On the composition of nonstoichiometric europium monoxide
International Nuclear Information System (INIS)
Ignat'eva, N.I.
1990-01-01
Consideration is given to results of of investigation into chemical composition, homogeneity region, type of disordering of nonstoichiometric europium monoxide. Precision methods of X-ray diffraction, electron-microscopic, atomic-absorption chemical analysis were used. It is shown that lattice volume reduces with increase of oxygen content in the oxide. For monocrystal of EuO 1.01 composition a=5.146 A. All samples of europium monoxide are characterized by low conductivity. Conductivity value changes by two orders (from 10 -8 to 10 -6 Θ -1 ·cm -1 ) when passing from the sample of stoichiometric composition to maximally disordered one. The disordering is considered according to the type of charged cation vacancies, leading to occurrence of equivalent number of electron defects of positive holes. 4 refs.; 1 tab
Energy Technology Data Exchange (ETDEWEB)
Wynter, C. I., E-mail: wynterc@ncc.edu [Nassau Community College, Department of Chemistry (United States); Ryan, D. H. [McGill University, Centre for the Physics Materials, Department of Physics (Canada); Taneja, S. P. [Maharshi Dayanand University, Department of Physics (India); May, L. [Catholic University of America, Department of Chemistry (United States); Oliver, F. W. [Morgan State University, Department of Physics (United States); Brown, D. E. [Northern Illinois University, Department of Physics (United States); Iwunzie, M. [Morgan State University, Department of Chemistry (United States)
2005-11-15
Although a number of europium water insoluble chelates have been prepared for several decades, the covalent nature of these compounds has never been established in any quantitative fashion. Shifts in the I.R. bands and conductivity measurements of these salts were hitherto used to qualitatively compare their molecular nature. In this communique we have used temperature coefficients of {sup 151}Eu Moessbauer spectra to determine the Debye temperatures ({theta}{sub D}) of three europium chelates: namely europium oxalate, europium bissalen ammonium (recently reported) and europium benzoate and compared their {theta}{sub D} with the measured {theta}{sub D} of the known ionic EuF{sub 3}. Additionally, the mean square amplitude (
Europium-151 Moessbauer spectroscopic and XANES investigation of europium-exchanged Y-zeolite
International Nuclear Information System (INIS)
Berry, F.J.; Marco, J.F.; Steel, A.T.
1994-01-01
Eu 3+ in ca. 10 wt% europium-exchanged Y-zeolite is partially reduced by treatment in hydrogen at 600 C to Eu 2+ . The reduction of Eu 3+ is more readily achieved in Y-zeolite than in europium(III) oxide. The discrepancy in the extent of reduction as revealed by 151 Eu Moessbauer spectroscopy and near edge X-ray absorption fine structure (XANES) is associated with any difference in the recoil free fractions of Eu 2+ and Eu 3+ which may exist at 298 K and the enhanced sensitivity of the XANES to changes in the europium oxidation state. (orig.)
Synthesis and spectral properties of europium phthalocyanine complexes
International Nuclear Information System (INIS)
Maksimova, K.N.; Bazyakina, N.L.; Kutyreva, V.V.; Suvorova, O.N.; Domrachev, G.A.
2008-01-01
Synthesis of europium monophthalocyanic complexes with thenoyltrifluroacetonate (tta) and ferrocenoyltrifluoroacetate (fta) ligands has been considered. Spectral characteristics of complexes PcEu(tta)(ttaH) and PcEu(fta)(ftaH) (Pc - phthalocyanine ligand) have been investigated. One of β-diketonate ligand is proposed to bind with europium ion covalently, and the second ligand saturates coordination sphere of europium due to donor-acceptor binding [ru
Europium-155 in Debris from Nuclear Weapons
DEFF Research Database (Denmark)
Aarkrog, Asker; Lippert, Jørgen Emil
1967-01-01
The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...
Energy Technology Data Exchange (ETDEWEB)
Pourmortazavi, Seied Mahdi [Malek Ashtar University of Technology, Faculty of Material and Manufacturing Technologies, P. O. Box 16765-3454, Tehran (Iran, Islamic Republic of); Rahimi-Nasrabadi, Mehdi [Imam Hossein University, Nano Science Center, Tehran (Iran, Islamic Republic of); Fazli, Yousef [Islamic Azad University, Department of Chemistry, Faculty of Science, Arak Branch, Arak (Iran, Islamic Republic of); Mohammad-Zadeh, Mohammad [Sabzevar University of Medical Sciences, Department of Physiology and Pharmacology, School of Medicine, Sabzevar (Iran, Islamic Republic of)
2015-06-15
Europium (III) molybdate nano-plates were synthesized in this work via chemical precipitation route involving adding of europium (III) ion solution to the aqueous solution of molybdate reagent. Effects of some reaction variables such as concentrations of europium and molybdate ions, flow rate of europium reagent, and reactor temperature on the diameter of the synthesized europium (III) molybdate nano-plates were experimentally investigated by orthogonal array design. The results showed that the size of europium (III) molybdate nano-plates can be optimized by adjusting the concentrations of europium (III) and molybdate ions, as well as the reactional temperature. Europium (III) molybdate nano-plates prepared under the optimum conditions were characterized by X-ray powder diffraction, scanning electron microscopy, and Fourier transform infrared spectroscopy. (orig.)
X-ray structural analysis of plasma sprayed europium oxide
Energy Technology Data Exchange (ETDEWEB)
Gorshkov, B.N.; Loskutov, V.S.; Gavrish, A.A.; Shakh, G.E.
1981-12-01
An X-ray structure microanalysis is made for europium oxide powder produced by sintering and plasmic spheroidization for plasma spraying. The technique of concern is shown not to alter chemical composition of the powder. It is stated that a rise in the plasma jet enthalpy while spraying does not result in dissociation of europium oxide and its interaction with the plasma flux. The coating (to 15.2 kWxs/g) is found to have only a high-temperature (monoclinic) europium oxide phase and there appears a low-temperature (cubic) phase with a subsequent increase in the enthalpy. The plasma jet enthalpy increasing the grain size and the crystal lattice c parameter of the sprayed europium oxide are shown to decrease; the a parameter reduces with an enthalpy growth to 16.2 kW s/g and then smoothly increases with the enthalpy further growth. It is noticed that the europium oxide coating does not interact with an aluminium D16 alloy substrate.
Resonance ionization scheme development for europium
Energy Technology Data Exchange (ETDEWEB)
Chrysalidis, K., E-mail: katerina.chrysalidis@cern.ch; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)
2017-11-15
Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.
Study of the europium behavior in aqueous media
International Nuclear Information System (INIS)
Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V.
1999-01-01
Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero
Directory of Open Access Journals (Sweden)
Soumen Dhara
2017-02-01
Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.
Preparation and spectral properties of europium hydrogen squarate microcrystals
Kolev, T.; Danchova, N.; Shandurkov, D.; Gutzov, S.
2018-04-01
A simple scheme for preparation of europium hydrogen squarate octahydrate microcrystals, Eu(HSq)3·8H2O is demonstrated. The microcrystalline powders obtained have a potential application as non-centrosymmetric and UV radiation - protective hybrid optical material. The site-symmetry of the Eu - ion is C2V or lower, obtained from diffuse reflectance spectra. The formation of europium hydrogen squarate is supported by IR - spectroscopy, UV-vis spectroscopy, chemical analysis and X-ray diffraction. A detailed analysis of the UV-vis and IR spectra of the micropowders prepared is presented. The reaction between europium oxide and squaric acid leads to formation of microcrystalline plate-like crystals of europium hydrogen squarate Eu(HSq)3·8H2O, a non-centrosymmetric hybrid optical material with a potential application as UV radiation - protective coatings.
Energy Technology Data Exchange (ETDEWEB)
Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)
2013-06-15
The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Europium ion as a probe for binding sites to carrageenans
International Nuclear Information System (INIS)
Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A.; Zaniquelli, Maria Elisabete D.; Wong, Kenneth
2007-01-01
Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu 3+ /Na + or K + with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan
Europium ion as a probe for binding sites to carrageenans
Energy Technology Data Exchange (ETDEWEB)
Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail: medzaniquelli@ffclrp.usp.br; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)
2007-12-15
Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.
SEPARATION OF EUROPIUM FROM OTHER LANTHANIDE RAE EARTHS BY SOLVENT EXTRACTION
Peppard, D.F.; Horwitz, E.P.; Mason, G.W.
1963-02-12
This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)
Organophosphate Nerve Agent Detection with Europium Complexes
Directory of Open Access Journals (Sweden)
Jake R. Schwierking
2004-01-01
Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.
Energy Technology Data Exchange (ETDEWEB)
Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee
2004-07-01
This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)
APW research of europium monochalcogenides. 1
International Nuclear Information System (INIS)
Farberovich, O.V.; Vlasov, S.V.
1981-01-01
The augmented plane wave method (APW) is used for a theoretical study of the electron properties of europium monochalcogenides. Spin-polarized energy band calculations of the ferromagnetic EuO, EuS, and EuSe explain qualitatively the exchange interactions therein. Based on the APW data in the frame of perturbation theory the Coulomb electron-electron interaction at the 4f shell of europium is taken into account for EuO and EuS. The band structures and the multiplet terms of the f 6 d and 3d 9 4f 8 excited states gives a new interpretation of a known experimental spectra for these compounds. (author)
Sulfur, cobalt and europium activation from the A-bombs in Japan
International Nuclear Information System (INIS)
Gritzner, M.L.; Egbert, S.D.; Woolson, W.A.
1987-01-01
Comparisons are made between calculations and measurements of in-situ sulfur, cobalt, and europium activation by neutrons at Hiroshima and Nagasaki to check the validity of the neutron sources and transport air-over-ground used in the new Dosimetry System 1986 (DS86). Europium and cobalt are activated by epithermal/thermal neutrons. The sulfur activation has an effective threshold around 2 MeV. Comparisons of sulfur activation at Hiroshima, which necessitate considering the tilt and heading of the cylindrically shaped Little Boy bomb, confirm the high energy neutron portion of the source relevant to sulfur activation. The europium and cobalt activation calculations tend to be higher than the measurements for ground ranges within 300 m and lower than the measurements beyond 700 m. Thus, the cobalt and europium measurements do not validate the source or the transport, embodied in DS87, for those neutrons relevant to europium and cobalt activation. Presently, it is unresolved as to whether the discrepancy can be explained as a problem in the measurements, in their interpretation, or as a problem in the calculations due to the source neutrons and/or their transport from source to the sample site
Soluble dendrimers europium(III) β-diketonate complex for organic memory devices
International Nuclear Information System (INIS)
Wang Binbin; Fang Junfeng; Li Bin; You Han; Ma Dongge; Hong Ziruo; Li Wenlian; Su Zhongmin
2008-01-01
We report the synthesis of a soluble dendrimers europium(III) complex, tris(dibenzoylmethanato)(1,3,5-tris[2-(2'-pyridyl) benzimidazoly]methylbenzene)-europium(III), and its application in organic electrical bistable memory device. Excellent stability that ensured more than 10 6 write-read-erase-reread cycles has been performed in ambient conditions without current-induced degradation. High-density, low-cost memory, good film-firming property, fascinating thermal and morphological stability allow the application of the dendrimers europium(III) complex as an active medium in non-volatile memory devices
21 CFR 146.146 - Frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...
Synthesis of samarium, europium and ytterbium acetylenides
International Nuclear Information System (INIS)
Bochkarev, M.N.; Fedorova, E.A.; Glushkova, N.V.; Protchenko, A.V.; Druzhkov , O.N.; Khorshev, S.Ya.
1995-01-01
Ethynyl complexes of samarium, europium and ytterbium were prepared by interaction of naphthalinides of metals with acetylene in tetrahydrofuran. The compounds are isolated in the form of dark-coloured pyrophore powders. Data of magnetic measurements suggest that in the course of the reaction Sm(2) is oxidized completely to Sm(3), Yb(2) transforms into Yb(3) partially, whereas europium preserves its initial bivalent state. Hydrolysis of the compounds prepared provides acetylene, ethylene, ethane and hydrogen which indicates the presence of acethylenide Ln 2 C 2 and hydride LnH groupings (Ln = Sm, Eu, Yb). 9 refs., 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Falconi, N; Radicella, R [Commissariat a l' Energie Atomique, Dir. des Materiaux et Combustibles Nucleaires, Saclay (France). Centre d' Etudes Nucleaires
1968-07-01
High activity 'point' sources of {sup 155}Eu are used for medical and industrial applications. For this purpose we have studied a method of obtaining I Ci of carrier free {sup 155}Eu, with a solid residue smaller than 5 mg per Ci. In order to separate the {sup 155}Eu from several grams of a {sup 154}Sm enriched target we propose a procedure which is based on the work of Bouissieres and David, Onstott, and Takekoshi et al. The separation is carried out by electrolysis on a mercury cathode followed by purification on ion exchange resin. The yields of the europium separation and target recovery are 80 per cent and 90 per cent respectively. The time required for the procedure is three days. (authors) [French] L'obtention de sources ponctuelles de haute activite d'europium-l55 est interessante tant pour des usages medicaux qu'industriels. Nous avons cherche le moyen de preparer en une seule fois, une solution d'un curie d'europium-155 sans entraineur presentant un extrait sec inferieur a 5 mg par curie. En se basant sur des travaux de Bouissieres et Davis, d'Onstott, et de Takekoshi et coll., nous avons mis au point une methode permettant de separer l'europium-155 de sa cible de samarium enrichi en {sup 154}Sm par une electrolyse sur cathode de mercure suivie d'une purification sur resine echangeuse d'ions. Les rendements chimiques de separation de l'europium et de recuperation de la cible de samarium enrichi sont respectivement de 80 pour cent et 90 pour cent. La duree de l'operation est de 3 jours. (auteurs)
Hintzen, H.T.J.M.; Hanssen, R.; Jansen, S.R.; Metselaar, R.
1999-01-01
In the literature confusion exists concerning the structure type, the valence of europium, and the amount of nitrogen incorporation of the compound europium aluminum oxynitride. By using X-ray diffraction and luminescence measurements, we show that europium aluminum oxynitride has the
Investigations of white light emitting europium doped zinc oxide nanoparticles
International Nuclear Information System (INIS)
Ashtaputre, S S; Nojima, A; Marathe, S K; Matsumura, D; Ohta, T; Tiwari, R; Dey, G K; Kulkarni, S K
2008-01-01
Europium doped zinc oxide nanoparticles have been synthesized using a chemical route. The amount of doped europium was varied which shows the changes in the photoluminescence (PL) intensity. The post synthesis annealing effect on the properties of ZnO nanoparticles has also been investigated. In general, PL is broad and a white light is emitted which originates from ZnO and the intra-4f transitions of Eu 3+ ions. The x-ray diffraction patterns do not show any Eu-related peaks for as-synthesized ZnO nanoparticles as well as for annealed samples. X-ray absorption spectroscopy reveals that europium ions are present on the surface of the core of ZnO and inside the shell of zinc hydroxide [Zn(OH 2 )] after annealing
International Nuclear Information System (INIS)
Voronina, R.D.; Zorov, N.B.
2007-01-01
Features of a sorption-luminescence method for the determination of trace europium were studied. The method includes the preliminary sorption of europium at pH 7.1 from solutions with silica chemically modified with iminodiacetic acid, the subsequent treatment of the sorbent with 2-thenoyltrifluoroacetone at pH 8.0, and the measurement of the intensity of luminescence of the surface three-component europium complex at 613 nm. The effect of moisture as the quencher of luminescence of the surface europium complex was studied, and techniques for its removal were proposed. Sorption in the static mode provides the detection limit of europium of 7 x 10 -5 g/ml. The calibration plot is linear in the range of two orders of magnitude of europium concentration in solutions. The relative standard deviation in the determination of 1.5 x 10 -2 μg/ml europium is 5%. In the dynamic mode of sorption from 1000 ml of an analyzed solution with the use of sorption-desorption, the detection limit of europium of 8 x 10 -7 μg/ml was attained [ru
Development of ultraviolet LED devices containing europium (III) complexes in fluorescence layer
International Nuclear Information System (INIS)
Iwanaga, Hiroki; Amano, Akio; Aiga, Fumihiko; Harada, Kohichi; Oguchi, Masayuki
2006-01-01
Relations between molecular structures of europium complexes and their luminescent properties were investigated. Europium complex with β-diketones and two different phosphine oxides 8 was highly soluble in fluorinated medium, and realized largest fluorescence intensities. The luminous intensity of ultraviolet light emitting diodes devices (LEDs) whose fluorescence layer consists of fluorinated polymer and 8 was over 200 mcd (20 mA). Fluorescence compounds of this type are promising for application in next-generation white LEDs. Moreover, we proposed a novel molecular design of europium complex with asymmetric diphosphine dioxide
Sorption of small amounts of europium(III) on iron(III) hydroxide and oxide
International Nuclear Information System (INIS)
Music, S.; Gessner, M.; Wolf, R.H.H.
1979-01-01
The sorption of small amounts of europium(III) on iron(III) hydroxide and oxide has been studied as a function of pH. The mechanism of sorption is discussed. Optimum conditions have been found for the preconcentration of small or trace amounts of europium(III) by iron(III) hydroxide and oxide. The influence of complexing agents (EDTA, oxalate, tartrate and 5-sulfosalicylic acid) on the sorption of small amounts of europium(III) on iron(III) oxide has also been studied. (author)
Characterisation of kaolinite and adsorption of europium on kaolinite
International Nuclear Information System (INIS)
Olin, M.; Puhakka, E.; Lehikoinen, J.; Puukko, E.; Hakanen, M.; Lindberg, A.
2007-10-01
Kaolinite is a common fracture mineral in many crystalline rocks and, thus, a potential sorbent for groundwater solutes. The low cation-exchange capacity makes kaolinite a good mineral to study sorption by inner-sphere complexation of multivalent ions, such as trivalent actinides or their analogues, the trivalent lanthanides. The sorption of europium and americium on kaolinite has been studied previously by Puukko and Hakanen using a natural kaolinite, KGa-1b (from the Clay Minerals Society, USA). This work describes the determination of surface-charging mechanism and surface acidity constants for KGa-1b kaolinite, and adsorption of Eu(III) on both the natural (KGa-1b) and its acid-conditioned form (HKGa). The ionic strength of the background NaNO 3 electrolyte used in these titrations was 0.05 M, 0.1 M and 0.5 M. The surface acidity of kaolinite was explained using the FITEQL software by applying the 1-pK model. The optimized concentration of surface sites was close to a value previously reported for KGa-1b kaolinite. The adsorption modelling of europium was carried out by adopting one surfacecomplexation and one cation-exchange reaction. In the acidic pH range, sorption of europium decreased with increasing ionic strength of the NaNO 3 solution, which is an indication of the dominance of cation exchange or outer-sphere complexation. At the lowest ionic strength, the sorption was reversible. In the 0.1 M and 0.5 M NaNO 3 solutions, the sorption of europium in the basic pH range was only partly reversible, or desorption kinetically slow. The degree of irreversibility increased with increasing pH and ionic strength. A diffuse-layer model was readily fitted on the per-cents sorbed scale (default in FITEQL), but the results were not as good on a Kd scale, especially at circumneutral pH values. In the water analysis of the batch titration of KGa-1b kaolinite, the main observed elements were aluminium and zinc. The concentrations of Al and Zn decreased with p
Magnetic and structural properties of yellow europium oxide compound and Eu(OH)3
International Nuclear Information System (INIS)
Lee, Dongwook; Seo, Jiwon; Valladares, Luis de los Santos; Avalos Quispe, O.; Barnes, Crispin H.W.
2015-01-01
A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH) 3 . The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH) 3 were also examined. Although Eu 3+ is present in Eu(OH) 3 , a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH) 3 ) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened
Synthesis and luminescence properties for europium oxide nanotubes
International Nuclear Information System (INIS)
Mo Zunli; Deng Zhepeng; Guo Ruibin; Fu Qiangang; Feng Chao; Liu Pengwei; Sun Yu
2012-01-01
Highlights: ► A novel high temperature sensitive fluorescent CNTs/Eu 2 O 3 nanocomposite was fabricated. ► The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 °C for 4 h. ► The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. ► We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 °C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the 5 D 0 → 7 F j (j = 0, 1) forced electric dipole transition of Eu 3+ ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 °C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu 3+ energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.
Energy Technology Data Exchange (ETDEWEB)
Ul' yanova, T M; Gerasimenko, G N; Tishchenko, M A; Vitkun, R A [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.
1983-03-01
Using luminescence method different-ligand complexing of europium ions with diantipyrylalkanes and cyclic ..beta..-diketones: 2-acetyl- and 2-benzoyl-1.3-indandions, has been studied. The optimum conditions of the formation of different-ligand complexes and the ratio of components in it are determined. Effect of alien lanthanides and diantipyrylmethane derivatives on the luminescence intensity of europium complexes is clarified. A correlation between the ratio of the luminescence intensity bands of europium complexes and the values of oscillator strengths of supersensitive transitions of neodymium and erbium absorption bands is established.
Extraction of europium (3) ions with stearic acid
International Nuclear Information System (INIS)
Lobanov, F.I.; Gladyshchev, V.P.; Nurtaeva, A.K.; Andreeva, N.N.
1981-01-01
Extraction of europium (3) in nitric acid solutions with the melts of stearic acid and its mixtures with paraffin at (80+-1) deg C is studied. The constant of stearic acid dimerization in paraffin K 2 =9.6+-0.6 and the constant of stearic acid distribution in the paraffin-water system Ksub(D,HA)=(1.06+-0.07)x10sub(3) are determined. The diagram of europium ion extraction at initial concentrations of metal in the aqueous phase of 10 -4 -10 -3 mol/l is suggested. The compound extracted has the EuA 3 composition with extraction constant of lg Ksub(ex)=-7.58 [ru
Energy Technology Data Exchange (ETDEWEB)
Wang, Dunjia, E-mail: dunjiawang@163.com; Pi, Yan; Liu, Hua; Wei, Xianhong; Hu, Yanjun; Zheng, Jing
2014-11-15
Highlights: • Synthesis of the tris-β-diketone ligand and its trinuclear europium complexes. • Photoluminescence behavior of trinuclear europium complexes. • Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), lifetime (τ) and quantum yield (η). - Abstract: A new tris-β-diketone ligand, 2-[4,6-bis-(1-benzoyl-2-oxo-2-phenyl-ethyl)-[1,3,5]triazin-2-yl] -1,3-diphenyl-propane-1,3-dione (H{sub 3}L), and its trinuclear europium complexes, Eu{sub 3}(DBM){sub 6}L (C1), Eu{sub 3}(DBM){sub 6}(Bipy){sub 3}L (C2) and Eu{sub 3}(DBM){sub 6}(Phen){sub 3}L (C3) were synthesized and their spectroscopic behaviors were studied by FT-IR, {sup 1}H NMR, UV–vis and photoluminescence spectroscopic techniques. These europium complexes exhibited the characteristic emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion in solid state. The Ω{sub 2} and Ω{sub 4} intensity parameters, lifetime (τ) and luminescence quantum yield (η) were calculated according to the emission spectra and luminescence decay curves in solid state. The results indicated that these trinuclear europium complexes displayed a longer lifetime (τ) and higher luminescence quantum efficiency (η), especially complexes C2 (τ = 0.820 ms, η = 46.5%) and C3 (τ = 0.804 ms, η = 47.4%), which due to the effect of two additional europium ion lumophors and the introduction of the third ligands, Bipy or Phen in trinuclear complexes. Their Ω{sub 2} values demonstrated that the europium ion in these complexes is in a highly polarizable chemical environment.
International Nuclear Information System (INIS)
Grasso, Andrea Nastri
2010-01-01
In this work were studied the spectroscopic properties of trivalent europium ion complexed with components of tetracycline family, chlorotetracycline, oxytetracycline and metacycline, in the presence of hydrogen peroxide and urea peroxide. Optical parameters were obtained such as absorption, emission, lifetime and calibration curves were constructed for luminescence spectra. Experiments were carried out with both inorganic compounds and europium-tetracyclines complexes in order to verify possible interferences. Studies for glucose determination were also described using europium-tetracyclines complexes as biosensors. Results show that europium tetracyclines complexes emit a narrow band in the visible region and, in the presence of hydrogen peroxide or urea peroxide there is a greater enhancement in their luminescence and lifetime. Thus, europium-tetracyclines complexes studied can be used as biosensors for hydrogen and urea peroxides determination as a low cost and room temperature method. An indirect method for glucose determination was studied by adding glucose oxidase enzyme in europium-tetracyclines complex in the presence of glucose promoting as product hydrogen peroxide. (author)
Formation of americium and europium humate complexes
International Nuclear Information System (INIS)
Minai, Y.; Tominaga, T.; Meguro, Y.
1991-01-01
Binding constants of americium and europium with a humic acid were determined to study if complex formation of trivalent actinide-humates affects dissolved species of the actinides in hydrosphere. The purified humic acid was characterized by means of UV-vis, IR, and pH titration, indicating high carboxylate capacity and low aromaticity. Binding constants of americium and europium humates were determined at pH 4.6 and 6.0 by solvent extraction using 241 Am or 152 Eu as a tracer. The binding constants for americium-humate obtained preliminarily suggest that complexes with humic acid are not negligible in speciation of trivalent actinides in hydrosphere. The obtained binding constants were nearly identical with those determined previously by the same procedures, but with humic acids of different origin and compositions. (author)
Sorption of europium (3) by polymer sorbents with grafted heterocyclic nitrogen-containing groupings
International Nuclear Information System (INIS)
Bel'tyukova, S.V.; Kravchenko, T.B.; Balamtsarashvili, G.M.; Roska, A.S.
1990-01-01
On polymer sorbents (copolymer of styrene-divinylbenzene) with grafted heterocyclic nitrogen-containing functional groupings of tetrazole, triazole and imidazole (sorbents 1,2,3, respectively). It is stated that europium sorption takes place from neutral solutions in presence of organic solvents. Luminescent properties of europium on sorbent are used to develope methods of its determination in high purity lanthanide and yttrium oxides. Europium determination limits consist 7.5·10 -5 μg/ml on 1 and 3 sorbents and 1.5·10 -4 μg/ml on sorbent 2, S p value is 0.089 and 0.075, respectivaly
Atomic absorption spectrophotometry of europium using an enhancing effect of ammonium perchlorate
International Nuclear Information System (INIS)
Oguro, Hiroshi
1976-01-01
In the atomic absorption spectrophotometry of europium in air-acetylene flame, ammonium perchlorate (NH 4 ClO 4 ) increases the absorption of europium. In the case of 0.5 M NH 4 ClO 4 , the increase is by about 1.5 times. In this paper, a method for eliminating the interferences of many coexisting compounds using an enhancing effect and a method for determining Eu 2 O 3 in La 2 O 3 were investigated. The working conditions using Nippon Jarrell-Ash model AA-1 atomic absorption/flame emission spectrophotometer were as follows; wavelength 4594 A, lamp current 15 mA, burner height 10 mm, air flow-rate 6.51/min, acetylene flow-rate 1.81/min. Though the enhancing or depressing effects of HCl, HNO 3 , HBr and HClO 4 in concentrations below 0.1 M were eliminated by 0.5 M NH 4 ClO 4 , the remarkable depressing effects of H 2 SO 4 and H 3 PO 4 on europium could not be eliminated. The interferences of Na + , K + , Cs + and Al 3+ in the concentration of 200 ppm were not eliminated, but those of other cations including rare earth elements were completely eliminated. Lanthanum in the range of (2000--10000) ppm increased the absorption of europium by about 1.4 times. But the effect of lanthanum in the range of (0--9000) ppm was also eliminated by NH 4 ClO 4 . The calibration curve for europium in the presence of NH 4 ClO 4 was linear in the range of (0--400) ppm with a sensitivity larger by about 1.5 times than that for europium alone. The analytical procedure is as follows. A sample is dissolved in HCl and NH 4 ClO 4 is added. Europium in the sample solution is determined by atomic absorption method using air-acetylene flame. For practical samples, the values obtained were in fair agreement with those by the flame emission method using a nitrous oxide-acetylene flame. The coefficients of variation by the present method were (3.7--2.4)% (Eu 2 O 3 content (1--3)%). (auth.)
Thermodynamic and structural description of europium complexation in 1-octanol - H2O solutions
International Nuclear Information System (INIS)
Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L.; Arnaud, F.
2008-01-01
Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP) 2 3+ and Eu(BTP) 3 3+ were obtained by both techniques (log(β 2 ) = 9.0 ± 0.3 and log(β 3 ) = 13.8 ± 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP) 2 3+ ] / [Eu(BTP) 3 3+ ] ratio. (authors)
Optical and magnetization studies on europium based iron pnictides
International Nuclear Information System (INIS)
Zapf, Sina Maria Ute
2015-01-01
The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe 2 (As 1-x P x ) 2 single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe 2 As 2 , revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.
Optical and magnetization studies on europium based iron pnictides
Energy Technology Data Exchange (ETDEWEB)
Zapf, Sina Maria Ute
2015-07-01
The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.
Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}
Energy Technology Data Exchange (ETDEWEB)
Lee, Dongwook, E-mail: dongwookleedl324@gmail.com [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: jiwonseo@yonsei.ac.kr [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)
2015-08-15
A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.
Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength
International Nuclear Information System (INIS)
Vijayakumar, Balakrishnan; Velmurugan, Devadasan
2012-01-01
Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level. Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f′′ = 11.17 e − , at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules
International Nuclear Information System (INIS)
Pereira Duarte, Adriana
2012-01-01
The association of the very interesting luminescence properties of the lanthanide chelates with the physicochemical properties of inorganic matrix such as silica is a promising way to obtain new probes or luminescent markers for biology analyses. In this idea, this work focuses on the preparation of new hybrid materials based on the grafting of new europium(III) complexes on silica nanoparticles. These europium complexes were developed in our group using bifunctional ligands containing both complexing and grafting sites. Intrinsic characteristic of the ligands gives us the ability to make a covalent bond between the material surface and the complex. Two different methodologies were used; the first one is the direct grafting reaction involving the complex and silica nanoparticles (i.e. dense or meso-porous particles). The second one is the Stoeber reaction, where the SiO 2 nanoparticles were prepared in presence of the europium complex. The last methodology has an additional difficult, because of the presence of silylated europium complex, it needs a closer control of the physicochemical conditions. The new organic-inorganic hybrid materials, obtained in this work, present an interesting luminescence behavior and this one is depending on the localization of the europium complex, i.e. on the surface or within the nanoparticles. In addition, the obtained hybrids present the nano-metric dimension and the complex is not leachable. Analyses were realized to describe the luminescence properties, beyond surface and structural characteristics. Initial results show that the new hybrids are promising candidates for luminescent bio-markers, particularly for the time-resolved analysis. (author) [fr
Carbamoyl methylphosphine oxide derivatives of adamantane as americium and europium extractants
International Nuclear Information System (INIS)
Babain, V.A.; Alyapyshev, M.Yu.; Novakov, I.A.; Orlinson, B.S.; Savel'ev, E.N.; Shokova, Eh.A.; Serebrayannikova, A.E.; Kovalev, V.V.
2007-01-01
Adamantane di-1,3-carbamoyl methylphosphine oxide (CMPO) derivatives, where CMPO-groups connect with 1,3-positions of rigid adamantane platform by methylene and ethylene bridges, are synthesized, and their efficiency as extractants of americium(III) and europium(III) from nitric acid solutions is demonstrated. Distribution function of Am 3+ and Eu + during extraction from 3M HNO 3 are measured in the investigation of extraction properties. It is noted that first synthesized adamantane CMPO derivatives are more effective for the extraction of americium(III) and europium(III) from 3MHNO 3 [ru
Luminescent micro- and nanofibers based on novel europium phthalate complex
Energy Technology Data Exchange (ETDEWEB)
Enculescu, M., E-mail: mdatcu@infim.ro [National Institute of Materials Physics, Multifunctional Materials and Structures, PO Box MG-7, 77125 Magurele-Bucharest (Romania); Preda, N.; Matei, E.; Enculescu, I. [National Institute of Materials Physics, Multifunctional Materials and Structures, PO Box MG-7, 77125 Magurele-Bucharest (Romania)
2012-09-14
We synthesized by wet chemical route a novel europium-potassium phthalate complex Eu{sup 3+}K{sup +}[(COO){sub 2}(C{sub 6}H{sub 4})]{sub 2}. The compound is a white powder insoluble in water. X-ray diffraction evaluation shows that we obtained a new crystalline compound with no traces of the starting materials (potassium hydrogen phthalate and europium chloride). Scanning electron microscopy reveals that the powder consists of fiber-shaped structures with sizes larger than 250 nm in diameter. Energy dispersive X-ray analysis proves that the compound has a 1:1 europium-potassium ratio. Fourier transform infrared spectroscopy confirms the presence of the phthalate in the new compound. Photoluminescence and cathodoluminescence measurements show that the fiber-shaped structures are intensely luminescent with emission bands corresponding to the {sup 5}D{sub 0} {yields} {sup 7}F{sub J} (J = 1-4) Eu (III) ion's transitions in the region between 580 nm and 700 nm, the most intense maximum being observed around 615 nm. Up-converted luminescence with a maximum at 315 nm was recorded. -- Highlights: Black-Right-Pointing-Pointer A new europium-potassium phthalate complex was synthesized by wet chemical route. Black-Right-Pointing-Pointer Fiber-shaped crystalline structures with sizes larger than 250 nm. Black-Right-Pointing-Pointer The most probable structure of the molecule is [C{sub 6}H{sub 4}(COO{sup -}){sub 2}]{sub 2} K{sup +}Eu{sup 3+}. Black-Right-Pointing-Pointer Intense luminescence due to Eu{sup 3+} ions {sup 5}D{sub 0} {yields} {sup 7}F{sub J} transitions. Black-Right-Pointing-Pointer Up-converted luminescence with a maximum at 315 nm was recorded.
International Nuclear Information System (INIS)
Ditchburn, R.G.; McCabe, W.J.
1982-05-01
The use of europium labelled sand as an aid in the study of sediment transport has been suggested. A method for the purification of acid leachable europium is described. The final measurement is made by flame emission spectrometry using a nitrous oxide-acetylene flame. The usefulness of the method is limited by the natural levels of europium which, in the sand studied, was around 0.3 ppm
Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions
Energy Technology Data Exchange (ETDEWEB)
Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)
2008-07-01
Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)
Excess europium content in Precambrian sedimentary rocks and continental evolution
Jakes, P.; Taylor, S. R.
1974-01-01
It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.
Europium enabled luminescent nanoparticles for biomedical applications
Energy Technology Data Exchange (ETDEWEB)
Syamchand, S.S., E-mail: syamchand.ss@gmail.com; Sony, G., E-mail: emailtosony@gmail.com
2015-09-15
Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2
Europium enabled luminescent nanoparticles for biomedical applications
International Nuclear Information System (INIS)
Syamchand, S.S.; Sony, G.
2015-01-01
Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2
Synthesis of xerogels with Europium impurities for dosimetric applications
International Nuclear Information System (INIS)
Rivera R, C.; Garcia R, F.J.; Yanez L, M. -
2007-01-01
The objective of this work is the obtaining xerogels in bundle of SiO 2 with europium impurities to low concentrations, with the objective of exploring their mechanical, optical and emission properties. The obtained xerogels was synthesized by means of the sol-gel technique, using water, TEOS and ethanol to a molar relationship 16:1:4 respectively, the europium was added by oxide via to the precursor solution and to catalyze the hydrolysis condensation reaction, its were added: nitric acid and hydrofluorhydric acid. Later on these mixtures were left to gel by 72 hours and under this same composition, but with different quantities of impurifying material (0.0, 0.01 and 0.05g of europium oxide), the materials were dried in a ramp of controlled temperature, from ambient temperature up to 120 C, some of these thermally tried materials were calcined at 500 and 800 C, being obtained in this way xerogels free of fractures, stable, porous and semi-transparent. The characterization of these materials includes: pH measurements and solutions viscosity during the gelation stage, as well as characterization of their optic properties by means of infrared spectroscopy, UV-vis and emission spectroscopy. The microhardness results show that these materials present smaller values to those corresponding of the corning glass, as well as a growing behavior with regard to the calcination temperatures of the material. (Author)
Fermi Surface and Antiferromagnetism in Europium Metal
DEFF Research Database (Denmark)
Andersen, O. Krogh; Loucks, T. L.
1968-01-01
of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...
