WorldWideScience

Sample records for europium 131

  1. Fluorescent Europium Chelate Stain

    Science.gov (United States)

    Scaff, W. L.; Dyer, D. L.; Mori, K.

    1969-01-01

    The europium chelate of 4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione (thenoyl-trifluoroacetone; TTA) is firmly bound to microorganisms. It fluoresces brightly at 613 nm with activation at 340 nm. Cells may be stained with 10−3m chelate in 50% ethyl alcohol, followed by washing with 50% ethyl alcohol. Equal or better stains are produced with 10−3m aqueous europium salt, water wash, and 10−2m aqueous TTA. A noncomplexing buffer should be used to maintain the pH at 6.5 to 6.8. Images PMID:4181107

  2. Europium-155 in Debris from Nuclear Weapons

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Lippert, Jørgen Emil

    1967-01-01

    The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...... of europium-155 from weapons was estimated at 1400 atoms per 10$^{6}$ fissions, which is close to the yield of europium-155 from fast fission of uranium-238....

  3. The electrochemical synthesis of europium boride

    Directory of Open Access Journals (Sweden)

    Bukatova G.A.

    2003-01-01

    Full Text Available The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. % melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  4. The electrochemical synthesis of europium boride

    OpenAIRE

    Bukatova G.A.; Kuznetsov S.A.; Gaune-Escard M.

    2003-01-01

    The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. %) melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  5. Liposome Biodistribution via Europium Complexes.

    Science.gov (United States)

    Mignet, Nathalie; Scherman, Daniel

    2017-01-01

    The drug delivery field needs tools to follow vector biodistribution. Radioactive tracers and conventional fluorophores are widely used. We propose here to use europium complexes. Use of pulsed light source time-resolved fluorimetry takes into account the fluorescence decay time of the lanthanide chelates to gain sensitivity in biological media. The method was developed to follow liposome biodistribution. Octadecyl-DTPA.Eu compound has been prepared and incorporated into liposomes without alteration of its fluorescence signal. The method has been validated by comparison with fluorophore-labeled liposomes. The way to proceed to use this method for liposomes or other vectors is detailed.

  6. Resonance ionization scheme development for europium

    CERN Document Server

    Chrysalidis, K; Fedosseev, V N; Marsh, B A; Naubereit, P; Rothe, S; Seiffert, C; Kron, T; Wendt, K

    2017-01-01

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  7. Resonance ionization scheme development for europium

    Energy Technology Data Exchange (ETDEWEB)

    Chrysalidis, K., E-mail: katerina.chrysalidis@cern.ch; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)

    2017-11-15

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  8. Electronic state of europium atoms on surface of oxidized tungsten

    CERN Document Server

    Davydov, S Y

    2001-01-01

    The energy scheme of the europium atoms adsorption system on the tungsten surface, coated with the oxygen monolayer, is considered. The evaluations of the europium adatoms charged state on the oxidized tungsten surface are performed. It is established, that europium, adsorbed at the oxidized tungsten surface, is a positive ion with the charge close to the unit. The zonal scheme of the Eu-O/W adsorption system for the europium low and high concentrations is proposed

  9. Europium anomaly in plagioclase feldspar - Experimental results and semiquantitative model.

    Science.gov (United States)

    Weill, D. F.; Drake, M. J.

    1973-01-01

    The partition of europium between plagioclase feldspar and magmatic liquid is considered in terms of the distribution coefficients for divalent and trivalent europium. A model equation is derived giving the europium anomaly in plagioclase as a function of temperature and oxygen fugacity. The model explains europium anomalies in plagioclase synthesized under controlled laboratory conditions as well as the variations of the anomaly observed in natural terrestrial and extraterrestrial igneous rocks.

  10. Fermi Surface and Antiferromagnetism in Europium Metal

    DEFF Research Database (Denmark)

    Andersen, O. Krogh; Loucks, T. L.

