl groups are each disordered over two orientations with occupancy ratios of 0.574 (10:0.426 (10 and 0.719 (16:0.281 (16. In 2, one isopropyl group is similarly disordered, occupancy ratio 0.649 (9:0.351 (9.

  6. Spectrofluorimetric study of the interaction between europium(III) and moxifloxacin in micellar solution and its analytical application (United States)

    Kamruzzaman, Mohammad; Alam, Al-Mahmnur; Lee, Sang Hak; Ragupathy, Dhanusuraman; Kim, Young Ho; Park, Sang-Ryoul; Kim, Sung Hong


    A sensitive spectrofluorimetric method has been developed for the determination of moxifloxacin (MOX) using europium(III)-MOX complex as a fluorescence probe in the presence of an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS). The fluorescence (FL) intensity of Eu 3+ was enhanced by complexation with MOX at 614 nm after excitation at 373 nm. The FL intensity of the Eu 3+-MOX complex was significantly intensified in the presence of SDBS. Under the optimum conditions, it was found that the enhanced FL intensity of the system showed a good linear relationship with the concentration of MOX over the range of 1.8 × 10 -11-7.3 × 10 -9 g mL -1 with a correlation coefficient of 0.9998. The limit of detection of MOX was found to be 2.8 × 10 -12 g mL -1 with relative standard deviation (RSD) of 1.25% for 5 replicate determination of 1.5 × 10 -8 g mL -1 MOX. The proposed method is simple, offers higher sensitivity with wide linear range and can be successfully applied to determine MOX in pharmaceutical and biological samples with good reproducibility. The luminescence mechanism is also discussed in detail with ultraviolet absorption spectra.

  7. Photoluminescence properties of europium doped di-strontium magnesium di-silicate phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available Europium doped di-strontium magnesium di-silicate phosphor namely (Sr2MgSi2O7:Eu3+ was prepared by the traditional high temperature solid state reaction method. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P42¯1m, this structure is a member of the melilite group and forms a layered compound. The EDX and FTIR spectra confirm the present elements in Sr2MgSi2O7:Eu3+ phosphor. Photoluminescence measurements showed that the phosphor exhibited strong emission peak with good intensity, corresponding to 5D0 → 7F2 (613 nm red emission and weak 5D0 → 7F1 (590 nm orange emission. The excitation spectra monitored at 613 nm show broad band from 220 to 300 nm ascribed to O–Eu charge-transfer band (CTB centered at about 269 nm, and the other peaks in the range of 300–400 nm originated from f–f transitions of Eu3+ ions. The strongest band at 395 nm can be assigned to 7F0 / 5L6 transition of Eu3+ ions due to the typical f–f transitions within Eu3+ of 4f6 configuration.

  8. Highly selective luminescent sensing of picric acid based on a water-stable europium metal-organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Tifeng; Zhu, Fengliang; Cui, Yuanjing, E-mail:; Yang, Yu; Wang, Zhiyu; Qian, Guodong, E-mail:


    A water-stable metal-organic framework (MOF) EuNDC has been synthesized for selective detection of the well-known contaminant and toxicant picric acid (PA) in aqueous solution. Due to the photo-induced electron transfer and self-absorption mechanism, EuNDC displayed rapid, selective and sensitive detection of PA with a detection limit of 37.6 ppb. Recyclability experiments revealed that EuNDC retains its initial luminescent intensity and same quenching efficiency in each cycle, suggesting high photostability and reusability for long-term sensing applications. The excellent detection performance of EuNDC makes it a promising PA sensing material for practical applications. - Graphical abstract: A water-stable europium-based metal-organic framework has been reported for highly selective sensing of picric acid (PA) with a detection limit of 37.6 ppb in aqueous solution. - Highlights: • A water-stable metal-organic framework (MOF) EuNDC was synthesized. • The highly selective detection of picric acid with a detection limit of 37.6 ppb was realized. • The detection mechanism were also presented and discussed.