Temperature effects in the valence fluctuation of europium intermetallic compounds
International Nuclear Information System (INIS)
Menezes, O.L.T. de; Troper, A.; Gomes, A.A.
1978-03-01
A previously reported model for valence fluctuations in europium compound in order to account for thermal occupation effect. Experimental results are critically discussed and new experiments are suggested
A Preliminary Study of Europium Uptake by Yeast Cells. The Case of Kluveromyces Marxianus
International Nuclear Information System (INIS)
Anagnostopoulos, V.; Symeopoulos, B.
2008-01-01
The objective of the present work is an exploration of a cost effective recovery of lanthanides, either for minimizing the industrial processes losses, or for reasons related to Radioactive Waste Management. Specifically, the uptake of europium from aqueous solutions by Kluveromyces marxianus cells was studied. Moreover, this biotechnological approach turns out to be environmental friendly, considering that cells of Kluveromyces marxianus are readily available as wastes from food fermentation industries. Europium [ 152 Eu+ 154 Eu]-labelled solutions were used providing better accuracy and reproducibility of measurements, mainly in low concentration range. The effect of pH, contact time and europium initial concentration were investigated. Adsorption data were fitted to Langmuir and Freundlich sorption models and Scatchard plots were used to reveal the existence of at least two types of binding sites
Nuclear orientation experiments on the magnetic moments of europium and gadolinium nuclei
International Nuclear Information System (INIS)
Berg, F.G. van den.
1984-01-01
In this thesis, experimental results on the ground state nuclear magnetic moments of europium and gadolinium isotopes are presented. The nuclear orientation experiments were performed on europium and gadolinium nuclei embedded in several host lattices. Attention is paid to the hyperfine interactions of the ions. Nuclear moments are discussed in the context of nuclear shell model. The theoretical framework is described for nuclear structure and low temperature nuclear orientation. Furthermore, the experimental techniques, the technical arrangement of the orientation apparatus, the methods for radiative detection and the use of nuclear orientation thermometry are described. (Auth.)
White OLED with a single-component europium complex.
Law, Ga-Lai; Wong, Ka-Leung; Tam, Hoi-Lam; Cheah, Kok-Wai; Wong, Wing-Tak
2009-11-16
A new direction for white organic light-emitting devices is shown, fabricated from a novel europium complex; this single component contains a double emission center of bluish-green and red, combined to a give a pure white emission (CIE x = 0.34 and y = 0.35).
Extraction of europium with thenoyltrifluoroacetone into alcohol, ketone and ester solvents
International Nuclear Information System (INIS)
Akiba, K.; Kanno, T.
1980-01-01
The effect of solvent has been studied on the extraction of tris-thenoyltrifluoroacetone (TTA) chelate of europium(III). Donor-active solvents (S) greatly promote the extraction owing to the formation of solvate species EuA 3 .mS (m = 1,2). Linear relations were established between the distribution of ratios of europium (Dsub(Eu)) and the partition constants of TTA (Psub(HA)); log Dsub(Eu) (at a definite pA) = a log Psub(HA) + b, where constants a and b were empirically determined for each series of solvents. The regularity is interpreted in terms of dual roles of solvent as donor and as medium. (author)
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...
International Nuclear Information System (INIS)
Fontenot, Ross S.; Hollerman, William A.; Bhat, Kamala N.; Aggarwal, Mohan D.
2013-01-01
The ability of a material to emit light upon fracture is known as triboluminescence. One of the few materials that emits triboluminescence in daylight is europium dibenzoylmethide triethylammonium (EuD 4 TEA). It has been shown that this material is 106% brighter than ZnS:Mn when excited by low speed impacts. In 2011, the authors of this paper found that replacing the traditional europium chloride with europium nitrate and changing the carrier solvent could both significantly affect the triboluminescent emission yield. While these changes provided a significant increase in yield, the emission was still not sufficient to be observed in bright daylight. In order to enhance the effect, a series of materials were added to the EuD 4 TEA to study the effects of “doping” on the triboluminescence yield. Results from this research showed that doping from a small number of materials, such as uranyl acetate, increased emission yield. This paper discusses the research that was completed on effects of the addition of uranyl acetate to EuD 4 TEA could increase the triboluminmescent emission yield. Results show that the added uranium does indeed increase emission yield when it is first synthesized. However, radiation emitted by the uranium also was found to damage the doped EuD 4 TEA, thus reducing the emitted triboluminescence over a period of time. - Highlights: ► Uranium doped europium dibenzoylmethide triethylammonium (EuD 4 TEA) was synthesized. ► Effects of uranium was studied for low velocity ( 4 TEA was determined.
Enantioselective cellular localisation of europium(iii) coordination complexes.
Frawley, Andrew T; Linford, Holly V; Starck, Matthieu; Pal, Robert; Parker, David
2018-01-28
The selective mitochondrial localisation of the Λ enantiomer of three different emissive europium(iii) complexes in NIH 3T3 and MCF7 cells contrasts with the behaviour of the Δ enantiomer, for which a predominant lysosomal localisation was observed by confocal microscopy. In each case, cell uptake occurs via macropinocytosis.
International Nuclear Information System (INIS)
Sivestrini, S.; Riello, P.; Freris, I.; Cristofori, D.; Enrichi, F.; Benedetti, A.
2010-01-01
The synthesis, morphology and luminescence properties of europium(III)-doped zirconium carbonates prepared as bulk materials and as silica-supported nanoparticles with differing calcination treatments are reported. Transmission electron microscopy and X-ray diffraction analyses have, respectively, been used to study the morphology and to quantify the atomic amount of europium present in the optically active phases of the variously prepared nanomaterials. Rietveld analysis was used to quantify the constituting phases and to determinate the europium content. Silica particles with an approximate size of 30 nm were coated with 2 nm carbonate nanoparticles, prepared in situ on the surface of the silica core. Luminescence measurements revealed the role of different preparation methods and of europium-doping quantities on the optical properties observed.
International Nuclear Information System (INIS)
Naik, Yeshwant; Tapase, Anant Shamrao; Mhatre, Amol; Datrik, Chandrashekhar; Tawade, Nilesh; Kumar, Umesh; Naik, Haladhara
2016-01-01
Circulardiscs of Li_2SiO_3 doped with europium were prepared and a new activation procedure for the neutron dose estimation in a breeder blanket of fusion reactor is described. The amount of europium in the disc was determined by neutron activation analysis (NAA) using an isotopic neutron source. The average neutron absorption cross section for the reaction was calculated using neutron distribution of the Am-Be source and available neutron absorption cross section data for the "1"5"1Eu(n,γ)"1"5"2"mEu reaction, which was used for estimation of europium in the pallet. The cross section of the elements varies with neutron energy, and the flux of the neutrons in each energy range seen by the nuclei under investigation also varies. Neutron distribution spectrum of the Am-Be source was worked out prior to NAA and the effective fractional flux for the nuclear reaction considered for the flux estimation was also determined. - Highlights: • Lithium meta-silicate is breeder materials for a fusion reactor. • Europium is used for neutron dose estimation in a breeder blanket. • It is important to determine amount of europium in lithium meta-silicate. • Amount of europium in lithium meta-silicate was determined by neutron activation and off-line gamma spectrometry.
Energy Technology Data Exchange (ETDEWEB)
Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)
2000-07-01
Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.
The europium and praseodymium hydrolysis in a 2M NaCl environment
International Nuclear Information System (INIS)
Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A.
1998-01-01
It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)
Trivalent europium speciation in a room-temperature ionic liquid
International Nuclear Information System (INIS)
Mekki, S.
2006-10-01
Since the nuclear industry is playing an important role in the power production field, a relevant number of problems have been revealed. Indeed, high-level radioactive long-lived nuclear wastes present a real difficulty for nuclear wastes management. Minor actinides, which compose most of these wastes, will be radioactive for several thousands of years. For eventual disposal deep underground, their reprocessing needs to be optimized. The extraction processes used industrially to separate actinides and lanthanides from other metal species characterizing the spent nuclear fuel produce, nevertheless, enormous quantities of contaminated liquid wastes directly issued from the liquid/liquid extraction step. During the last decade, some room-temperature ionic liquid have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room-temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this thesis is to test the ability of the specific ionic liquid bumimTf 2 N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high-level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the
2010-10-01
... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...
Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide
Energy Technology Data Exchange (ETDEWEB)
Stollenwerk, Tobias
2013-09-15
In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.
Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide
International Nuclear Information System (INIS)
Stollenwerk, Tobias
2013-09-01
In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.
Determination of Europium by fluorescence using pyrrolidinium based task specific ionic liquid
International Nuclear Information System (INIS)
Kumar, Satendra; Gayan, Siuli Maji; Sankaran, K.
2012-01-01
Determination of lanthanides using fluorescence is a major challenge in aqueous medium due to their poor molar absorptivities and low quantum yield. To overcome these problems, ligand sensitized fluorescence has been widely used for trace level detection of lanthanides in solutions. Recently, ionic liquid a non aqueous medium has been used to observe the fluorescence of lanthanides. In this work we have used pyrrolidinium based ionic liquid for the study of europium fluorescence. The ionic liquid (bmpyr)(BA) was prepared using the metathesis reaction involving 1-butyl,1-methyl pyrrolidinium chloride (bmpyr)(CI). (bmpyr)(Cl) crystals and silver benzoate were added according to their mole equivalents in methanol and stirred for 4 hrs. The filtrate was concentrated using a rotary evaporator, dried for 10 h at room temperature, and then for 40 h at 105℃under reduced pressure. This results in a white crystalline hygroscopic solid which was characterized by FT-lR spectroscopy. The yield of the product was ∼ 95%. Butyl-1, methyl pyrrolidinium bis(trifluoromethanesulfonyl)amide (bmpyr)(TF 2 N) is used for dissolve and dilute (bmpyr)(BA) and fluorescence and life time of Eu 3+ were obtained. For the concentration of Eu 3+ used in this study (2x10 -7 M), the optimum concentration of the sensitizing ionic liquid was found to be 10 -4 M. An enhancement factor of about 32000 was found in this ionic liquid compare to aqueous medium. Fluorescence life time of europium in this ionic liquid is 1100 μs which is ten times more than the life time of europium in aqueous medium (110 μs), indicating a reduction in the rates of non-radiative processes which was provided by the ionic liquid. This study leads to detection of europium in ppb level. (author)
Synthesis of mixed ligand europium complexes: Verification of predicted luminescence intensification
International Nuclear Information System (INIS)
Lima, Nathalia B.D.; Silva, Anderson I.S.; Gonçalves, Simone M.C.; Simas, Alfredo M.
2016-01-01
Mixed ligand europium complexes are predicted to be more luminescent than what would be expected from their corresponding repeating ligand compounds according to a conjecture recently advanced by our research group; a conjecture that has already been validated for strongly luminescent europium complexes. In this article, we seek to further verify the validity of this conjecture for complexes which are much more symmetric, and which thus display lower levels of luminescence. Accordingly, we synthesized complexes Eu(DBM) 3 (L) 2 , and all novel mixed ligand combinations Eu(DBM) 3 (L,L') with L and L' equal to DBSO, PTSO, and TPPO. The syntheses were carried out via displacement reactions from the starting complex Eu(DBM) 3 (H 2 O) 2 , passing through the intermediates Eu(DBM) 3 (L) 2 and finally, by displacement of L by L', arriving at Eu(DBM) 3 (L,L'). The ligands L obey the following order of displacement TPPO>PTSO>DBSO>H 2 O, which had been previously described by our group. In the present article, we further show that this displacement order could have been predicted by Sparkle/RM1 thermochemical calculations. Subsequently, we determined the radiative decay rates, A rad , for all six compounds by photophysical measurements. As expected, results show that the measured A rad values for all novel mixed ligand complexes are larger than the average of the A rad values for the corresponding repeating ligand coordination compounds. In conclusion, the present article does broaden the scope of our conjecture, which enunciates that an increase in the diversity of ligands around the europium ion tends to intensify the luminescence. - Highlights: • Mixed ligand europium complexes are predicted to be more luminescent than repeating ligand ones. • Radiative decay rates increase with structural coordination asymmetry. • The non-ionic ligands displacement order in substitution reactions is TPPO>PTSO>DBSO>H 2 O. • Sparkle/RM1 correctly predicts the
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...
Temperature dependences in electron-stimulated desorption of neutral europium
Ageev, V N; Madey, T E
2003-01-01
The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...
Magneto-optical studies of valence instability in europium and terbium phosphors
Czech Academy of Sciences Publication Activity Database
Rodrigues, L.C.v.; Hölsä, J.; Brito, H.F.; Maryško, Miroslav; Matos, J.R.; Paturi, P.; Rodrigues, R.V.; Lastusaari, M.
2016-01-01
Roč. 170, Feb (2016), 701-706 ISSN 0022-2313 Institutional support: RVO:68378271 Keywords : valence * europium * terbium * oxysulfide and -sulfate * phosphors * paramagnetic susceptibility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...
Luminescence properties of europium (III) cryptates trapped in sol-gel glass
International Nuclear Information System (INIS)
Zaitoun, M.A.; Kim, T.; Jaradat, Q.M.; Momani, K.; Qaseer, H.A.; El-Qisairi, A.K.; Qudah, A.; Radwan, N.E.
2008-01-01
The Lanthanide complexes Eu-2.2.1 and Eu-2.2.2 were synthesized and then incorporated into silica based transparent organic-inorganic hybrid material by the sol-gel method as an example of how doped xerogel materials are emerging as an important means of producing new materials. The produced gels were diagnosed to monitor emission spectra of the luminescent trivalent europium (Eu 3+ ) complexes; emissions were compared to those for gels containing uncomplexed Eu 3+ . Results of the experiments (emission and lifetimes) concerning the coordination sphere composition showed that a cryptand ligand with aromatic groups (short range effect) and the hydrophobic gel host (long range effect) settle efficient action in the antenna effect and isolate the central ion from efficient quenchers, as e.g. water molecules. Each ligand imposed a distinct splitting pattern on the europium emission bands that helps identify them
Energy Technology Data Exchange (ETDEWEB)
Gebelt, R. E. [Oklahoma State University, Stillwater, OK (United States); Eick, H. A. [Michigan State University, East Lansing, MI (United States)
1966-01-15
Europium dicarbide has been prepared by the reaction of europium metal and graphite in a stainless steel bomb. Chemical analysis indicates an average composition of the product of EuC{sub 1.87{+-}0.07}. X-ray powder diffraction analysis shows the compound to be of body-centred tetragonal symmetry, space group D{sup 17}{sub 4}n-14/mm , with lattice parameters: a{sub 0} = 4.045 A; c{sub 0} = 6.645 A. Vapour phase chromatographic analysis indicates that 98% of the gaseous product of acid hydrolysis of europium dicarbide is the hydrocarbon acetylene. These analytical data, together with the lattice parameters, indicate that europium dicarbide resembles alkaline earth dicarbides more than it resembles the other lanthanon dicarbides. The vaporization of europium dicarbide over the temperature range 1130 to 1600 Degree-Sign K was investigated by the Knudsen effusion method. The effusate was either collected and analysed chemically or observed with a time-of-flight mass spectrometer. Thedata presented here are based predominantly on the massspectro- metric observations since they yielded more reproducible data than the collection technique. Gaseous europium dicarbide and europium, in concentrations of 1 and 99%respectively, were found in the effusate. Instrument limitations prevented determination of the concentration of the gaseous dicarbide as a function of temperature. Calibration of the mass spectrometer with silver permitted the calculation of the pressures corresponding to the observed ion intensities. An empirical equation was fitted to the data for europium by the method of least squares. From the second law of thermodynamics the following values were calculated for the reaction: EuC{sub 2} Rightwards-Harpoon-Over-Leftwards-Harpoon Eu(g) + 2C (graphite); {Delta}H{sup 0}{sub 298} = 51.09{+-}1.42kcal/mole; {Delta}H{sup 0}{sub 298} = 18.43 {+-} 1.75 e.u. Values of the free energy function for EuC{sub 2}(s) were estimated and combined with published data to yield for
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex
Energy Technology Data Exchange (ETDEWEB)
Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)
2016-07-01
The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.
Synthesis and characterization of europium aluminophosphate
International Nuclear Information System (INIS)
Araujo, A.S.; Diniz, J.C.; Silva, A.O.S.
1998-01-01
Full text: Aluminophosphate molecular sieves (ALPO) represents a class of materials formed by AlO 2+ and PO 2- tetrahedra linked together through b the oxygen atom. The incorporation of metal cations, specifically rare earths, in the ALPO matrix, gives rise to generation of new materials that can be used as acid catalysts in chemical processes. In this work, it was synthesized hydrothermally a molecular sieve type Eu-ALPO-11, starting from an hydrated alumina (pseudobohemite), phosphoric acid solution, europium chloride, water, and di-isopropylamine (DIPA) as organic template. The gel of synthesis presented the following composition: 1.0 DIPA: 0.05 Eu 2 O 3 :0.95 Al 2 O 3 : 1.0 P 2 O 5 : 80 H 2 O The hydrogel was autoclaved at 170 deg C for a period of 3 days. After that the obtained solid was filtered, washed, dried and calcined at 500 deg C to remove the template. The sample was characterized by several physico-chemical methods, such a atomic absorption, FT-IR spectroscopy, X-ray diffraction, thermal analysis, scanning electron microscopy. Its spectroscopic properties was investigated by europium luminescence. The physico-chemical characterization of the Eu-ALPO-11 showed very good crystallinity, with AEL structure, and orthorhombic symmetry. Also, the material presents excellent thermal stability, with no structural collapse until 950 deg C. Through the luminescence spectra in the visible region, it was observed that the emission of the Eu 3+ is strongly influenced by the increasing of the 5d0 7f0 transition (Electric Dipole), as compared to the 5d0 7f1 transition (Magnetic Dipole) between the levels of 4f configuration perturbed by the crystalline field. The ED/MD ratio to the as synthesized sample was ca. 2.1, against ca. 1.1 relative to the calcined sample. The FT-IR spectra presented well defined absorption bands relative to Al-O and P-O bonds, of the structural internal tetrahedra (IT) and external links (EL): 1250- 950 cm -1 , symmetric stretching due to
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...
Enthalpies of formation of europium alkoxides: What lessons can be drawn from them
International Nuclear Information System (INIS)
Branco, Joaquim B.; Carretas, José M.; Epple, Matthias; Cruz, Adelaide; Pires de Matos, A.; Leal, João Paulo
2014-01-01
Highlights: • First time measurement of europium(II) alkoxides enthalpy of formation. • Calculation of alkoxides thermochemical radii and M–O distances in this environment. • Comparison of experimental EXAFS distance with the calculated ones. • Hints on the type of bond existing in these compounds. • Correlation of bond type and possible use as catalysts. - Abstract: The synthesis and characterization of two europium alkoxides, Eu(OCH 3 ) 2 and Eu(OC 2 H 5 ) 2 , were described. For the first time the enthalpies of formation of divalent lanthanide alkoxides were determined by using reaction-solution calorimetry. The values obtained are Δ f H 0 [Eu(OCH 3 ) 2 ,cr] = −850.5 ± 5.0 kJ/mol and Δ f H 0 [Eu(OC 2 H 5 ) 2 ,cr] = −902.5 ± 5.5 kJ/mol, respectively. Since these compounds have a large use as catalysts or catalysts precursors, the first step of the reaction of them with CO 2 was addressed, which permits to have an idea of the kind of bond involved in those compounds. Moreover, insertion of CO 2 in the europium oxygen bond and formation of metal carboxylate complexes, is in both cases presumably bidentate
Energy Technology Data Exchange (ETDEWEB)
Shaorong Liu; Jian Meng (Beijing Research Institute of Chemical Engineering and Metallurgy (China)); Wenhua Liu (General Research Institute for Non-Ferrous Metals (China))
1992-08-24
When thenoyltrifluoroacetone-phenanthroline-Triton X-100 is used to determine samarium(III) and europium(III) fluorimetrically, only a limited amount of neodymium(III) can be tolerated. By using an on- line separation which can partially separate neodymium(III) from samarium(III), a practical and convenient method was developed to detect samarium(III) at concentrations >0.05% and europium(III) at concentrations >0.005% in neodymium oxide. (author). 7 refs.; 4 figs.; 3 tabs.
International Nuclear Information System (INIS)
Shaorong Liu; Jian Meng; Wenhua Liu
1992-01-01
When thenoyltrifluoroacetone-phenanthroline-Triton X-100 is used to determine samarium(III) and europium(III) fluorimetrically, only a limited amount of neodymium(III) can be tolerated. By using an on- line separation which can partially separate neodymium(III) from samarium(III), a practical and convenient method was developed to detect samarium(III) at concentrations >0.05% and europium(III) at concentrations >0.005% in neodymium oxide. (author). 7 refs.; 4 figs.; 3 tabs
International Nuclear Information System (INIS)
Luiz, J.M.
1989-01-01
The synthesis of lanthanum and yttrium oxysulfides activated by europium were obtained by thermal decomposition of lanthanum and yttrium oxalates doped with europium, under an argon and sulphur atmosphere. The thermal decomposition of these compounds is studied by differential thermal analysis (DTA). The characterization of these oxysulfides were made by chemical analyses, infrared spectroscopy, X-ray diffraction, scanning electron microscopy and emission spectroscopy. (M.V.M.)
The migrant 152Eu as europium humate
International Nuclear Information System (INIS)
Klotz, D.
2001-01-01
Europium was used as a representative of the lanthanide group in the migration experiments in underground water. These 14 elements, with the atomic numbers of 58 (cerium) through 71 (lutetium) are quite similar in their chemical characteristics, and all of them will form metal-humate complexes with humic acids via proton exchange groups. Apart from the concentration, chemical composition and structure, also the particle size of these metal humates will vary strongly as it is dependent on the geochemistry and geophysics of the underground systems [de
Solubility and first hydrolysis constants of europium at different ionic strength and 303 K
International Nuclear Information System (INIS)
Ramirez-Garcia, J.J.; Jimenez-Reyes, M.; Lopez-Gonzalez, H.; Autonoma Metropolitana-Iztapalapa Univ., Mexico City; Solache-Rios, M.; Fernandez-Ramirez, E.; Centro Interamericano de Recursos del Agua, Toluca; Rojas-Hernandez, A.
2003-01-01
The solubility of europium at 0.02M, 0.1M and 0.7M NaClO 4 ionic strength solutions was determined by a radiometric method and pEu s -pC H diagrams were obtained. Hydrolysis constants were also determined at the same ionic strengths by pH titration and the values found were log *β 1 -7.68±0.11, -8.07±0.10 and -8.20±0.11. The log K sp values were -23.5±0.2, -22.7±0.2 and -21.9±0.2 for 0.02M, 0.1M and 0.7M NaClO 4 ionic strengths, respectively, at 303 K under CO 2 -free conditions and the extrapolated value at zero ionic strength was log K sp 0 = -24.15. The working pC H ranges for the calculation of the hydrolysis constants were selected from the pEu s -pC H diagrams in the region where precipitation of europium oxide or hydroxide was less than 20%. Europium removal from aqueous solutions with zeolites was explored. (author)
International Nuclear Information System (INIS)
Beudaert, Ph.; Lamare, V.; Wipff, G.
2001-01-01
Molecular dynamics simulations have been performed in water on europium nitrate complexes with three neutral organophosphorus extractants (TBP, TPPO and CMPO) in order to determine on what criteria it is possible to obtain by simulations the experimental 1:3 stoichiometry in organic solution. This stoichiometry was investigated by progressive saturation of the cation coordination sphere. When the nitrate counter-ions are bidentate, the 1:3 stoichiometry corresponds to the degree of saturation where the interaction energy between europium and water becomes repulsive. Beyond this stoichiometry, complexes with TPPO and CMPO are unstable, although a 1:4 complex with TBP may exist but its formation appears to be energetically unfavored. (author)
21 CFR 146.141 - Canned orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...
Kalinovskaya, I. V.; Zadorozhnaya, A. N.
2018-04-01
Influence of cinnamic acid on the luminescent properties of the europium(III) nitrate with 1,10-phenantroline in a polymer materials was studied. It was shown that combined use of these rare earth complexes leads to intense luminescence in the 400-700 nm region. Samples containing polymer europium nitrate with 1,10-phenantroline and cinnamic acid at a molar ratio of 1:2,0 had the maximum luminescence intensity and photostability.
Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate
Energy Technology Data Exchange (ETDEWEB)
Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental
2013-02-15
In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)
Synthesis, characterization and fluorescence studies of a novel europium complex based sensor
International Nuclear Information System (INIS)
Li Bin; Chen Qiuyun; Wang Yachen; Huang Jing; Li Yang
2010-01-01
A novel europium(III) complex was synthesized using TTA (α-thenoyltrifluoroacetone) as the first ligand and H 2 bpdc (2,2'-bipyridine-3,3'-dicarboxylate) as the second ligand. Elemental analysis, thermal analysis, IR and UV-vis spectrum and fluorescence spectrum of the europium(III) complex were carried out. A characteristic Eu 3+ fluorescence emission was observed in ethanol-water (1:1) solution, indicating that the complex is stable in solution and the emission of Eu(III) ions was not influenced by the water molecules. The fluorescence emission of the complex was quenched completely by the Co 2+ and Fe 3+ ions, but the quenched emission was recovered in the presence of glycine. Moreover, the Eu 3+ emission was very sensitive to pH, so the complex can be used as pH-dependent fluorescence probe or chemosensors.
Characterization of the europium tetracycline complex as a biomarker for atherosclerosis
Courrol, Lilia C.; da Silva, Mônica N.; Sicchieri, Leticia B.
2016-04-01
Atherosclerosis is a narrowing of the arteries caused by an increase of atheromatous plaque: material formed by macrophage cells containing cholesterol and fatty acids, calcium and a variable amount of fibrous connective tissue. The elation between vulnerable plaques and cardiovascular events can be determined using plaque biomarkers. In this work, atherosclerotic plaques stained with different molar ratios of europium, in a potential plaque biomarker, europium tetracycline complex, were studied by fluorescence microscopy. The tetracycline antibiotic used was chlortetracycline. The growth of atherosclerotic plaque was followed during 60 days in New Zealand rabbits divided in two groups: an experimental group (EG), with nine animals and a control group (CG) with three animals. The animals in the EG received a diet with 1% of cholesterol and the animals of GC received a normal diet. The aortic arch of the animals with 60 days were cut in the vertical plane in 6 μm thick slices, which were mounted on glass slides and stained with hematoxylin an eosin and europium chlortetracycline complex (EuCTc). The fluorescence images were obtained exciting the EuCTc absorption band with a filter cube D (BP 355 - 425) and the emission was collected with a LP 470 suppression filter. Light intensity, detector gain and acquisition time were fixed for comparisons. The 20× magnified images were collected with 12 bit (or 4096 gray tones) resolution. The mean value of gray scale for each molar ratio of EuCTc was different, indicating that the complex interacts with the components of atherosclerotic plaque and the best molar ratio was 1.5 EuCTc. These results indicate the potential use of the EuCTc biomarker for atherosclerotic plaque characterization.
19 CFR 146.26 - System review.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...
22 CFR 146.525 - Fringe benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...
Directory of Open Access Journals (Sweden)
Simona-Liliana Iconaru
2013-01-01
Full Text Available Fourier transform infrared spectroscopy (FT-IR analysis was conducted on europium-doped hydroxyapatite, Ca10-xEux(PO46(OH2 nanocrystalline powders (Eu:HAp with 0≤xEu≤0.2. Antimicrobial studies were also performed for the first time on Eu:HAp. The antimicrobial properties of Eu:HAp nanoparticles with 0≤xEu≤0.2 on Gram-negative (E. coli ATCC 25922, Pseudomonas aeruginosa 1397 and Gram-positive (Staphylococcus aureus 0364, Enterococcus faecalis ATCC 29212 bacteria systems and a species of fungus (Candida albicans ATCC 10231 were reported. Our study demonstrates that the antimicrobial activity of Eu:HAp nanoparticles is dependent on the europium concentration.
21 CFR 146.140 - Pasteurized orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...
International Nuclear Information System (INIS)
Mishchenko, V.T.; Aleksandrova, N.N.
1989-01-01
Spectrophotometric methods for europium determination in luminophors are proposed. Application of standard and derivative spectrophotometry allows one to determine europium in oxide and oxysulfide luminophors, their wastes and raffinates produced during waste reprocessing quite accurately and reliably. When determining Eu 2 O 3 (Eu 2 O 2 S) mass shares within 4-8 % limits absolute deviation from the mean result makes up to more than ± 0.2 %, relative standard deviation does not exceed 0.02
Stability constants of the Europium complexes with the chloride ions
International Nuclear Information System (INIS)
Jimenez R, M.; Solache R, M.; Rojas H, A.
2000-01-01
The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)
Sorption of europium by Haro river sand in aqueous solution
International Nuclear Information System (INIS)
Syed Moosa Hasany; Syed Javaid Khurshid
1997-01-01
The sorption of Eu(III) on Haro river sand has been investigated. Influences include composition of the sorptive medium, the concentration of sorbent and sorbate, and shaking time. Haro river sand can be exploited for the preconcentration and removal of europium from very dilute solutions, for the decontamination and treatment of radioactive waste water and effluents from nuclear installations. (Author)
19 CFR 146.3 - Customs supervision.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...
21 CFR 146.137 - Frozen orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...
21 CFR 146.145 - Orange juice from concentrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...
International Nuclear Information System (INIS)
Berdonosova, D.G.; Burlakova, E.V.; Yasenkova, M.A.; Ivanov, L.N.; Melikhov, I.V.
1989-01-01
The mechanism of formation of the precipitated CaSO 4 ·0.5H 2 O phase was studied in detail; the precipitation was performed at 80 degree, equimolar solutions of Ca(H 2 PO 4 ) 2 and H 2 SO 4 in phosphoric acid of 38% concentration being used. The availability of detailed information on the mechanism of formation of CaSO 4 ·0.5H 2 O precipitates determined the choice of conditions of study of capture of rare earths. In particular, H 3 PO 4 of 38% P 2 O 5 concentration was used as the medium of formation of the calcium sulfate precipitate. Europium was chosen as the rare earth. Its behavior in the liquid and solid phases was studied by radiometric and luminescence methods. The radionuclide 152 Eu is convenient as a radioactive tracer while luminescence of europium is structure-sensitive; therefore, europium is often used in physicochemical investigations as a luminescent probe. It follows from the data that most of the europium captured by the precipitate during coagulation of the ultramicrocrystals is retained firmly by the solid phase. Therefore, in order to diminish capture of europium (and other rare earths) by the precipitate coagulation of the latter should be prevented
Mass spectrometric investigation of fluorated europium β-diketonates
International Nuclear Information System (INIS)
Khomenko, V.S.; Lozinskij, M.O.; Fialkov, Yu.A.; Rasshinina, T.A.; Suboch, V.P.; AN Ukrainskoj SSR, Kiev. Inst. Organicheskoj Khimii)
1983-01-01
Ternary complexes of europium with two organic lidands - fluorated β-diketone and organic base - in the aqueous phase at electron shock are investigated; regroupings that take place in them are established. Mass-spectrometric investigation has shown that complexes with β-diketones, containing in oxygen atom in a fluorated radical, eliminate stable molecules of difluorophosgen, CoF 2 . For the complexes studied under the above conditions the Co molecule elimination is also typical which is accompanied by the formation of ions with a metal-carbon bond
Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)
Energy Technology Data Exchange (ETDEWEB)
Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)
2017-06-01
With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.
Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)
International Nuclear Information System (INIS)
Wollenberg, Anne; Raff, Johannes
2017-01-01
With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.
Synthesis and characterization of highly triboluminescent doped europium tetrakis compounds
International Nuclear Information System (INIS)
Fontenot, Ross S.; Hollerman, William A.; Bhat, Kamala N.; Aggarwal, Mohan D.
2012-01-01
One of the most intriguing properties involving crystals is their ability to emit light when fractured. While this property was discovered over 200 years ago, no one has ever been able to come up with a complete theory that can predict the physical principles associated with triboluminescence. However, this has not stopped scientists from coming up with various uses for these materials. One such application is to use these materials as the active element for smart impact sensors that can warn of catastrophic impacts. If these sensors are to become a reality however, the material must emit a bright light when fractured. One of the brightest triboluminescent materials found thus far is europium dibenzoylmethide triethylammonium (EuD 4 TEA). This material was discovered by Hurt in 1966 and is bright enough to be seen in daylight. In 2011, the authors discovered that synthesizing EuD 4 TEA using europium nitrate instead of chloride significantly increased the triboluminescence yield and made the synthesis much easier and more consistent. However, to date, there are few investigations into the effects of dopants on the triboluminescence of EuD 4 TEA. This paper reports the investigation of the effects of various dopants on: (1) The triboluminescent light yield, (2) Crystal size and structure, (3) Synthesis time, and (4) Prompt decay time. Results show that inclusion of dopants during synthesis increases the triboluminescence emission of EuD 4 TEA by 55%, significantly reduces the synthesis time, and controls the decay time. All of these properties can be useful for constructing the first prototype of a customized impact sensor. - Highlights: ► Doped europium dibenzoylmethide triethylammonium (EuD 4 TEA) was synthesized. ► Effects of dopants was studied from EuD 4 TEA during low velocity (<10 m/s) impacts. ► The triboluminescent light yield, decay time, and synthesis time were measured. ► A specially-built drop tower was developed to measure triboluminescence
Nouhi, A.; Hajjoul, H.; Redon, R.; Gagné, J. P.; Mounier, S.
2018-03-01
Time-resolved Laser Fluorescence Spectroscopy (TRLFS) has proved its usefulness in the fields of biophysics, life science and geochemistry to characterize the fluorescence probe molecule with its chemical environment. The purpose of this study is to demonstrate the applicability of this powerful technique combined with Steady-State (S-S) measurements. A multi-mode factor analysis, in particular CP/PARAFAC, was used to analyze the interaction between Europium (Eu) and Humic substances (HSs) extracted from Saint Lawrence Estuary in Canada. The Saint Lawrence system is a semi-enclosed water stream with connections to the Atlantic Ocean and is an excellent natural laboratory. CP/PARAFAC applied to fluorescence S-S data allows introspecting ligands-metal interactions and the one-site 1:1 modeling gives information about the stability constants. From the spectral signatures and decay lifetimes data given by TRLFS, one can deduce the fluorescence quenching which modifies the fluorescence and discuss its mechanisms. Results indicated a relatively strong binding ability between europium and humic substances samples (Log K value varies from 3.38 to 5.08 at pH 7.00). Using the Stern-Volmer plot, it has been concluded that static and dynamic quenching takes places in the case of salicylic acid and europium interaction while for HSs interaction only a static quenching is observed.
Bioenvironmental aspects of europium and rhodium: a selected bibliography
International Nuclear Information System (INIS)
Fore, C.S.; Carrier, R.F.; Talmage, S.S.; Fielden, J.M.; Daniel, E.W.
1983-09-01
This bibliography of 428 abstracted references represents a summary of the domestic and foreign literature relevant to the biological and environmental aspects of europium and rhodium. The collected data are organized by current NAEG interests - research highlighting inventory and distribution of the radionulcides, ecological studies covering terrestrial and aquatic systems, and biological studies in both man and animals. Studies that focus directly on research conducted at specific sites (e.g., the Nevada Test Site) are emphasized throughout the bibliography
Davydov, S Y
2002-01-01
One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms
2011-06-01
... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...
Sorption of Europium in zirconium silicate
International Nuclear Information System (INIS)
Garcia R, G.
2004-01-01
Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO 4 ). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)
Metal plasmon enhanced europium complex luminescence
International Nuclear Information System (INIS)
Liu Feng; Aldea, Gabriela; Nunzi, Jean-Michel
2010-01-01
The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod) 3 ) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.
42 CFR 410.146 - Diabetes outcome measurements.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...
International Nuclear Information System (INIS)
Alvarado B, A.; Jimenez R, M.; Solache R, M.