    1968-01-01

    We have calculated the Fermi surface of europium in order to find those features which determine the wave vector of the helical moment arrangement below the Néel point. We find that there are two pieces of Fermi surface: an electron surface at the symmetry point H, which has the shape of rounded...... of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...

  11. Organophosphate Nerve Agent Detection with Europium Complexes

    Directory of Open Access Journals (Sweden)

    Jake R. Schwierking

    2004-01-01

    Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.

  12. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail: syamchand.ss@gmail.com; Sony, G., E-mail: emailtosony@gmail.com

    2015-09-15

    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  13. The Europium Oxybarometer: Power and Pitfalls

    Science.gov (United States)

    McKay, G.

    2004-01-01

    One of the most important characteristics of a planet is the oxidation state of its mantle, as reflected in primitive basalts. Petrologists have devised several methods to estimate the oxygen fugacity under which basalts crystallized. One method that has been the subject of recent interest involves the depth of the Eu anomaly in first-crystallizing minerals. A discussion detailing the experimental calibration of the Europium oxybarometer and the application of this device to Angrites and Martian basaltic meteorites are presented. The strengths and weaknesses of the instrument are also included.

  14. Europium Effect on the Electron Transport in Graphene Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Bobadilla, Alfredo D.; Ocola, Leonidas E.; Sumant, Anirudha V.; Kaminski, Michael; Kumar, Narendra; Seminario, Jorge M.

    2015-10-01

    We report in this complementary theoretical-experimental work the effect of gating on the election transport of grapheme ribbons when exposed to very low concentration of europium in an aqueous solution. We find a direct correlation between the level of concentration of europium ions in the solvent and the change in electron transport in graphene, observing a change of up to 3 orders of magnitude at the lowest level of concentration tested (0.1 mM), suggesting a possibility that graphene ribbons can be used for detecting very low concentrations of europium in liquid solutions.

  15. Paramagnetic Europium Salen Complex and Sickle-Cell Anemia

    Science.gov (United States)

    Wynter, Clive I.; Ryan, D. H.; May, Leopold; Oliver, F. W.; Brown, Eugene; Hoffman, Eugene J.; Bernstein, David

    2005-04-01

    A new europium salen complex, Eu(salen)2NH4, was synthesized, and its composition was confirmed by chemical analysis and infrared spectroscopy. Further characterization was carried out by 151 Eu Mössbauer spectroscopy and magnetic susceptibility measurements. Mössbauer spectroscopic measurements were made at varying temperatures between 9 K and room temperature and a value of Debye temperature of 133 ±5 K was computed. Both Mössbauer and magnetic susceptibility measurements confirmed the paramagnetic behavior of this complex and the trivalent state of the europium ion. In view of the fact that the "odd" paramagnetic molecule NO has been shown to reverse sickling of red blood cells in sickle cell anemia, the interaction between the paramagnetic europium salen complex and sickle cells was examined after incubation with this europium complex and shown to have similar effects.

  16. Europium polyoxometalates encapsulated in silica nanoparticles - characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)

    2013-06-15

    The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Spectral Properties of a bis-Azospiropyran Complexed with Europium

    Science.gov (United States)

    Nourmohammadian, F.; Ghahari, M.; Gholami, M. Davoudzadeh

    2015-09-01

    The complexation of recently synthesized symmetrical bifunctional bis-azospiropyran photochromic dye with europium nitrate and its effect on UV-vis absorption and fluorescent emission was studied. Upon addition of Eu 3+ to colorless spiropyran, a yellow merocyanine europium complex was obtained with an absorption band at 410 nm. Negatively charged phenolic oxygenin zwitterionic ring-open form provides an effective metal binding site for Eu 3+ . Meanwhile, the inherent fluorescence emission of the photochromic dye at 380 nm is switched off due to the Eu 3+ - induced drive of spiro-mero equilibrium to form mero form. The stoichiometry of dye-europium complexation was evaluated by fluorescence emission and UV-vis absorption spectroscopy and a 8:1 ratio was obtained in both cases. The binding constant (K) value of the dye-europium complex was 3 × 106 M -1 . In conclusion, the current molecular switch is a useful sensitive dual measuring tool for solutions containing europium or europium-like elements by evaluation of visible absorption or fluorescent emission spectroscopy.