  9. One-pot carbonization synthesis of europium-doped carbon quantum dots for highly selective detection of tetracycline (United States)

    Li Liu, Meng; Chen, Bin Bin; Yang, Tong; Wang, Jian; Liu, Xi Dong; Zhi Huang, Cheng


    The detection of tetracycline is of great significance because of its damaging effects on human health, such as renal toxicity and hemolytic anemia. Any release of tetracycline into the surrounding environment can produce bacterial drug resistance. We develop a new sensitive and selective detection approach for tetracycline in complex water samples by preparing europium-doped carbon quantum dots (Eu-CQDs) through a simple and rapid carbonization method operating at 200 °C for 5 min. The Eu-CQDs are characterized by blue photoluminescence, excitation-wavelength-dependent emission and excellent stability. Importantly, the fluorescence of the Eu-CQDs can be quenched efficiently by tetracycline, based on the strong inner filter effect mechanism between Eu-CQDs and tetracycline, making the fluorescence intensity ratio (I 0/I) of the Eu-CQDs at 465 nm correlate linearly with the concentration of tetracycline in the range of 0.5-200 μM, with a limit of detection of 0.3 μM. This shows the broad applicability of the Eu-CQDs in pursuing the concepts of simplicity and specificity for analytical purposes.

  10. Mesoporous Europium-Doped Titania Nanoparticles (Eu-MTNs) for Luminescence-Based Intracellular Bio-Imaging. (United States)

    Chen, Kuan-Chou; Dutta, Saikat; Yamauchi, Yusuke; Alshehri, Saad M; Nguyen, Mai Thanh; Yonezawa, Tetsu; Shen, Kun-Hung; Wu, Kevin C W


    Monodisperse and mesoporous europium (Eu)-doped titania nanoparticles (denoted as Eu-MTNs) were prepared by a co-synthesis method with the presence of a cationic surfactant (i.e., CTAB). A maximum loading amount of 8 mol% of Eu could be successfully incorporated into the framework of MTNs. The synthesized Eu-MTNs samples were characterized with X-ray diffraction (XRD) and scanning electron microscopy (SEM), with their luminescent property examined by photoluminescence (PL). Under ultraviolet irradiation, the Eu-MTNs samples exhibit several characteristic luminescence corresponding to 5D0-7F(j) for Eu+3 ions, which can be attributed to the energy transfer from titania nanocrystallite to Eu3+ ions dispersed in amorphous mesoporous titania region. The potential intracellular bio-imaging application of the synthesized Eu-MTN nanoparticles was demonstrated with a breast cancer cell line (i.e., BT-20). High biocompatibility and strong luminescence of the Eu-MTNs show great potential in biomedical applications.

  11. Abrogation of CD40–CD154 Signaling Impedes the Homeostasis of Thymic Resident Regulatory T Cells by Altering the Levels of IL-2, but Does Not Affect Regulatory T Cell Development (United States)

    Cuss, Steven M.


    Identification of costimulatory signals required for murine regulatory T (Treg) cell development relies on measuring the frequency of total thymic Treg cells. However, the thymus contains both resident and newly developed Treg cells; whether such signals target both populations is unknown. In this study, we show that CD40–CD154 blockade specifically targeted thymic resident Treg cells, but not, as was previously believed, newly developed Treg cells. Unlike CD28–CD80/CD86 signals, CD40–CD154 signals were not required for Treg cell precursor development. Instead we demonstrate that homeostatic proliferation of thymic resident Treg cells was dependent on CD40–CD154 signals maintaining IL-2 levels. Furthermore, in newborn mice, where all Treg cells are newly developed, blockade of CD40–CD154 signals had no effect on thymic Treg numbers or their proliferation. Our studies highlight the complexity in the study of thymic Treg cell development due to the heterogeneity of thymic Treg cells. PMID:22802415

  12. The europium and praseodymium hydrolysis in a 2M NaCl environment; La hidrolisis del europio y del praseodimio en un medio 2M de NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)


    It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)

  13. KLF10 Mediated Epigenetic Dysregulation of Epithelial CD40/CD154 Promotes Endometriosis. (United States)

    Delaney, Abigail A; Khan, Zaraq; Zheng, Ye; Correa, Luiz F; Zanfagnin, Valentina; Shenoy, Chandra C; Schoolmeester, John K; Saadalla, Abdulrahman M; El-Nashar, Sherif; Famuyide, Abimbola O; Subramaniam, Malayannan; Hawse, John R; Khazaie, Khashayarsha; Daftary, Gaurang S


    Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human disease association, loss of the paralog Klf10 causes a unique inflammatory, cystic endometriosis phenotype in contrast to fibrotic progression seen with loss of Klf11. We identify here for the first time a novel role for KLF10 in endometriosis. In an animal endometriosis model, unlike wild-type controls, Klf10(-/-) animals developed cystic lesions with massive immune infiltrate and minimal peri-lesional fibrosis. The Klf10(-/-) disease progression phenotype also contrasted with prolific fibrosis and minimal immune cell infiltration seen in Klf11(-/-) animals. We further found that lesion genotype rather than that of the host determined each unique disease progression phenotype. Mechanistically, KLF10 regulated CD40/CD154-mediated immune pathways. Both inflammatory as well as fibrotic phenotypes are the commonest clinical manifestations in chronic fibro-inflammatory diseases such as endometriosis. The complementary, paralogous Klf10 and Klf11 models therefore offer novel insights into the mechanisms of inflammation and fibrosis in a disease-relevant context. Our data suggests that divergence in underlying gene dysregulation critically determines disease-phenotype predominance rather than the conventional paradigm of inflammation being precedent to fibrotic scarring. Heterogeneity in clinical progression and treatment response are thus likely from disparate gene regulation profiles. Characterization of disease phenotype-associated gene dysregulation offers novel approaches for developing targeted, individualized therapy for recurrent and recalcitrant chronic disease. © 2016 by the Society for the Study of Reproduction, Inc.

  14. Specific chiral sensing of amino acids using induced circularly polarized luminescence of bis(diimine)dicarboxylic acid europium(III) complexes. (United States)

    Okutani, Kazuhiro; Nozaki, Koichi; Iwamura, Munetaka


    The circularly polarized luminescence (CPL) from [Eu(pda)2](-) (pda = 1,10-phenanthroline-2,9-dicarboxylic acid) and [Eu(bda)2](-) (bda = 2,2'-bipyridine-6,6'-dicarboxylic acid) in aqueous solutions containing various amino acids was investigated. The europium(III) complexes exhibited bright-red luminescence assignable to the f-f transition of the Eu(III) ion when irradiated with UV light. Although the luminescence was not circularly polarized in the solid state or in aqueous solutions, in accordance with the achiral crystal structure, the complexes exhibited detectable induced CPL (iCPL) in aqueous solutions containing chiral amino acids. In the presence of L-pyrrolidonecarboxylic acid, both [Eu(pda)2](-) and [Eu(bda)2](-) showed similar iCPL intensity (glum ∼ 0.03 for the (5)D0 → (7)F1 transition at 1 mol·dm(-3) of the amino acid). On the other hand, in the presence of L-histidine or L-arginine, [Eu(pda)2](-) exhibited intense CPL (glum ∼ 0.08 for the (5)D0 → (7)F1 transition at 0.10 mol·dm(-3) of the amino acid), whereas quite weak CPL was observed for [Eu(bda)2](-) under the same conditions (glum europium(III) complexes possess coordination structures similar to that in the crystal with slight distortion to form a chiral structure due to specific interaction with two zwitterionic amino acids. This mechanism was in stark contrast to that of the europium(III) complex-pyrrolidonecarboxylic acid system in which one amino acid coordinates to the Eu(III) ion to yield an achiral coordination structure.

  15. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays. (United States)

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun


    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  16. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system

    Directory of Open Access Journals (Sweden)

    D. Singh


    Full Text Available Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle–γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with ‘fast’ α and 2α-emission channels are found to be entirely different from fusion–evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  17. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system (United States)

    Singh, D.; Linda, Sneha B.; Giri, Pankaj K.; Mahato, Amritraj; Tripathi, R.; Kumar, Harish; Afzal Ansari, M.; Sathik, N. P. M.; Ali, Rahbar; Kumar, Rakesh; Muralithar, S.; Singh, R. P.


    Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle-γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with 'fast' α and 2α-emission channels are found to be entirely different from fusion-evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  18. Europium-activated phosphors containing oxides of rare-earth and group-IIIB metals and method of making the same (United States)

    Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan


    Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.

  19. Bis{[6-methoxy-2-(4-methylphenyliminiomethyl]phenolate-κ2O,O′}tris(nitrato-κ2O,O′europium(III

    Directory of Open Access Journals (Sweden)

    Hang-Ming Guo


    Full Text Available The crystal structure of title compound, [Eu(NO33(C15H15NO22], contains two Schiff base 6-methoxy-2-[(4-methylphenyliminomethyl]phenolate (L ligands and three independent nitrate ions that chelate to the europium(III ion via the O atoms. The coordination number of the EuIII ion is ten. The L ligands chelate with a strong Eu—O(deprotonated phenolate bond and a weak Eu—O(methoxy contact, the latter can be interpreted as the apices of the bicapped square-antiprismatic EuIII polyhedron. Intramolecular N—H...O hydrogen bonds occur.