1999-01-01
This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC H values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)
Improved efficiency of organic light-emitting diodes based on a europium complex by fluorescent dye
Energy Technology Data Exchange (ETDEWEB)
You Han [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Graduate School of Chinese Academy of Sciences, Changchun 130022 (China); Fang Junfeng [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Graduate School of Chinese Academy of Sciences, Changchun 130022 (China); Gao Jia [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Graduate School of Chinese Academy of Sciences, Changchun 130022 (China); Ma Dongge [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Graduate School of Chinese Academy of Sciences, Changchun 130022 (China)]. E-mail: mdg1014@ciac.jl.cn
2007-01-15
Improved efficiency of organic light-emitting diodes (OLEDs) based on europium complexes have been realized by using a fluorescent dye 4-(dicyanomethylene)-2-t-butyl-6 (1,1,7,7-tetramethyljulolidyl-9-enyl))-4H-pyran (DCJTB) doping .The luminous efficiency of the devices with a fluorescent dye in the emissive layer was found to improve two times of that in devices without fluorescent dye. The devices showed pure red light, which is the characteristic emission of trivalent europium ion with a full-width at half-maximum of 3 nm.The maximum brightness and luminous efficiency reached 1200 cd/m{sup 2} at 23 V and 7.3 cd/A (2.0 lm/w), respectively, at a current density of 0.35 mA/cm{sup 2}.
Determination of the first hydrolysis constant of Europium (III) in 3 M of ionic strength
International Nuclear Information System (INIS)
Ramirez B, M.E.
1994-01-01
The first hydrolysis constant of Eu 3+ has been determined at 303 K and 3 M (NaCl) ionic strength. A solvent extraction method was used, the extractant was dibenzoylmethane in benzene and di glycolate anion in the aqueous phase provided competitive complexation. The tracer solution was 152m1 Eu (III) in water. The radioactive solution of europium was obtained by neutron irradiation of europium nitrate solutions at pH 3.0, in a TRIGA Mark III nuclear reactor at a neutron flux of 1 x 10 13 cm -2 s -1 . The half life of the produced isotope, 152m1 Eu (9.3 h), was verified by means of a Ge H detector and no interfering radiations were observed in the spectra. (Author)
21 CFR 146.150 - Canned concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...
19 CFR 146.63 - Entry for consumption.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...
International Nuclear Information System (INIS)
Nissamudeen, K.M.; Krishnan, Renju R.; Rajan, Geo; Gopchandran, K.G.
2007-01-01
Full text: Phosphors are essential materials in display applications. Oxide-based phosphors are likely to emerge as the potential choice for the FED red phosphor. Among those oxide-based phosphors, there has been significant research interest in the development of Y 2 O 3 :Eu thin films as one of the most promising oxide based red phosphor systems. Yttrium oxide mixed with europium exhibit strong UV and cathode-ray-excited luminescence that are useful in lamp and display applications. Dielectric Y 2 O 3 film has recently attracted much attention for its potential application as an electric insulation layer in electroluminescent devices and high-density dynamic random access memory gate dielectrics because of its high band gap (5.8 eV) and large dielectric constant (14 to 18). Another important application of Y 2 O 3 has been in luminescent displays as a host material for rare-earth ions, specifically europium, in order to get emission of red light. In the present study thin films were deposited under a vacuum of 10 -6 mbar on fused amorphous quartz substrates using a Q-switched Nd: YAG laser, 532 nm, pulse width 9 n sec, and repetition frequency of 10 Hz, with sintered Y 2 O 3 pellets having different europium concentration as target material. Attempts were made to understand the effect of europium concentration and annealing process on the photoemission properties of the films. A europium concentration of 8 wt% and an annealing temperature of 1173 K were found to be optimum conditions for maximum photoemission. The dependence of structure and morphology of the films on the photoemission intensity are described with XRD patterns and images obtained from AFM and SEM studies
Test of zircon materials for sorption of europium
International Nuclear Information System (INIS)
Ordonez R, E.; Fernandez V, S.M.; Garcia R, G.
2003-01-01
In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO 4 ) and the alpha zirconium hydrogen phosphate (Zr(HPO 4 ) 2H 2 0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)
Electronic structure and superconductivity of europium
International Nuclear Information System (INIS)
Nixon, Lane W.; Papaconstantopoulos, D.A.
2010-01-01
We have calculated the electronic structure of Eu for the bcc, hcp, and fcc crystal structures for volumes near equilibrium up to a calculated 90 GPa pressure using the augmented-plane-wave method in the local-density approximation. The frozen-core approximation was used with a semi-empirical shift of the f-states energies in the radial Schroedinger equation to move the occupied 4f valence states below the Γ 1 energy and into the core. This shift of the highly localized f-states yields the correct europium phase ordering with lattice parameters and bulk moduli in good agreement with experimental data. The calculated superconductivity properties under pressure for the bcc and hcp structures are also found to agree with and follow a T c trend similar to recent measurement by Debessai et al.
Mass spectrometric investigation of fluorated europium. beta. -diketonates. [Electrons
Energy Technology Data Exchange (ETDEWEB)
Khomenko, V.S.; Lozinskij, M.O.; Fialkov, Yu.A.; Rasshinina, T.A.; Suboch, V.P. (AN Belorusskoj SSR, Minsk. Inst. Fiziki; AN Ukrainskoj SSR, Kiev. Inst. Organicheskoj Khimii)
Ternary complexes of europium with two organic ligands - fluorated ..beta..-diketone and organic base - in the aqueous phase at electron shock are investigated; regroupings that take place in them are established. Mass-spectrometric investigation has shown that complexes with ..beta..-diketones, containing in oxygen atom in a fluorated radical, eliminate stable molecules of difluorophosgen, CoF/sub 2/. For the complexes studied under the above conditions the Co molecule elimination is also typical which is accompanied by the formation of ions with a metal-carbon bond.
21 CFR 146.187 - Canned prune juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...
Europium sorption on zirconia at elevated temperatures: experimental study and modeling
International Nuclear Information System (INIS)
Eglizaud, N.; Catalette, H.
2005-01-01
Full text of publication follows: Direct disposal of spent nuclear fuel in deep underground repository is being considered by several countries. The waste package maintains an elevated temperature for thousands of years. As sorption is one of the main phenomenon limiting the dispersion of radionuclides in the environment, it has to be studied at elevated temperatures. Zirconia is an oxide produced by cladding oxidation which is suspected in the near field of a nuclear repository. It then could possibly be in contact with waste elements as Europium (III), the sorption of which is therefore studied on zirconia. Experiments were performed by the batch method at a solid/liquid ratio of 10 g.L-1. The sorption edges were recorded in the pH-range from 2 to 10 at 2.10 -5 mol.L -1 Eu(NO 3 ) 3 (I = 0.1 mol.L -1 KNO 3 ). An over-pressure device in an autoclave with an incorporated filtering system allowed the experiments, carbonate free, at 25 deg. C, 50 deg. C, 80 deg. C, 120 deg. C and 150 deg. C and in situ pH measurements. Filtrates were analyzed by the ICP-AES method. Sorption isotherms show an increase in the sorption phenomenon when the temperature raises. The half sorption pH decreases from 7 at 25 deg. C to 3,6 at 150 deg. C. The distribution coefficients that were obtained at elevated temperatures enriched the databases of integrated performance assessment codes. Raw data were modeled with the surface complexation theory using the double layer model (DLM). Several possible surface complexes were examined and discussed, taking into account aqueous hydrolyzed and precipitated species of Europium. A good agreement between experimental values and modeled isotherms was found at all studied temperatures. Results were consistent with a bidentate complex formed by Europium (III) on the zirconia surface. Associated formation constants were then determined with the geochemical computer code CHESS. (authors)
ULTRAVIOLET TRANSITIONS IN EUROPIUM STUDIED WITH A FREQUENCY-DOUBLED CW RING DYE-LASER
Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.
1981-01-01
High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.
Detection of Molecular Chirality by Induced Resonance Raman Optical Activity in Europium Complexes
Czech Academy of Sciences Publication Activity Database
Yamamoto, Shigeki; Bouř, Petr
2012-01-01
Roč. 51, č. 44 (2012), s. 11058-11061 ISSN 1433-7851 R&D Projects: GA MŠk(CZ) LH11033; GA ČR GAP208/11/0105 Institutional support: RVO:61388963 Keywords : europium * complexes * raman optical activity * resonance Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 13.734, year: 2012
International Nuclear Information System (INIS)
Milchlin, E.B.; Khmuran, M.A.; Mikhailichenko, A.I.
1986-01-01
A study has been made of the distribution of microquantities of europium (III) on extraction with neutral phosphoorganic compounds-tri-n-butyl phosphate (TBP), diisooctylmethyl phosphonate (DIOMP),trialkylphosphine oxide with dissimilar radicals (PODR), or mixtures thereof-from a solution of 2 mole/liter NH 4 NO 3 and 0.01 mole/liter HNO 3 , in the temperature range 20-60 0 C. A temperature rise results in a decrease of the distribution coefficients of the europium on extraction by all of the extractants tested and their mixtures, and also in a reduction of the synergistic effect in extraction by mixtures of the extractants. Based on an investigation of the temperature dependences of the distribution constants of europium nitrate upon extraction by TBP, DIOMP, PODR, or their mixtures, values have been determined for the enthalpy, free energy, and entropy of extraction. It is shown that the enthalpy (-ΔH) increases in the order TBP< DIOMP< PODR. In an extraction with mixed extractants, the enthalpy has a value intermediate between those with the individual extractants. The entropy of extraction (-ΔS) increases in the reverse order PODR< DIOMP< TBP
In vivo toxicity studies of europium hydroxide nanorods in mice
International Nuclear Information System (INIS)
Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H.; Mukhopadhyay, Debabrata
2009-01-01
Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence and pro-angiogenic properties to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [Eu III (OH) 3 ] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mg kg -1 day -1 ) and time dependent manner (8-60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice euthanized on days 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod-treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods.
40 CFR 146.2 - Law authorizing these regulations.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...
Cao, Hong; Gao, Xicun; Huang, Chun-Hui
2000-07-01
With a europium complex, tris(α-thenoyltrifluoroacetonato) bis(triphenylphosphine oxide) europium (Eu(TTA) 3(TPPO) 2), as the light-emitting layer, N, N'-diphenyl- N, N'-di( m-tolyl)-benzidine (TPD) as the hole transport layer and tris(8-quinolinolato) aluminum (ALQ) as the electron transport layer, the triple-layer electroluminescent (EL) device emits red light characteristic of Eu 3+ emission. However, as the mixture of Eu(TTA) 3(TPPO) 2 and ALQ is co-evaporated as the light-emitting layer to form a bilayer EL device, a new wide-banded emission peaked at c. 640 nm was obtained. This emission is neither from ALQ nor from the europium complex. The photoluminescence (PL) of the thin film on quartz substrate evaporated from one mixed solid powder of Eu(TTA) 3(TPPO) 2 and ALQ is composed of distinct PL emissions of Eu(TTA) 3(TPPO) 2 and ALQ, denying an exciplex formation mechanism. It is impossible to form a host-guest system. We propose that the EL emission peaked at c. 640 nm is from an electroplex route: a transition between the lowest unoccupied molecular orbital (LUMO) of Eu(TTA) 3(TPPO) 2 and the highest occupied molecular orbital (HOMO) of ALQ.
Kim, Eunjeong; Ma, Eunsook
2007-04-01
The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.
22 CFR 146.400 - Education programs or activities.
2010-04-01
... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...
19 CFR 146.13 - Customs forms and procedures.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...
19 CFR 146.10 - Authority to examine merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...
International Nuclear Information System (INIS)
Kim, Woo-Sik; Kim, Woon-Soo; Kim, Kwang-Seok; Kim, Joon-Soo; Ward, Michael D.
2004-01-01
The particle agglomeration of europium oxalate was investigated in a double-jet semi-batch reactor over a wide range of operating variables, including the agitation speed, reactant feed rate, and reactant concentration. The size of the agglomerates was directly dictated by the particle collision and supersaturation promoting agglomeration and the fluid shear force inhibiting agglomeration. Thus, with a longer feeding time and higher feed concentration for the reaction crystallization, the mean particle size increased, while the corresponding total particle population decreased due to the enhanced chance of particle agglomeration, resulting from a longer residence time and higher supersaturation in the reactor. Agitation was found to exhibit a rather complicated influence on particle agglomeration. Although both particle collision and turbulent fluid shear were promoted by an increase in the mixing intensity, the crystal agglomeration of europium oxalate was maximized at around 500 rpm of agitation speed due to an optimized balance between particle aggregation and breakage
Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS
AUTHOR|(CDS)2099873; Marsh, Bruce Alan
The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...
Energy Technology Data Exchange (ETDEWEB)
Grasso, Andrea Nastri
2010-07-01
In this work were studied the spectroscopic properties of trivalent europium ion complexed with components of tetracycline family, chlorotetracycline, oxytetracycline and metacycline, in the presence of hydrogen peroxide and urea peroxide. Optical parameters were obtained such as absorption, emission, lifetime and calibration curves were constructed for luminescence spectra. Experiments were carried out with both inorganic compounds and europium-tetracyclines complexes in order to verify possible interferences. Studies for glucose determination were also described using europium-tetracyclines complexes as biosensors. Results show that europium tetracyclines complexes emit a narrow band in the visible region and, in the presence of hydrogen peroxide or urea peroxide there is a greater enhancement in their luminescence and lifetime. Thus, europium-tetracyclines complexes studied can be used as biosensors for hydrogen and urea peroxides determination as a low cost and room temperature method. An indirect method for glucose determination was studied by adding glucose oxidase enzyme in europium-tetracyclines complex in the presence of glucose promoting as product hydrogen peroxide. (author)
19 CFR 146.51 - Customs control of merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...
10 CFR 72.146 - Design control.
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...
21 CFR 146.151 - Orange juice for manufacturing.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...
21 CFR 146.152 - Orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...
2010-07-07
... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...
Europium-doped calcium titanate: Optical and structural evaluations
Energy Technology Data Exchange (ETDEWEB)
Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: ilvrosa@ufscar.br [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)
2014-02-05
Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.
Energy Technology Data Exchange (ETDEWEB)
Dubey, Vikas, E-mail: jsvikasdubey@gmail.com [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)
2016-05-06
Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.
International Nuclear Information System (INIS)
Kokko, Leena; Sandberg, Kaisa; Loevgren, Timo; Soukka, Tero
2004-01-01
Nanoparticles containing thousands of fluorescent europium(III) chelates have a very high specific activity compared to traditional lanthanide chelate labels. It can be assumed that if these particles are used in a homogeneous assay as donors, multiple chelates can excite a single acceptor in turns and the energy transfer to the acceptor is increased. The principle was employed in an immunoassay using luminescent resonance energy transfer from a long lifetime europium(III) chelate-dyed nanoparticle to a short lifetime, near-infrared fluorescent molecule. Due to energy transfer fluorescence lifetime of the sensitised emission was prolonged and fluorescence could be measured using a time-resolved detection. A competitive homogeneous immunoassay for estradiol was created using 92 nm europium(III) chelate-dyed nanoparticle coated with 17β-estradiol specific recombinant antibody Fab fragments as a donor and estradiol conjugated with near-infrared dye AlexaFluor 680 as an acceptor. The density of Fab fragments on the surface of the particle influenced the sensitivity of the immunoassay. The optimal Fab density was reached when the entire surface of the particle participated in the energy transfer, but the areas where the energy was transferred to a single acceptor, did not overlap. We were able to detect estradiol concentrations down to 70 pmol l -1 (3xSD of a standard containing 0 nmol l -1 of E2) using a 96-well platform. In this study we demonstrated that nanoparticles containing lanthanide chelates could be used as efficient donors in homogeneous assays
21 CFR 146.135 - Orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...
International Nuclear Information System (INIS)
Diamandescu, L.; Vasiliu, F.; Tarabasanu-Mihaila, D.; Feder, M.; Vlaicu, A.M.; Teodorescu, C.M.; Macovei, D.; Enculescu, I.; Parvulescu, V.; Vasile, E.
2008-01-01
Iron- and europium-doped (≤1 at.%) TiO 2 nanoparticles powders have been synthesized by a hydrothermal route at 200 deg. C, starting with TiCl 4 , FeCl 3 .6H 2 O and EuCl 3 .6H 2 O. The structure, morphology and optical peculiarities were investigated by means of X-ray diffraction (XRD), transmission electron microscopy (TEM), extended X-ray absorption fine structure (EXAFS), Moessbauer spectroscopy and UV-vis measurements. The photocatalytic performance was analysed in the photodegradation reaction of phenol. Rietveld refinements of XRD patterns reveal that the as-prepared samples consist in iron- and europium-doped TiO 2 in the tetragonal anatase structural shape, with particle size as low as 15 nm. By means of Moessbauer spectroscopy on both 57 Fe and 151 Eu isotopes as well as by EXAFS analyses, the presence of Fe 3+ and/or Eu 3+ ions in the nanosized powders has been evidenced. It was found that iron and europium ions can substitute for titanium in the anatase structure. From the UV-vis reflection spectra, by using the transformed Kubelka-Munk functions, the band gap energy (E g ) of the hydrothermal samples has been determined in comparison with that of Degussa P-25 photocatalyst. A decrease of E g from 2.9 eV found for Degussa photocatalyst to 2.8 eV for the titania doped with 1 at.% Fe has been evidenced, indicating a valuable absorption shift (∼20 nm) towards visible light region. However, the best photocatalytic activity in the photodegradation reaction of phenol was evidenced for the hydrothermal sample, TiO 2 : 1 at.% Fe, 0.5 at.% Eu, in both UV and visible light regions. The photocatalytic activities of iron-doped and iron-europium-codoped samples are high and practically the same only in visible light. The photocatalytic properties in correlation with the structural and optical peculiarities of the hydrothermal samples are discussed
International Nuclear Information System (INIS)
McKittrick, J.; Bacalski, C.F.; Hirata, G.A.; Hubbard, K.M.; Pattillo, S.G.; Salazar, K.V.; Trkula, M.
1998-01-01
Europium doped yttrium oxide, (Y 1-x Eu x ) 2 O 3 , thin-films were deposited on silicon and sapphire substrates by metallorganic chemical vapor deposition (MOCVD). The films were grown in a MOCVD chamber reacting yttrium and europium tris(2,2,6,6-tetramethyl-3,5,-heptanedionates) precursors in an oxygen atmosphere at low pressures (5 Torr) and low substrate temperatures (500--700 C). The films deposited at 500 C were flat and composed of nanocrystalline regions of cubic Y 2 O 3 , grown in a textured [100] or [110] orientation to the substrate surface. Films deposited at 600 C developed from the flat, nanocrystalline morphology into a plate-like growth morphology oriented in the [111] with increasing deposition time. Monoclinic Y 2 O 3 :Eu 3+ was observed in x-ray diffraction for deposition temperatures ≥600 C on both (111) Si and (001) sapphire substrates. This was also confirmed by the photoluminescent emission spectra
International Nuclear Information System (INIS)
Pogrebnoj, A.M.; Kudin, L.S.
2003-01-01
Composition of saturated vapor over europium dichloride was studied by the method of high-temperature mass spectrometry in the temperature range of 1154 - 1267 K. For neutral components of the vapor, represented by monomer and dimer molecules, partial pressures were determined. Enthalpies of sublimation of europium dichloride Δ s H 0 (298 K) as monomers (338 ± 9) and dimers (407 ± 20 kJ/mol) were calculated. Equilibrium constants of ion-molecular and ion-ionic reactions were measured, their enthalpies being ascertained. Enthalpies of formation of molecules and ions Δ f H 0 (298 K) were calculated: -486 ± 11 (EuCl 2 ), -1242 ± 22 (Eu 2 Cl 4 ), 1 ± 12 (Eu 2 Cl 2 + ), -347 ± 20 (Eu 2 Cl 3 + ), -1111 ± 42 (Eu 3 Cl 5 + ), -975 ± 20 (EuCl 3 - ), -1309 ± 17(EuCl 4 - ), -1734 ± 20 (Eu 2 Cl 5 - ) kJ/mol [ru
Directory of Open Access Journals (Sweden)
Faley Jean de Sousa
2010-03-01
Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Energy Technology Data Exchange (ETDEWEB)
Gutzov, Stoyan, E-mail: sgutzov@chem.uni-sofia.bg [University of Sofia “St. Kliment Ohridski”, Department of Physical Chemistry, J. Bourchier Blvd. 1, 1164 Sofia (Bulgaria); Danchova, Nina; Kirilova, Rada; Petrov, Vesselin [University of Sofia “St. Kliment Ohridski”, Department of Physical Chemistry, J. Bourchier Blvd. 1, 1164 Sofia (Bulgaria); Yordanova, Stanislava [University of Sofia “St. Kliment Ohridski”, Department of Organic Chemistry, J. Bourchier Blvd. 1, 1164 Sofia (Bulgaria)
2017-03-15
A simple two step procedure for the functionalization of hydrophobic silica aerogel microgranules with europium ions and/or 1,10 - phenanthroline is demonstrated. The activation procedure is based on soaking aerogels in a europium nitrate solution, followed by functionalization with 1,10 – phenanthroline. The functionalized materials display strong red or blue emission at UV-excitation, coming from the formation of [Eu(phen){sub 2}](NO{sub 3}){sub 3} or Si(IV)– 1,10-phenathroline complexes in the porous system of the aerogels. The most probable site symmetry of the europium cation is C{sub 2v} confirmed by luminescence spectra analysis. Room temperature diffuse reflectance spectra and excitation/luminescence spectra are used to describe the optical properties of the hybrid composites. Excitation spectra prove an efficient energy transfer between 1,10 – phenanthroline and the Eu{sup 3+} ion. - Graphical abstract: An effective activation procedure for functionalization of silica aerogel granules with [Eu(phen){sub 2}](NO{sub 3}){sub 3} and/or 1,10 – phenanthroline /phen/ has been demonstrated in order to obtain red or blue emitting materials. Luminescence spectra (excitation at 355 nm) of functionalized aerogel granules: 1 – SiO{sub 2}:0.18phen; 2 – [Eu(phen){sub 2}](NO{sub 3}){sub 3}; 3– SiO{sub 2}:0.007Eu(phen){sub 2}(NO{sub 3}){sub 3}. The Eu{sup 3+} f-f {sup 5}D{sub 0} →{sup 7}F {sub 0,1,2,3,4} emission transitions are denoted as 0-0, 0-1, 0-2, 0-3, 0-4. The most probable site symmetry of Eu3{sup +} ion is C{sub 2v}.
International Nuclear Information System (INIS)
Sroor, Farid M.; Hrib, Cristian G.; Hilfert, Liane; Edelmann, Frank T.
2015-01-01
The reaction of EuI_2(THF)_2 with 3 equiv. of the recently discovered lithium-cyclopropylethinylamidinate Li[c-C_3H_5-C≡C-C(NCy)_2] (1) (Cy = cyclohexyl) unexpectedly afforded the heterometallic europium(III) amidinate complex [{c-C_3H_5-C≡C-C(NCy)_2}Li{c-C_3H_5-C≡C-C(NCy)_2}_2Eu(μ-I)_2Li(THF)_2] (2) in the form of bright yellow, air- and moisture-sensitive crystals. An X-ray diffraction study of 2 revealed several unusual structural features. It comprises a double ''ate'' complex of the tentative trivalent europium(III) bis(cyclopropylethinylamidinate) derivative [c-C_3H_5-C≡C-C(NCy)_2]_2Eu"I"I"II. ''Ate'' complex formation occurred not only through retention of one equiv. of lithium iodide but also through addition of one equiv. of Li[c-C_3H_5-C≡C-C(NCy)_2]. The Li atom in the iodo-bridged Eu(μ-I)_2Li(THF)_2 part of the molecule is tetrahedrally coordinated, whereas the second lithium atom is only tricoordinate through the presence of a rare monodentate (dangling) amidinate ligand. (Copyright copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Thermal expansion studies on europium titanate (Eu2TiO5)
International Nuclear Information System (INIS)
Panneerselvam, G.; Subramanian, G.G.S.; Antony, M.P.
2008-01-01
The lattice thermal expansion characteristics of europium titanate (Eu 2 TiO 5 ) have been studied by measuring the lattice parameter by high temperature X-ray diffraction technique (HT-XRD) in the temperature range 298-1573K. Percentage linear thermal expansion and mean linear thermal expansion coefficients were computed from the lattice parameter data. The percentage linear thermal expansion in the temperature range 298-1573 K along a, b and c axes are 1.05, 1.15 and 0.95 respectively. (author)
Energy Technology Data Exchange (ETDEWEB)
Chen, Shuenn-Gang; Tsai, Hui-Tuh; Wu, Shaw-Chii [Institute of Nuclear Energy Research, Lung-Tan (Taiwan, Republic of China)
1981-10-03
An internal-standard method was applied for the determination of uranium, thorium, lanthanum and europium is carbonaceous shale samples and monazite sand by epithermal neutron activation analysis using gold as an internal standard element. The samples were irradiated in a zero-power reactor at the Institute of Nuclear Energy Research and measured with a high-resolution Ge(Li) detector. The detection limit is 0.1 ppm for uranium and europium, 1 ppm for thorium, 5 ppm for lanthanum, and the realative error of all elements is within +-2.6%.
Popa Cristina; Ciobanu Carmen; Iconaru Simona; Stan Miruna; Dinischiotu Anca; Negrila Constantin; Motelica-Heino Mikael; Guegan Regis; Predoi Daniela
2014-01-01
International audience; This paper reports a systematic investigation on europium doped hydroxyapatite (Eu:HAp). In this work, a set of complementary techniques Fourier Transform Infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), transmission electron microscopy (TEM) and, Brunauer-Emmett-Teller (BET) technique was used to allowing a proper understanding of Eu:HAp. The XPS analysis confirmed the substitution of Ca ions by Eu ions in Eu:HAp samples. Eu:HAp and pure HAp show ...
13 CFR 146.500 - Secretary of Defense.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...
13 CFR 146.600 - Semi-annual compilation.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...
Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.
Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan
2016-10-01
This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA
29 CFR 4.146 - Contract obligations after award, generally.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...
International Nuclear Information System (INIS)
Ukonaho, Telle; Rantanen, Terhi; Jaemsen, Laura; Kuningas, Katri; Paekkilae, Henna; Loevgren, Timo; Soukka, Tero
2007-01-01
Research in the field of immunoassays and labels used in the detection has been recently focused on particulate reporters, which possess very high specific activity that excludes the label as a sensitivity limiting factor. However, the large size and shape of the particulate labels may produce additional problems to immunoassay performance. The aim of this work was to study with two identical non-competitive two-site immunoassays whether up-converting phosphor (UCP) particles are comparable in performance with europium(III) chelate-dyed nanoparticles as particulate labels. In addition we strived to verify the common assumption of the photostability of up-converting phosphor particles supporting their potential applicability in imaging. Detection limits in two-site immunoassay for free prostate-specific antigen (free-PSA) were 0.53 ng L -1 and 1.3 ng L -1 using two different up-converting phosphors and 0.16 ng L -1 using europium(III) nanoparticle. Large size distribution and non-specific binding of up-converting phosphor particles caused assay variation in low analyte concentrations and limited the analytical detection limit. The non-specific binding was the major factor limiting the analytical sensitivity of the immunoassay. The results suggests the need for nanoscaled and uniformely sized UCP-particles to increace the sensitivity and applicability of up-converting phosphor particles. Anti-Stokes photoluminescence of up-converting phosphor particles did not photobleach when measured repeatedly, on the contrary, the time-resolved fluorescence of europium nanoparticles photobleached relatively rapidly
34 CFR 300.146 - Responsibility of SEA.
2010-07-01
... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...
19 CFR 146.93 - Inventory control and recordkeeping system.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others
2013-01-15
The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.
Red light emission from europium doped zinc sodium bismuth borate glasses
Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.
2017-12-01
Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.
Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung
2017-11-09
A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λ irr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.
International Nuclear Information System (INIS)
Karasev, V.E.; Botova, I.N.
1988-01-01
Some different-ligand europium complexes with dibenzoylmethane (DBM), hexamethylphosphotriamide (HMPA) and NO 3 -group of composition: Eu(NO 3 ) 3 x3HMPAx2H 2 O, Eu(NO 3 ) 2 xDBMx2HMPA, EuNO 3 x(DBM) 2 x2HMPA and Eu(DBM) 3 xHMPA are synthesized. Individuality of each complex is confirmed by methods of chemical, IR spectroscopic, luminescent, thermogravimetric analyses. Integral intensities of luminescence of synthesized complexes are measured, their excitation spectra in the crystal state at 77 K in the 200-600 nm range are studied
Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.
Abou Asa, S
2017-07-01
MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.
Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...
Energy Technology Data Exchange (ETDEWEB)
Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro
2015-07-01
The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).
Energy Technology Data Exchange (ETDEWEB)
Thang, Cao Xuan; Pham, Vuong-Hung, E-mail: vuong.phamhung@hust.edu.vn
2015-07-15
Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.
Energy Technology Data Exchange (ETDEWEB)
Rudolph, Daniel; Schleid, Thomas [Stuttgart Univ. (Germany). Inst. fuer Anorganische Chemie
2017-07-01
The syntheses and crystal structures of the two isotypic europium(II) oxide halides Eu{sub 2}OBr{sub 2} and Eu{sub 2}OI{sub 2} are reported. They crystallize orthorhombically in the space group Ibam (Z=4; Eu{sub 2}OBr{sub 2}: a=709.86(5), b=1200.34(9), c=628.71(4) pm; Eu{sub 2}OI{sub 2}: a=739.78(5), b=1295.13(9), c=644.82(4) pm). The unit cell parameters presented here, and thus the interatomic distances of Eu{sub 2}OI{sub 2}, are significantly smaller than the ones reported in the literature, which is explained by the substitution of europium with larger barium cations due to the synthesis route described in the early study. Central building blocks of both crystal structures are trans-edge-connected [OEu{sub 4}]{sup 6+} tetrahedra forming straight {sup 1}{sub ∞}{[OEu"e_4_/_2]"2"+} chains running parallel to the [001] direction. Bundled like a hexagonal rod packing, their interaction is achieved by Br{sup -} or I{sup -} anions for charge compensation.
First-Principles Investigations on Europium Monoxide
Wang, Hao
2011-05-01
Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.
International Nuclear Information System (INIS)
Zamani, Hassan Ali; Kamjoo, Rahman; Mohammadhosseini, Majid; Zaferoni, Mojdeh; Rafati, Zynab; Ganjali, Mohammad Reza; Faridbod, Farnoush; Meghdadi, Soraia
2012-01-01
Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 × 10 −2 and 1.0 × 10 −6 mol L −1 , Nernstian slope of 19.8 ± 0.3 mV per decade and a detection limit of 6.4 × 10 −7 mol L −1 . The potentiometric response is pH independent in the range of 2.4–7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu 3+ ions with EDTA and for determination of Eu 3+ ion concentration in mixtures of two and three different ions. - Highlights: ► A new ion carrier is introduced to preparation of a selective sensor for Eu 3+ ions. ► This technique is very simple and it's not necessary to use sophisticated equipment. ► The novelty of this work is the high affinity of the ionophore toward the Eu 3+ ions. ► The sensor is superior to the formerly reported Eu 3+ sensors in terms of selectivity.
Energy Technology Data Exchange (ETDEWEB)
Moutiers, G.; Mekki, S. [CEA Saclay, Dept. de Physico-Chimie, Service de Chimie Physique, 91 - Gif sur Yvette (France); Billard, I. [IN2P3/CNRS, 69 - Villeurbanne (France)
2007-07-01
One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf{sub 2}N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf{sub 2}N for the whole thesis and start with
International Nuclear Information System (INIS)
Moutiers, G.; Mekki, S.; Billard, I.
2007-01-01
One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf 2 N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf 2 N for the whole thesis and start with the electrochemical
Chloride, bromide and iodide scintillators with europium
Zhuravleva, Mariya; Yang, Kan
2016-09-27
A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.
International Nuclear Information System (INIS)
Metwally, S.S.; Hassan, R.S.; El-Masry, E.H.; Borai, E.H.
2018-01-01
Gamma radiation polymerization method was used for the modification of kaolin to produce (poly acrylamide-acrylic acid)-Kaolin (PAM-AA-K). Monazite ore is one of the main resources of uranium and lanthanide elements, therefore, this work focused on sorption of uranium, lanthanum and europium ions from low grade monazite leachate. The removal percent for Eu 3+ , La 3+ and UO 2 2+ are 94.6, 91.6 and 73.4%, respectively. Monolayer capacity of Eu 3+ , La 3+ and UO 2 2+ were found to be 54.64, 45.87 and 37.59 mg/g, respectively. The sorption mechanism of lanthanum and europium ions on PAM-AA-K composite mainly takes place as Ln(OH) 2+ , and for uranium as uranyl ion, UO 2 2+ . (author)
Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C
2013-07-29
The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Influence of the organic coating and calcium ions on the sorption of europium on a silica gel
International Nuclear Information System (INIS)
Fleury, C.; Barbot, C.; Pieri, J.; Durand, J.P.; Goudard, F.
1999-01-01
Humic substances, ubiquitous polyelectrolyte and polydisperse macromolecules, have a great affinity towards heavy metals and radionuclides. It is important to understand the role of these substances in the migration of contaminants that could be accidentialy released from radioactive waste repositories. The migration of these radionuclides is also governed by different influent parameters like pH, flow rate, ionic strength and presence of competing cations. Lab experiments have been undertaken, they allowed us to confirm that the behaviour and dispersion of europium (used as analog of actinides) depends on the presence of humic acids. If the latter are bound to mineral surfaces, they immobilize the radionuclides. On the other hand, if they are in a suspended form, they are able to decrease the influence of some parameters (pH, flow rate or ionic strength) and stabilize europium onto the mineral surfaces. The presence of calcium cations tends to increase the migration of Eu at lower flow rates and at most alcaline pH. (orig.)
Preparation of 1 Ci of europium 155 without carrier
International Nuclear Information System (INIS)
Falconi, N.; Radicella, R.
1968-01-01
High activity 'point' sources of 155 Eu are used for medical and industrial applications. For this purpose we have studied a method of obtaining I Ci of carrier free 155 Eu, with a solid residue smaller than 5 mg per Ci. In order to separate the 155 Eu from several grams of a 154 Sm enriched target we propose a procedure which is based on the work of Bouissieres and David, Onstott, and Takekoshi et al. The separation is carried out by electrolysis on a mercury cathode followed by purification on ion exchange resin. The yields of the europium separation and target recovery are 80 per cent and 90 per cent respectively. The time required for the procedure is three days. (authors) [fr
CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.
Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W
2018-04-01
CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.
33 CFR 146.120 - Manning of survival craft.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...
Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B
2013-09-01
Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong
2012-01-01
A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10 -9 - 7.0 Χ 10 -7 mol L -1 with a detection limit of 1.3 Χ 10 -9 mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10 -8 mol L -1 bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly
Energy Technology Data Exchange (ETDEWEB)
Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)
2012-04-01
Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.
International Nuclear Information System (INIS)
Elam, K.R.; Reich, W.J.
1995-09-01
The High Flux Isotope Reactor (HFIR) at the Oak Ridge National Laboratory (ORNL) is a 100 MWth light-water research reactor designed and built in the 1960s primarily for the production of transuranic isotopes. The HFIR is equipped with two concentric cylindrical blade assemblies, known as control cylinders, that are used to control reactor power. These control cylinders, which become highly radioactive from neutron exposure, are periodically replaced as part of the normal operation of the reactor. The highly radioactive region of the control cylinders is composed of europium oxide in an aluminum matrix. The spent HFIR control cylinders have historically been emplaced in the ORNL Waste Area Grouping (WAG) 6. The control cylinders pose a potential radiological hazard due to the long lived radiotoxic europium isotopes 152 Eu, 154 Eu, and 155 Eu. In a 1991 health evaluation of WAG 6 (ERD 1991) it was shown that these cylinders were a major component of the total radioactivity in WAG 6 and posed a potential exposure hazard to the public in some of the postulated assessment scenarios. These health evaluations, though preliminary and conservative in nature, illustrate the incentive to investigate methods for permanent destruction of the europium radionuclides. When the cost of removing the control cylinders from WAG 6, performing chemical separations and irradiating the material in HFIR are factored in, the option of leaving the control cylinders in place for decay must be considered. Other options, such as construction of an engineered barrier around the disposal silos to reduce the chance of migration, should also be analyzed
22 CFR 146.455 - Textbooks and curricular material.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...
Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe
He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing
2011-11-01
The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.
Directory of Open Access Journals (Sweden)
Zhang Kui-Hua
2011-01-01
Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.