  18. Metal plasmon enhanced europium complex luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Liu Feng [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Aldea, Gabriela [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Petru Poni Institute of Macromolecular Chemistry Iasi, Aleea Grigore Ghica Voda 41A, 700487 Iasi (Romania); Nunzi, Jean-Michel, E-mail: nunzijm@queensu.c [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada)

    2010-01-15

    The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod){sub 3}) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.

  19. Novel fluorescent probe for low density lipoprotein, based on the enhancement of Europium emission band

    OpenAIRE

    Courrol, Lilia Coronato; Monteiro, A.M.; SILVA, F.R.O.; L. Gomes; VIEIRA, N.D.; Gidlund, Magnus; Figueiredo Neto, A.M.

    2007-01-01

    We report here the observation of the enhancement of Europium-tetracycline complex emission in Low Density Lipoprotein (LDL) solutions. Europium emission band of tetracycline solution containing Europium (III) chloride hexahydrate was tested to obtain effective enhancement in the presence of native LDL and oxidized LDL. Europium emission lifetime in the presence of lipoproteins was measured, resulting in a simple method to measure the lipoproteins quantity in an aqueous solution at physiologi...

  20. Europium ion as a probe for binding sites to carrageenans

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail: medzaniquelli@ffclrp.usp.br; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)

    2007-12-15

    Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.

  1. First-Principles Investigations on Europium Monoxide

    KAUST Repository

    Wang, Hao

    2011-05-01

    Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.

  2. Chloride, bromide and iodide scintillators with europium

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2016-09-27

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  3. Electrochemical extraction of europium from molten fluoride media

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Massot, L., E-mail: massot@chimie.ups-tlse.f [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Chamelot, P.; Cassayre, L.; Taxil, P. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France)

    2009-12-15

    This work concerns the extraction of europium from molten fluoride media. Two electrochemical ways have been examined: (i) the use of a reactive cathode made of copper and (ii) the co-deposition with aluminium on inert electrode, leading to the formation of europium-copper and europium-aluminium alloys, respectively, as identified by SEM-EDS analysis. Cyclic voltammetry and square wave voltammetry were used to identify the reduction pathway and to characterise the step of Cu-Eu and Al-Eu alloys formation. Then, electrochemical extractions using the two methodologies have been performed with extraction efficiency around 92% for copper electrode and 99.7% for co-reduction with aluminium ions.

  4. Solubilization of europium fulvate in aqueous solutions containing complexing agents

    Energy Technology Data Exchange (ETDEWEB)

    Legin, E.K.; Trifonov, Yu.I.; Khokhlov, M.L. [Khlopin Radium Inst., St. Petersburg (Russian Federation)] [and others

    1995-07-01

    The europium fulvate complex is synthesized and characterized by spectroscopic and chemical methods. By an example of this complex, it is demonstrated that metal complexes of humic substances are solubilized in the presence of complexing anions such as OAc{sup {minus}}, C{sub 2}O{sup 2{minus}}{sub 4}, and EDTA{sup 2{minus}}. The solubilization is studied by the optical and radioactive tracer methods. The solubilization of europium fulvate increases parallel to the complexing power of anions. In the solid fulvate europium is bonded stronger than in the ethylenediaminetetraacetate complex. The solubilization is considered as a potential source for decomposition of the {open_quotes}absorbing soil complex,{close_quotes} resulting in mobile forms of a metal and humic component in soils and soil waters.

  5. Excess europium content in Precambrian sedimentary rocks and continental evolution

    Science.gov (United States)

    Jakes, P.; Taylor, S. R.

    1974-01-01

    It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.