  20. Some light-ion excitation-function measurements on titanium, yttrium, and europium, and associated results

    Energy Technology Data Exchange (ETDEWEB)

    West, H.I. Jr. [ed.; Lanier, R.G.; Mustafa, M.G.; Nuckolls, R.M.; Nagle, R.J.; O`Brien, H. [Lawrence Livermore National Lab., CA (United States); Frehaut, J.; Adam, A.; Philis, C. [Service de Physique et Techniques Nucleaires, Centre d`Etudes Bruyeres-le-Chatel, Boite Postale 12 (France)


    This report discusses: Fabrication of Plastic-Matrix-Encapsulated Accelerator Targets and Their Use in Measuring Nuclear Excitation Functions; Correcting Excitation Function Data in the Low Energy Region for Finite Thickness of the Target Foils, Including Effects of Straggling; Excitation Functions for the Nuclear Reactions on Titanium Leading to the Production {sup 48}V, {sup 44}Sc and {sup 47}Sc by Proton, Deuteron and Triton Irradiations at 0--35 MeV; Some Excitation Functions of Proton and Deuteron Induced Reactions on {sup 89}Y; Measurements of the Excitation Functions of the Isobaric Chain {sup 87}Y, {sup 87}Y{sup m}, {sup 87}Y{sup g} and {sup 87}Sr{sup m}; Levels in {sup 87}Y Observed in the Decay of {sup 87}Zr; and Nuclear Reaction Excitation Functions from the Irradiation of {sup 151,153}Eu with Protons And deuterons up to 35 MeV.

  1. [Effect of ICOS signaling on CD154/CD40 expressions in mice infected with Schistosoma japonicum]. (United States)

    Wang, Yu; Cai, Ru; Xia, Chao-ming


    To explore the effect of ICOS signaling on the CD154/CD40 expressions and immunopathology in mice infected with Schistosoma japonicum. ICOS transgenic (ICOS-Tg) mice and wildtype FVB/NJ mice were used as experimental schistosomiasis models. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of the liver in the mice infected with S. japonicuin were detected by flow cytometry and im- munohistochemical staining. HE staining was applied to observe the changes on the granulomatous of the mice liver. Compared with the wildtype FVB/NJ mice, the expressions of CD154 on CD4 T splenocytes and of CD40 on CD19' B splenocytes in the ICOS-Tg mice significantly increased in 12 and 16 weeks post-infection (all P CD154 on inflammatory cells around granulomatous infiltration in the liver of the ICOS-Tg mice were significantly higher than those of the wildtype FVB/NJ mice in 7, 12, 16 and 20 weeks post-infection (all P CD154/CD40 expressions, and may play an important role in the hepatic egg granuloma formation of schistosomiasis.

  2. Target Laboratory (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  3. Carbon footprint assessment of recycling technologies for rare earth elements: A case study of recycling yttrium and europium from phosphor. (United States)

    Hu, Allen H; Kuo, Chien-Hung; Huang, Lance H; Su, Chao-Chin


    Rare earth elements are key raw materials in high-technology industries. Mining activities and manufacturing processes of such industries have caused considerable environmental impacts, such as soil erosion, vegetation destruction, and various forms of pollution. Sustaining the long-term supply of rare earth elements is difficult because of the global shortage of rare earth resources. The diminishing supply of rare earth elements has attracted considerable concern because many industrialized countries regarded such elements as important strategic resources for economic growth. This study aims to explore the carbon footprints of yttrium and europium recovery techniques from phosphor. Two extraction recovery methods, namely, acid extraction and solvent extraction, were selected for the analysis and comparison of carbon footprints. The two following functional units were used: (1) the same phosphor amounts for specific Y and Eu recovery concentrations, and (2) the same phosphor amounts for extraction. For acid extraction method, two acidic solutions (H2SO4 and HCl) were used at two different temperatures (60 and 90°C). For solvent extraction method, acid leaching was performed followed by ionic liquid extraction. Carbon footprints from acid and solvent extraction methods were estimated to be 10.1 and 10.6kgCO2eq, respectively. Comparison of the carbon emissions of the two extraction methods shows that the solvent extraction method has significantly higher extraction efficiency, even though acid extraction method has a lower carbon footprint. These results may be used to develop strategies for life cycle management of rare earth resources to realize sustainable usage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Europium doped di-calcium magnesium di-silicate orange–red emitting phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu


    Full Text Available A new orange–red europium doped di-calcium magnesium di-silicate (Ca2MgSi2O7:Eu3+ phosphor was prepared by the traditional high temperature solid state reaction method. The prepared Ca2MgSi2O7:Eu3+ phosphor was characterized by X-ray diffractometer (XRD, transmission electron microscopy (TEM, field emission scanning electron microscopy (FESEM with energy dispersive x-ray spectroscopy (EDX, fourier transform infrared spectra (FTIR, photoluminescence (PL and decay characteristics. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P4¯21m, this structure is a member of the melilite group and forms a layered compound. The chemical composition of the sintered Ca2MgSi2O7:Eu3+ phosphor was confirmed by EDX spectra. The PL spectra indicate that Ca2MgSi2O7:Eu3+ can be excited effectively by near ultraviolet (NUV light and exhibit bright orange–red emission with excellent color stability. The fluorescence lifetime of Ca2MgSi2O7:Eu3+ phosphor was found to be 28.47 ms. CIE color coordinates of Ca2MgSi2O7:Eu3+ phosphor is suitable as orange-red light emitting phosphor with a CIE value of (X = 0.5554, Y = 0.4397. Therefore, it is considered to be a new promising orange–red emitting phosphor for white light emitting diode (LED application.

  5. Evaluation of in vivo cytogenetic toxicity of europium hydroxide nanorods (EHNs) in male and female Swiss albino mice. (United States)

    Bollu, Vishnu Sravan; Nethi, Susheel Kumar; Dasari, Rama Krishna; Rao, Soma Shiva Nageshwara; Misra, Sunil; Patra, Chitta Ranjan


    Our group already demonstrated that europium hydroxide nanorods (EHNs) show none or mild toxicity in C57BL/6 mice even at high dose and exhibited excellent pro-angiogenic activity towards in vitro and in vivo models. In the present study, we evaluated the in vivo cytogenetic toxicity of intraperitoneally administered EHNs (12.5-250 mg/kg/b.w.) in male and female Swiss albino mice by analyzing chromosomal aberrations (CAs), mitotic index (MI), micronucleus (MN) from bone marrow and peripheral blood. Furthermore, we performed the cytogenetic toxicity study of EHNs towards Chinese hamster ovary (CHO) cells, in order to compare with the in vivo results. The results of CA assay of mice treated with EHNs (12.5-125 mg/kg/b.w.) showed no significant change in the formation of aberrant metaphases compared to the control group. Also, there was no significant difference in the number of dividing cells between the control group and EHNs-treated groups observed by MI study, suggesting the non-cytotoxicity of EHNs. Additionally, FACS study revealed that EHNs do not arrest cells at any phase of cell cycle in the mouse model. Furthermore, MN test of both bone marrow and peripheral blood showed no significant differences in the induction of MNs when compared with the control group. In vitro results from CHO cells also support our in vivo observations. Considering the role of angiogenesis by EHNs and the absence of its genotoxicity in mouse model, we strongly believe the future application of EHNs in treating various diseases, where angiogenesis plays an important role such as cardiovascular diseases, ischemic diseases and wound healing.

  6. 46 CFR 154.540 - Quick-closing shut-off valves: Emergency shut-down system. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Quick-closing shut-off valves: Emergency shut-down... shut-down system. The quick-closing shut-off valves under §§ 154.530, 154.532, and 154.538 must have an emergency shut-down system that: (a) Closes all the valves; (b) Is actuated by a single control in at least...

  7. A hydrophobic patch surrounding Trp154 in human neuroserpin controls the helix F dynamics with implications in inhibition and aggregation (United States)

    Ali, Mohammad Farhan; Kaushik, Abhinav; Kapil, Charu; Gupta, Dinesh; Jairajpuri, Mohamad Aman


    Neuroserpin (NS) mediated inhibition of tissue-type plasminogen activator (tPA) is important for brain development, synapse formation and memory. Aberrations in helix F and β-sheet A movement during inhibition can directly lead to epilepsy or dementia. Conserved W154 residue in a hydrophobic patch between helix F and β-sheet A is ideally placed to control their movement during inhibition. Molecular Dynamics (MD) simulation on wild type (WT) NS and its two variants (W154A and W154P) demonstrated partial deformation in helix F and conformational differences in strands 1A and 2A only in W154P. A fluorescence and Circular Dichroism (CD) analysis with purified W154 variants revealed a significant red-shift and an increase in α-helical content in W154P as compared to W154A and WT NS. Kinetics of tPA inhibition showed a decline in association rates (ka) for W154A as compared to WT NS with indication of complex formation. Appearance of cleaved without complex formation in W154P indicates that the variant acts as substrate due to conformational misfolding around helix F. Both the variants however showed increased rate of aggregation as compared to WT NS. The hydrophobic patch identified in this study may have importance in helix F dynamics of NS.