International Nuclear Information System (INIS)
Liu Ping; Huang Mingsheng; Pan Wanzhang; Zhang Yamin; Hu Jianhua; Deng Wenji
2006-01-01
With an aim to develop novel luminescence materials, europium and terbium complexes of 2,5-(2-thiophene)-pyridine (TPY) and 5,5'-bis(5-(2,2'-bithiophene))-2,2'-bipyridine (B2TBPY) were synthesized, and their luminescence properties studied. The complexes exhibit ligand-sensitized emission, which is typical of Eu(III) and Tb(III) ions
Levels in 146Ce and the N = 88 isotones
International Nuclear Information System (INIS)
Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.
1981-01-01
An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout
Excited states in 146Sm and 147Sm
International Nuclear Information System (INIS)
Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.
1979-10-01
The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)
Liquid crystal europium(III) β-diketonato complex with 5,5'-di(heptadecyl)-2,2'-bipyridine
International Nuclear Information System (INIS)
Knyazev, A.A.; Lobkov, V.S.; Galyametdinov, Yu.G.
2004-01-01
Liquid crystal europium(III) complex containing β-diketone and 5,5-di(heptadecyl)-2,2'-bipyridine as ligands was prepared in ethanol solution and was isolated as a yellow precipitate with 62% yield. The product was characterized by data of elementary analysis, thermography, IR spectroscopy and luminescence spectra. Temperatures of crystal-mesophase and mesophase-isotropic liquid phase transitions amount to 95 and 130 Deg C respectively [ru
International Nuclear Information System (INIS)
Raynal, Francoise
1975-01-01
Eulytin is a bismuth orthosilicate and eulytin compounds revealed to be interesting matrix materials which can be used as medium gain laser materials. This research report is thus a contribution for a better knowledge of this material. Different eulytin compounds doped with lanthanide ions have been used to study the cationic polyhedron (by using structural probes such as the trivalent Europium in spectroscopy, or the trivalent gadolinium in electronic paramagnetic resonance) and the anionic polyhedron
Luminescent amine sensor based on europium(III) chelate.
Petrochenkova, Nataliya V; Mirochnik, Anatolii G; Emelina, Tatyana B; Sergeev, Alexander A; Leonov, Andrei A; Voznesenskii, Sergey S
2018-07-05
The effect of methylamine vapor on luminescence of Eu(III) tris-benzoylacetonate (I) immobilized in thin-layer chromatography plates has been investigated. It has been revealed that interaction of I with analyte vapor results in increase of the intensity of Eu(III) luminescence. The mechanism of the effect of methylamine vapors on intensification of the Eu(III) luminescence has been suggested using the data of IR spectroscopy and quantum chemistry calculations. The mechanism of luminescence sensitization consists in bonding of an analyte molecule with a water molecule into the coordination sphere of Eu(III). As a result, the bond of a water molecule with the luminescence centre weakens, rigid structural fragment including europium ion, water and methylamine molecules forms. The presence of such fragment must naturally promote decrease of influence of OH-vibrations on luminescence of the complex I. Copyright © 2018 Elsevier B.V. All rights reserved.
29 CFR 1990.146 - Issues to be considered in the rulemaking.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...
Directory of Open Access Journals (Sweden)
Ting-Yu Chang
Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up
The mercury-richest europium amalgam Eu{sub 10}Hg{sub 55}
Energy Technology Data Exchange (ETDEWEB)
Tambornino, Frank; Hoch, Constantin [Department of Chemistry, Ludwig-Maximilians-Universitaet Muenchen (Germany)
2015-03-15
The mercury-richest europium amalgam Eu{sub 10}Hg{sub 55} was synthesized by isothermal electrocrystallization from a solution of EuI{sub 3}.8DMF in DMF on a reactive mercury cathode. The crystal structure shows remarkable complexity and polar metal-metal bonding. Closely related to the structures of mercury-rich amalgams A{sub 11-x}Hg{sub 55+x} (A = Na, Ca, Sr), it shows underoccupied Hg positions along [00z]. Eu{sub 10}Hg{sub 55} can be described as hettotype structure of the Gd{sub 14}Ag{sub 51} structure type. (Copyright copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
40 CFR 146.9 - Criteria for establishing permitting priorities.
2010-07-01
....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...
Positive parity states and some electromagnetic transition properties of even-odd europium isotopes
Energy Technology Data Exchange (ETDEWEB)
Yazar, Harun Resit, E-mail: yazar@nevsehir.edu.tr [Nevsehir University, Faculty of Art and Science (Turkey)
2013-06-15
The positive-parity low-spin states of even-odd Europium isotopes ({sup 151-155}Eu) were studied within the framework of the interacting boson-fermion model. The calculated positive low-spin state energy spectra of the odd Eu isotope were found to agree quite well with the experimental data. The B(E2) values were also calculated and it was found that the calculated positive-parity low-spin state energy spectra of the odd-A Eu isotopes agree quite well with the experimental data.
International Nuclear Information System (INIS)
Jimenez, J.A.; Lysenko, S.; Liu, H.; Fachini, E.; Cabrera, C.R.
2010-01-01
Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu 3+ ions luminescence have been assessed. For the glass system containing only europium, Eu 3+ PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu 3+ PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag + ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu 3+ PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu 3+ →Eu 2+ reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu 3+ PL.
21 CFR 146.154 - Concentrated orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...
Spectroscopic studies of 2-thenoyltrifluoro acetonate of uranyl salts doped with europium
International Nuclear Information System (INIS)
Nakagawa, F.T.; Luiz, J.E.M. de Sa; Felinto, M.C.F.C.; Brito, H.F.; Teotonio, E.E.S.
2006-01-01
Uranyl compounds present a great potential as luminescence materials. Some examples of applications are: in laser technology, cathode ray tube, X-rays diagnostic. In this work it was studied the synthesis, characterization and spectroscopic properties study of uranyl 2-thenoyl trifluoroacetonate and uranyl 2- thenoyl trifluoroacetonate doped with europium. The compounds were synthesized and characterized by infrared absorption spectroscopy, thermal analysis, scanning electronic microscopy, and electronic spectroscopy of emission and excitation. The Eu 3+ ion acted as an effective luminescent probe, however the process of energy transfer from UO 2 2+ to Eu 3+ ion has not been efficient. (author)
Determination of micro amounts of samarium and europium by analogue derivative spectrophotometry
International Nuclear Information System (INIS)
Ishii, H.; Satoh, K.
1982-01-01
Derivative spectrophotometry using the analogue differentiation circuit was applied to the determination of samarium and europium at ppm levels. By measuring the second or the fourth derivative spectra of the characteristic absorption bands of both the rare earth ions around 400 nm, they can be determined directly and selectively in the presence of large amounts of most other rare earths without any prior separation. Further, aptly selecting conditions for the measurement of the derivative spectra, the simultaneous determination of both the rare earth elements was feasible. The principle and the characteristics of analogue derivative spectrophotometry are also described. (orig.) [de
Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex
International Nuclear Information System (INIS)
Liu, Yu; Wang, Yafei; Li, Chun; Huang, Ying; Dang, Dongfeng; Zhu, Meixiang; Zhu, Weiguo; Cao, Yong
2014-01-01
A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM) 3 (BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM) 3 (BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu 3+ ion emission, based on the 5 D 0 → 7 F 2 transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE ext ) of 1.26% at current density of 1.65 mA cm −2 , with a maximum brightness of 568 cd m −2 at 137.8 mA cm −2 was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM) 3 (BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM) 3 (BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices
Chloride, bromide and iodide scintillators with europium doping
Zhuravleva, Mariya; Yang, Kan
2014-08-26
A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.
Ferromagnetic semiconductor-metal transition in heterostructures of europium monoxide
Energy Technology Data Exchange (ETDEWEB)
Stollenwerk, Tobias; Kroha, Johann [Physikalisches Institut der Universitaet Bonn (Germany)
2012-07-01
Experiments on thin films of electron doped europium monoxide show a simultaneous ferromagnetic semiconductor-metal transition which goes along with a huge drop in resistivity over several orders of magnitude. Therefore, this material is a very promising candidate for spintronics applications. We have developed a theory which correctly predicts the simultaneous phase transition in thin films of electron doped EuO and the increase of the Curie temperature T{sub C} with doping concentration. The origin of the increased T{sub C} lies in the enhanced RKKY interaction between the localized 4f moments of the Eu atoms. Therefore, the phase transition is controlled by the population of the conduction band. We investigate the influence of film thickness and interface effects on the population of the conduction band and on the magnetic and electronic properties of the EuO film.
2010-01-01
... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...
19 CFR 146.61 - Constructive transfer to Customs territory.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...
Influence of biofilms on migration of uranium, americium and europium in the environment
International Nuclear Information System (INIS)
Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro
2015-01-01
The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).
Chen, Muhua; Zheng, Yuhui; Gao, Jinwei; Wang, Qianming
2016-10-01
A new type of Eu(III)-gatifloxacin complex with characteristic red luminescence has been prepared. Due to the presence of ionization effect linked to the organic chromophore, the molecular fluorescent sensor demonstrated variable pH-sensitive absorption and emission curves. The red emission derived from europium ions was strong during pH range 8-10. Between pH = 7 and 4, the europium emission remained relatively stable and fluorescence signals of gatifloxacin has been improved substantially. Under acidic conditions (pH = 1 to 3), the dramatic changes in the emission colors (from red, yellow to green) were clearly observed. Moreover, the excitation wavelength can be extended into the visible light range (Ex = 411 nm) by using the concentration effect experiment. Importantly, it gave turn-off emissions in the presence of Cu2+ or Fe3+ and the detection limits were determined to be 6.5 μM for Cu2+ and 6.2 μM for Fe3+ respectively.
9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.
2010-01-01
...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...
11 CFR 100.146 - Legal or accounting services to other political committees.
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...
Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells
Directory of Open Access Journals (Sweden)
Suning Huang
2014-01-01
Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.
Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang
2014-01-01
Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146
RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W
1995-01-01
Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states
19 CFR 146.8 - Seals, authority of operator to break and affix.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...
14 CFR 1260.146 - Procurement records.
2010-01-01
... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...
International Nuclear Information System (INIS)
Southard, Glen E.; Van Houten, Kelly A.; Ott, Edward W.; Murray, George M.
2007-01-01
Molecularly imprinted polymers capable of sensing organophosphorous compounds by luminescence have been prepared by reversible addition fragmentation chain transfer (RAFT) polymerization. The polymer contained a dithiobenzoate substituted tris(β-diketonate) europium(III) complex which served as a polymerization substrate and as a luminescent binding site for pinacolyl methylphosphonate (PMP), the hydrolysis product of the nerve agent Soman. The resultant polymer allowed quantitation of PMP in the low ppb range with minimal interference from similar compounds. Polymers were characterized by luminescence spectroscopy and scanning electron microscopy
2010-04-01
... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...
Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.
Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E
2016-09-01
Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells
International Nuclear Information System (INIS)
Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun
2014-01-01
Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma
A novel photoluminescent and photochromic europium complex
Institute of Scientific and Technical Information of China (English)
无
2002-01-01
A ternary europium complex of 4-aminobutyric acid (ABA) with 1,10-phenanthroline (phen) [Eu2(ABA)4 (phen)4](phen)4(ClO4)6 was synthesized and characterized by X-ray single crystal diffraction. The result shows that 4-aminobutyric acid exists in zwitterion form in the binuclear complex and that the carboxylates coordinate with Eu3+ ion in bidentate bridging and tridentate chelating-bridging modes. There are two types of phen molecules, one is coordinated and the other is uncoordinated. When excited by YAG: Nd laser with 355 nm light, the title complex can emit strong red fluorescence, and its high-resolution emission spectrum was recorded at 77 K. The Eu3+ ion site is in low symmetry, which is in agreement with the result of X-ray single crystal diffraction analysis. When irradiated with a mercury lamp, the aqueous solution of the title complex can perform photochromism with the color change from colorless to green and the green color can fade away in the dark. The photochromic response time is related to the concentration and pH of the solution, the temperature and the light intensity.
Study of Polymeric Luminescent Blend (PC/PMMA) Doped with Europium Complex under Gamma-Iradiation
International Nuclear Information System (INIS)
Parra, D. F.
2006-01-01
Spectroscopic properties of blends formed by bisphenol-A polycarbonate (PC) and poly(methyl methacrylate) (PMMA) doped with europium in organic complex were studied. Polymeric luminescent blends are potential materials for many applications; however, little information has been reported concerning the stability under thermal and radiation conditions. Luminescent films were synthesized from europium thenoyltrifluoroacetonate at different concentrations doped in PC/PMMA blends. Films produced of the luminescent polymer blend were irradiated in a 60 C o source. Their luminescent properties, in the solid state, as well as, the thermal oxidative resistance after gamma irradiation was investigated. These systems were characterized by elemental analysis, thermogravimetry (TGA), differential scanning calorimetry (DSC) and infrared spectroscopy (FTIR). Based on TGA data, the thermal stability of PC/PMMA:(tta)3 system is higher than the polymer blend. The DSC results indicated that those new systems are chemically stables. The emission spectra of the Eu 3 +-tta complex doped in the PC/PMMA recorded at 298 and 77 K exhibited the characteristic bands arising from the 5 D 0 →7 F J transitions (J = 0-6). The luminescence intensity decreases with increasing of precursor concentration in the doped polymer obtained by chemical reaction. This result is different from that of samples obtained by physical method in melting doping. The blend was irradiated under ionizing radiation of 60 C o source. After irradiation of the luminescent films the physical properties of luminescence, thermal and oxidative stability were evaluated.(Fapesp and Cnpq financial support)
The condition for electroplex emission from an europium complex doped poly( N-vinylcarbazole)
Zhang, T.; Xu, Z.; Qian, L.; Tao, D. L.; Teng, F.; Gao, X.; Xu, X. R.
2005-10-01
Spectral characteristics of photoluminescence (PL) and electroluminescence (EL) of poly( N-vinylcarbazole) (PVK) matrices doped with a novel europium complex Eu(aspirin) 3phen were investigated. A red-shift and broadening were observed in the EL spectra but not in the PL ones. However, neither red-shift nor broadening were observed in the EL spectra of PVK doped with a similar complex with the same ligand, terbium complex (Tb(aspirin) 3phen). This result suggests the formation of electroplexes in blend systems, which is likely due to inefficient energy transfer from host molecules to dopant molecules.
UL146 variability among clinical isolates of Human Cytomegalovirus from Japan
Directory of Open Access Journals (Sweden)
Francisco Aguayo
2010-01-01
Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.
CD146/MCAM defines functionality of human bone marrow stromal stem cell populations
DEFF Research Database (Denmark)
Harkness, Linda; Zaher, Walid; Ditzel, Nicholas
2016-01-01
BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...
Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.
Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying
2018-06-01
A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.
Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.
1990-01-01
Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.
The different-ligand complexing of europium with complexones and β-diketones in micellar solution
International Nuclear Information System (INIS)
Svetlova, I.E.; Dobrynina, N.A.; Smirnova, N.S.; Martynenko, L.I.; Evseev, A.M.; Savitskij, A.P.
1989-01-01
Method of pH-metric titration with mathematical simulation was used to study the effect of nonionic surfactant (polyoxyethyleneoctylphenyl este) on stability of europium complexes with cyclohexanediaminetetraacetic and ethylenediaminetetraacetic acids. Optimal conditions for ternary complex formation in the system Eu 3+ -complexone-β-diketone at pH 7.0-9.0 were found. Complex-compositions were determined and their stability constants were calculated. It is shown that complex stability decreases by several orders in micellar solutions, tecause β-diketone introduction to the solution decreases thermodynamic stability of complexes
First principles description of the insulator-metal transition in europium monoxide
Wang, Hao
2012-02-01
Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.
19 CFR 146.23 - Accountability for merchandise in a zone.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...
22 CFR 146.440 - Health and insurance benefits and services.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
21 CFR 146.148 - Reduced acid frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...
2010-04-01
... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Energy Technology Data Exchange (ETDEWEB)
Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)
1998-07-01
It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)
Energy Technology Data Exchange (ETDEWEB)
Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)
2017-05-15
The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)
International Nuclear Information System (INIS)
Fontenot, Ross S.; Bhat, Kamala N.; Owens, Constance A.; Hollerman, William A.; Aggarwal, Mohan D.
2015-01-01
Since 2003, the authors have been pushing the boundaries on a special type of functional material, i.e., a material that gives off light when it is stressed, strained, and/or fractured. This unique class of materials has been proposed for the active element of impact sensors, earthquake detectors, and stress sensors. However, in order for this concept to go from the lab to real world applications, the light emission from these functional materials must be bright such that inexpensive light detectors can be used. One of the brightest materials found thus far is europium tetrakis dibenzoylmethide triethylammonium (EuD 4 TEA). This material has an emission so bright that it can be observed in daylight. In 2013, the authors discovered that the addition of dimethyl methylphosphonate (DMMP) increased the light emission two fold. As a result, a search for similar compounds was conducted to determine if the emission can be increased further. This paper explores the effects of dibutyl phosphate (DBP) on EuD 4 TEA. The effects of DBP on the triboluminescence, photoluminescence, and crystal structure of EuD 4 TEA will be determined. This paper will show that DBP has an even greater effect on the properties of EuD 4 TEA than DMMP. - Highlights: • Synthesized europium tetrakis dibenzoylmethide triethylammonium. • Six fold increase in the light yield was detected. • Effects of dibutyl phosphate on the triboluminescence on EuD 4 TEA were determined. • Effects of dibutyl phosphate on the photoluminescence of EuD 4 TEA were determined
Energy Technology Data Exchange (ETDEWEB)
Fontenot, Ross S., E-mail: rsfontenot@hotmail.com [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, AL 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, Kamala N.; Owens, Constance A. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, AL 35762 (United States); Hollerman, William A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Aggarwal, Mohan D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, AL 35762 (United States)
2015-02-15
Since 2003, the authors have been pushing the boundaries on a special type of functional material, i.e., a material that gives off light when it is stressed, strained, and/or fractured. This unique class of materials has been proposed for the active element of impact sensors, earthquake detectors, and stress sensors. However, in order for this concept to go from the lab to real world applications, the light emission from these functional materials must be bright such that inexpensive light detectors can be used. One of the brightest materials found thus far is europium tetrakis dibenzoylmethide triethylammonium (EuD{sub 4}TEA). This material has an emission so bright that it can be observed in daylight. In 2013, the authors discovered that the addition of dimethyl methylphosphonate (DMMP) increased the light emission two fold. As a result, a search for similar compounds was conducted to determine if the emission can be increased further. This paper explores the effects of dibutyl phosphate (DBP) on EuD{sub 4}TEA. The effects of DBP on the triboluminescence, photoluminescence, and crystal structure of EuD{sub 4}TEA will be determined. This paper will show that DBP has an even greater effect on the properties of EuD{sub 4}TEA than DMMP. - Highlights: • Synthesized europium tetrakis dibenzoylmethide triethylammonium. • Six fold increase in the light yield was detected. • Effects of dibutyl phosphate on the triboluminescence on EuD{sub 4}TEA were determined. • Effects of dibutyl phosphate on the photoluminescence of EuD{sub 4}TEA were determined.
19 CFR 146.21 - General requirements.
2010-04-01
... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...
Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.
2018-03-01
The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.
International Nuclear Information System (INIS)
Goryushko, A.G.; Davidenko, N.K.; Kudryavtseva, L.S.; Lozinskij, M.O.; Lugina, L.N.; Fialkov, Yu.A.
1980-01-01
Altogether five coordination compounds of europium (3) of the composition EuL 3 , wherein HL is a fluorinated beta-diketone containing in its fluorinated linear or cyclic radical a heteroatom, such as oxygen, have been obtained. The hygroscopicity of the obtained tris-beta-ketones has been tested. Their activity as lanthanide shifting agents for NMR spectroscopy purposes has been analyzed and the stability constants of their monoadducts with ethyl acetate have been determined [ru
International Nuclear Information System (INIS)
Karasev, V.E.; Mirochnik, A.G.; Shchelokov, R.N.
1983-01-01
Spectral-luminescent characteristics of europium tristhenoyltrifluoroacetonate with 1.10-phenanthpoline in polystyrepe and polyvinyl chloride are investigated. E 4 (TTA) 3 phen during introduction into polymers preserves its composition and structure. Weak temperature dependence of half-Width of luminescent lines qualitatively different from the case of crystal chelate is characteristic for polymers doped with E 4 (TTA) 3 xphen. Investigation into temperature dependence of E 4 3+ luminescent intensity in chelate doped polymers proves the conclusion on weakening processes of excitation energy relaxation by vibration constituents of close and far environment during chelate introduction into polymers
International Nuclear Information System (INIS)
Ma Zhiya; Dosev, Dosi; Kennedy, Ian M
2009-01-01
A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core-silica shell (Ag-SiO 2 ) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag-SiO 2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability.
38 CFR 21.146 - Independent instructor course.
2010-07-01
.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...
22 CFR 146.120 - Transfers of property.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...
21 CFR 146.185 - Pineapple juice.
2010-04-01
... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...
22 CFR 146.115 - Assurance required.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
Optical isotype shifts of 146Sm and 151Sm
International Nuclear Information System (INIS)
Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.
1984-01-01
We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)
10 CFR 1.46 - Office of Nuclear Security and Incident Response.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...
Directory of Open Access Journals (Sweden)
Sylvie Bouvier
Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in
Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi
2016-03-30
Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.
Tuning Eu"3"+ emission in europium sesquioxide films by changing the crystalline phase
International Nuclear Information System (INIS)
Mariscal, A.; Quesada, A.; Camps, I.; Palomares, F.J.; Fernández, J.F.; Serna, R.
2016-01-01
Highlights: • PLD production of high quality europium sesquioxide (Eu_2O_3) films. • The deposition of Al_2O_3 capping and/or buffer layers modifies the crystallization for Eu_2O_3 films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu"3"+ emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu_2O_3) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu_2O_3 ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al_2O_3). The optical properties, refractive index and extinction coefficient of the as deposited Eu_2O_3 layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu"3"+ ions. The emission spectral shape depends on the crystalline phase of the Eu_2O_3 layer. Specifically, changes in the hypersensitive "5D_0 → "7F_2 emission confirm the strong influence of the crystal field effect on the Eu"3"+ energy levels.
International Nuclear Information System (INIS)
Zeitz, W.-D.; Unterricker, S.; Schneider, F.; Samokhvalov, V.; Potzger, K.; Weber, A.; Dietrich, M.
2004-01-01
The magnetic response of europium in γ-cerium and in platinum was studied by applying the perturbed angular correlation spectroscopy. The probe nuclei were 147 Eu(11/2 - ) and 149 Eu(11/2 - ). The response in γ-Ce was determined by the electronic S = J = 7/2 ground state of divalent Eu. In Pt, on the other hand, Eu is trivalent (J = 0 ground state). Here the magnetic contributions originate from Van Vleck terms of the whole multiplet system.
40 CFR 146.67 - Operating requirements.
2010-07-01
... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...
MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.
Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng
2016-01-01
MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.
New levels and reinvestigation of octupole correlations in {sup 146,147}La
Energy Technology Data Exchange (ETDEWEB)
Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)
2017-12-15
High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)
2010-04-01
... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...
International Nuclear Information System (INIS)
Bizzeti, P.G.; Bizzetti-Sona, A.M.
1998-01-01
The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd
Directory of Open Access Journals (Sweden)
Rema Matakova
2012-03-01
Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.
International Nuclear Information System (INIS)
Moreira dos Santos, Antonio; Coelho, Ana C.; Almeida Paz, Filipe A.; Rocha, Joao; Goncalves, Isabel S.; Carlos, Luis D.
2008-01-01
A new europium(III) complex, Eu(BTA) 3 (ethyl[3-(2-pyridyl)-1-pyrazolyl]acetate) (where BTA: 1-benzoyl-3,3,3-trifluoroacetonate), was synthesised by simple ligand exchange with the solvent adduct Eu(BTA) 3 (H 2 O) 2 . The compound was characterised by elemental analysis, thermogravimetry, FTIR, FT Raman and photoluminescence spectroscopies. A significant increase of the 5 D 0 lifetime of the complex, relative to the value found for the water-coordinated adduct (from 0.657 ± 0.001 to 0.835 ± 0.002 ms), and a larger contribution of the ligand levels to the excitation spectrum indicate a better photoluminescence performance for the former complex
21 CFR 133.146 - Grated cheeses.
2010-04-01
... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...
MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis
Directory of Open Access Journals (Sweden)
Joshua L. Heuslein
2018-01-01
Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.
Energy Technology Data Exchange (ETDEWEB)
Basu, Bharathi Bai J. [Surface Engineering Division, National Aerospace Laboratories, Bangalore 560017 (India)], E-mail: bharathi@css.nal.res.in; Vasantharajan, N. [Surface Engineering Division, National Aerospace Laboratories, Bangalore 560017 (India)
2008-10-15
The temperature dependence of the luminescence lifetime of temperature sensor films based on europium (III) thenoyltrifluoroacetonate (EuTTA) as sensor dye in various polymer matrices such as polystyrene (PS), polymethylmethacrylate (PMMA), polyurethane (PU) and model airplane dope was studied and compared. The luminescence lifetime of EuTTA was found to depend on the polymer matrix. The temperature sensitivity of lifetime was maximum for EuTTA-PS coating in the temperature range of 10-60 deg. C. The effect of concentration of the sensor dye in the polymer on the lifetime and temperature sensitivity was also studied.
Magnesium ionophore II as an extraction agent for trivalent europium and americium
Energy Technology Data Exchange (ETDEWEB)
Makrlik, Emanuel [Czech Univ. of Life Sciences, Prague (Czech Republic). Faculty of Environmental Sciences; Vanura, Petr [Univ. of Chemistry and Technology, Prague (Czech Republic). Dept. of Analytical Chemistry
2016-11-01
Solvent extraction of microamounts of trivalent europium and americium into nitrobenzene by using a mixture of hydrogen dicarbollylcobaltate (H{sup +}B{sup -}) and magnesium ionophore II (L) was studied. The equilibrium data were explained assuming that the species HL{sup +}, HL{sup +}{sub 2}, ML{sup 3+}{sub 2}, and ML{sup 3+}{sub 3} (M{sup 3+} = Eu{sup 3+}, Am{sup 3+}; L=magnesium, ionophore II) are extracted into the nitrobenzene phase. Extraction and stability constants of the cationic complex species in nitrobenzene saturated with water were determined and discussed. From the experimental results it is evident that this effective magnesium ionophore II receptor for the Eu{sup 3+} and Am{sup 3+} cations could be considered as a potential extraction agent for nuclear waste treatment.
Energy Technology Data Exchange (ETDEWEB)
Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: nanda_louise@yahoo.com.br [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica
2013-07-01
This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.
Europium and samarium doped calcium sulfide thin films grown by PLD
International Nuclear Information System (INIS)
Christoulakis, S.; Suchea, M; Katsarakis, N.; Koudoumas, E
2007-01-01
Europium and samarium doped calcium sulfide thin films (CaS:Eu,Sm) with different thickness were prepared by the pulsed laser deposition technique using sintered targets. A typical homemade deposition chamber and XeCl excimer laser (308 nm) were employed and the films were deposited in helium atmosphere onto silicon and corning glass substrates. Structural investigations carried out by X-ray diffraction and atomic force microscopy showed a strong influence of the deposition parameters on the film properties. The films grown had an amorphous or polycrystalline structure depending on growth temperature and the number of pulses used, the same parameters affecting the film roughness, the grain shape and dimensions, the film thickness and the optical transmittance. This work indicates that pulsed laser deposition can be a suitable technique for the preparation of CaS:Eu,Sm thin films, the film characteristics being controlled by the growth conditions
22 CFR 146.100 - Purpose and effective date.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...
International Nuclear Information System (INIS)
Kaczmarek, Malgorzata; Lis, Stefan
2009-01-01
A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10 -7 to 2 x 10 -5 mol L -1 of Chlor-TC; 2 x 10 -7 to 2 x 10 -5 mol L -1 of Oxy-TC and 1 x 10 -7 to 3 x 10 -5 mol L -1 of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.
Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio
Energy Technology Data Exchange (ETDEWEB)
Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)
2004-07-01
Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)
45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.
2010-10-01
... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...
Energy Technology Data Exchange (ETDEWEB)
Aziz, Siti Maisarah; Sahar, M.R., E-mail: mrahim057@gmail.com; Ghoshal, S.K.
2017-02-01
This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)
2011-02-07
.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...
International Nuclear Information System (INIS)
Cai, Q.J.; Ling, Q.D.; Li, S.; Zhu, F.R.; Huang, Wei; Kang, E.T.; Neoh, K.G.
2004-01-01
The chemical states and electronic properties of the interface between thermally evaporated aluminium and a photoluminescent conjugated copolymer containing 9,9'-dihexylfluorene and europium complex-chelated benzoate units in the main chain (PF6-Eu(dbm) 2 phen) were studied in situ by X-ray photoelectron spectroscopy (XPS) and ultraviolet photoelectron spectroscopy (UPS). The changes in C 1s, Eu 3d, N 1s, and Al 2p core-level lineshapes with progressive deposition of aluminium atoms were carefully monitored. Aluminium was found to interact with the conjugated backbone of the copolymer to form the Al carbide, Al-O-C complex, and Al(III)-N chelate at the interface. In addition, the europium ions were reduced to the metallic state by the deposited aluminium atoms, which were oxidized and chelated by the 1,10-phenanthroline ligands (phen). The changes in chemical states at the interface suggest that the intramolecular energy transfer process in this copolymer had been affected. Moreover, aluminium also interacted with the bulk-adsorbed oxygen, which migrates to the surface in response to the deposition of aluminium atoms, to form a layer of metal oxides. On the other hand, the evolution of the UPS spectra suggests that the π-states of the conjugated system were affected and an unfavorable dipole layer was induced by the deposited aluminium atoms
International Nuclear Information System (INIS)
Khomenko, V.S.; Pavich, T.A.; Lozonskij, M.O.; Fialkov, Yu.A.; AN Ukrainskoj SSR, Kiev. Inst. Organicheskoj Khimii)
1987-01-01
Methods of mass-spectrometry, luminescent specroscopy and thermogravimetry are used to study decomposition ways, structure and volatility of mixed europium and neodymium complexes with fluorated organic ligands and bisheterocycles. It is shown that complexes containing an oxygen atom in a fluorated ligand elimination of difluorophosgene and tetrafluoroethylene molecules takes place. The addition of a bisheterocyclic ligand to a triligand complex makes the averaged bond in the complex more covalent and increase its volatility
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.
Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt
2018-01-01
The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was
The effect of stem cell factor on proliferation of human endometrial CD146+ cells
Directory of Open Access Journals (Sweden)
Mehri Fayazi
2016-07-01
Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies
Uba, Samuel
High performance detectors used in the detection of ionizing radiation is critical to nuclear nonproliferation applications and other radiation detectors applications. In this research we grew and tested Europium doped Lithium Strontium Iodide compound. A mixture of lithium iodide, strontium iodide and europium iodide was used as the starting materials for this research. Congruent melting and freezing temperature of the synthesized compound was determined by differential scanning calorimetry (DSC) using a Setaram Labsys Evo DSC-DTA instrument. The melting temperatures were recorded at 390.35°C, 407.59°C and freezing temperature was recorded at 322.84°C from a graph of heat flow plotted against temperature. The synthesized material was used as the charge for the vertical Bridgeman growth, and a 6.5 cm and 7.7cm length boule were grown in a multi-zone transparent Mullen furnace. A scintillating detector of thickness 2.53mm was fabricated by mechanical lapping in mineral oil, and scintillating response and timing were obtained to a cesium source using CS-137 isotope. An energy resolution (FWHM over peak position) of 12.1% was observed for the 662keV full absorption peak. Optical absorption in the UV-Vis wavelength range was recorded for the grown crystal using a U-2900 UV/VIS Spectrophotometer. Absorption peaks were recorded at 194nm, 273nm, and 344nm from the absorbance spectrum, various optical parameters such as absorption coefficient, extinction coefficient, refractive index, and optical loss were derived. The optical band gap energy was calculated using Tauc relation expression at 1.79eV.
Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli
2015-12-21
Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.
Davydov, S Y
2002-01-01
The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level
Institute of Scientific and Technical Information of China (English)
余旭东; 李景印; 李亚娟; 耿丽君; 甄小丽; 于涛
2015-01-01
A novel covalently bonded Eu3+-based silica hybrid material was designed and its spectrophotometric anion sensing prop-erty was studied. The fluorescent receptor (europium complex) was covalently grafted to the silica matrix via a sol-gel approach. FTIR, UV-vis spectra, scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD) and photoluminescent spectra were characterized, and the results revealed that the hybrid material with nanosphere structure displayed excellent photophysical property. In addition, the selective anion sensing property of the hybrid material was studied by UV-vis and fluorescence spectra. The results showed that the hybrid material exhibited a smart response with fluoride anions.
Promotion of Hendra Virus Replication by MicroRNA 146a
Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa
2013-01-01
Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523
45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...
RBS and RNRA studies on sorption of europium by apatite
Energy Technology Data Exchange (ETDEWEB)
Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi
1997-03-01
The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)
Directory of Open Access Journals (Sweden)
Carmen Steluta Ciobanu
2012-01-01
Full Text Available The luminescent europium-doped hydroxyapatite (Eu:HAp, Ca10−xEux(PO46(OH2 with 0≤x≤0.2 nanocrystalline powders was synthesized by coprecipitation. The structural, morphological, and textural properties were well characterized by X-ray diffraction, scanning electron microscopy, and transmission electron microscopy. The vibrational studies were performed by Fourier transform infrared, Raman, and photoluminescence spectroscopies. The X-ray diffraction analysis revealed that hydroxyapatite is the unique crystalline constituent of all the samples, indicating that Eu has been successfully inserted into the HAp lattice. Eu doping inhibits HAp crystallization, leading to a decrease of the average crystallite size from around 20 nm in the undoped sample to around 7 nm in the sample with the highest Eu concentration. Furthermore, the samples show the characteristic 5D0→7F0 transition observed at 578 nm related to Eu3+ ions distributed on Ca2+ sites of the apatitic structure.
International Nuclear Information System (INIS)
Ciobanu, C.S.; Iconaru, S.L.; Predoi, D.; Massuyeau, F.; Constantin, L.V.; Costescu, A.
2012-01-01
The luminescent europium-doped hydroxyapatite (Eu:HAp, Ca 10-x Eu x (PO 4 ) 6 (OH) 2 ) with 0>x>0.2 nanocrystalline powders was synthesized by coprecipitation. The structural, morphological, and textural properties were well characterized by X-ray diffraction, scanning electron microscopy, and transmission electron microscopy. The vibrational studies were performed by Fourier transform infrared, Raman, and photoluminescence spectroscopies. The X-ray diffraction analysis revealed that hydroxyapatite is the unique crystalline constituent of all the samples, indicating that Eu has been successfully inserted into the HAp lattice. Eu doping inhibits HAp crystallization, leading to a decrease of the average crystallite size from around 20 nm in the undoped sample to around 7 nm in the sample with the highest Eu concentration. Furthermore, the samples show the characteristic 5 D 0 → 7 F 0 transition observed at 578 nm related to Eu 3+ ions distributed on Ca 2+ sites of the apatitic structure
BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles
Directory of Open Access Journals (Sweden)
Cong Li
2018-01-01
Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66
Fluorescence properties of europium and samarium. beta. -diketonates and their use in fluorometry
Energy Technology Data Exchange (ETDEWEB)
Huang, H; Hiraki, K; Nishikawa, Y [Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology
1981-01-01
Several europium and samarium ..beta..-diketonates (tta, ntfa, bfa) complexed with 1, 10-phenanthroline, or with trioctylphosphine oxide (topo) were synthesized. The fluorescence properties of these compounds in benzene or hexane have been studied. Absorption and fluorescence spectra, fluorescence quantum yield, fluorescence sensitivity index (F.S.I.), and fluorescence lifetime were measured. From the measurement of fluorescence lifetime of the ..beta..-diketonates, the velocity of radiative process (k sub(f)/phi sub(f)) has almost the same value for benzene and hexane solvent. The red fluorescence (Em. max. : 619 nm) of Eu(III) in these chelates is attributed to transitions from /sup 5/D/sub 0/ ..-->.. /sup 7/F/sub 2/ levels of this ion, and the three-band spectrum (Em. max. : 569 nm, 606 nm, 650 nm) indicates the transitions from the /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(5/2), /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(7/2), and /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(9/2) levels of Sm(III), respectively. These spectra are not changed by any solvents and ligands. From the results, the fluorescence of the ..beta..-diketonates in organic solvent has been attributed to m* ..-->.. m luminescence transition. The complexes of Eu(III) and Sm(III) show radiative transition within orbitals, composed exclusively of 4f orbitals of rare earth ions (m* ..-->.. m radiative transition). Fluorinated ligands show better sensitivity than unfluorinated ligands, and the best sensitivity is obtained with TTA-phen system, and/or TTA-topo system for the spectrofluorometric determination of the two metals. In the case of Eu determination, 619 nm emission wavelength is used (the determinable range : 0.2 -- 10 ppb Eu), and in the case of Sm determination, 650 nm emission wavelength is adopted (the determinable range : 0.1 -- 1 ppm Sm), because of much higher sensitivity than the other two peaks (569, 606 nm) without interference from europium complex.