  6. Murine High Specificity/Sensitivity Competitive Europium Insulin Autoantibody Assay

    Science.gov (United States)

    Babaya, Naru; Liu, Edwin; Miao, DongMei; Li, Marcella; Yu, Liping

    2009-01-01

    Abstract Background Most insulin autoantibody assays for both human and animal models are in a radioassay format utilizing 125I-insulin, but despite the radioassay format international workshops have documented difficulty in standardization between laboratories. There is thus a need for simpler assay formats that do not utilize radioactivity, yet retain the high specificity and sensitivity of radioassays. Methods To establish an easier enzyme-linked immunosorbent assay (ELISA) for insulin autoantibodies of non-obese diabetic (NOD) mice, we used an ELISA format, competition with unlabeled insulin, europium-avidin, and time-resolved fluorescence detection (competitive europium insulin autoantibody assay). Results The competitive europium assay of insulin autoantibodies when applied to sera from NOD mice had high sensitivity and specificity (92% sensitivity, 100% specificity) compared to our standard insulin autoantibody radioassay (72% sensitivity, 100% specificity) in analyzing blind workshop sera. It is noteworthy that though the assay has extremely high sensitivity for murine insulin autoantibodies and utilizes human insulin as target autoantigen, human sera with high levels of insulin autoantibodies are not detected. Conclusions Our results clearly indicate that low levels of insulin autoantibodies can be detected in an ELISA-like format. Combining a europium-based ELISA with competition with fluid-phase autoantigen can be applicable to many autoantigens to achieve high specificity and sensitivity in an ELISA format. PMID:19344197

  7. Tridentate benzimidazole-pyridine-tetrazolates as sensitizers of europium luminescence.

    Science.gov (United States)

    Shavaleev, Nail M; Eliseeva, Svetlana V; Scopelliti, Rosario; Bünzli, Jean-Claude G

    2014-05-19

    We report on new anionic tridentate benzimidazole-pyridine-tetrazolate ligands that form neutral 3:1 complexes with trivalent lanthanides. The ligands are UV-absorbing chromophores that sensitize the red luminescence of europium with energy-transfer efficiency of 74-100%. The lifetime and quantum yield of the sensitized europium luminescence increase from 0.5 ms and 12-13% for the as-prepared solids to 2.8 ms and 41% for dichloromethane solution. From analysis of the data, the as-prepared solids can be described as aqua-complexes [Ln(κ(3)-ligand)2(κ(1)-ligand)(H2O)x] where the coordinated water molecules are responsible for the strong quenching of the europium luminescence. In solution, the coordinated water molecules are replaced by the nitrogen atoms of the κ(1)-ligand to give anhydrous complexes [Ln(κ(3)-ligand)3] that exhibit efficient europium luminescence. X-ray structures of the anhydrous complexes confirm that the lanthanide ion (La(III), Eu(III)) is nine-coordinate in a distorted tricapped trigonal prismatic environment and that coordination of the lanthanide ion by tetrazolate is weaker than by carboxylate.

  8. Europium 2-benzofuranoate: Synthesis and use for bioimaging

    Science.gov (United States)

    Utochnikova, V. V.; Koshelev, D. S.; Medvedko, A. V.; Kalyakina, A. S.; Bushmarinov, I. S.; Grishko, A. Yu; Schepers, U.; Bräse, S.; Vatsadze, S. Z.

    2017-12-01

    Europium 2-benzofuranoate Eu(BFC)3(H2O)3 was successfully used for bioimaging in cellulo due to the combination of high solubility and high luminescence intensity in solution. It was possible due to the purposeful variation of the aromatic core of carboxylate anion.

  9. SEPARATION OF EUROPIUM FROM OTHER LANTHANIDE RAE EARTHS BY SOLVENT EXTRACTION

    Science.gov (United States)

    Peppard, D.F.; Horwitz, E.P.; Mason, G.W.