  8. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline (United States)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir


    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  9. Investigation on the co-luminescence effect of europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system and its application. (United States)

    Si, Hailin; Zhao, Fang; Cai, Huan


    A novel luminescence, enhancement phenomenon in the europium(III)-dopamine-sodium dodecylbenzene sulfonate system was observed when lanthanum(III) was added. Based on this, a sensitive co-luminescence method was established for the determination of dopamine. The luminescence signal for the europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system was monitored at λ(ex) = 300 nm, λ(em) = 618 nm and pH 8.3. Under optimized conditions, the enhanced luminescence signal responded linearly to the concentration of dopamine in the range 1.0 × 10(-10)-5.0 × 10(-7) mol/L with a correlation coefficient of 0.9993 (n = 11). The detection limit (3σ) was 2.7 × 10(-11) mol/L and the relative standard deviation for 11 parallel measurements of 3.0 × 10(-8) mol/L dopamine was 1.9%. The presented method was successfully applied for the estimation of dopamine in samples of pharmaceutical preparations, human serum and urine. The possible luminescence enhancement mechanism of the system is discussed briefly. Copyright © 2013 John Wiley & Sons, Ltd.

  10. Europium-phenolic network coated BaGdF5 nanocomposites for tri-modal computed tomography/magnetic resonance/luminescence imaging. (United States)

    Zhu, Wei; Liang, Shuang; Wang, Jing; Yang, Zhe; Zhang, Li; Yuan, Tianmeng; Xu, Zushun; Xu, Haibo; Li, Penghui


    Multifunctional nanocomposites based on BaGdF5 nanoparticles (NPs) and metal phenolic network (MPN) have been engineered as novel contrast agents for potential applications in X-ray computed tomography, magnetic resonance and luminescence imaging. The BaGdF5@MPN nanocomposites were synthesized at room temperature by coating BaGdF5 NPs with europium-phenolic network, which was obtained by the coordination of europium (III) with tannic acid (TA). The in vitro cytotoxicity assays against HepG2 cells revealed that the BaGdF5@MPN nanocomposites presented better cytocompatibility and lower cytotoxity than pure BaGdF5 NPs. In addition, vivid red and green luminescence can be observed by confocal laser scanning microscope (CLSM) from the BaGdF5@MPN nanocomposites laden HepG2 cells under the excitation of UV (390 nm) and visible light (440 nm), respectively. The longitudinal relaxivity value (r1) of the nanocomposites was 2.457 mM-1s-1. Moreover, the nanocomoposites exhibited X-ray computed tomography (CT) and T1-weighted magnetic resonance (MR) imaging capacities, and the intensities of the enhanced signals of in vitro CT and MR images were proportional to the concentrations of the nanocomposites. These results indicated that the as-prepared BaGdF5@MPN nanocomposites are promising contrast agents for CT/MR/luminescence imaging.

  11. Effective visible light-active boron and europium co-doped BiVO4 synthesized by sol-gel method for photodegradion of methyl orange. (United States)

    Wang, Min; Che, Yinsheng; Niu, Chao; Dang, Mingyan; Dong, Duo


    Eu-B co-doped BiVO4 visible-light-driven photocatalysts have been synthesized using the sol-gel method. The resulting materials were characterized by a series of joint techniques, including XPS, XRD, SEM, BET, and UV-vis DRS analyses. Compared with BiVO4 and B-BiVO4 photocatalysts, the Eu-B-BiVO4 photocatalysts exhibited much higher photocatalytic activity for methyl orange (MO) degradation under visible light irradiation. The optimal Eu doping content is 0.8 mol%. It was revealed that boron and europium were doped into the lattice of BiVO4 and this led to more surface oxygen vacancies, high specific surface areas, small crystallite size, a narrower band gap and intense light absorbance in the visible region. The doped Eu(III) cations can help in the separation of photogenerated electrons. The synergistic effects of boron and europium in doped BiVO4 were the main reason for improving visible light photocatalytic activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Emission tunability and local environment in europium-doped OH{sup −}-free calcium aluminosilicate glasses for artificial lighting applications

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others


    The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.