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck
2000-01-01
cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...
Energy Technology Data Exchange (ETDEWEB)
Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)
2009-04-20
A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice
Directory of Open Access Journals (Sweden)
Nellie A. Martin
2018-03-01
Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and
Energy Technology Data Exchange (ETDEWEB)
Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)
2000-07-01
The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck
2000-01-01
The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...
International Nuclear Information System (INIS)
Benes, P.; Stamberg, K.; Siroky, L.; Mizera, J.
2002-01-01
The sorption of trace europium, as a trivalent actinide homologue, was studied in the system Gorleben sand - aqueous solution with the aim to elucidate its mechanism. Radiotracer method ( 152/154 Eu) and batch experiments were used. Simultaneously, the distribution of humic substances present in, or added to the system was measured. The evaluation of the sorption was complicated by the adsorption of Eu on the walls of polyethylene vials used for the experiments, which was rather high and had to be taken into consideration. It has been found that Eu sorption on Gorleben sand increases from pH 2 to pH 5-7 and then it decreases. The decrease is due to the complexation of Eu with humic substances leached from Gorleben sand at pH>7. The position of the sorption maximum depends on the composition of the solution and on the liquid-to-solid ratio. It is shifted to lower pH values in the presence of added humic acid (HA), which enhances Eu sorption at low PH values and suppresses it at pH values higher than 5. The regions of the enhancing/suppressing effects coincidence with the high/low adsorption of HA on Gorleben sand, respectively. The increasing ionic strength (from 0.01 to 0.1) and europium concentration (3.4 x 10 -8 to 9.3 x 10 -7 mol/l) suppress the relative sorption (expressed in %) at low pH values and enhance it at pH>6-8. Addition of carbonates (5 x 10 -3 mol/l) supports Eu sorption at pH>7.5 so that no decrease with pH is observed till pH 9. Alkaline leaching of the sand significantly changes most of the effects found. These results were qualitatively interpreted and conclusions were drawn on the mechanism of the sorption. (author)
Energy Technology Data Exchange (ETDEWEB)
Alvarado B, A.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)
1999-07-01
This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC{sub H} values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)
miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.
Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili
2017-10-02
Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.
Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C
2018-02-01
The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.
Europium(II)heptaphosphide EuP/sub 7/
Energy Technology Data Exchange (ETDEWEB)
von Schnering, H G; Wittmann, M
1980-07-01
The novel polyphosphide, EuP/sub 7/, was prepared under controlled conditions by reaction of the elements in salt melts at 750-800 K. EuP/sub 7/ forms black prismatic crystals not attacked by dilute mineral acids and bases. The thermal decomposition yields EuP/sub 3/ at 700 K and in further steps EuP/sub 2/, Eu/sub 3/P/sub 4/ and EuP, respectively. According to the crystal structure as well as the electrical, optical and magnetic properties, EuP/sub 7/ is a semiconductor (Esub(G) = 0.9 eV; Esub(G) (vert) = 1.1 eV) with divalent europium (..mu.. = 7.55 B.M.). The compound crystallizes in the monoclinic space group P 2/sub 1//n with a = 1148.8(7) pm, b = 570.0(3) pm, c = 1061.0(6) pm, and ..beta.. = 106.08/sup 0/(5); (X-ray diffraction data; 1479 hkl; R = 0.031). The P-atoms are connected ((P-P) = 218.0-223.5 pm) to a 2-dimensional infinite polyanionic structure 2sub(infinity)(P/sub 7//sup 2 -/) with homonuclear 3-bonded and 2-bonded P-atoms in the ratio 5 : 2. The polyanionic network contains P/sub 6/-rings (chair conformation) as well as P/sub 8/-rings and P/sub 10/-rings. The Eu-atoms are bonded to 9 P-atoms (1,4,4-polyhedra) with bond distances ranging from 306.6 to 326.6 pm. The Eu-atoms complete the tetrahedral environment of the P-atoms.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
Energy Technology Data Exchange (ETDEWEB)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)
2011-06-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
International Nuclear Information System (INIS)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C
2011-01-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies
International Nuclear Information System (INIS)
Freire, Ricardo O.; Rocha, Gerd B.; Albuquerque, Rodrigo Q.; Simas, Alfredo M.
2005-01-01
The second version of the sparkle model for the calculation of lanthanide complexes (SMLC II) as well as ab-initio calculations (HF/STO-3G and HF/3-21G) have been used to calculate the geometries of a series of europium (III) complexes with different coordination numbers (CN=7, 8 and 9), ligating atoms (O and N) and ligands (mono, bi and polydentate). The so-called ligand field parameters, Bqk's, have been calculated from both SMLC II and ab-initio optimized structures and compared to the ones calculated from crystallographic data. The results show that the SMLC II model represents a significant improvement over the previous version (SMLC) and has given good results when compared to ab-initio methods, which demand a much higher computational effort. Indeed, ab-initio methods take around a hundred times more computing time than SMLC. As such, our results indicate that our sparkle model can be a very useful and a fast tool when applied to the prediction of both ground state geometries and ligand field parameters of europium (III) complexes
Energy Technology Data Exchange (ETDEWEB)
Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)
2003-07-01
In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)
International Nuclear Information System (INIS)
Kalinovskaya, I.V.; Karasev, V.E.
2000-01-01
Effect of solvents and parameters of mechanical treatment on basic regularities of synthesis of rare earth compounds with nitrogen-containing heterocyclic compounds is studied. It is shown that interaction on europium (3) and terbium (3) nitrates with nitrogen-containing heterocyclic compounds leads to formation of compounds of Ln(NO 3 )·2D composition, where Ln=Eu, Tb; D=2,2-dipyridyl, 1,10-phenanthroline, diphenylguanidine. Effect of conditions of mechanical treatment and different additions on process and yield of products is studied. Compounds prepared are characterized by the methods of chemical element analysis, IR spectroscopy and luminescent spectroscopy [ru
Europium-Doped Lanthanum Hafnate Nanoparticles: Structure, Photoluminescence, and Radioluminescence
Wahid, Kareem; Pokhrel, Madhab; Mao, Yuanbing
Due to their novel physical properties, nanostructured phosphors are of interest for radiation-based imaging and therapeutics. Herein, the structural and luminescent properties of europium-doped lanthanum hafnate (La2Hf2O7:xmol%Eu3+, x = 0 - 35) nanoparticles are investigated for use as scintillators. X-ray diffraction, Raman spectroscopy, and scanning electron microscopy confirm samples prepared through a combined co-precipitation and low-temperature molten salt synthetic process homogenously form spherical nanocrystals of 36 nm in the ordered pyrochlore phase. Ultraviolet and X-ray excitation of these samples induce strong red emissions in the 580 - 590 and 612 - 630 nm range corresponding to the 5D0->7 F1 magnetic dipole and 5D0->7 F2 electric dipole transitions of Eu3+. Optical response and quantum yield are optimized at 5% Eu3+; a proposed trade-off between quenching mechanisms (defect-states/cross-relaxation) and dopant concentration is discussed. Owing to their high density, large effective atomic number, and bright luminescence, these La2Hf2O7:xmol%Eu3+ nanoparticles warrant further investigation for scintillator applications. The authors thank the support from the Defense Threat Reduction Agency of the U.S. Department of Defense (award #HDTRA1- 10-1-0114).
Removal of cobalt and europium radioisotopes using activated carbon prepared from apricot stones
International Nuclear Information System (INIS)
Daifullah, A.A.M.; Moloukhia, H.
2002-01-01
the phenomena of cobalt and europium sorption by activated carbon from aqueous solution was studied. Activated carbon prepared from locally available agricultural wastes; apricot stones; was used. The prepared carbon was characterized using different techniques. The chemical nature of the surface of the activated carbon was also studied. Experimental studies were conducted to evaluate and optimize the various process variables i.e. equilibrium time, carbon dose, solution ph and the presence of competitive. Optimal conditions for the sorption of the radioisotopes have been identified. The sorption isotherm of Freundlich was the best fitting for the concentration range studied. Interference of oxalic acid, EDTA and phenol molecules were discussed. Percentages desorption of both acid, EDTA and phenol using bi-distilled water and IMHCI was determined. The data suggest the possible use of activated carbon of apricot stone (ACAS) for the concentration of these cations
Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.
Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin
2018-01-01
Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.
22 CFR 146.445 - Marital or parental status.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...
Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.
Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M
2015-01-01
Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.
Energy Technology Data Exchange (ETDEWEB)
Huang, H; Hiraki, K; Nishikawa, Y [Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology
1981-07-01
This communication reported the optimum conditions for the fluorometric determination of these ions, and the method was adopted in the simultaneous determination of samarium and europium in xenotime and monazite minerals. From the experimental results on the effect of diverse ions and the extraction pH of the aqueous phase, it became clear that TTA-TOPO hexane method was the best system for the determination of samarium and europium because of the highest fluorescence sensitivity of the ternary complex, and also because the lower extraction pH eliminated the effect of diverse ions. Moreover, the very high detection limit (2 ppb) of Sm was achieved by the use of a red sensitive photomultiplier. Which was used at 644 nm, and that of Eu (0.02 ppb) at 614 nm. The procedure was established as follows: The rare earth minerals (xenotime, monazite) sample was treated with hot conc. H/sub 2/SO/sub 4/ and twice precipitated with 0.5 mol dm/sup -3/ oxalic acid (pH was adjusted to 2.0 -- 2.2). Then the precipitate was filtered and ignited to give the rare earth oxide. Fifty milligrams of the oxide was dissolved in HCl and diluted with water in order to obtain the solution containing 5 ..mu..g cm/sup -3/ rare earth oxide. An aliquot of the solution ((1.0 -- 3.0) cm/sup 3/) was adjusted to pH 5.5 with sodium acetate and shaken with 1 x 10/sup -4/ mol dm/sup -3/ TTA- 2 x 10/sup -2/ mol dm/sup -3/ TOPO hexane solution. Then the fluorescence intensity of the organic layer was measured at 644 nm for Sm and 614 nm for Eu. In this procedure, the recovery of Sm and Eu was found to be about 96%. Xenotime contained 0.70% of Sm and 0.004% of Eu, and monazite contained 1.84% of Sm and 0.003% of Eu.
Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase
Energy Technology Data Exchange (ETDEWEB)
Mariscal, A., E-mail: antonio.mariscal@csic.es [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)
2016-06-30
Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.
MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.
Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun
2016-03-01
Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
22 CFR 146.520 - Job classification and structure.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...
40 CFR 146.4 - Criteria for exempted aquifers.
2010-07-01
... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...
Study of relaxation processes and uniaxial anisotropy in the Europium Gallium Garnet epitaxial films
International Nuclear Information System (INIS)
Mukhopadhyay, P.
1987-04-01
We report here the magnetic properties of Europium-Gallium Garnet LPE films of the type Eu x Y 3-x Fe 5-y Ga y O 12 (where O< x<1.2 and 1< y<1.1). The mechanism by which the magnetic moments relax in Eu or Sm Garnets is still not fully understood. We have made studies on Eu-Ga garnet films and explain some of the results observed in these films. Pb and Pt ions are always found as impurities in our films. Pb ions contribute to the anisotropy in the film. Most of the experimental results can be explained with the three sub lattice model. The shape of the FMR line width shows strong sensitivity towards the surface impurities. (author). 18 refs, 6 figs, 1 tab
Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha
2011-01-01
Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267
Energy Technology Data Exchange (ETDEWEB)
Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others
2015-04-15
The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.
Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a
Directory of Open Access Journals (Sweden)
Min-Ching Wang
2018-04-01
Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL
Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu
2015-09-01
Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.
International Nuclear Information System (INIS)
Wang Feng; Fan Xianping; Wang Minquan; Zhang Xianghua
2005-01-01
The luminescence behavior of the dibenzoyl methane europium(III) complexes (Eu(DBM) 3 ) in sol-gel derived host materials have been investigated. The steady-state excitation and emission spectra and the time-resolved spectra of the 1% EuCl 3 and 3% DBM co-doped gel indicated an efficient ligand-to-metal energy transfer. The Eu(DBM) 3 complexes in the gel showed longer 5 D 0 lifetimes in comparison with Eu(DBM) 3 .3H 2 O complexes. The luminescence intensity of the 1% EuCl 3 and 3% DBM co-doped gel decreased continuously with increasing temperature and time of heat treatment, which indicated the gradual decomposition of the Eu(DBM) 3 complexes in the gel during heat treatment
International Nuclear Information System (INIS)
Sepulveda Munita, C.J.A.; Atalla, L.T.
1980-01-01
The determination of thorium via the measurement of 233 Th activity (obtained by irradiating natural thorium with neutrons) may suffer the interference of various radioisotopes which may be also formed during irradiation, if their parent isotopes are present in the sample. Taking into account this possibility, another technique was chosen for the determination of thorium, based on isotopic exchange associated with ionic exchange. Conditions for the isotopic exchange between 234 Th in solution and 232 Th in the resin were optimized. It was verified that the behaviour of 233 Th and 234 Th is the same regarding isotopic exchange with 232 Th. 234 Th was chosen for the experiments since it has a longer half-life (24.1 days) than 233 Th (22.3 min), thus facilitating the performance of the work. As the major objective of this work is to separate thorium and europium isotopes, the behaviour of 152-154 Eu was studied in the same system used for thorium, envisaging a minimum retention of these radioisotopes in the resin. In order to establish the best conditions for separating 234-Th and 152/154-Eu, the following parameters were considered: the thorium concentration in the solution; the hydrochloric acid concentration in solution; the concentration of other elements in solution; the degree of cross-linking of the resin; the flow rate of the solution through the column. The other elements added to the elutant solution were: uranium, molybdenum, lanthanum, europium, ytterbium, bromine, cobalt, barium, manganese, indium, cesium and selenium. Europium was added so to dilute the 152/154-Eu tracer and avoid the retention of the latter in the resin. The other elements were added because they give rise to radioisotopes which interfere in the activation analysis of thorium when 233-Th activity is used and, the separation of these elements from thorium will also be subsequently studied by the method used in the present work. (C.L.B.) [pt
Spectral characteristics of europium-doped lead iodide
International Nuclear Information System (INIS)
Novosad, I.S.; Novosad, S.S.
2013-01-01
Optical absorption and x-ray luminescence spectra and thermally stimulated luminescence curves of a PbI 2 :EuCl 3 crystal grown by the Stockbarger method were investigated in the temperature range 85-295 K. It was presumed based on results of EPR spectral studies that the europium ions in this material existed in the divalent state and replaced matrix cations. An intense broad non-elementary band at 780 nm in addition to a weak band with a maximum in the range 512-520 nm were observed in the PbI 2 :Eu 2+ x-ray luminescence spectrum at 85 K. The intensity of the long-wavelength emission increased slightly upon increasing the crystal temperature from 85 to 130 K and was quenched in several stages upon increasing the temperature further to 220 K. The maximum shifted to 740 nm. It was proposed based on an analysis of the obtained data and results of a study of the luminescence properties of PbI 2 and PbI 2 :Mn 2+ crystals that the non-elementary emission band of the PbI 2 :Eu 2+ crystal at 780 nm could be represented as a superposition of three individual Gaussian bands with maxima near 715, 740, and 800 nm that were due to centers characteristic of the matrix and additional centers that were formed by Eu ions through association with intrinsic and dopant oxygen-containing defects, respectively. Doping PbI 2 with Eu 2+ ions did not affect the spectrum of matrix trapping levels. The nature of emission and trapping centers and luminescence excitation mechanisms of PbI 2 :Eu 2+ were discussed. (authors)
NMR and luminescence spectroscopy study of formation of mixed β-diketonate europium complexes
International Nuclear Information System (INIS)
Kavun, V.Ya.; Kalinovskaya, I.V.; Karasev, V.E.; Chernyshov, B.N.; Steblevskaya, N.I.
1987-01-01
Methods of NMR ('H, 19 F) and luminescent spectroscopy were applied to study ligand substitution in Eu(β-dik) 3 phen-CDCl 3 -(β-dik)' systems, where β-dik-acetylacetone (AA) and hexafluoroacetyl-acetone (HFAA), phen-1.10-phenathroline at different mole ratio (m) of competing ligands (m=AA/HFAA). Formation of mixed Eu(AA) 2 (HFAA)phen and Eu(AA)(HFAA) 2 phen complexes is proved; calculation of the stark structure of 5 D 0 - 7 F j (j=0,1,2) transitions in low-temperature luminescence spectra is conducted for these complexes. It is stated that at minimum HFAA concentration in the solution the latter replaces AA from europium coordination sphere. It is shown that depending on the value in substitution of acidoligands proceeds successfully by the equations Eu(AA) 3 phen+(NHFAA) n → Eu(AA) 3-n → (HFAA) n phen+(NAA) n ; (n=1,2,3)
miR-146a Suppresses Invasion of Pancreatic Cancer Cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2010-01-01
The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483
146----10 Dec indd [ FINAL VERSION].indd
African Journals Online (AJOL)
23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.
Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei
2017-06-01
Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.
Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan
2004-07-13
Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.
MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
2015-09-01
determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6
Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice
DEFF Research Database (Denmark)
Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.
2018-01-01
Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...
International Nuclear Information System (INIS)
Chitnis, Dipti; Thejokalyani, N.; Dhoble, S.J.
2017-01-01
In order to explore the spectroscopic properties of a novel europium activated hybrid organic tris(thenoyltrifluoroacetonate)(2,2′-bipyridine)europium(III), Eu(TTA) 3 bipy phosphor in various solvents at different pH and molar concentrations, UV–vis optical absorption and photoluminescence spectra were carried out. With a variation in the solvent from basic (chloroform, toluene, tetrahydrofuran) to acidic (acetic acid, formic acid) media, staggering differences in optical absorptions and optical densities were noticed with hypsochromic shift in the absorption peaks. The optical density was found to be maximum for the complex with pH= 7.0 and the intensity as well as optical density gradually decreased when pH is lowered to 6.0 or raised to 8.0 (at an interval of 0.5), proving that the complex is pH sensitive. It's optical energy gap and stokes shift values in various organic solvents were also calculated on the basis of Lippert-Mataga plot. The exploration of spectroscopic properties of solvated Eu(TTA) 3 bipy complex demonstrates its prospective for solution processed OLEDs and display devices. - Graphical abstract: Pictorial depiction of photoluminescence in solvated Eu(TTA) 3 bipy complex under UV light.
Shen, Jiangli; Yu, Zhaohui; Li, Na
2018-06-20
The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.
He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing
2018-03-21
Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.
Chemical species of europium (III) in ionic force media 0.02M, 0.1M, and 0.7M NaClO4 at 298 K
International Nuclear Information System (INIS)
Fernandez R, E.; Jimenez R, M.; Solache R, M.
2000-01-01
In order to know the effects of the controlled or accidental liberation of the europium in the environment, it is necessary to know its chemical behavior in found conditions in oceans, ground and surface water. The behavior of this element in these environments can be controlled mainly by the hydrolysis and its interaction with inorganic and organic ions. (Author)
International Nuclear Information System (INIS)
Fleury, Ch.
1998-01-01
After having been reprocessed, radioactive wastes are stored in conditions which depend on the toxicity of the radioelements. In particular, for the actinides, the packaging has to be sure for several thousands years. In the case of a defective storage, phenomena which favour or diminish the migration of radioelements in the environment have to be identified. In water, organic or inorganic colloids able to bind radioelements can migrate. Among these colloids, are found the humic acids (HA), macromolecules (poly-electrolytes and poly-dispersed) known for their affinity towards some radioelements. These HA are either present on a soluble state or bound to mineral supports. Humic acids have then been studied in these two states and their influence on the europium migration in dynamical system have been observed (ion exchange and affinity chromatography). When HA are bound by covalent bonds to silica gel, they strongly retain the radioelement, whatever be the conditions of pH, flow rate or ionic strength, and either if phosphate ions are present. The study of HA in solution has shown that, on the one hand the formation of a Eu-HA complex alters the adsorption of the radioelement on sand and that the influence of the humic acids on the europium retention is superior to those of the inorganic colloids (silicon oxide, bentonite). On the other hand, the study has revealed that a solution containing HA desorbs almost entirely the europium beforehand bound to the sand. This desorption depends on the pH and on the flow rate but not on the presence of competitive ions as for instance phosphate ions. (O.M.)
Energy Technology Data Exchange (ETDEWEB)
Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)
2015-07-10
Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.
Study of nano - second isomers near 146Gd
International Nuclear Information System (INIS)
Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.
2010-01-01
The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied
Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET
DEFF Research Database (Denmark)
James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen
2014-01-01
. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...
Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer
Directory of Open Access Journals (Sweden)
Wang P
2015-01-01
Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle
31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?
2010-07-01
... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...
Effect of the ion force on the hydrolysis constants and of the solubility product of Europium
International Nuclear Information System (INIS)
Jimenez R, M.; Ramirez G, J.J.; Solache R, M.; Rojas H, A.
2003-01-01
A study on the behavior of the first hydrolysis constant β Eu,H l-0 and the constant of the solubility product Kps of the europium in front of the changes of the ion force: 0. 02 M, 0.1 M, 0.7M, 2M, 3M and 4M of sodium perchlorate, at 303 K. Experimentally the potentiometry and also radioactivity measures its were used. The specific interaction of ions theory (SIT) of Bronsted-Guggenheim-Scatchard allows the extrapolation of the values to infinite dilution and the results were: log β Eu,H l-0 = -7 36 and log K sp l-0 = -24. 68. A discussion of the group of results with the data of the literature is presented. (Author)
Nikolaev, Anton; Kolesnikov, Ilya; Frank-Kamenetskaya, Olga; Kuz'mina, Maria
2017-12-01
Series of Eu-apatites were synthesized by precipitation from aqueous solutions with the Eu/Ca atomic ratio from 0.5% to 5% at T = 90 °C. Resulting precipitates were studied using different experimental techniques including X-ray powder diffraction, infrared and raman spectroscopy, scanning elecrton microscopy, EDX and photoluminescent spectroscopy. Eu-doped Ca-deficit nanosized non-stoichiometric hydroxyapatite with high water content has been obtained throughout the experiment. Europium content in the synthesized apatites reaches 0.24 apfu (Eu/Ca = 2.5%). Relations between Eu content is the solution and precipitate have been established. It was shown that Eu-monacite starts to precipitate as secondary phase at Eu/Ca ratio in starting solution 1% or higher. Maximum luminescence is observed in apatite with ∼2% Eu/Ca ratio (which equals to ∼0.2 apfu and corresponds to 3% Eu/Ca ratio in the starting solution). As an important and brand-new result, apatite with 2% Eu/Ca ratio can be considered as the most appropriate material for the producing biolabels for luminescent research in medicine and biology.
Directory of Open Access Journals (Sweden)
Robert B Lochhead
2014-06-01
Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B
International Nuclear Information System (INIS)
Goryushko, A.G.; Gololobov, Yu.G.; Boldeskul, A.E.; Oganesyan, A.S.; Yartsev, V.G.
1990-01-01
By the methods of electron, IR and PMR spectroscopy interaction of vinyl esters of phosphoric acid with praseodymium (3) and europium (3) nitrates in acetonitrile solutions has been studied. It is shown that the character of metal-ligand interaction is determined by chemical nature of the ligands: for a compound of ionic structure partially covalent bond is formed, and for a compound of betaine structure the interaction has mainly dipole character. Addition of molecule with betaine structure to praseodymium nitrate causes a change in geometry of Pr 3+ close surrounding and increase in its coordination number. The possibility of formation of the complex with metal-ligand ratio equal to 1:3 is shown
International Nuclear Information System (INIS)
Leinweber, G.; Barry, D.P.; Burke, J.A.; Rapp, M.J.; Block, R.C.; Danon, Y.; Geuther, J.A.; Saglime III, F.J.
2014-01-01
Highlights: • Metal samples were sealed and imaged with X-rays to determine sample uniformity. • Eleven new resonances were identified below 100 eV. • The resonance regions of 151 Eu and 153 Eu have been extended from 100 to 200 eV. • The thermal total cross section for 151 Eu was measured, up (9 ± 3)% from ENDF/B-VII.1. • Radiation widths were assigned for all resonances from experimental data. - Abstract: Europium is a good absorber of neutrons suitable for use as a nuclear reactor control material. It is also a fission product in the low-yield tail at the high end of the fission fragment mass distribution. Measurements have been made of the stable isotopes with natural and enriched samples. The linear electron accelerator center (LINAC) at the Rensselaer Polytechnic Institute (RPI) was used to explore neutron interactions with europium in the energy region from 0.01 to 200 eV. Neutron capture and transmission measurements were performed by the time-of-flight technique. Two transmission measurements were performed at flight paths of 15 and 25 m with 6 Li glass scintillation detectors. The neutron capture measurements were performed at a flight path of 25 m with a 16-segment sodium iodide multiplicity detector. Resonance parameters were extracted from the data using the multilevel R-matrix Bayesian code SAMMY. A table of resonance parameters and their uncertainties is presented. To prevent air oxidation metal samples were sealed in airtight aluminum cans in an inert environment. Metal samples of natural europium, 47.8 atom% 151 Eu, 52.2 atom% 153 Eu, as well as metal samples enriched to 98.77 atom% 153 Eu were measured. The measured neutron capture resonance integral for 153 Eu is (9.9 ± 0.4)% larger than ENDF/B-VII.1. The capture resonance integral for 151 Eu is (7 ± 1)% larger than ENDF/B-VII.1. Another significant finding from these measurements was a significant increase in thermal total cross section for 151 Eu, up (9 ± 3)% from ENDF/B-VII.1
Si, Chengshuai; Yu, Qiao; Yao, Yufeng
2018-05-01
MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.
Ligand effect on the performance of organic light-emitting diodes based on europium complexes
International Nuclear Information System (INIS)
Fang Junfeng; You Han; Gao Jia; Lu Wu; Ma Dongge
2007-01-01
A series of europium complexes were synthesized and their electroluminescent (EL) characteristics were studied. It was found by comparison that the different substituted groups, such as methyl, chlorine, and nitryl, on ligand 1,10-phenanthroline affect significantly the EL performance of devices based on these complexes. The more methyl-substituted groups on ligand 1,10-phenanthroline led to higher device efficiency. A chlorine-substituted group showed the approximate EL performance as two methyl-substituted groups, whereas a nitryl substituent reduced significantly the EL luminous efficiency. However, β-diketonate ligand TTA and DBM exhibited similar EL performance. The improved EL luminous efficiency by proper substituted groups on the 1,10-phenanthroline was attributed to the reduction of the energy loss caused by light hydrogen atom vibration, as well as concentration quenching caused by intermolecular interaction, and the match of energy level between the ligand and Eu 3+
CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.
Directory of Open Access Journals (Sweden)
Mineo Iwata
Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.
International Nuclear Information System (INIS)
Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu
2009-01-01
Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.
Synergistic extraction of europium(III) in ammonium ionic liquid
International Nuclear Information System (INIS)
Rout, Alok; Venkatesan, K.A.; Antony, M.P.
2016-01-01
Room temperature ionic liquids have been receiving increased attention for possible applications in the area of nuclear fuel reprocessing and waste management due to their fascinating properties such as good ionicity, high solvation capability, properties tunable etc. Most of the studies in the literature on the extraction of metal ions with molecular extractants dissolved in ionic liquid diluents are making use of the hydrophobic ionic liquids containing imidazolium cations such as the 1-alkyl-3-methylimidazolium ion. From an environmental point of view, such ionic liquids are not suitable as the primary mode of the metal extraction is by cation exchange mechanism wherein ionic liquid cation is lost to the aqueous phase leading to aqueous contamination and issue of recyclability of organic phase. However, there are some hydrophobic ionic liquids such as trioctylmethylammonium chloride ((N 1888 )(Cl)), and trihexyl(tetradecyl)phoshonium chloride (Cyphos IL 101) that exhibit no cation exchange in the aqueous phase during extraction. In this context, the extraction behavior of europium(III) using a neutral extractant, octyl, phenyl-N.N-diisobutylmethylcarbamoylphophinoxide (CMPO) and/or an acidic extractant bis(ethylhexyl)phosphoric acid (D2EHPA) dissolved in the ammonium ionic liquid diluent, trioctylmethylammonium bis(trifluoromethanesulfonyl)imide, (N 1888 )(NTf 2 ). The extraction behavior of CMPO (or D2EHPA)/(N 1888 )((Tf 2 ) system was investigated as a function of different extraction parameters such as feed acidity, extractant concentration, equilibration time etc.
Energy Technology Data Exchange (ETDEWEB)
Chitnis, Dipti [Department of Physics, RTM Nagpur University, Nagpur 440033 (India); Thejokalyani, N., E-mail: thejokalyani@rediffmail.com [Department of Applied Physics, Laxminarayan Institute of Technology, Nagpur 440033 (India); Dhoble, S.J. [Department of Physics, RTM Nagpur University, Nagpur 440033 (India)
2017-05-15
In order to explore the spectroscopic properties of a novel europium activated hybrid organic tris(thenoyltrifluoroacetonate)(2,2′-bipyridine)europium(III), Eu(TTA){sub 3}bipy phosphor in various solvents at different pH and molar concentrations, UV–vis optical absorption and photoluminescence spectra were carried out. With a variation in the solvent from basic (chloroform, toluene, tetrahydrofuran) to acidic (acetic acid, formic acid) media, staggering differences in optical absorptions and optical densities were noticed with hypsochromic shift in the absorption peaks. The optical density was found to be maximum for the complex with pH= 7.0 and the intensity as well as optical density gradually decreased when pH is lowered to 6.0 or raised to 8.0 (at an interval of 0.5), proving that the complex is pH sensitive. It's optical energy gap and stokes shift values in various organic solvents were also calculated on the basis of Lippert-Mataga plot. The exploration of spectroscopic properties of solvated Eu(TTA){sub 3}bipy complex demonstrates its prospective for solution processed OLEDs and display devices. - Graphical abstract: Pictorial depiction of photoluminescence in solvated Eu(TTA){sub 3}bipy complex under UV light.
22 CFR 146.110 - Remedial and affirmative action and self-evaluation.
2010-04-01
... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...
Energy Technology Data Exchange (ETDEWEB)
Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: carmen.coya@urjc.es [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)
2015-03-15
Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.
9 CFR 146.23 - Terminology and classification; flocks and products.
2010-01-01
... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...
Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P
2012-01-01
Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma
Energy Technology Data Exchange (ETDEWEB)
Li, Wen-Xian, E-mail: nmglwx@163.com [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Guo, Feng [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-Fang; Feng, Shu-Yan; Bai, Juan; Xin, Xiao-Dong [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)
2014-09-15
Two novel binary and ternary Europium (III) perchlorate complexes were synthesized. The binary complex was prepared with bis(benzylsulfinyl)methane as ligand, and the ternary complex was with bis(benzylsulfinyl)methane as first ligand and 1,10-Phenanthroline as second ligand. They were characterized by element analysis, molar conductivity, coordination titration analysis, IR, TG-DSC, {sup 1}HNMR and UV spectra. The results indicated that the composition of binary and ternary complexes was EuL{sub 2.5}·(ClO{sub 4}){sub 3}·3H{sub 2}O and Eu{sub 2}L{sub 4}·phen·(ClO{sub 4}){sub 6}·12H{sub 2}O (L=C{sub 6}H{sub 5}CH{sub 2}SOCH{sub 2}SOCH{sub 2}C{sub 6}H{sub 5}), respectively. The fluorescent spectra illustrated that the complexes displayed characteristic Europium (III) ion fluorescence in solid state, indicating the ligands favored energy transfer to the excitation state energy level of it. The strongest characteristic fluorescence emission intensity of the ternary system was 1.87 times as strong as that of the binary system. The fluorescent quantum yields of the Eu (III) ternary and binary complexes were also calculated. Additionally, the phosphorescence spectra and the luminescence mechanisms of the complexes were studied and explained. - Highlights: • Two rare earth complexes are new. And they are stabilized. • The intensities of the two rare earth complexes were all stronger and the lifetimes were longer. • The introduction of the second organic ligand1,10-Phenanthroline enhanced the fluorescence intensity. • The fluorescent quantum yields of two complexes being calculated are both very high.
Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}
Energy Technology Data Exchange (ETDEWEB)
Klobes, B., E-mail: b.klobes@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail: y.arinicheva@fz-juelich.de; Neumeier, S., E-mail: s.neumeier@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail: r.simon@fz-juelich.de; Jafari, A., E-mail: a.jafari@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: d.bosbach@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: hermannrp@ornl.gov [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)
2016-12-15
Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.
Characterization of an azo-calix[4]arene-based optical sensor for Europium (III) ions
International Nuclear Information System (INIS)
Echabaane, M.; Rouis, A.; Bonnamour, I.; Ouada, H. Ben
2012-01-01
Selective and sensitive optical sensor membranes (optodes) were elaborated to detect cations in aqueous solutions. The sensing films are based on chromogenic calix[4]arene derivatives. The optode membranes were studied using UV/Vis absorption spectroscopy measurements. The sensitivity of the optode has been tested for Pb 2+ , Cd 2+ , Mg 2+ and Eu 3+ ions at pH 6.8. The results showed a good selectivity response towards Eu 3+ . Low selectivity coefficients were observed for Cd 2+ and Mg 2+ where Pb 2+ can be considered as interfering ions. The characteristics of this optode such as response time, regeneration, reproducibility and lifetime are discussed. - Highlights: ► We report optical sensing studies of chromogenic calixarene derivatives. ► We investigate optical interaction between azo-calix[4]arene and Eu 3+ . ► We study sensitivity and selectivity of optode films. ► We describe characteristics of optode films for determination of europium traces.
Directory of Open Access Journals (Sweden)
Wing Pui Tsang
Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness
20 CFR 702.146 - Source of the special fund.
2010-04-01
... by the employer into the fund. Compensation orders shall be made and filed in accordance with the... during that period for compensation, and (2) the ratio of the amount of payments made by the special fund... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Source of the special fund. 702.146 Section...
9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.
2010-01-01
.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
MicroRNA-146a expression as a potential biomarker for rheumatoid arthritis in Egypt. Heba Mohamed Abdelkader Elsayed, Walaa Shawky Khater, Ayman Asaad Ibrahim, Maha Salah El-din Hamdy, Nashwa Aly Morshedy ...
Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M
2018-02-01
Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.
19 CFR 146.2 - Port director as Board representative.
2010-04-01
...; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.2 Port director as Board representative. The appropriate port director shall be in charge of the zone as the representative of the Board. [T.D. 86-16, 51 FR 5049, Feb. 11, 1986, as amended by T.D. 99-27, 64 FR 13676, Mar. 22, 1999] ...
Synthesis and electroluminescence properties of europium (III) complexes with new second ligands
International Nuclear Information System (INIS)
Liu Ze; Wen Fushan; Li Wenlian
2005-01-01
Two novel second ligands, 9,9-Di-(4-methoxyphenyl)-9-H-4,5-' (OMe-Spiro-DF) and 9,9-Di-(2-(4-(4-butyloxy)phenyl)-5-phenyl-1,3,4-oxadiazolyl)-phenyl-9-H-4, 5-Diazafluorene (OXD-Spiro-DF), were successfully prepared. Europium complexes, Eu(DBM) 3 (OMe-Spiro-DF) and Eu(DBM) 3 (OXD-Spiro-DF) (DBM=dibenzolylmethane) based on the two ligands were designed and synthesized. For a double-layer device with configuration of indium tin oxide (ITO)/N, N'-diphenyl-N,N'-bis(3-methylphenyl)-1,1'-biphenyl-4,4'-diamine (TPD)/Eu(DBM) 3 (OXD-Spiro-DF) or Eu(DBM) 3 (OMe-Spiro-DF)/Mg/Ag, compared with the device based on complex Eu(DBM) 3 (OMe-Spiro-DF), the brightness and electroluminescent (EL) efficiency of device based on complex Eu(DBM) 3 (OXD-Spiro-DF) with oxadiazole-functionalized ligand OXD-Spiro-DF are significantly improved due to the improvement of electron-transporting ability. A maximum brightness of 154 cd/m 2 was obtained at 17 V in the complex Eu(DBM) 3 (OXD-Spiro-DF), about four times brighter than the corresponding complex Eu(DBM) 3 (OMe-Spiro-DF)
DEFF Research Database (Denmark)
Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter
2017-01-01
In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum......, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based...... on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved...