    1963-02-12

    This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)

  10. Distribution, elimination, and renal effects of single oral doses of europium in rats.

    Science.gov (United States)

    Ohnishi, Keiko; Usuda, Kan; Nakayama, Shin; Sugiura, Yumiko; Kitamura, Yasuhiro; Kurita, Akihiro; Tsuda, Yuko; Kimura, Motoshi; Kono, Koichi

    2011-11-01

    Single doses of europium (III) chloride hexahydrate were orally administered to several groups of rats. Cumulative urine samples were taken at 0-24 h, and blood samples were drawn after 24-h administration. The europium concentration was determined in these samples by inductively coupled plasma atomic emission spectroscopy. The volume, creatinine, ß-2-microglobulin, and N-acetyl-ß-D-glucosaminidase were measured in the urine samples to evaluate possible europium-induced renal effects. The blood samples showed low europium distribution, with an average of 77.5 μg/L for all groups. Although the urinary concentration and excretion showed dose-dependent increases, the percentage of europium excreted showed a dose-dependent decrease, with an average of 0.31% in all groups. The administration of europium resulted in a significant decrease of creatinine and a significant increase of urinary volume, N-acetyl-ß-D-glucosaminidase, and ß-2-microglobulin. Rare earth elements, including europium, are believed to form colloidal conjugates that deposit in the reticuloendothelial system and glomeruli. This specific reaction may contribute to low europium bioavailability and renal function disturbances. Despite low bioavailability, the high performance of the analytical method for determination of europium makes the blood and urine sampling suitable tools for monitoring of exposure to this element. The results presented in this study will be of great importance in future studies on the health impacts of rare earth elements.

  11. [Synthesis and luminescence properties of reactive ternary europium complexes].

    Science.gov (United States)

    Guo, Dong-cai; Shu, Wan-gen; Zhang, Wei; Liu, You-nian; Zhou, Yue

    2004-09-01

    In this paper, five new reactive ternary europium complexes were synthesized with the first ligand of 1,10-phenanthroline and the reactive second ligands of maleic anhydride, acrylonitrile, undecenoic acid, oleic acid and linoleic acid, and also characterized by means of elemental analysis, EDTA titrimetric method, FTIR spectra and UV spectra. The fluorescence spectra show that the five new ternary complexes have much higher luminescence intensity than their corresponding binary complexes, and the synergy ability sequence of the five reactive ligands is as follows: linoleic acid > oleic acid > acrylonitrile > maleic anhydride > undecenoic acid. At the same time, the reactive ternary europium complexes coordinated with the reactive ligands, which can be copolymerized with other monomers, will provide a new way for the synthesis of bonding-type rare earth polymer functional materials with excellent luminescence properties.

  12. Solvent extraction of europium(III) to a fluorine-free ionic liquid phase with a diglycolamic acid extractant

    OpenAIRE

    Rout, Alok; Souza, Ernesto Rezende; Binnemans, Koen

    2014-01-01

    Europium(III) was extracted by bis(2-ethylhexyl)diglycolamic acid (DEHDGA) dissolved in the non-fluorinated ionic liquid tetraoctylammonium dodecyl sulphate, [N8888][DS]. The extraction behaviour of europium(III) was investigated as a function of various parameters: pH, extractant concentration, concentration of the europium(III) ion in the aqueous feed and concentration of the salting-out agent. A comparison was made with extraction of europium(III) by the acidic extractants bis(2-ethylhexyl...

  13. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    2017-07-25

    Jul 25, 2017 ... Abstract. Europium (Eu3+) doped silver lead borate glasses with the composition of xEu2O3−(1 − x)Ag2. O−29PbO−70B2O3 (x = 0, 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional melt quenching method. Thermal, structural and luminescence properties have been studied ...

  14. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    Europium (Eu 3 + ) doped silver lead borate glasses with the composition of x Eu 2 O 3 −( 1 − x )Ag 2 O−29PbO−70B 2 O 3 ( x = 0 , 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional meltquenching method. Thermal, structural and luminescence properties have been studied using ...