  13. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand expression in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Chien-Hsueh Tung

    Full Text Available CD154 (commonly referred to as CD40-ligand is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA. TNF-α blockade treatment had dramatic efficacy in RA.To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA.Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points.The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001. The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221. Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187.TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  14. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand) expression in rheumatoid arthritis. (United States)

    Tung, Chien-Hsueh; Lu, Ming-Chi; Lai, Ning-Sheng; Wu, Shu-Fen


    CD154 (commonly referred to as CD40-ligand) is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA). TNF-α blockade treatment had dramatic efficacy in RA. To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA. Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points. The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001). The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221). Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187). TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  15. Pulsed laser deposition of europium-doped multilayer thin films for spectral storage applications (United States)

    Bezares, Francisco J.

    This thesis studies different Eu optical centers in MgS:Eu and CaS:Eu thin films produced by Chemically Controlled Pulse Laser Deposition (CCPLD) and evaluates their suitability for the development of spectral storage devices of the future. The produced thin films consist of one or more optically active layer(s), MgS:Eu, CaS:Eu or a similar material, and a corresponding ZnS capping layer that functions as a protecting barrier for the other layers and preserves their composition and integrity. Given that the synthesis of the materials used to produce the multilayer structures in this work proved a great challenge, careful attention was given to the optimization of all fabrication parameters. Mass Spectrometry was used during the deposition of the thin films and the data obtained resulted on improvements and optimization of the deposition process. Scanning electron microscopy studies of these thin films were conducted to study degradation upon long-term storage. Microscopy results show that the morphology of the produced thin films is correlated to the growth environment during deposition and deterioration of the deposited materials could be initiated by nano-gaps and cracks in the capping layer of the thin films. In addition to optical centers in MgS:Eu and CaS:Eu, new centers were created by changing the thin film growth environment inside a hi-vacuum chamber, modifying the composition of the ablation target material, or both. For example, introducing O2--, or alternatively HCl, inside the CCPLD chamber while producing MgS:Eu thin films results in the formation of impurity associated centers across lattice sites throughout the deposited structures. In another method of impurity doping studied, Cl-- and Na+ were introduced into the MgS:Eu and CaS:Eu lattices by mixing trace amounts of the impurity ions into these materials in polycrystalline form and making this mixture a deposition target by hi-pressure cold compression technique. The introduction of these impurity

  16. A microscopic study of deformation systematics in 154− 166Dy ...

    Indian Academy of Sciences (India)

    The Hartree–Bogoliubov (HB) framework of calculations has been applied for calculating various nuclear structure quantities for 154−166Dy mass chains. In this framework, the intrinsic quadrupole moments, the low-lying yrast states ( E 2 + and E 4 + ) and occupation numbers for various shell model orbits have been ...

  17. Dual function of the hemagglutinin H5 fused to chicken CD154 in a ...

    African Journals Online (AJOL)

    Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study. AG Pose, ES Rodriguez, AC Mendez, JN Gomez, AV Redondo, ER Rodriguez, EMG Ramos, AA Gutierrez, MPR Molto, DG Roche, YS Ugalde, AM Lopez ...

  18. 40 CFR 154.5 - Burden of persuasion in determinations under this part. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Burden of persuasion in determinations... (CONTINUED) PESTICIDE PROGRAMS SPECIAL REVIEW PROCEDURES General Provisions § 154.5 Burden of persuasion in... principle that the burden of persuasion that a pesticide product is entitled to registration or continued...

  19. A microscopic study of deformation systematics in 154−166Dy ...

    Indian Academy of Sciences (India)

    A microscopic study of deformation systematics in 154−166Dy isotopes. AMITA DUA, ARUN BHARTI. ∗ and S K KHOSA. Department of Physics, University of Jammu, Jammu & Kashmir 180 006, India. ∗. Corresponding Author. E-mail: arunbharti MS received 30 March 2006; revised 9 March 2007; ...

  20. 5 CFR 1201.154 - Time for filing appeal; closing record in cases involving grievance decisions. (United States)


    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Time for filing appeal; closing record in... Allegations of Discrimination § 1201.154 Time for filing appeal; closing record in cases involving grievance... matter otherwise appealable to the Board must comply with the following time limits: (a) Where the...