Energy Technology Data Exchange (ETDEWEB)
Zhou, Liang; Jiang, Yunlong; Cui, Rongzhen; Li, Yanan; Zhao, Xuesen; Deng, Ruiping; Zhang, Hongjie, E-mail: hongjie@ciac.ac.cn
2016-02-15
In this study, we aim to further enhance the electroluminescence (EL) performances of trivalent europium complex Eu(TTA){sub 3}phen (TTA=thenoyltrifluoroacetone and phen=1,10-phenanthroline) by designing the device structure with stepwise energy levels. The widely used bipolar material 2,6-bis(3-(9H-carbazol-9-yl)phenyl)pyridine (26DCzPPy) was chosen as host material, while the doping concentration of Eu(TTA){sub 3}phen was optimized to be 4%. To facilitate the injection and transport of holes, MoO{sub 3} anode modification layer and 4,4′,4′′-Tris(carbazole-9-yl)triphenylamine (TcTa) hole transport layer were inserted in sequence. Efficient pure red emission with suppressed efficiency roll-off was obtained attributed to the reduction of accumulation holes, the broadening of recombination zone, and the improved balance of holes and electrons on Eu(TTA){sub 3}phen molecules. Finally, the device with 3 nm MoO{sub 3} and 5 nm TcTa obtained the highest brightness of 3278 cd/m{sup 2}, current efficiency of 12.45 cd/A, power efficiency of 11.50 lm/W, and external quantum efficiency of 6.60%. Such a device design strategy helps to improve the EL performances of emitters with low-lying energy levels and provides a chance to simplify device fabrication processes. - Highlights: • Electroluminescent performances of europium complex were further improved. • Device structure with stepwise energy levels was designed. • Better carriers' balance was realized by improving the injection and transport of holes. • The selection of bipolar host caused the broadening of recombination zone.
40 CFR 146.73 - Financial responsibility for post-closure care.
2010-07-01
...-closure by using a trust fund, surety bond, letter of credit, financial test, insurance or corporate... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Financial responsibility for post... Standards Applicable to Class I Hazardous Waste Injection Wells § 146.73 Financial responsibility for post...
Greco, Claudio; Moro, Giorgio; Bertini, Luca; Biczysko, Malgorzata; Barone, Vincenzo; Cosentino, Ugo
2014-02-11
The adiabatic transition energies from the lowest triplet states of four Europium tris β-diketonate/phenantroline complexes have been determined in vacuo and in dicholomethane solution by the ΔSCF approach at the density functional theory level, using the PBE1PBE and the CAM-B3LYP hybrid functionals. The calculated adiabatic transition energies have been compared with the experimental 0-0 transitions of each complex determined from phosphorescence spectra of the corresponding Gd(3+) complexes and followed by direct comparison between simulated and experimental spectra line shapes. For compound 1, the Eu(TTA)3Phen system, triplet states other than the lowest one and conformational isomers other than the one present in the crystallographic structure have been considered. In the crystallographic structure, this compound presents three quasi-degenerate low energy triplet states, differing for the TTA ligand where the two unpaired electrons are localized and showing close adiabatic transition energies. For compound 1, the lowest triplet states of the four investigated conformational isomers show similar characteristics and close adiabatic transition energies. On the basis of these results, an investigation of compounds 2-4 (Eu(Br-TTA)3Phen, Eu(DTDK)3Phen, and Eu(MeT-TTA)3) has been performed by considering only the isomer present in the crystallographic structure and only the lowest triplet state of each compound. For compounds 1-3, the energies of the lowest triplet states calculated by both functionals in solution including zero-point energy corrections well reproduce the experimental trends as well as the values of the adiabatic transition energies: CAM-B3LYP, the best performing functional, provides energies of the lowest triplet state with deviations from experiments lower than 1200 cm(-1). Also, the calculated vibrationally resolved phosphorescence spectra and UV-vis absorptions well reproduce the main features of their experimental counterparts. Significant
Energy Technology Data Exchange (ETDEWEB)
Kowal-Fouchard, A
2002-11-01
Bentonite clay has been selected as a potential buffer or backfill material in a number of disposal programmes for high level waste. In order to enhance the thermodynamic database of sorption phenomena at the solid-water interface, we have investigated sorption mechanisms of europium(III) and uranium(VI) ions onto montmorillonite and bentonite. Thermodynamic data were obtained for different ions concentrations, different background electrolytes and different ionic strengths. The structural identification of the surface complexes and sorption sites was carried out using two spectroscopies, XPS and TRLIFS, while sorption edges were performed using batch experiments. However, clays are complex minerals and in order to understand these sorption mechanisms we have studied europium(III) and uranium(VI) retention on a silica and an alumina because these solids are often considered as basic components of clays. The comparison of structural results shows that europium ions are significantly sorbed on permanently charged sites of clay until pH 7. But this ion is also sorbed on {identical_to}SiOH and {identical_to}AlOH sites of montmorillonite at pH higher than 6. Uranyl ions sorption on montmorillonite is mainly explained by retention of three complexes on {identical_to}SiOH sites. Moreover, we have shown that nitrate ions and dissolved silicates affect on uranium(VI) sorption mechanisms onto alumina. Nevertheless, uranyl ions sorption on montmorillonite and bentonite only decreases with increasing carbonate concentration. Finally, all the sorption edges were then modeled using these results and a surface complexation model (2 pK and constant capacitance models). (author)
Siparex hits target with '146m for third mid-market fund
2003-01-01
Sigefi Private Equity has reached its target final closing of '146m ($155m) for its third mid-market buy-out and expansion capital fund. International investors contributed 26% of the capital including commitments from CERN, Switzerland (1 paragraph).
Energy Technology Data Exchange (ETDEWEB)
Merigou, C
1990-10-15
With a view for digitizing of radiological images, the luminescent properties of divalent europium in diverse halogen compounds involving strontium or barium have been studied. In halogen-rich compounds (MCl{sub 2}, M{sub 4}OCl{sub 6}, M{sub 5}SiO{sub 4}Cl{sub 6},... where M is Sr or Ba), the thermal extinction of the emission begins only above 300 K. High densities of coloured spots have been produced with X-ray irradiation. The combining of these 2 features has led to the obtention of high yields for argon laser stimulated luminescence in the case of Sr{sub 5}SiO{sub 4}Cl{sub 5}Br:Eu halogen silicate. Although these yields are high they stay below that of BaXF:Eu which is usually used in photon-stimulated screens.
24 CFR 146.3 - Purpose of HUD's age discrimination regulation.
2010-04-01
... RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.3 Purpose of HUD's age discrimination regulation. The purpose of this part is to state HUD's policies and procedures under the Age Discrimination Act of 1975... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of HUD's age discrimination...
International Nuclear Information System (INIS)
Forster, Pedro Lima
2010-01-01
Polymers doped with rare earth complexes are advantaged in film production for many applications in the luminescent field. In this study luminescent polymer obtained from polycarbonate (PC) and poly(9-vinylcarbazole) films doped with diaquatris(thenoyltrifluoroacetonate)europium(III) complex [Eu(tta) 3 (H 2 0) 2 ] were prepared and their calorimetric and luminescent properties in the solid state are reported. The thermal behavior was investigated by differential scanning calorimetry (OSC) and thermogravimetry analysis (TGA). Due of the addition of rare earth Eu(tta) 3 (H 2 0) 2 ] into PC and PVK matrices, changes were observed in the thermal behavior concerning the glass transition and thermal stability. Characteristic broadened narrow bands arising from the 5 D 0 -→ 7 F J transitions (J = 0-4) of Eu 3+ ion indicate the incorporation of the Eu 3+ ions into those polymers. The luminescent films show enhancement emission intensity with an increase in the rare earth concentration in polymeric matrix accompanied by decrease in thermal stability. (author)
International Nuclear Information System (INIS)
Mallah, M.H.; Atomic Energy Organization of Iran, Tehran; Shemirani, F.; Ghannadi Maragheh, M.
2008-01-01
A new preconcentration method of dispersive liquid-liquid microextraction (DLLME) was developed for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium. DLLME technique was successfully used as a sample preparation method. In this preconcentration method, an appropriate mixture of extraction solvent, disperser solvent was injected rapidly into an aqueous solution containing Sm, Eu, Gd and Dy after complex formation using chelating reagent of the 1-(2-pyridylazo)-2-naphthol (PAN). After phase separation, 0.5 mL of the settled phase containing enriched analytes was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The main factors affected the preconcentration of Sm, Eu, Gd and Dy were extraction and dispersive solvent type and their volume, extraction time, volume of chelating agent (PAN), centrifuge speed and drying temperature of the samples. Under the best operating condition simultaneous preconcentration factors of 80, 100, 103 and 78 were obtained for Sm, Eu, Gd and Dy, respectively. (author)
International Nuclear Information System (INIS)
Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.
2009-01-01
MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.
Kumar, Mithlesh; Mohapatra, M.
2016-04-01
Zinc aluminate (ZAO), a member of spinel class of inorganic compounds has been of much interest of late due to its wide range of use in catalysis, optical, electronic and ceramic industries. When doped with several lanthanides, this material has proved to be a potential host matrix for phosphors. As lanthanides suffer from poor (direct) excitation and emission cross sections, the use of a co-dopant ion can help to circumvent this and extract better emission from a lanthanide doped ZAO system. In this connection, energy transfer mechanism from uranium to europium in the ZAO host was investigated by photoluminescence spectroscopic technique. It was seen that uranium gets stabilized in the hexavalent state as UO66 - (octahedral uranate) where as the lanthanide ion, Eu is stabilized in its trivalent state in the ZAO host. In the co-doped system, an efficient energy transfer pathway from the uranate to europium ion was observed. Based upon emission and life time data a suitable mechanism was proposed for the energy transfer (quenching) process. It was proposed that after excitation by photons, the uranate ions transfer their energy to nearby 5D1 level of Eu3 + ions which non-radiatively de-excites to the corresponding lower levels of 5D0. Further this 5D0 level decays in a radiative mode to the 7F manifold giving the characteristic emission profile of trivalent Eu. It was proposed that both static and dynamic types of energy transfer mechanism were responsible for this process.
Yang, Xuecheng; Mao, Xin; Ding, Xuemei; Guan, Fengju; Jia, Yuefeng; Luo, Lei; Li, Bin; Tan, Hailin; Cao, Caixia
2018-02-26
Oxidative stress and miRNAs have been confirmed to play an important role in neurological diseases. The study aimed to explore the underlying effect and mechanisms of miR-146a in H 2 O 2 -induced injury of PC12 cells. Here, PC12 cells were stimulated with 200 μM of H 2 O 2 to construct oxidative injury model. Cell injury was evaluated on the basis of the changes in cell viability, migration, invasion, apoptosis, and DNA damage. Results revealed that miR-146a expression was up-regulated in H 2 O 2 -induced PC12 cells. Functional analysis showed that down-regulation of miR-146a alleviated H 2 O 2 -induced cytotoxicity in PC12 cells. Dual-luciferase reporter and western blot assay verified that MCL1 was a direct target gene of miR-146a. Moreover, anti-miR-146a-mediated suppression on cell cytotoxicity was abated following MCL1 knockdown in H 2 O 2 -induced PC12 cells. Furthermore, MCL1 activated JAK/STAT signaling pathway and MCL1 overexpression attenuated H 2 O 2 -induced cytotoxicity in PC12 cells by JAK/STAT signaling pathway. In conclusion, this study suggested that suppression of miR-146a abated H 2 O 2 -induced cytotoxicity in PC12 cells via regulating MCL1/JAK/STAT pathway.
International Nuclear Information System (INIS)
Noro, Junji; Sekine, Tatsuya.
1992-01-01
The solvent extraction of lanthanum(III), europium(III), lutetium(III), scandium(III), and indium(III) in 0.1 mol dm -3 sodium nitrate solutions with 2-thenoyltrifluoroacetone (Htta) in the absence and presence of tetrabutylammonium ions (tba + ) into carbon tetrachloride was measured. The extraction of lanthanum(III), europium(III), and lutetium(III) was greatly enhanced by the addition of tba + ; this could be explained in terms of the extraction of a ternary complex, M(tta) 4 - tba + . However, the extractions of scandium(III) and indium(III) were nearly the same when tba + was added. The data were treated on the basis of the formation equilibrium of the ternary complex from the neutral chelate, M(tta) 3 , with the extracted ion-pairs of the reagents, tta - tba + , in the organic phase. It was concluded that the degree of association of M(tta) 3 with the ion-pair, tta - tba + , is greater in the order La(tta) 3 ≅ Eu(tta) 3 > Lu(tta) 3 , or that the stability of the ternary complex in the organic phase is higher in the order La(tta) 4 - tba + ≅ Eu(tta) 4 - tba + > Lu(tta) 4 - tba + . This is similar to those of adduct metal chelates of Htta with tributylphosphate (TBP) in synergistic extraction systems. (author)
Directory of Open Access Journals (Sweden)
Michiel M. Harmsen
2017-08-01
Full Text Available Intact (146S foot-and-mouth disease virus (FMDVs can dissociate into specific (12S viral capsid degradation products. FMD vaccines normally consist of inactivated virions. Vaccine quality is dependent on 146S virus particles rather than 12S particles. We earlier isolated two llama single-domain antibody fragments (VHHs that specifically recognize 146S particles of FMDV strain O1 Manisa and shown their potential use in quality control of FMD vaccines during manufacturing. These 146S-specific VHHs were specific for particular O serotype strains and did not bind strains from other FMDV serotypes. Here, we describe the isolation of 146S-specific VHHs against FMDV SAT2 and Asia 1 strains by phage display selection from llama immune libraries. VHHs that bind both 12S and 146S particles were readily isolated but VHHs that bind specifically to 146S particles could only be isolated by phage display selection using prior depletion for 12S particles. We obtained one 146S-specific VHH—M332F—that binds to strain Asia 1 Shamir and several VHHs that preferentially bind 146S particles of SAT2 strain SAU/2/00, from which we selected VHH M379F for further characterization. Both M332F and M379F did not bind FMDV strains from other serotypes. In a sandwich enzyme-linked immunosorbent assay (ELISA employing unlabeled and biotinylated versions of the same VHH M332F showed high specificity for 146S particles but M379F showed lower 146S-specificity with some cross-reaction with 12S particles. These ELISAs could detect 146S particle concentrations as low as 2.3–4.6 µg/l. They can be used for FMD vaccine quality control and research and development, for example, to identify virion stabilizing excipients.
Ebrahimi, Seyed Omar; Reiisi, Somayeh; Parchami Barjui, Shahrbanou
2018-04-11
Polycystic ovary syndrome (PCOS) is an endocrinopathy in reproductive-age women believed to be affected by several genetics and environmental factors or both. Different miRNAs are one of such genetic factors that their associations with PCOS have been implicated. For instance, miR-146a that is well known for strongly regulating the immune response and inflammation was upregulated in serum plasma, follicular fluid and granulosa cells of PCOS patients. Different studies have shown that genetic changes in pre-miRNA can cause change in the expression or biological function of mature miRNA. Therefore, the main aim of this study was to investigate the association of miR-146a gene variation (rs2910164) with the susceptibility to PCOS. This study consists of 180 patients with PCOS and 192 healthy women matched by age and geographical region. Genotyping were determined by using PCR-RFLP in all subjects. The genotype frequency and allele distributions of all subjects were evaluated using Fisher's exact test directed by SPSS v.20. The genotype and allele frequencies of the miR-146a polymorphism (rs2910164) significantly differ between PCOS and healthy controls. The frequencies of CC genotype (p = .054) and 'C' allele (p = .0001) of the miR-146a variant indicated a significant incidence in cases compared to controls. Such association was obtained in co-dominant (OR = 3.16) and dominant (OR = 2.29) models. Result of this study can be proposed that women with miR-146a variation are at a higher risk for developing PCOS, which can be due to up-regulation of miR-146a.
9 CFR 146.53 - Terminology and classification; slaughter plants and premises.
2010-01-01
... from which the commercial waterfowl and commercial upland game bird industry may conduct a program to... COMMERCIAL POULTRY Special Provisions for Commercial Upland Game Birds, Commercial Waterfowl, Raised-for-Release Upland Game Birds, and Raised-for-Release Waterfowl § 146.53 Terminology and classification...
Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.
Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei
2012-12-01
MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.
Mean-field potential approach for thermodynamic properties of lanthanide: Europium as a prototype
Kumar, Priyank; Bhatt, N. K.; Vyas, P. R.; Gohel, V. B.
2018-03-01
In the present paper, a simple conjunction scheme [mean-field potential (MFP) + local pseudopotential] is used to study the thermodynamic properties of divalent lanthanide europium (Eu) at extreme environment. Present study has been carried out due to the fact that divalent nature of Eu arises because of stable half-filled 4f-shell at ambient condition, which has great influence on the thermodynamic properties at extreme environment. Due to such electronic structure, it is different from remaining lanthanides having incomplete 4f-shell. The presently computed results of thermodynamic properties of Eu are in good agreement with the experimental results. Looking to such success, it seems that the concept of MFP approach is successful to account contribution due to nuclear motion to the total Helmholtz free energy at finite temperatures and pressure-induced inter-band transfer of electrons for condensed state of matter. The local pseudopotential is used to evaluate cold energy and hence MFP accounts the s-p-d-f hybridization properly. Looking to the reliability and transferability along with its computational and conceptual simplicity, we would like to extend the present scheme for the study of thermodynamic properties of remaining lanthanides and actinides at extreme environment.
Energy Technology Data Exchange (ETDEWEB)
Al-Kindy, Salma M.Z. [Department of Chemistry, College of Science, P.O. Box 36, Al-Khod 123, Sultan Qaboos University (Oman)], E-mail: alkindy@squ.edu.om; Suliman, Fakhr Eldin O.; Al-Wishahi, Aisha A.; Al-Lawati, Haidar A.J.; Aoudia, Muhammed [Department of Chemistry, College of Science, P.O. Box 36, Al-Khod 123, Sultan Qaboos University (Oman)
2007-12-15
A simple, selective and sensitive luminescence method for the assay of piroxicam (PX) in aqueous solution is developed. The method is based on the luminescence sensitization of europium (Eu{sup 3+}) by formation of ternary complex with PX in the presence of TOPO and Tween-80 as surfactant. The signal for Eu-PX-TOPO is monitored at {lambda}{sub ex}=359 nm and {lambda}{sub em}=615 nm. Optimum conditions for the formation of the complex in sequential injection analysis (SIA) were 0.01 M Tris buffer, pH 7.5, TOPO 5.0x10{sup -5} M, Tween-80 0.15% and 1.5 mM of Eu{sup 3+}, which allows the determination of 100-1000 ppb of PX with limit of detection (LOD) of 29 ppb. The relative standard deviations of the method range between 0.5% and 3.9% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assay of PX in pharmaceutical formulations and in urine samples. Average recoveries of 100.8{+-}1.7% was obtained in tablet, whereas a recovery of 97.5{+-}2.0% was obtained for the total PX (PX+hydoxy-PX) in urine sample.
International Nuclear Information System (INIS)
Al-Kindy, Salma M.Z.; Suliman, Fakhr Eldin O.; Al-Wishahi, Aisha A.; Al-Lawati, Haidar A.J.; Aoudia, Muhammed
2007-01-01
A simple, selective and sensitive luminescence method for the assay of piroxicam (PX) in aqueous solution is developed. The method is based on the luminescence sensitization of europium (Eu 3+ ) by formation of ternary complex with PX in the presence of TOPO and Tween-80 as surfactant. The signal for Eu-PX-TOPO is monitored at λ ex =359 nm and λ em =615 nm. Optimum conditions for the formation of the complex in sequential injection analysis (SIA) were 0.01 M Tris buffer, pH 7.5, TOPO 5.0x10 -5 M, Tween-80 0.15% and 1.5 mM of Eu 3+ , which allows the determination of 100-1000 ppb of PX with limit of detection (LOD) of 29 ppb. The relative standard deviations of the method range between 0.5% and 3.9% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assay of PX in pharmaceutical formulations and in urine samples. Average recoveries of 100.8±1.7% was obtained in tablet, whereas a recovery of 97.5±2.0% was obtained for the total PX (PX+hydoxy-PX) in urine sample
Directory of Open Access Journals (Sweden)
Jiang Xiaoying
2010-06-01
Full Text Available Abstract Background Despite the widespread induction of miR-146a during the innate immune response little is known regarding its biogenesis, function and mechanism. We have therefore examined the role of miR-146a during the interleukin (IL-1β-stimulated IL-6 and IL-8 release and proliferation in primary human airway smooth muscle (HASM cells. Methods HASM cells were isolated from human lung re-section, cultured to a maximum of 3 - 6 passages and then exposed to IL-1β. miR-146a expression were determined by qRT-PCR, IL-6 and IL-8 release by ELISA and proliferation using bromodeoxyuridine incorporation. The role of NF-κB and the MAP kinase pathways was assessed using pharmacological inhibitors of IKK2 (TPCA-1, JNK (SP600125, p38 MAP kinase (SB203580 and MEK-1/2 (PD98059. miR-146a function was determined following transfection of HASM with inhibitors and mimics using Amaxa electroporation. Results IL-1β induced a time-dependent and prolonged 100-fold induction in miR-146a expression, which correlated with release of IL-6 and IL-8. Exposure to IL-1β had no effect upon HASM proliferation. Pharmacological studies showed that expression of primary miR-146a was regulated at the transcriptional levels by NF-κB whilst post-transcriptional processing to mature miR-146a was regulated by MEK-1/2 and JNK-1/2. Functional studies indicated that IL-1β-induced miR-146a expression does not negatively regulate IL-6 and IL-8 release or basal proliferation. However, inhibition of IL-1β-induced IL-6 and IL-8 release was observed at the super-maximal intracellular miR-146a levels obtained by transfection with miR-146a mimics and indicates that studies using miRNA mimics can produce false positive results. Mechanistic studies showed that in the presence of super-maximal levels, the action of miR-146a mimics was mediated at a step following IL-6 and IL-8 mRNA transcription and not through down-regulation of IL-1 receptor associated kinase 1 (IRAK-1 and TNF
International Nuclear Information System (INIS)
Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A.; Brito, Hermi F.
2009-01-01
This work presents the results of synthesis and characterization of an inorganic ion exchanger based on tin/titanium mixed oxides doped with europium (SnO 2 /TiO 2 :Eu 3+ ) to be used in environmental field. The adsorption study of nickel was realized in this exchanger to recover the nickel metal which is in thorium-nickel alloys used as electrode of discharge lamps. The studied exchanger was synthesized by neutralization of tin chloride (IV) and titanium chloride (III) mixed solution and characterized by thermogravimetric measurement (TG), Differential Scanning Calorimetry (DSC), X-Ray Powder Diffraction (XRD), Infrared Spectroscopy (IR) and Scanning Electron Microscopy (SEM). The adsorption study showed that these inorganic ion exchangers are good materials to recovery nickel with high weight distribution ratios (Dw Ni 2+ ) and percent adsorption. (author)
Intranasal Delivery of miR-146a Mimics Delayed Seizure Onset in the Lithium-Pilocarpine Mouse Model
Directory of Open Access Journals (Sweden)
Hua Tao
2017-01-01
Full Text Available Unveiling the key mechanism of temporal lobe epilepsy (TLE for the development of novel treatments is of increasing interest, and anti-inflammatory miR-146a is now considered a promising molecular target for TLE. In the current study, a C57BL/6 TLE mouse model was established using the lithium-pilocarpine protocol. The seizure degree was evaluated according to the Racine scale, and level 5 was considered the threshold for generalized convulsions. Animals were sacrificed to analyze the hippocampus at three time points (2 h and 4 and 8 weeks after pilocarpine administration to evaluate the acute, latent, and chronic phases, resp.. After intranasal delivery of miR-146a mimics (30 min before pilocarpine injection, the percent of animals with no induced seizures increased by 6.7%, the latency to generalized convulsions was extended, and seizure severity was reduced. Additionally, hippocampal damage was alleviated. While the relative miR-146a levels significantly increased, the expression of its target mRNAs (IRAK-1 and TRAF-6 and typical inflammatory modulators (NF-κB, TNF-α, IL-1β, and IL-6 decreased, supporting an anti-inflammatory role of miR-146a via the TLR pathway. This study is the first to demonstrate that intranasal delivery of miR-146a mimics can improve seizure onset and hippocampal damage in the acute phase of lithium-pilocarpine-induced seizures, which provides inflammation-based clues for the development of novel TLE treatments.
Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza
2016-03-01
The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.
International Nuclear Information System (INIS)
Kochetkova, N.E.; Kojro, O.Eh.; Nesterova, N.P.; Medved', T.Ya.; Chmutova, M.K.; Myasoedov, B.F.; Kabachnik, M.I.
1986-01-01
The influence of substituents in methylene bridge on solubility, extractivity and selectivity of bidentate neutral phosphorus- and phosphorus-nitrogen-containing reagents in the process of U(6), TUE, Eu extraction has been studied. It is ascertained that hydrogen substitution in the bridge of tetraphenylmethylenediphosphine dioxide (1) causes a decrease in the extractivity of reagent as to TPE, uranium (6) and europium. There is no visible regular relation between basicity and extractivity of substituted reagents. Hydrogen substitution in the bridge of diphenyl[diethylcarbamoylmethyl]phosphine oxide (2) causes a decrease in extractivity of the reagent as to TPE, uranium (6) and europium. In contrast to monodentate neutral reagents, when bidentate neutral reagents are used, sometimes no increase in the reagent extractivity with an increase in its basicity is observed. When fragments restricting the conformation mobility of bidentate reagent molecule are introduced in it (here substituents in methylene bridge), it may result in the violation of the regularity, since of all the factors affecting the reagent extractivity the spatial factor may become the prevailing one. On hydrogen substitution in the bridge of 1 separation factors of practically all (with few exceptions) studied pairs of elements increase. Hydrogen substitution in the bridge of 2 causes an increase in separation factor of U (6) /Am pair and it does not affect the separation factor of Am/Eu pair. Hydrogen substitution in the bridge of 1 and 2 does not result in the preparation of more efficient and considerably more selective reagents for extractive isolation and separation of the elements, but some of the substituted reagents (Cl-substituted 1, for instance) may turn out useful for the element separation
Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation
Energy Technology Data Exchange (ETDEWEB)
Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: jorgeiriqui@gimmunison.com [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)
2015-10-15
Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)
Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, Margrethe Rømer
2002-01-01
The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...
Up-regulation of miR-146a contributes to the inhibition of invasion of pancreatic cancer cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2009-01-01
Pancreatic cancer (PC) is an aggressive malignancy with high mortality and is believed to be in part due to its highly invasive and metastatic behavior, which is associated with over-expression of EGFR and activation of NF-κB. Emerging evidence also suggest critical roles of microRNAs (miRNAs) in the regulation of various pathobiological processes including metastasis in PC and in other human malignancies. In the present study, we found lower expression of miR-146a in PC cells compared to normal human pancreatic duct epithelial (HPDE) cells. Interestingly, re-expression of miR-146a inhibited the invasive capacity of Colo357 and Panc-1 PC cells with concomitant down-regulation of EGFR and IRAK-1. Mechanistic studies including miR-146a re-expression, anti-miR-146 transfection, and EGFR knock-down experiment showed that there was a crosstalk between EGFR, MTA-2, IRAK-1, IκBα and NF-κB. Most importantly, we found that the treatment of PC cells with “natural agents” [3,3′-diinodolylmethane (DIM) or isoflavone] led to an increase in the expression of miR-146a and consequently down-regulated the expression of EGFR, MTA-2, IRAK-1 and NF-κB, resulting in the inhibition of invasion of Colo357 and Panc-1 cells. These results provide experimental evidence in support of the role of DIM and isoflavone as potential non-toxic agents as regulators of miRNA, which could be useful for the inhibition of cancer cell invasion and metastasis, and further suggesting that these agents could be important for designing novel targeted strategy for the treatment of PC. PMID:25242818
12 CFR 563.146 - Will the OTS permit my capital distribution?
2010-01-01
... under 12 U.S.C. 1831o(d)(1)(B). (b) Your proposed capital distribution raises safety or soundness... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Will the OTS permit my capital distribution... SAVINGS ASSOCIATIONS-OPERATIONS Capital Distributions § 563.146 Will the OTS permit my capital...
27 CFR 70.146 - 45-day period for making disbursements.
2010-04-01
... tax lien filing, to the lien imposed by 26 U.S.C. 6321 if, and to the extent, a right to payment has... Collection of Excise and Special (Occupational) Tax Lien for Taxes § 70.146 45-day period for making disbursements. Even though a notice of a lien imposed by 26 U.S.C. 6321 is filed in accordance with § 70.149 of...
International Nuclear Information System (INIS)
Meadows, J.W.; Smith, D.L.; Ikeda, Y.; Konno, C.
1990-01-01
Identical sample packets, each containing samples of elemental copper, silver, europium, terbium, and hafnium, as well as titanium, iron and nickel as dosimeters, have been irradiated in three distinct accelerator neutron fields (at Argonne National Laboratory and Los Alamos National Laboratory in the U.S.A., and Japan Atomic Energy Research Institute, Tokai, Japan) as part of an interlaboratory research collaboration to search for the production of long-lived radionuclides for fusion waste disposal applications. This paper is a progress report on this project. To date, we have detected the following activities, and have obtained preliminary experimental cross section values for several of these: Ag-106m,108m,110m; Eu-150m,152g,154; Tb-158,160; and Hf-175,178m2,179m2,181. (author). 11 refs, 1 fig., 4 tabs
International Nuclear Information System (INIS)
Haigh, D.; Higgo, J.J.W.; Williams, G.M.; Hooker, P.J.; Ross, C.A.M.; Falck, W.E.; Allen, M.A.; Warwick, P.
1991-01-01
This study has been undertaken within the Commission of the European Communities MIRAGE II program on the determination of radionuclides in the geosphere. Preliminary batch sorption experiments have been carried out to study the behaviour of strontium, caesium, iodine, europium and uranium in a glacial sand-groundwater system. The effect of (i) the presence or absence of natural organic material and (ii) the addition of increasing quantities of EDTA or acetate on the distribution ratios was determined. In some cases speciation modelling was used as an aid to designing the experiments and interpreting the results. The aim of this work was to select suitable tracers for use in field experiments at Drigg. Cumbria and the results are intended to aid the design of future experiments rather than to provide a complete analysis of the radionuclide-organic interactions. 11 tabs., 49 refs
MicroRNA-146 protects A549 and H1975 cells from LPS-induced ...
Indian Academy of Sciences (India)
Qiang Wang
2017-10-26
Oct 26, 2017 ... States, pneumonia is the sixth most common cause of dis- ease-related deaths. In addition, pneumonia is the most common hospital-acquired fatal infections. ... 146 targets the messengers of bacterial lipopolysaccharide.
Photoluminescent behaviors of several kinds of europium ternary complexes doped in PMMA
International Nuclear Information System (INIS)
Liu, H.-G.; Lee, Yong-Ill; Park, Seongtae; Jang, Kiwan; Kim, Sang Su
2004-01-01
Four kinds of europium ternary complexes; Eu(DBM) 3 phen, Eu(DBM) 3 (DB-bpy), Eu(DBM) 3 (DN-bpy) and Eu(DBM) 3 biq (DBM, phen, DB-bpy, DN-bpy and biq refer to Dibenzoylmethane, 1,10-phenanthroline, 4,4'-Di-tert-butyl-2,2'-dipyridyl, 4,4'-Dinonyl-2,2'-dipyridyl and 2,2'-Biquinoline, respectively), were doped in poly(methyl methacrylate) (PMMA) matrix. The luminescence properties of the composites were investigated by emission spectroscopy and lifetime measurements. It was found that the composites formed by the three complexes, Eu(DBM) 3 phen, Eu(DBM) 3 (DB-bpy), and Eu(DBM) 3 (DN-bpy), exhibit strong luminescence and similar emission spectral characteristics to Eu(III). Whereas, Eu(DBM) 3 biq shows large differences in its luminescence spectrum compared to those of other complexes. The luminescence was very weak and broad. The emission spectral features of Eu(III) in the Eu(DBM) 3 biq/PMMA systems change with the molar ratios of the complex and PMMA. The lifetime of 5 D 0 level of Eu(III) in Eu(DBM) 3 biq/PMMA systems is shorter than those in the other systems. The luminescence intensity of Eu(III) in Eu(DBM) 3 biq/PMMA systems decreases gradually when exposed to UV-light while the broad emission band becomes stronger
Energy Technology Data Exchange (ETDEWEB)
Bicho, Rita C., E-mail: ritabicho@ua.pt; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)
2016-12-15
Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.
International Nuclear Information System (INIS)
Bicho, Rita C.; Soares, Amadeu M.V.M.; Nogueira, Helena I.S.; Amorim, Mónica J.B.
2016-01-01
Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO 2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO 2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO 2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.
International Nuclear Information System (INIS)
Dong Dewen; Yang Yongsheng; Jiang Bingzheng
2006-01-01
Novel organic-inorganic hybrid composite films with ternary lanthanide complex covalently bonded with silica matrix were prepared in situ via co-ordination of N-(3-propyltriethoxysilane)-4-carboxyphthalimide (TAT) and 1,10-phenanthroline (Phen) with europium ion (Eu 3+ ) during a sol-gel approach and characterized by the means of spectrofluorimeter, phosphorimeter and infrared spectrophotometer (FTIR). The resulting transparent films showed improved photophysical properties, i.e. increased luminescence intensity and longer luminescence lifetime, compared with the corresponding binary composite films without Phen. All the results revealed that the intense luminescence of the composite film was attributed to the efficient energy transfer from ligands, especially Phen, to chelated Eu 3+ and the reduced non-radiation through the rigid silica matrix and 'site isolation'
International Nuclear Information System (INIS)
Misso, Agatha Matos
2016-01-01
Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na 2 SiO 3 solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl - , and dried. The reduction of the europium to Eu 2+ was performed under atmosphere of 5% of H 2 and 95% of Ar to 900° C for 3h, to reach CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi 2 O 6 :Eu 2+ lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f N → 4f N-1 5d transition of Eu 2+ ion. The spectra of excitation showed 4f N → 4f N-1 5d transition of Eu 2+ ion broad band, related to the ligand to metal charge transfer transition (LMCT) O 2- (2p) → Eu 3+ in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu 3+ ion bands, showing the 7 F 0 → 5 L 6 transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of 5 D 0 → 7 F J (J = 0 - 5) transition of Eu 3+ ion, indicating that the Eu 3+ ion occupies a site with center of inversion. Finally, the obtained results indicate that the developed method is suitable to synthesize CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors, as it has been proposed. (author)
Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters
Directory of Open Access Journals (Sweden)
Reeta Kangas
2017-01-01
Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.
Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.
Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem
2017-12-01
Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.
Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae
2016-04-01
Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required
24 CFR 146.1 - Purpose of the Age Discrimination Act of 1975.
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.1 Purpose of the Age Discrimination Act of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of the Age Discrimination... programs or activities receiving Federal financial assistance. The Act, however, permits federally assisted...
19 CFR 146.52 - Manipulation, manufacture, exhibition or destruction; Customs Form 216.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Manipulation, manufacture, exhibition or... Merchandise in a Zone § 146.52 Manipulation, manufacture, exhibition or destruction; Customs Form 216. (a... application) on Customs Form 216 for permission to manipulate, manufacture, exhibit, or destroy merchandise in...
Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin
2016-03-01
MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.
MicroED Structure of Au146(p-MBA)57 at Subatomic Resolution Reveals a Twinned FCC Cluster.
Vergara, Sandra; Lukes, Dylan A; Martynowycz, Michael W; Santiago, Ulises; Plascencia-Villa, Germán; Weiss, Simon C; de la Cruz, M Jason; Black, David M; Alvarez, Marcos M; López-Lozano, Xochitl; Barnes, Christopher O; Lin, Guowu; Weissker, Hans-Christian; Whetten, Robert L; Gonen, Tamir; Yacaman, Miguel Jose; Calero, Guillermo
2017-11-16
Solving the atomic structure of metallic clusters is fundamental to understanding their optical, electronic, and chemical properties. Herein we present the structure of the largest aqueous gold cluster, Au 146 (p-MBA) 57 (p-MBA: para-mercaptobenzoic acid), solved by electron micro-diffraction (MicroED) to subatomic resolution (0.85 Å) and by X-ray diffraction at atomic resolution (1.3 Å). The 146 gold atoms may be decomposed into two constituent sets consisting of 119 core and 27 peripheral atoms. The core atoms are organized in a twinned FCC structure, whereas the surface gold atoms follow a C 2 rotational symmetry about an axis bisecting the twinning plane. The protective layer of 57 p-MBAs fully encloses the cluster and comprises bridging, monomeric, and dimeric staple motifs. Au 146 (p-MBA) 57 is the largest cluster observed exhibiting a bulk-like FCC structure as well as the smallest gold particle exhibiting a stacking fault.
Cui, Lili; Tao, Hua; Wang, Yan; Liu, Zhou; Xu, Zhien; Zhou, Haihong; Cai, Yujie; Yao, Lifen; Chen, Beichu; Liang, Wandong; Liu, Yu; Cheng, Wanwen; Liu, Tingting; Ma, Guoda; Li, You; Zhao, Bin; Li, Keshen
2015-04-01
Epilepsy is the third most common chronic brain disorder and is characterized by an enduring predisposition for seizures. Recently, a growing body of evidence has suggested that microRNA-146a (miR-146a) is upregulated in the brains of epilepsy patients and of mouse models; furthermore, miR-146a may be involved in the development and progression of seizures through the regulation of inflammation and immune responses. In this report, we performed a case-control study to analyze the relationship between the two potentially functional single nucleotide polymorphisms (SNPs) of the miR-146a gene (rs2910464 and rs57095329) and the risk of epilepsy in a Chinese population comprising 249 cases and 249 healthy controls. Our study comprised 249 epilepsy patients and 249 healthy controls in two regions of China. The DNA was genotyped using the ABI PRISM SNapShot method. The statistical analysis was estimated using the chi-square test or Fisher's exact test. Our results indicated a significant association between the rs57095329 SNP of the miR-146a gene and the risk of drug resistant epilepsy (DRE) (genotypes, p = 0.0258 and alleles, p = 0.0108). Moreover, the rs57095329 A allele was found to be associated with a reduced risk of seizures frequency in DRE patients (all p epilepsy. Our data indicate that the rs57095329 polymorphism in the promoter region of miR-146a is involved in the genetic susceptibility to DRE and the seizures frequency. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Damage recovery and optical activity in europium implanted wide gap oxides
International Nuclear Information System (INIS)
Alves, E.; Marques, C.; Franco, N.; Alves, L.C.; Peres, M.; Soares, M.J.; Monteiro, T.
2010-01-01
In this study we compare and discuss the defects and optical behaviour of sapphire and magnesium oxide single crystals implanted at room temperature with different fluences (1 x 10 15 -1 x 10 16 cm -2 ) of europium ions. Rutherford backscattering channelling shows that for fluences above 5 x 10 15 cm -2 the surface disorder level in the Al-sublattice reaches the random level. Implantation damage recovers fast for annealing in oxidizing atmosphere but even for the highest fluence we recover almost completely all the damage after annealing at 1300 o C, independently of the annealing environment (reducing or oxidizing). Annealing above 1000 o C promotes the formation of Eu 2 O 3 in the samples with higher concentration of Eu. The optical activation of the rare earth ions at room temperature was observed after annealing at 800 o C by photoluminescence and ionoluminescence. In Al 2 O 3 lattice the highest intensity line of the Eu 3+ ions corresponds to the forced electric dipole 5 D 0 → 7 F 2 transition that occurs ∼616 nm. For the MgO samples the Eu 3+ optical activation was also achieved after implantation with different fluences. Here, the lanthanide recombination is dominated by the magnetic dipole 5 D 0 → 7 F 1 transition near by 590 nm commonly observed for samples were Eu 3+ is placed in a high symmetry local site. The results clearly demonstrate the possibility to get Eu incorporated in optical active regular lattice sites in wide gap oxides.
Liu, Jing; Zuo, Wei; Zhang, Wei; Liu, Jian; Wang, Zhiyi; Yang, Zhengyin; Wang, Baodui
2014-10-07
Ultrasensitive, accurate detection and separation of heavy metal ions is very important in environmental monitoring and biological detection. In this paper, a highly sensitive and specific detection method for Cu(2+) based on the fluorescence quenching of a europium(III) hybrid magnetic nanoprobe is presented. This nanoprobe can detect Cu(2+) over a wide pH range (5.0-10.0) with a detection limit as low as 0.1 nM and it can be used for detecting Cu(2+) in living cells. After the magnetic separation, the Cu(2+) concentration decreased to 1.18 ppm, which is less than the US EPA drinking water standard (1.3 ppm), and more than 70% Cu(2+) could be removed when the amount of nanocomposite 1 reached 1 mg.
Directory of Open Access Journals (Sweden)
Qian Cheng
2017-01-01
Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.
International Nuclear Information System (INIS)
Liu, Yanting; Fan, Louzhen; Zhou, Shixin; Fan, Hong
2016-01-01
We have prepared graphene quantum dot-europium(III) complex composites by noncovalently connecting chelating ligands dibenzoylmethane (DBM) and 1,10-phenanthroline (Phen) with graphene quantum dots (GQDs) first, followed by coordination to Eu(III). The resulting composites are well water-soluble and display red fluorescence of high color purity. The composites were characterized by transmission electron microscopy, X-ray photoelectron spectroscopy and X-ray diffraction. Aqueous solutions of the composites under 365 nm excitation display fluorescence with a peak at 613 nm and a quantum yield as high as 15.5 %. The good water solubility and stable photoluminescence make the composites very different from other Eu(III)-based coordination complexes. The composites are cell viable and can be used to label both the cell membrane and the cytoplasm of MCF-7 cells. They are also shown to act as bioprobes for in-vivo localization of tumorous tissue. In our perception, such composites are expected to possess wide scope because of the many functionalizations that are possible with GQDs. (author)
Directory of Open Access Journals (Sweden)
Paula F T Cezar-de-Mello
2014-09-01
Full Text Available Mycobacterium leprae infects macrophages and Schwann cells inducing a gene expression program to facilitate its replication and progression to disease. MicroRNAs (miRNAs are key regulators of gene expression and could be involved during the infection. To address the genetic influence of miRNAs in leprosy, we enrolled 1,098 individuals and conducted a case-control analysis in order to study four miRNAs genes containing single nucleotide polymorphism (miRSNP. We tested miRSNP-125a (rs12975333 G>T, miRSNP-223 (rs34952329 *>T, miRSNP-196a-2 (rs11614913 C>T and miRSNP-146a (rs2910164 G>C. Amongst them, miRSNP-146a was the unique gene associated with risk to leprosy per se (GC OR = 1.44, p = 0.04; CC OR = 2.18, p = 0.0091. We replicated this finding showing that the C-allele was over-transmitted (p = 0.003 using a transmission-disequilibrium test. A functional analysis revealed that live M. leprae (MOI 100:1 was able to induce miR-146a expression in THP-1 (p<0.05. Furthermore, pure neural leprosy biopsies expressed augmented levels of that miRNA as compared to biopsy samples from neuropathies not related with leprosy (p = 0.001. Interestingly, carriers of the risk variant (C-allele produce higher levels of mature miR-146a in nerves (p = 0.04. From skin biopsies, although we observed augmented levels of miR-146a, we were not able to correlate it with a particular clinical form or neither host genotype. MiR-146a is known to modulate TNF levels, thus we assessed TNF expression (nerve biopsies and released by peripheral blood mononuclear cells infected with BCG Moreau. In both cases lower TNF levels correlates with subjects carrying the risk C-allele, (p = 0.0453 and p = 0.0352; respectively, which is consistent with an immunomodulatory role of this miRNA in leprosy.
22 CFR 146.425 - Counseling and use of appraisal and counseling materials.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on...
The N=82 gap in /sup 146/Gd from beta -decay studies of Tb isotopes
Styczen, J; Kleinheinz, P; Piiparinen, M
1981-01-01
The beta -decay study of 23 s /sup 146/Tb suggests a ( pi h/sub 11/2/ nu d/sup -1//sub 3/2/) 5/sup -/ configuration for this activity. In its decay the authors have identified a pi h/sub 11/2/ to nu h/sub 9/2 / GT decay branch which populates neutron particle-hole states in /sup 146/Gd. Hence the N=82 single particle energy gap is less than 4 MeV. Neutron one-particle two-hole and two-particle one-hole states in /sup 145/Gd and /sup 147/Gd were identified in the beta -decays of 29 s /sup 145/Tb and 1.6 h /sup 147/Tb. (11 refs).
Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian
2017-02-01
In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.
Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T
2017-07-01
We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.
Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS
International Nuclear Information System (INIS)
Kautenburger, R.; Nowotka, K.; Beck, H.P.
2005-01-01
Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu 3+ ) and gadolinium (Gd 3+ ) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 μl nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for 153 Eu and 125 ppt for 158 Gd. With this optimized CE-ICP-MS coupling
Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong
2017-08-01
MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.
Gysler, Stefan M; Mulla, Melissa J; Guerra, Marta; Brosens, Jan J; Salmon, Jane E; Chamley, Lawrence W; Abrahams, Vikki M
2016-07-01
What is the role of microRNAs (miRs) in antiphospholipid antibody (aPL)-induced trophoblast inflammation? aPL-induced up-regulation of trophoblast miR-146a-3p is mediated by Toll-like receptor 4 (TLR4), and miR-146a-3p in turn drives the cells to secrete interleukin (IL)-8 by activating the RNA sensor, TLR8. Obstetric antiphospholipid syndrome (APS) is an autoimmune disorder characterized by circulating aPL and an increased risk of pregnancy complications. We previously showed that aPL recognizing beta2 glycoprotein I (β2GPI) elicit human first trimester trophoblast secretion of IL-8 by activating TLR4. Since some miRs control TLR responses, their regulation in trophoblast cells by aPL and functional role in the aPL-mediated inflammatory response was investigated. miRs can be released from cells via exosomes, and therefore, miR exosome expression was also examined. A panel of miRs was selected based on their involvement with TLR signaling: miR-9; miR-146a-5p and its isomiR, miR-146a-3p; miR-155, miR-210; and Let-7c. Since certain miRs can activate the RNA sensor, TLR8, this was also investigated. For in vitro studies, the human first trimester extravillous trophoblast cell line, HTR8 was studied. HTR8 cells transfected to express a TLR8 dominant negative (DN) were also used. Plasma was evaluated from pregnant women who have aPL, either with or without systemic lupus erythematous (SLE) (n = 39); SLE patients without aPL (n = 30); and healthy pregnant controls (n = 20). Trophoblast HTR8 wildtype and TLR8-DN cells were incubated with or without aPL (mouse anti-human β2GPI mAb) for 48-72 h. HTR8 cells were also treated with or without aPL in the presence and the absence of a TLR4 antagonist (lipopolysaccharide from Rhodobacter sphaeroides; LPS-RS), specific miR inhibitors or specific miR mimics. miR expression levels in trophoblast cells, trophoblast-derived exosomes and exosomes isolated from patient plasma were measured by qPCR. Trophoblast IL-8 secretion was
Energy Technology Data Exchange (ETDEWEB)
Reckeweg, Olaf [Baker Laboratory, Department of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14853-1301 (United States); Institut fuer Anorganische Chemie, Universitaet Stuttgart, Pfaffenwaldring 55, 70569 Stuttgart (Germany); DiSalvo, Francis J. [Baker Laboratory, Department of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14853-1301 (United States); Wolf, Sarah; Schleid, Thomas [Institut fuer Anorganische Chemie, Universitaet Stuttgart, Pfaffenwaldring 55, 70569 Stuttgart (Germany)
2014-06-15
Dark ruby-red, transparent, triangular plate-shaped single crystals of Eu{sub 2}H{sub 3}Cl and colorless, transparent, needle-shaped single crystals of Eu{sub 7}F{sub 12}Cl{sub 2} were obtained by solid-state reactions of Eu, NaH, NaCl, and Na (2:4:1:2 molar ratio) or Eu, EuCl{sub 3}, and LiF (1:1:4 molar ratio), respectively, in silica-jacketed tantalum ampoules at 900 C for 13 h. Eu{sub 2}H{sub 3}Cl crystallizes isotypically to Ba{sub 2}H{sub 3}X (X = Cl, Br, I) in the trigonal space group P anti 3m1 (no. 164) with lattice parameters a = 409.67(4) and c = 696.18(7) pm, whereas Eu{sub 7}F{sub 12}Cl{sub 2} crystallizes isotypically to Ba{sub 7}F{sub 12}Cl{sub 2} or Sr{sub 7}H{sub 12}Cl{sub 2} in the hexagonal space group P anti 6 (no. 174) with lattice parameters a = 1002.31(5) and c = 392.54(2) pm. Both compounds contain Eu{sup 2+} cations with coordination numbers as high as nine (Eu{sub 7}F{sub 12}Cl{sub 2}) and ten (Eu{sub 2}H{sub 3}Cl) with respect to the halide anions (F{sup -} or H{sup -} and Cl{sup -}). The structural results are corroborated by EUTAX and MAPLE calculations on both ternary mixed-anion europium(II) chlorides in comparison to these for related binary and ternary compounds with divalent europium. (Copyright copyright 2014 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice
Directory of Open Access Journals (Sweden)
Pan Y
2012-12-01
Full Text Available Yang Pan,1,2 Tingting Jia,1,2 Yuan Zhang,1,2 Kuo Zhang,1 Rui Zhang,1 Jinming Li,1 Lunan Wang11National Center for Clinical Laboratories, Beijing Hospital of the Ministry of Health, Beijing, People’s Republic of China; 2Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of ChinaBackground: Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the presence of pathogenic autoantibodies. Recent studies suggest that microRNAs (miRNAs play an essential role in immunoregulation and may be involved in the pathogenesis of SLE. Therefore, it was of interest to investigate the potential therapeutic application of miRNAs in SLE, a concept that has not been thoroughly investigated thus far. Virus-like particles (VLPs are a type of recombinant nanoparticle enveloped by certain proteins derived from the outer coat of a virus. Herein, we describe a novel miRNA-delivery approach via bacteriophage MS2 VLPs and investigate the therapeutic effects of miR-146a, a well-studied and SLE-related miRNA, in BXSB lupus-prone mice.Methods: VLPs containing miR-146a, and the control VLPs, were prepared using an Escherichia coli expression system and then administered to lupus-prone mice over a 12-day period. We performed an enzyme-linked immunosorbent assay to evaluate the anti-dsDNA antibody, autoantibody to nuclear antigen (ANA, total IgG and total IgM levels in serum. The expression of miR-146a was analyzed by qRT-PCR. SLE-related cytokines as well as some toll-like receptor signaling pathway molecules were also measured.Results: Treatment with MS2-miR146a VLP showed profound effects on lupus-prone BXSB mice, including an increased level of mature miR-146a, which led to a significant reduction in the expression of autoantibodies and total IgG. Remarkably, these mice also exhibited reduced levels of proinflammatorycytokines, including IFN-Interferon-α (IFN-α, Interleukin-1β (Il-1
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, M R
1999-01-01
The aim of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability enhancement by different pH values, different osmolality values or bile salts. For this purpose, the increase in the apparent permeability (P...
International Nuclear Information System (INIS)
Peng Qian; Hou Faju; Ge Xiaoxia; Jiang Chongqiu; Gong Shubo
2005-01-01
A new spectrofluorimetric method was developed for the determination of trace amount of nicotinamide adenine dinucleotide phosphate (NADP). Using europium (Eu 3+ )-tetracycline (TC) complex as a fluorescent probe, in the buffer solution of pH 7.60. NADP can remarkably enhance the fluorescence intensity of the Eu 3+ -TC complex at λ = 612 nm and the enhanced fluorescence intensity of Eu 3+ ion is in proportion to the concentration of NADP. Optimum conditions for the determination of NADP were also investigated. The dynamic range for the determination of NADP is 4.4 x 10 -7 to 2.2 x 10 -6 mol l -1 with detection limit of 6.9 x 10 -8 mol l -1 . This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of NADP in synthetic water samples and in serum samples. Moreover, the enhancement mechanisms of the fluorescence intensity in the Eu 3+ -TC system and the Eu 3+ -TC-NADP system have been also discussed
DEFF Research Database (Denmark)
Li, Tong; Pires, Carlota; Nielsen, Troels Tolstrup
2016-01-01
Skin fibroblasts were obtained from a 46-year-old symptomatic man carrying a M146I mutation in the presenilin 1 gene (PSEN1), responsible for causing Alzheimer's disease (AD). Induced pluripotent stem cells (iPSCs) were derived via transfection with episomal vectors carrying hOCT4, hSOX2, hKLF2, h......L-MYC, hLIN28 and shTP53 genes. M146I-iPSCs were free of genomically integrated reprogramming genes, had the specific mutation but no additional genomic aberrancies, expressed the expected pluripotency markers and displayed in vitro differentiation potential to the three germ layers. The reported M146I...
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
Heba Mohamed Abdelkader Elsayed
2016-07-26
Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...
Different photoluminescent properties of binary and ternary europium chelates doped in PMMA
International Nuclear Information System (INIS)
Liu Hongguo; Park, Seongtae; Jang, Kiwan; Zhang Wansong; Seo, Hyo-Jin; Lee, Yong-Ill
2003-01-01
Two kinds of europium-β-diketone chelates, binary Eu(DBM) 3 and ternary Eu(DBM) 3 phen were doped in poly(methyl methacrylate) (PMMA). These chelates show very different photoluminescent (PL) behaviors: the hypersensitive 5 D 0 → 7 F 2 emission bands of Eu(DBM) 3 phen change slightly with the molar ratios, while those of Eu(DBM) 3 change obviously and regularly with the molar ratios. The results of the luminescent lifetimes of 5 D 0 levels show that the binary chelate exists as two kinds of species in the doped systems, and the lifetimes and contents of each species change with the molar ratios, while the ternary chelate exists as one kind of species in the doped systems. X-ray diffraction (XRD) patterns of the binary chelate doped systems give some diffraction peaks that are different from those of pure chelate and change with the molar ratios, indicating new kinds of crystal structures formed, and consequently, the first coordination sphere of Eu 3+ ion changes; while those of the ternary chelate doped systems just show amorphous diffraction halos of the host, indicating that the ternary chelate exist in an amorphous state and disperse well in the host. The FTIR spectra of PMMA also change gradually with increasing the molar ratios of the doped two kinds of chelates, and the XRD patterns show that the amorphous halos of PMMA in the doped systems are different from those of pure PMMA and change with the molar ratios, too, suggesting the interaction between the guest and the host
Directory of Open Access Journals (Sweden)
Xing He
2016-11-01
Full Text Available Schistosomiasis is a chronic disease caused by the parasite of the Schistosoma genus and is characterized by egg-induced hepatic granulomas and fibrosis. Macrophages play a central role in schistosomiasis with several studies highlighting their differentiation into M2 cells involved in the survival of infected mice through limitation of immunopathology. However, little is known regarding the mechanisms of regulating macrophage differentiation. Here, we showed that the early stage of infection by Schistosoma japonicum induced expression of type 1 T-helper-cell (Th1 cytokine, interferon-γ (IFN-γ, leading to increase in M1 cells. However, the presence of liver-trapped eggs induced the expression of Th2 cytokines including interleukin-4 (IL-4, IL-10, and IL-13 that upregulated the transcription of miR-146b by activating signal transducer and activator of transcription 3/6 (STAT3/6 that bind to the promoter of the pre-miR-146b gene. We found that the miR-146a/b was significantly upregulated in macrophages during the progression of hepatic schistosomiasis. The elevated miR-146a/b inhibited the IFN-γ-induced differentiation of macrophages to M1 cells through targeting STAT1. Our data indicate the protective roles of miR-146a/b in hepatic schistosomiasis through regulating the differentiation of macrophages into M2 cells.
29 CFR 780.146 - Importance of relationship of the practice to farming generally.
2010-07-01
... to include typical factory workers or industrial operations, and the sponsors of the bill made it clear that the erection and operation on a farm by a farmer of a factory, even one using raw materials... in Conjunction Withâ the Farming Operations § 780.146 Importance of relationship of the practice to...
Owens, Constance; Fontenot, Ross S.; Bhat, Kamala N.; Aggarwal, Mohan D.
2014-03-01
A triboluminescent (TL) material is one that emits light upon pressure, impact, friction, or mechanical shock. TL materials are desirable for investigation because they have the potential to be used as the active element for smart impact sensors. While the material europium dibenzoylmethide triethylammonium (EuD4TEA) produces a TL emission yield that can be observed by the naked eye, it is still not sufficiently bright for use in smart sensor devices. Previous studies have shown that additional materials can be combined with EuD4TEA in order to improve the TL emission yield. In this paper, we discuss the effects of doping on EuD4TEA at different concentrations with a variety of materials on the TL emission yield and decay times. The dopants that were used in this study were nicotine, dibutyl phosphate (DBP), and magnesium. We also discuss both the effects of pH on EuD4TEA, and the doping effects on impact energy. For testing triboluminescent properties, we use a custom-built drop tower that generates triboluminescence by fracturing compounds through impact. Collected data is analyzed using specially written LabVIEW programs.
International Nuclear Information System (INIS)
Finck, N.
2006-10-01
Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)
Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes.
Taha, Mohamed; Khan, Imran; Coutinho, João A P
2016-04-01
With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Fujio, Yuki; Xu, Chao-Nan; Terasaki, Nao; Ueno, Naohiro
2014-01-01
The influence of an organic solvent treatment on elasticoluminescent (ELS) characteristics of mechanoluminescent (ML) sensor using the composite film consisting of an ELS material and epoxy resin was investigated. We used strontium aluminate doped with a small amount of europium (SrAl 2 O 4 :Eu, SAOE) as an ELS material in this study. After evaluating the ELS characteristics of the fabricated ML sensors using SAOE treated with/without various organic solvents, SAOE treated with methanol and ethanol showed lower ELS intensities than that of untreated SAOE. In contrast, the ELS response curves against strain for the ML sensors using SAOE treated with acetone and toluene, overlapped with that of untreated SAOE. From the characterization of SAOE treated with alcohols, such as methanol and ethanol, we can hypothesize that poor ELS characteristics is due to the degradation of the SAOE grain surfaces by the hydrolyze reaction of SAOE with hydroxyl group of alcohol. Thus, on the basis of the obtained results, we can conclude that the selection of organic solvent used in the preparation of SAOE film is of considerable importance in the development of ML sensor with a highly-reliable ELS characteristic. -- Highlights: • Influence of organic solution treatment on the sensing characteristics of a mechanoluminescent (ML) sensor using SrAl 2 O 4 :Eu has been investigated. • An alcohol treatment of SAOE powder has considerable effect on its ML characteristic. • There is almost no influence of acetone and toluene treatments on ML characteristics
EUROPIUM ION INFLUENCE ON THE FORMATION OF Ag-NANOPARTICLES IN FLUORINE PHOSPHATE GLASSES
Directory of Open Access Journals (Sweden)
R. O. Pysh'ev
2015-05-01
Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.
45 CFR 146.136 - Parity in mental health and substance use disorder benefits.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Parity in mental health and substance use disorder... Benefits § 146.136 Parity in mental health and substance use disorder benefits. (a) Meaning of terms. For... benefits and mental health or substance use disorder benefits must comply with paragraph (b)(2), (b)(3), or...
International Nuclear Information System (INIS)
Busch, M.R.; Mace, J.E.; Ho, N.T.; Ho, Chien
1991-01-01
Assessment of the roles of the carboxyl-terminal β146 histidyl residues in the alkaline Bohr effect in human and normal adult hemoglobin by high-resolution proton nuclear magnetic resonance spectroscopy requires assignment of the resonances corresponding to these residues. By a careful spectroscopic study of human normal adult hemoglobin, enzymatically prepared des(His146β)-hemoglobin, and the mutant hemoglobins Cowtown (β146His → Leu) and York (β146His → Pro), the authors have resolved some of these conflicting results. By a close incremental variation of pH over a wide range in chloride-free 0.1 M N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid buffer, a single resonance has been found to be consistently missing in the proton nuclear magnetic resonance spectra of these hemoglobin variants. The results indicate that the contribution of the β146 histidyl residues is 0.52 H + /hemoglobin tetramer at pH 7.6, markedly less than 0.8 H + /hemoglobin tetramer estimated by study of the mutant hemoglobin Cowtown (β146His → Leu) by Shih and Perutz. They have found that at least two histidyl residues in the carbonmonoxy form of this mutant have pK values that are perturbed, and they suggest that these pK differences may in part account for this discrepancy. The results show that the pK values of β146 histidyl residues in the carbonmonoxy form of hemoglobin are substantially affected by the presence of chloride and other anions in the solvent, and thus, the contribution of this amino acid residue to the alkaline Bohr effect can be shown to vary widely in magnitude, depending on the solvent composition. These results demonstrate that the detailed molecular mechanisms of the alkaline Bohr effect are not unique but are affected both by the hemoglobin structure and by the interactions with the solvent components in which the hemoglobin molecule resides
Directory of Open Access Journals (Sweden)
Lili Cui
Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.
Neutral V production with 14.6 x A GeV/c silicon beams
International Nuclear Information System (INIS)
Eiseman, S.E.; Etkin, A.; Foley, K.J.; Hackenburg, R.W.; Longacre, R.S.; Love, W.A.; Morris, T.W.; Platner, E.D.; Saulys, A.C.; Lindenbaum, S.J.; Chan, C.S.; Kramer, M.A.; Zhao, K.; Hallman, T.J.; Madansky, L.; Bonner, B.E.; Buchanan, J.A.; Chiou, C.N.; Clement, J.M.; Corcoran, M.D.; Kruk, J.W.; Mutchler, G.S.; Nessi-Tedaldi, F.; Nessi, M.; Roberts, J.B.
1990-01-01
We present the results of a measurement of neutral V production with 14.6xA GeV/c Si beams on Au and Cu targets. The Λ and K s 0 yields were measured as a function of negative particle multiplicity. Effective temperatures were determined from an exponential fit to the transverse mass distributions. (orig.)
Directory of Open Access Journals (Sweden)
Lu Liu
2016-01-01
Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.
Wang, Xiaofang; Yuan, Taixian; Yuan, Jun; Su, Yufeng; Sun, Xiaoyu; Wu, Jingwen; Zhang, Hong; Min, Xun; Zhang, Xuemei; Yin, Yibing
2018-03-01
The fusion protein DnaJ-ΔA146Ply could induce cross-protective immunity against pneumococcal infection via mucosal and subcutaneous immunization in mice in the absence of additional adjuvants. DnaJ and Ply are both Toll-like receptor 4 (TLR4) but not TLR2 ligands. However, we found that TLR2 -/- mice immunized subcutaneously with DnaJ-ΔA146Ply showed significantly lower survival rates and higher bacterial loads in nasal washes than did wild-type (WT) mice after being challenged with pneumococcal strain D39 or 19F. The gamma interferon (IFN-γ) level in splenocytes decreased in TLR2 -/- mice, indicating that Th1 immunity elicited by DnaJ-ΔA146Ply was impaired in these mice. We explored the mechanism of protective immunity conferred by DnaJ-ΔA146Ply and the role of TLR2 in this process. DnaJ-ΔA146Ply effectively promoted dendritic cell (DC) maturation via TLR4 but not the TLR2 signaling pathway. In a DnaJ-ΔA146Ply-treated DC and naive CD4 + T cell coculture system, the deficiency of TLR2 in DCs resulted in a significant decline of IFN-γ production and Th1 subset differentiation. The same effect was observed in adoptive-transfer experiments. In addition, TLR2 -/- DCs showed remarkably lower levels of the Th1-polarizing cytokine IL-12p70 than did WT DCs, suggesting that TLR2 was indispensable for DnaJ-ΔA146Ply-induced IL-12 production and Th1 proliferation. Thus, our findings illustrate that dendritic cell expression of TLR2 is essential for optimal Th1 immune response against pneumococci in mice immunized subcutaneously with DnaJ-ΔA146Ply. Copyright © 2018 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Burnham Steven
2017-01-01
Full Text Available Neutron activation analysis is widely used for identification of elements and their quantities even in trace amounts in the samples of almost any type. The challenges in detecting trace amounts of particular elements are often associated with the neutron flux produced at the research reactors. Low-flux neutron activation analysis usually presents the biggest challenge when analyzing trace quantities of elements with lower magnitude of radiative capture cross-sections. In this paper, we present the methodology and the quantified uncertainties associated with the detection of trace amounts of cobalt and europium, using as an example concrete aggregates. Recent growing interest is in improving structural concrete (increasing its strength but reducing its activation in nuclear power plant environments. Aside from buildings, structural concrete is also used as a biological shield in nuclear power plant that become radioactive after exposure to neutron flux. Due to radiative capture interactions, artificial radionuclides are generated to high enough concentrations that classify concrete as low-level radioactive waste at the time of the plant's decommissioning. Disposal of this concrete adds to the expense of nuclear power plant financing and its construction. Three radionuclides, 60Co, 152Eu, and 154Eu, account for 99 % of total residual radioactivity of nuclear power plant decommissioned concrete. IAEA document RS-G-1.7, Application of the Concepts of Exclusion, Exemption, and Clearance, specifies clearance levels of radionuclides specific activities: a specific activity lower than 0.1 Bqg-1 for 60Co and 152Eu, and 154Eu allows for a concrete to be recycled after decommissioning of the nuclear power plant. Therefore, low-flux neutron activation analysis is used to test the detection limits of trace elements in samples of cement, coarse, and fine concrete aggregates. These samples are irradiated at the University of Utah's 100 kW TRIGA Reactor at
MiR-146a regulates PM1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells.
Liu, Limin; Wan, Chong; Zhang, Wei; Guan, Longfei; Tian, Guoxiong; Zhang, Fang; Ding, Wenjun
2018-04-18
Exposure to particulate matter (PM) leads to kinds of cardiopulmonary diseases, such as asthma, COPD, arrhythmias, lung cancer, etc., which are related to PM-induced inflammation. We have found that PM 2.5 (aerodynamics diameter <2.5 µm) exposure induces inflammatory response both in vivo and in vitro. Since the toxicity of PM is tightly associated with its size and components, PM 1 (aerodynamics diameter <1.0 µm) is supposed to be more toxic than PM 2.5 . However, the mechanism of PM 1 -induced inflammation is not clear. Recently, emerging evidences prove that microRNAs play a vital role in regulating inflammation. Therefore, we studied the regulation of miR-146a in PM 1 -induced inflammation in human lung bronchial epithelial BEAS-2B cells. The results show that PM 1 induces the increase of IL-6 and IL-8 in BEAS-2B cells and up-regulates the miR-146a expression by activating NF-κB signaling pathway. Overexpressed miR-146a prevents the nuclear translocation of p65 through inhibiting the IRAK1/TRAF6 expression, and downregulates the expression of IL-6 and IL-8. Taken together, these results demonstrate that miR-146a can negatively feedback regulate PM 1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells. © 2018 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Finck, N
2006-10-15
Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)
Frawley, Andrew T.; Linford, Holly V.; Starck, Matthieu; Pal, Robert
2017-01-01
The selective mitochondrial localisation of the Λ enantiomer of three different emissive europium(iii) complexes in NIH 3T3 and MCF7 cells contrasts with the behaviour of the Δ enantiomer, for which a predominant lysosomal localisation was observed by confocal microscopy. In each case, cell uptake occurs via macropinocytosis. PMID:29675151
Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi
2011-08-01
We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.
Search for hyperdeformation in 146Gd using the microball and gammasphere
International Nuclear Information System (INIS)
Hua, P.F.; LaFosse, D.; Korolija, M.; Sarantites, D.G.; Baktash, C.; Cross, C.; Cederwall, B.; Fallon, P.; Lee, I.Y.; Machiavelli, A.
1994-01-01
Results from the first attempt to observe hyperdeformation in 146 Gd by the 100 Mo( 51 V, p4n) reaction are presented. The γ-ray spectra were recorded with Gammasphere. The Microball was used to select protons with an efficiency of 90%. A total of 2 x 10 9 proton selected triple events were obtained. The pxn channels comprised ∼25% of the total events. The proton gating decreased the background from competing xn, αxn and fission by a factor of 4
DEFF Research Database (Denmark)
Crone, Stephanie Geisler; Jacobsen, Anders; Federspiel, Birgitte
2012-01-01
Gastric cancer is the second most common cause of cancer-related death in the world. Inflammatory signals originating from gastric cancer cells are important for recruiting inflammatory cells and regulation of metastasis of gastric cancer. Several microRNAs (miRNA) have been shown to be involved...... in development and progression of gastric cancer. miRNA-146a (miR-146a) is a modulator of inflammatory signals, but little is known about its importance in gastric cancer. We therefore wanted to identify targets of miR-146a in gastric cancer and examine its biological roles....
Measurement and Evaluation of the Activation Resonance Integral of 146Nd, 148Nd and 150Nd
International Nuclear Information System (INIS)
Ricabarra, M. D.; Turjanski, R.; Ricabarra, G. H.
2012-01-01
Values of the ratio of the reduced activation resonance integral to the thermal cross section, I'/σ 0 of 146 Nd, 148 Nd and 150 Nd were determined relative to gold by measuring cadmium ratios. A lithium-drifted germanium gamma ray spectrometer was used to resolve the activities of the irradiated samples. The results are for 146 Nd I'/σ 0 = 1.42±0.1 0 and with an assumed σ 0 = 1.4 barn, I' = 1 .99±0.20; for 148 Nd I'/ σ 0 = 4.22±0.1 4 and with an assumed σ 0 = 2.5 barn, I' = 10.5±0. 9 barn, and for 150 Nd I'/σ 0 = 13.7±0. 8 and with an assumed σ 0 = 1.2 barn, I' = 16.4±2.8. The resolved and unresolved epithermal integrals of 146 Nd, 148 Nd and 150 Nd were calculated. Values of the spectral correction factor were also calculated, so the resonance integral could be obtained from the epithermal integral data measured in our reactor spectrum in this experiment. Epithermal integral and spectral correction factors are listed in the text. The most important result of this investigation is that the 148 Nd activation reduced resonance integral is about half of the previously recommended value and consequently the radiative width for 148 Nd is also about half of the previously accepted value. (author)
Sparkle/PM3 for the modeling of europium(III), gadolinium(III), and terbium(III) complexes
International Nuclear Information System (INIS)
Freire, Ricardo O.; Rocha, Gerd B.; Simas, Alfredo M.
2009-01-01
The Sparkle/PM3 model is extended to europium(III), gadolinium(III), and terbium(III) complexes. The validation procedure was carried out using only high quality crystallographic structures, for a total of ninety-six Eu(III) complexes, seventy Gd(III) complexes, and forty-two Tb(III) complexes. The Sparkle/PM3 unsigned mean error, for all interatomic distances between the trivalent lanthanide ion and the ligand atoms of the first sphere of coordination, is: 0.080 A for Eu(III); 0.063 A for Gd(III); and 0.070 A for Tb(III). These figures are similar to the Sparkle/AM1 ones of 0.082 A, 0.061 A, and 0.068 A respectively, indicating they are all comparable parameterizations. Moreover, their accuracy is similar to what can be obtained by present-day ab initio effective core potential full geometry optimization calculations on such lanthanide complexes. Finally, we report a preliminary attempt to show that Sparkle/PM3 geometry predictions are reliable. For one of the Eu(III) complexes, BAFZEO, we created hundreds of different input geometries by randomly varying the distances and angles of the ligands to the central Eu(III) ion, which were all subsequently fully optimized. A significant trend was unveiled, indicating that more accurate local minima geometries cluster at lower total energies, thus reinforcing the validity of sparkle model calculations. (author)
Jiménez, G. Lesly; Reyes-Rodríguez, J. L.; Padilla, Isela; Alarcón-Flores, G.; Falcony, C.
2018-02-01
A highly luminescent europium complex obtained with two different ligands, succinimide (SI) and 2-thenoyltrifluoroacetone (TTA) , was synthetized with different TTA concentrations. The photoluminescence (PL) emission from these materials corresponds to the characteristic inter-electronic energy level transitions of the Eu3+ ions. However, the excitation spectrum is strongly dependent on the presence of TTA, having an optimum response when 0.75 mmol of this compound is added to the EuL3(H2O)3 complex. The quantum yield obtained by these powders were around 72 % ± 1.7 % indicating an optimum sensitization of these complex. The EuL3 TTA complex with the best PL properties was embedded in a styrene butadiene copolymer (SBC) film, produced by the drop casting method, obtaining similar PL behavior at different concentrations, the highest intensity was observed at 1.2% (w/v) of EuL3 TTA complex and the quantum yield of these composite films was 60.5 % ± 2 % . These films were exposed to continuous UV irradiation and after 141 h no photo-bleaching effect was observed in contrast with the EuL3 TTA complex that exhibited a noticeable photoluminescence intensity degradation at much shorter exposure times. Both the Eu-complexes and the composite films were characterized by FT-IR, XRD, SEM and fluorescence spectroscopy.
International Nuclear Information System (INIS)
Caires, A.C.F.
1985-01-01
A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt
Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A
2015-09-02
Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Maarten Hulsmans
Full Text Available BACKGROUND: Low adiponectin, a well-recognized antidiabetic adipokine, has been associated with obesity-related inflammation, oxidative stress and insulin resistance. Globular adiponectin is an important regulator of the interleukin-1 receptor-associated kinase (IRAK/NFκB pathway in monocytes of obese subjects. It protects against inflammation and oxidative stress by inducing IRAK3. microRNA (miR-146b-5p inhibits NFκB-mediated inflammation by targeted repression of IRAK1 and TNF receptor-associated factor-6 (TRAF6. Therefore, we measured the expression of miR-146b-5p in monocytes of obese subjects. Because it was low we determined the involvement of this miR in the anti-inflammatory, antioxidative and insulin signaling action of globular adiponectin. METHODS: miR-146b-5p expression in monocytes of obese subjects was determined by qRT-PCR. The effect of miR-146b-5p silencing on molecular markers of inflammation, oxidative stress and insulin signaling and the association with globular adiponectin was assessed in human THP-1 monocytes. RESULTS: miR-146b-5p was downregulated in monocytes of obese persons. Low globular adiponectin decreased miR-146b-5p and IRAK3 in THP-1 monocytes, associated with increased mitochondrial reactive oxygen species (ROS. Intracellular ROS and insulin receptor substrate-1 (IRS1 protein were unchanged. Silencing of miR-146b-5p with an antisense inhibitor resulted in increased expression of IRAK1 and TRAF6 leading to more NFκB p65 DNA binding activity and TNFα. As a response IRAK3 and IRS1 protein increased. Mitochondrial and intracellular ROS production did not increase despite more inflammation. In addition, exposure of miR-146b-5p-depleted THP-1 monocytes to high levels of globular adiponectin resulted in an increased production of TNFα and intracellular ROS. Still, they did not lose their potential to increase IRAK3 and IRS1 protein and to decrease mitochondrial ROS. CONCLUSION: miR-146b-5p, decreased in monocytes
42 CFR 84.146 - Method of measuring the power and torque required to operate blowers.
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Method of measuring the power and torque required... RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.146 Method of measuring the power and torque.... These are used to facilitate timing. To determine the torque or horsepower required to operate the...
International Nuclear Information System (INIS)
Lisiecki, Radosław
2013-01-01
The KGd 2 F 7 :Tb and KGd 2 F 7 :Tb,Eu samples were obtained using a solid state reaction. Excitation spectra and emission spectra are reported and analyzed within the VUV–UV–vis spectral range. The intense green luminescence is observed in the KGd 2 F 7 :Tb while the combined emission of terbium and europium in the KGd 2 F 7 :Tb,Eu covers substantially the region of white light. The materials under study can be effectively excited making use of intense f–d transitions of Tb 3+ in the VUV–UV region. Experimental lifetimes of luminescent levels have been measured and discussed. It was found that the considerable energy transfer from Tb 3+ to Eu 3+ occurs. -- Highlights: • The prospective green and white emitting phosphors. • The effective VUV and UV–vis excitation process. • The considerable energy transfer among optically active ions. • The influence of (Tb, Eu) co-doping on relaxation dynamic of excited states
Synthesis, characterization, and properties of reduced europium molybdates and tungstates
Energy Technology Data Exchange (ETDEWEB)
Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: zurloye@mailbox.sc.edu [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)
2015-09-15
Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.
Ho, Wen-Jeng; You, Bang-Jin; Liu, Jheng-Jie; Bai, Wen-Bin; Syu, Hong-Jhang; Lin, Ching-Fuh
2018-05-18
This paper presents a scheme for the enhancement of silicon solar cells in terms of luminescent emission band and photovoltaic performance. The proposed devices are coated with an luminescent down-shifting (LDS) layer comprising three species of europium (Eu)-doped phosphors mixed within a silicate film (SiO₂) using a spin-on film deposition. The three species of phosphor were mixed at ratios of 0.5:1:1.5, 1:1:1, or 1.5:1:0.5 in weight percentage (wt %). The total quantity of Eu-doped phosphors in the silicate solution was fixed at 3 wt %. The emission wavelengths of the Eu-doped phosphors were as follows: 518 nm (specie-A), 551 nm (specie-B), and 609 nm (specie-C). We examined the extended luminescent emission bands via photoluminescence measurements at room temperature. Closely matching the luminescent emission band to the high responsivity band of the silicon semiconductor resulted in good photovoltaic performance. Impressive improvements in efficiency were observed in all three samples: 0.5:1:1.5 (20.43%), 1:1:1 (19.67%), 1.5:1:0.5 (16.81%), compared to the control with a layer of pure SiO₂ (13.80%).
Europium-labeled epidermal growth factor and neurotensin: novel probes for receptor-binding studies.
Mazor, Ohad; Hillairet de Boisferon, Marc; Lombet, Alain; Gruaz-Guyon, Anne; Gayer, Batya; Skrzydelsky, Delphine; Kohen, Fortune; Forgez, Patricia; Scherz, Avigdor; Rostene, William; Salomon, Yoram
2002-02-01
We investigated the possibility of labeling two biologically active peptides, epidermal growth factor (EGF) and neurotensin (NT), with europium (Eu)-diethylenetriaminepentaacetic acid. More specifically, we tested them as probes in studying receptor binding using time-resolved fluorescence of Eu3+. The relatively simple synthesis yields ligands with acceptable binding characteristics similar to isotopically labeled derivatives. The binding affinity (Kd) of labeled Eu-EGF to human A431 epidermal carcinoid cells was 3.6 +/- 1.2 nM, similar to the reported Kd values of EGF, whereas the Kd of Eu-NT to human HT29 colon cancer cells (7.4 +/- 0.5 nM) or to Chinese hamster ovary (CHO) cells transfected with the high-affinity NT receptor (CHO-NT1) were about 10-fold higher than the Kd values of NT. The bioactivity of the Eu-labeled EGF as determined by stimulation of cultured murine D1 hematopoietic cell proliferation was nearly the same as that obtained with native EGF. The maximal stimulation of Ca2+ influx with NT and Eu-NT in CHO-NT1 cells was similar, but the respective K0.5 values were 20 pM and 1 nM, corresponding to differences in the binding affinities previously described. The results of these studies indicate that Eu labeling of peptide hormones and growth factor molecules ranging from 10(3) to 10(5) Da can be conveniently accomplished. Importantly, the Eu-labeled products are stable for approximately 2 years and are completely safe for laboratory use compared to the biohazardous radioligands. Thus, Eu-labeled peptides present an attractive alternative for commonly used radiolabeled ligands in biological studies in general and in receptor assays in particular.
Size-dependent cytotoxicity of europium doped NaYF4 nanoparticles in endothelial cells
International Nuclear Information System (INIS)
Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang; Zhang, Jinchao
2014-01-01
Lanthanide-doped sodium yttrium fluoride (NaYF 4 ) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF 4 (NaYF 4 :Eu 3+ ) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF 4 :Eu 3+ nanoparticles with three diameters have been synthesized. • NaYF 4 :Eu 3+ nanoparticles could be uptaken by endothelial cells (ECs). • NaYF 4 :Eu 3+ nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF 4 :Eu 3+ nanoparticles may be important to their toxicology effect
DEFF Research Database (Denmark)
Portero, Ana; Remuñán-López, Carmen; Nielsen, Hanne Mørck
2002-01-01
To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used.......To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used....
International Nuclear Information System (INIS)
Liu, H.-G.; Park, Seongtae; Jang, Kiwan; Feng, X.-S.; Kim, Changdae; Seo, H.-J.; Lee, Y.-I.
2004-01-01
Three kinds of europium β-diketonates Eu(DBM) 3 , Eu(BA) 3 and Eu(TTA) 3 (DBM: Dibenzoylmethane; BA: 1-Benzoylacetone; TTA: Thenoyltrifluoroacetone) were doped in poly(methyl methacrylate) (PMMA) matrix. The doped systems were studied by using photoluminescent (PL) spectroscopy, emission decay experiments and X-ray diffractometry. Eu(III) ions in the doped Eu(DBM) 3 /PMMA systems have two distinct symmetric sites and the emission band changes greatly with the compositions. Eu(III) in the Eu(BA) 3 /PMMA systems gives only one symmetric site in the doped systems and the emission band changes slightly with the compositions. Although two distinct symmetric sites of Eu(III) can be distinguished in the doped systems of Eu(TTA) 3 /PMMA, the two sites have similar 5 D 0 lifetimes and the luminescent spectra almost do not change with the compositions. XRD reveals that crystallites were formed in the doped Eu(DBM) 3 /PMMA systems that have different crystalline structure from that of the chelate, and Eu(BA) 3 and Eu(TTA) 3 exist in amorphous state in the doped systems. The difference between the PL properties and structures of the doped systems for the three kinds of chelates should be attributed to different interactions between the chelate molecules and between the chelate and PMMA
International Nuclear Information System (INIS)
Paganini, Paula P.; Felinto, Maria Claudia F.C.; Brito, Hermi F.
2011-01-01
Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)
Energy Technology Data Exchange (ETDEWEB)
Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f
2011-07-01
Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)
Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J
2014-04-21
Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Gao, Yingning; Ma, Pan; Chen, Yanli; Zhang, Ying; Bian, Yongzhong; Li, Xiyou; Jiang, Jianzhuang; Ma, Changqin
2009-01-05
Two amphiphilic heteroleptic tris(phthalocyaninato) europium complexes with hydrophilic crown ether heads and hydrophobic octyloxy tails [Pc(mCn)(4)]Eu[Pc(mCn)(4)]Eu[Pc(OC(8)H(17))(8)] [m = 12, n = 4, H(2)Pc(12C4)(4) = 2,3,9,10,16,17,23,24-tetrakis(12-crown-4)phthalocyanine; m = 18, n = 6, H(2)Pc(18C6)(4) = 2,3,9,10,16,17,23,24-tetrakis(18-crown-6)phthalocyanine; H(2)Pc(OC(8)H(17))(8) = 2,3,9,10,16,17,23,24-octakis(octyloxy)phthalocyanine] (1, 2) were designed and prepared from the reaction between homoleptic bis(phthalocyaninato) europium compound [Pc(mCn)(4)]Eu[Pc(mCn)(4)] (m = 12, n = 4; m = 18, n = 6) and metal-free H(2)Pc(OC(8)H(17))(8) in the presence of Eu(acac)(3).H(2)O (Hacac = acetylacetone) in boiling 1,2,4-trichlorobenzene. These novel sandwich triple-decker complexes were characterized by a wide range of spectroscopic methods and electrochemically studied. With the help of the Langmuir-Blodgett technique, these typical amphiphilic triple-decker complexes were fabricated into organic field effect transistors (OFET) with top contact configuration on bare SiO(2)/Si substrate, hexamethyldisilazane-treated SiO(2)/Si substrate, and octadecyltrichlorosilane (OTS)-treated SiO(2)/Si substrate, respectively. The device performance is revealed to be dependent on the species of crown ether substituents and substrate surface treatment. OFETs fabricated from the triple decker with 12-crown-4 hydrophilic substituents, 1, allow the hole transfer in the direction parallel to the aromatic phthalocyanine rings. In contrast, the devices of a triple-decker compound containing 18-crown-6 as hydrophilic heads, 2, transfer holes in a direction along the long axis of the assembly composed of face-to-face aggregated triple-decker molecules, revealing the effect of molecular structure, specifically the crown ether substituents on the film structure and OFET functional properties. The carrier mobility for hole as high as 0.33 cm(2) V(-1) s(-1) and current modulation of 7.91 x 10
Energy Technology Data Exchange (ETDEWEB)
Dehelean, A. [National Research and Development Institute for Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Rada, S. [Technical University of Cluj-Napoca (Romania); Popa, A.; Suciu, R.C. [National Research and Development Institute for Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Culea, E., E-mail: eugen.culea@phys.utcluj.ro [Technical University of Cluj-Napoca (Romania)
2016-09-15
Raman, photoluminescence and EPR spectroscopies were used to characterize some xEu{sub 2}O{sub 3}·(100−x)[4TeO{sub 2}·PbO{sub 2}] glasses with x=0–50 mol% obtained by melt quenching technique. Raman spectra of these glasses were interpreted in terms of vibration modes of deformed Te–O–Te linkages due to the intercalation of [PbO{sub n}] and [EuO{sub n}] entities produced by addition of Eu{sub 2}O{sub 3} to the host lead–tellurite glass. Photoluminescence spectra of xEu{sub 2}O{sub 3}·(100−x)[4TeO{sub 2}·PbO{sub 2}] glasses reveal the presence of Pb{sup 2+}, Eu{sup 2+} and Eu{sup 3+} ions. EPR data confirm the presence of Eu{sup 2+} ions in the europium–lead–tellurite glassy network and offer information about the compositional evolution of the Eu{sup 2+} ions local environment and Eu{sup 3+}↔Eu{sup 2+} redox process. PL and EPR data show that the decrease of the Eu{sup 2+} ions luminescence intensity for the x≥40 mol% Eu{sub 2}O{sub 3} region is not due to the clusterization of europium ions but is due the decrease of the amount of Eu{sup 2+} ions as result of changes in the Eu{sup 3+}→Eu{sup 2+} redox equilibrium.
Doping β-Ga2O3 with europium: influence of the implantation and annealing temperature
Peres, M.; Lorenz, K.; Alves, E.; Nogales, E.; Méndez, B.; Biquard, X.; Daudin, B.; Víllora, E. G.; Shimamura, K.
2017-08-01
β-Ga2O3 bulk single crystals were doped by ion implantation at temperatures from room temperature to 1000 °C, using a 300 keV Europium beam with a fluence of 1 × 1015 at cm-2. Rising the implantation temperature from room temperature to 400-600 °C resulted in a significant increase of the substitutional Eu fraction and of the number of Eu ions in the 3+ charge state as well as in a considerable decrease of implantation damage. Eu is found in both charge states 2+ and 3+ and their relative fractions are critically dependent on the implantation and annealing temperature, suggesting that defects play an important role in stabilizing one of the charge states. The damage recovery during post-implant annealing is a complex process and typically defect levels first increase for intermediate annealing temperatures and a significant recovery of the crystal only starts around 1000 °C. Cathodoluminescence spectra are dominated by the sharp Eu3+ related intra-ionic 4f transition lines in the red spectral region. They show a strong increase of the emission intensity with increasing annealing temperature, in particular for samples implanted at elevated temperature, indicating the optical activation of Eu3+ ions. However, no direct correlation of emission intensity and Eu3+ fraction was found, again pointing to the important role of defects on the physical properties of these luminescent materials.
International Nuclear Information System (INIS)
Noro, Junji; Sekine, Tatsuya.
1992-01-01
The solvent extraction of europium (III) in 0.1 mol dm -3 sodium nitrate solutions with benzoylacetone (Hbza) or benzoyltrifluoroacetone (Hbfa) in carbon tetrachloride was measured in the absence and presence or tetrabutylammonium ions (tba + ). Although extraction with Hbfa occurred at lower pH than with Hbza, the extraction measured as a function of the β-diketonate ion concentration in the aqueous phase was rather similar. It was also found that extraction with Hbfa was greatly enhanced by the addition of tba + , the effect, however, was negligible with Hbza. The data were analyzed from the stand point that the neutral metal chelate, Eu(bfa) 3 , was extracted into the organic phase and associated with ion-pairs of the reagents, bfa - tba + , in this phase. It was also found that though extraction of ion-pairs of bfa - tba + occurred, that of bza - tba + was negligible. Thus, the reason for the negligible extraction of the ternary complex, Eu (bza) 4 - tba + , was explained in terms of the negligible extraction of the bza - tba + , which might associate with Eu(bza) 3 in the organic phase. (author)
Energy Technology Data Exchange (ETDEWEB)
Lin, Liping [College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, 350002 (China); Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); Zhao, Li; Zhao, Tingting [Xiamen Huaxia College, Xiamen, 361024 (China); Chen, Xi, E-mail: xichen@xmu.edu.cn [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, 361005 (China)
2015-09-03
In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel “off-on” fluorescent probe for the label-free determination of Cu{sup 2+} and L-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu{sup 2+} owing to the coordination reaction between Cu{sup 2+} and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu{sup 2+} to L-Cys via the Cu–S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1–10 μM for Cu{sup 2+} and 0.5–50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu{sup 2+} and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu{sup 2+} and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. - Highlights: • The europium-decorated graphene quantum dots (Eu-GQDs) have been successfully prepared. • Various characterizations results proved that Eu atoms were successfully introduced into graphene quantum dots. • The introduced Eu atoms changed the electron density and surface chemical activities of Eu-GQDs. • Eu-GQDs were used as an “off-on” fluorescent probe for Cu{sup 2+} and L-cysteine detection
Directory of Open Access Journals (Sweden)
Dimitrios Kouroupis
2014-08-01
Full Text Available Adult stem cells are characterised by longer telomeres compared to mature cells from the same tissue. In this study, candidate CD146+ umbilical cord (UC mesenchymal stem cells (MSCs were purified by cell sorting from UC tissue digests and their telomere lengths were measured in comparison to donor-matched CD146-negative fraction. UC tissue fragments were enzymatically treated with collagenase and the cells were used for cell sorting, colony-forming fibroblast (CFU-F assay or for long-term MSC cultivation. Telomere lengths were measured by qPCR in both culture-expanded MSCs and candidate native UC MSCs. Immunohistochemistry was undertaken to study the topography of CD146+ cells. Culture-expanded UC MSCs had a stable expression of CD73, CD90 and CD105, whereas CD146 declined in later passages which correlated with the shortening of telomeres in the same cultures. In five out of seven donors, telomeres in candidate native UC MSCs (CD45-CD235α-CD31-CD146+ were longer compared to donor-matched CD146- population (CD45-CD235α-CD31-CD146-. The frequency of CD45-CD235α-CD31-CD146+ cells measured by flow cytometry was ~1000-fold above that of CFU-Fs (means 10.4% and 0.01%, respectively. CD146+ cells were also abundant in situ having a broad topography including high levels of positivity in muscle areas in addition to vessels. Although qPCR-based telomere length analysis in sorted populations could be limited in its sensitivity, very high frequency of CD146+ cells in UC tissue suggests that CD146 expression alone is unlikely to be sufficient to identify and purify native MSCs from the UC tissue.
Comparison of inclusive particle production in 14.6 GeV/c proton-nucleus collisions with simulation
International Nuclear Information System (INIS)
Jaffe, D.E.; Lo, K.H.; Comfort, J.R.; Sivertz, M.
2006-01-01
Inclusive charged pion, kaon, proton and deuteron production in 14.6 GeV/c proton-nucleus collisions measured by BNL experiment E802 is compared with results from the GEANT3, GEANT4 and FLUKA simulation packages. The FLUKA package is found to have the best overall agreement
Particle production in Si + A and p + A collisions at 14.6 A·GeV/c
International Nuclear Information System (INIS)
Miake, Y.
1990-01-01
Particle production (π ± , K ± , p) has been measured in both Si+A and p+A collisions at 14.6 A·GeV/c. Comparisons of m t and dn/dy distributions between p+Be, p+Au and central Si+Au collisions are discussed. 8 refs., 3 figs
Directory of Open Access Journals (Sweden)
Shirin Abdolvand
2017-06-01
Full Text Available Abstract Background: The incidence of gastric cancer is different in two sexes with ratio 2 to 1 that it is more common in men. The most important biologically reason is sexual hormones between two sexes that lead to sexual dimorphism and in turn can cause a sex bias in incidence of disease between two sexes. Recently, studies have shown that microRNA is involved in sexual dimorphism in gene expression. Given the sexual dimorphism in the incidence of gastric cancer and sex hormones response elements in the regulatory regions of miR-146a and miR-148a genes, in this study, the expression of these two genes in the stomach of healthy men and women at different age groups were compared. Materials and Methods: Using endoscopy, gastric antrum tissues of 35 healthy women and 35 healthy men were collected. After RNA extraction and synthesis of cDNA, the expression of miR-146a and miR-148a genes were compared between sexes by Real time RT-PCR and data were analyzed using independent sample t and ANOVA tests. Results: There was no difference between men and women in genes expression of miR-146a and miR-148a. However, expression of miR-146a gene was significantly more in men under 45 years than men over 45 years (p= 0.017, df= 14, t= 1.47. Also, expression of miR-148a gene was significantly more in men over 45 years than men under 45 years (p=0.001, df= 12, t= 1.28. But the expression of both genes had no significant difference between women under 45 years and women over 45 years. Conclusion: Expression of miR-146a and miR-148a genes in the stomach is increased and decreased with aging in men, respectively.
Development of frequency step tunable 1 MW gyrotron at 131 to 146.5 GHz
Energy Technology Data Exchange (ETDEWEB)
Samartsev, A.; Gantenbein, G.; Dammertz, G.; Illy, S.; Kern, S.; Leonhardt, W.; Schlaich, A.; Schmid, M.; Thumm, M., E-mail: andrey.samartsev@kit.edu [Karlsruhe Institute of Technology, Association EURATOM-KIT, Karlsruhe (Germany)
2011-07-01
Effective control of power absorption in tokamaks and stellarators could be achieved by the frequency tuning of ECH and CD power delivered by high-power gyrotrons. In this report some results of the development of a frequency tunable gyrotron with fused-silica Brewster window are presented. Excitation of several modes at 1 MW power level in the range of frequencies from 131 to 146.5 GHz is achieved. (author)
Influence of natural mobile organic matter on europium retention on Bure clay rock
International Nuclear Information System (INIS)
Vu-Do, Laurence
2013-01-01
Bure clay rock (CR) was chosen as host rock for the French high and intermediate level long lived radioactive waste repository. This choice is mostly explained by the retention ability of the Callovo-Oxfordian rock (COx). Bure clay rock contains natural organic matter (OM) that could have an influence on radionuclide retention. The aim of this work is to assess the influence of natural mobile OM on the retention of Eu on clay rock. Eu was chosen as a chemical model for trivalent actinides contained in vitrified waste. Three organic molecules were studied: suberic, sorbic and tiglic acids, small organic acids identified in COx pore water. All the experiments were carried out in an environment recreating COx water (pH=7.5; I=0.1 mol/L; PCO 2 =10 -2 bar).Clay rock sample characterization showed that the sample used in this work was similar to those previously extracted from the area of interest and that it was necessary to maintain pH at 7.5 to avoid altering the clay rock. The Eu-OM system study indicated that organic acids had no influence on Eu speciation in COx water. The Eu-CR system experimental study confirmed that retention implied sorption on CR (C(Eu)≤6.10 -6 mol/L) and precipitation in COx water (C(Eu)≥6.10 -6 mol/L). Distribution coefficient Rd (quantifying sorption) was estimated at 170 ± 30 L/g. This high value is consistent with literature values obtained on clay rocks. The ternary Eu-OM-CR system study showed a slight increase of sorption in the presence of organic matter. This synergistic effect is very satisfactory in terms of storage security: the presence of small organic acids in clay rock does not question retention properties with respect to europium and trivalent actinides. (author)
Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria
2017-11-15
This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected
Directory of Open Access Journals (Sweden)
Wen-Jeng Ho
2018-05-01
Full Text Available This paper presents a scheme for the enhancement of silicon solar cells in terms of luminescent emission band and photovoltaic performance. The proposed devices are coated with an luminescent down-shifting (LDS layer comprising three species of europium (Eu-doped phosphors mixed within a silicate film (SiO2 using a spin-on film deposition. The three species of phosphor were mixed at ratios of 0.5:1:1.5, 1:1:1, or 1.5:1:0.5 in weight percentage (wt %. The total quantity of Eu-doped phosphors in the silicate solution was fixed at 3 wt %. The emission wavelengths of the Eu-doped phosphors were as follows: 518 nm (specie-A, 551 nm (specie-B, and 609 nm (specie-C. We examined the extended luminescent emission bands via photoluminescence measurements at room temperature. Closely matching the luminescent emission band to the high responsivity band of the silicon semiconductor resulted in good photovoltaic performance. Impressive improvements in efficiency were observed in all three samples: 0.5:1:1.5 (20.43%, 1:1:1 (19.67%, 1.5:1:0.5 (16.81%, compared to the control with a layer of pure SiO2 (13.80%.
International Nuclear Information System (INIS)
Li, H Harold; Yang, Deshan; Xiao, Zhiyan; Driewer, Joseph P; Han, Zhaohui; Low, Daniel A
2014-01-01
Recent research has shown that KCl:Eu 2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu 2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X-ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had been completely incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl − ) centers were the electron storage centers post x-ray irradiation and that Eu 2+ cations acted as luminescence centers in the photostimulation process. The 150 µm thick casted KCl:Eu 2+ SPF showed sub-millimeter spatial-resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu 2+ and 80% low Z polymer binder exhibited almost no energy-dependence in a 6 MV beam. KCl:Eu 2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl's intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu 2+ -based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. (paper)
Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms
International Nuclear Information System (INIS)
Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z.; Gillow, J.B.; Francis, A.J.
2004-01-01
We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K d ) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N H 2 O ) and the degree of strength of ligand field (R E/M ) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K d of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K d , indicating that an exchange with Na + on the functional groups was involved in their sorption. The ΔN H 2 O (= 9 - N H 2 O ) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R E/M for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)
Sorption behavior of europium(III) and curium(III) on the cell surfaces of microorganisms
Energy Technology Data Exchange (ETDEWEB)
Ozaki, T.; Kimura, T.; Ohnuki, T.; Yoshida, Z. [Advanced Science Research Center, Japan Atomic Energy Research Inst., Ibaraki (Japan); Gillow, J.B.; Francis, A.J. [Environmental Sciences Dept., Brookhaven National Lab., Upton, NY (United States)
2004-07-01
We investigated the association of europium(III) and curium(III) with the microorganisms Chlorella vulgaris, Bacillus subtilis, Pseudomonas fluorescens, Halomonas sp., Halobacterium salinarum, and Halobacterium halobium. We determined the kinetics and distribution coefficients (K{sub d}) for Eu(III) and Cm(III) sorption at pH 3-5 by batch experiments, and evaluated the number of water molecules in the inner-sphere (N{sub H{sub 2}O}) and the degree of strength of ligand field (R{sub E/M}) for Eu(III) by time-resolved laser-induced fluorescence spectroscopy (TRLFS). Exudates from C. vulgaris, Halomonas sp., and H. halobium had an affinity for Eu(III) and Cm(III). The log K{sub d} of Eu(III) and Cm(III) showed that their sorption was not fully due to the exchange with three protons on the functional groups on cell surfaces. The halophilic microorganisms (Halomonas sp., Halobacterium salinarum, H. halobium) showed almost no pH dependence in log K{sub d}, indicating that an exchange with Na{sup +} on the functional groups was involved in their sorption. The {delta}N{sub H{sub 2}O} (= 9 - N{sub H{sub 2}O}) for Eu(III) on C. vulgaris was 1-3, while that for the other microorganisms was over 3, demonstrating that the coordination of Eu(III) with C. vulgaris was predominantly an outer-spherical process. The R{sub E/M} for Eu(III) on halophilic microorganisms was 2.5-5, while that for non-halophilic ones was 1-2.5. This finding suggests that the coordination environment of Eu(III) on the halophilic microorganisms is more complicated than that on the other three non-halophilic ones. (orig.)
Li, Xin; Kroin, Jeffrey S; Kc, Ranjan; Gibson, Gary; Chen, Di; Corbett, Grant T; Pahan, Kalipada; Fayyaz, Sana; Kim, Jae-Sung; van Wijnen, Andre J; Suh, Joon; Kim, Su-Gwan; Im, Hee-Jeong
2013-12-01
The objective of this study was to examine whether altered expression of microRNAs in central nervous system components is pathologically linked to chronic knee joint pain in osteoarthritis. A surgical animal model for knee joint OA was generated by medial meniscus transection in rats followed by behavioral pain tests. Relationships between pathological changes in knee joint and development of chronic joint pain were examined by histology and imaging analyses. Alterations in microRNAs associated with OA-evoked pain sensation were determined in bilateral lumbar dorsal root ganglia (DRG) and the spinal dorsal horn by microRNA array followed by individual microRNA analyses. Gain- and loss-of-function studies of selected microRNAs (miR-146a and miR-183 cluster) were conducted to identify target pain mediators regulated by these selective microRNAs in glial cells. The ipsilateral hind leg displayed significantly increased hyperalgesia after 4 weeks of surgery, and sensitivity was sustained for the remainder of the 8-week experimental period (F = 341, p pain was correlated with pathological changes in the knee joints as assessed by histological and imaging analyses. MicroRNA analyses showed that miR-146a and the miR-183 cluster were markedly reduced in the sensory neurons in DRG (L4/L5) and spinal cord from animals experiencing knee joint OA pain. The downregulation of miR-146a and/or the miR-183 cluster in the central compartments (DRG and spinal cord) are closely associated with the upregulation of inflammatory pain mediators. The corroboration between decreases in these signature microRNAs and their specific target pain mediators were further confirmed by gain- and loss-of-function analyses in glia, the major cellular component of the central nervous system (CNS). MicroRNA therapy using miR-146a and the miR-183 cluster could be powerful therapeutic intervention for OA in alleviating joint pain and concomitantly regenerating peripheral knee joint cartilage. © 2013
International Nuclear Information System (INIS)
Zhou Yonghui; Zhou Liang; Wu, Jing; Li, Hong-Yan; Zheng Youxuan; You Xiaozeng; Zhang Hongjie
2010-01-01
The photoluminescence properties of one europium complex Eu(TFNB) 3 Phen (TFNB = 4,4,4-trifluoro-1-(naphthyl)-1,3-butanedione, Phen = 1,10-phenanthroline) doped in a hole-transporting material CBP (4,4'-N,N'-dicarbazole-biphenyl) films were studied. A series of organic light-emitting devices (OLEDs) using Eu(TFNB) 3 Phen as the emitter were fabricated with a multilayer structure of indium tin oxide, 250 Ω/square)/TPD (N,N'-diphenyl-N,N'-bis(3-methyllphenyl)-(1,1'-biphenyl)-4,4'-diamine, 50 nm)/Eu(TFNB) 3 phen (x): CBP (4,4'-N,N'-dicarbazole-biphenyl, 45 nm)/BCP (2,9-dimethyl-4,7-diphenyl-l,10 phenanthroline, 20 nm)/AlQ (tris(8-hydroxy-quinoline) aluminium, 30 nm)/LiF (1 nm)/Al (100 nm), where x is the weight percentage of Eu(TFNB) 3 phen doped in the CBP matrix (1-6%). A red emission at 612 nm with a half bandwidth of 3 nm, characteristic of Eu(III) ion, was observed with all devices. The device with a 3% dopant concentration shows the maximum luminance up to 1169 cd/m 2 (18 V) and the device with a 5% dopant concentration exhibits a current efficiency of 4.46 cd/A and power efficiency of 2.03 lm/W. The mechanism of the electroluminescence was also discussed.
Directory of Open Access Journals (Sweden)
Olfat Gamil Shaker
2018-05-01
Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.
Zhao, Haiyan; Su, Wuyun; Kang, Qingmei; Xing, Ze; Lin, Xue; Wu, Zhongjun
2018-01-01
Natural killer (NK) cells have exhibited promising efficacy in inhibiting cancer growth. We aimed to explorer the effect of NK cells on oxaliplatin-resistant colorectal cancer and the underlying molecular mechanism. Oxaliplatin-resistant colorectal cancer cell lines were co-cultured with NK cells to evaluate the effect on viability, proliferation, migration and invasion in vitro . Oxaliplatin-resistant colorectal cancer cells were also co-injected with NK cells into mice to establish xenograft tumor model, to assess the in vivo effect of NK cells on tumorigenesis of the oxaliplatin-resistant colorectal cancer cells. Expression of WBSCR22 gene was assessed in the oxaliplatin-resistant colorectal cancer cells following NK cell treatment to elucidate the mechanism. NK cell treatment significantly reduces growth of oxaliplatin-resistant colorectal cancer cells both in vitro and in vivo , as well as reduced WBSCR22 expression. MicroRNAs potentially targeting WBSCR22 were analyzed, and microRNA-146b-5p was found to be significantly upregulated following NK cell treatment. MicroRNA-146b-5p directly targeted WBSCR22 mRNA 3'-UTR to inhibit its expression, which was required for NK cell-induced inhibition of oxaliplatin-resistant colorectal cancer cell lines. NK cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p, both of which could serve as candidates for targeted therapy against oxaliplatin-resistant colorectal cancer.
International Nuclear Information System (INIS)
Lin Humao; Qing Caixiao; Qian Miao; Ping Xiaohong
2005-01-01
A novel europium(III) coordination polymer [Eu(Sip)(H 2 O) 5 ] n · nH 2 O · 1.5 n(Bipy) (I) (Sip is 5-sulfoisophthalate trivalent anion and Bipy is 4,4'-bipyridine) is hydrothermally synthesized and determined by the single crystal X-ray diffraction method. Polymer I crystallizes in the monoclinic system, space group C2/c with a = 30.7515(6), b = 10.9577(2), c = 17.5545(4) A, β = 112.040(1) deg, Z = 4. In I, each Eu 3+ ion is coordinated by four oxygen atoms from two carboxylate groups of two different Sip anions and five oxygen atoms from five coordinated water molecules to complete a deformed mono-cap square antiprism. Moreover, each Sip anion acts as a tetradentate ligand to connect two adjacent Eu 3+ ions through its two chelating carboxylate groups, resulting in one-dimensional linear chains. In addition, fifteen different kinds of hydrogen-bonding interactions link the chains, lattice water molecules, and free Bipy molecules to engender a complicated hydrogen-bonding network [ru
Vouraki, Sotiria; Gelasakis, Athanasios I; Alexandri, Panoraia; Boukouvala, Evridiki; Ekateriniadou, Loukia V; Banos, Georgios; Arsenos, Georgios
2018-01-01
Polymorphisms at PRNP gene locus have been associated with resistance against classical scrapie in goats. Genetic selection on this gene within appropriate breeding programs may contribute to the control of the disease. The present study characterized the genetic profile of codons 146, 211 and 222 in three dairy goat breeds in Greece. A total of 766 dairy goats from seven farms were used. Animals belonged to two indigenous Greek, Eghoria (n = 264) and Skopelos (n = 287) and a foreign breed, Damascus (n = 215). Genomic DNA was extracted from blood samples from individual animals. Polymorphisms were detected in these codons using Real-Time PCR analysis and four different Custom TaqMan® SNP Genotyping Assays. Genotypic, allelic and haplotypic frequencies were calculated based on individual animal genotypes. Chi-square tests were used to examine Hardy-Weinberg equilibrium state and compare genotypic distribution across breeds. Genetic distances among the three breeds, and between these and 30 breeds reared in other countries were estimated based on haplotypic frequencies using fixation index FST with Arlequin v3.1 software; a Neighbor-Joining tree was created using PHYLIP package v3.695. Level of statistical significance was set at P = 0.01. All scrapie resistance-associated alleles (146S, 146D, 211Q and 222K) were detected in the studied population. Significant frequency differences were observed between the indigenous Greek and Damascus breeds. Alleles 222K and 146S had the highest frequency in the two indigenous and the Damascus breed, respectively (ca. 6.0%). The studied breeds shared similar haplotypic frequencies with most South Italian and Turkish breeds but differed significantly from North-Western European, Far East and some USA goat breeds. Results suggest there is adequate variation in the PRNP gene locus to support breeding programs for enhanced scrapie resistance in goats reared in Greece. Genetic comparisons among goat breeds indicate that separate