  15. Synthesis and luminescence properties for europium oxide nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mo Zunli, E-mail: mozl@163.com [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China) and State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Deng Zhepeng; Guo Ruibin [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China); Fu Qiangang [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Feng Chao; Liu Pengwei; Sun Yu [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China)

    2012-01-25

    Highlights: Black-Right-Pointing-Pointer A novel high temperature sensitive fluorescent CNTs/Eu{sub 2}O{sub 3} nanocomposite was fabricated. Black-Right-Pointing-Pointer The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 Degree-Sign C for 4 h. Black-Right-Pointing-Pointer The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. Black-Right-Pointing-Pointer We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 Degree-Sign C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the {sup 5}D{sub 0} {yields} {sup 7}F{sub j} (j = 0, 1) forced electric dipole transition of Eu{sup 3+} ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 Degree-Sign C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu{sup 3+} energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.

  16. Optical and magnetization studies on europium based iron pnictides

    Energy Technology Data Exchange (ETDEWEB)

    Zapf, Sina Maria Ute

    2015-07-01

    The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.

  17. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength

    OpenAIRE

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2012-01-01

    Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level.

  18. Enhancement in red emission at room temperature from europium doped ZnO nanowires by 1,10 phenanthroline-europium interface induced resonant excitations

    Directory of Open Access Journals (Sweden)

    Soumen Dhara

    2017-02-01

    Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.

  19. Dual doped graphene oxide for electrochemical sensing of europium ion

    Science.gov (United States)

    Kumar, Sunil; Patra, Santanu; Madhuri, Rashmi; Sharma, Prashant K.

    2017-05-01

    This present work represents a single step hydrothermal method for the preparation of N, and N, S dual doped graphene oxide (GO). First time, a comparative electrochemical study between single dope and dual doped GO was carried out using potassium ferrocyanide as an electro-active probe molecule and found that the dual doped GO has the highest electrocatalytic activity than single doped, due to the presence of two heteroatoms as a doping material. Afterwards, the dual doped GO was successfully applied for the electrochemical detection of a rare earth element i.e. europium, with LOD value of 5.92 μg L-1.

  20. Crystal growth of nanoscaled europium selenide having characteristic crystal shapes

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Adachi, Taka-aki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Hasegawa, Yasuchika, E-mail: hasegawa@ms.naist.j [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Kawai, Tsuyoshi [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan)

    2009-12-04

    Tetrapod-shaped EuSe nanocrystals were prepared through the thermal reduction of europium chloride an organic selenide complex, n-hexadecylamine, and two additives oleic acid and oleylamine. The obtained EuSe nanoparticles were characterized by X-ray diffraction (XRD). The crystal grain size from the XRD spectrum was estimated to be 50 nm. In contrast, observation of the transmission electron microscope (TEM) gave larger sized EuSe (average size: 200 nm). Anisotropic crystal-growth of EuSe nanocrystals was achieved by addition of a small amount of oleic acid in the crystal growth process.

  1. Photoprotective properties of the fluorescent europium complex in UV-irradiated skin.

    Science.gov (United States)

    Vogt, O; Lademann, J; Rancan, F; Meinke, M C; Schanzer, S; Stockfleth, E; Sterry, W; Lange-Asschenfeldt, B

    2013-01-01

    In this study, we compared the UV-protective abilities of the europium complex compared to titanium dioxide, which represents the most common physical filter for ultraviolet light in the broad-band spectral range. The UV absorption and light transformative capacities of the europium complex were evaluated using a spectrometer with a double-integrating sphere showing that the europium complex does not only absorb and reflect UV light, but transforms it into red and infrared light. It was found that the europium complex binds to the surface of Jurkat cells in vitro. Cells incubated with the europium complex showed a significantly higher viability after UVA and UVB irradiation as compared to untreated cells and cells incubated with titanium dioxide pointing out its photoprotective properties. The europium complex and titanium dioxide show similar penetration capacities into the stratum corneum as tested in human and porcine skin using tape stripping analysis. The europium complex has proved to be an efficient UV filter with a low cyto- and phototoxic profile and therefore represents a potential candidate for use in sunscreen formulations. Copyright © 2013 S. Karger AG, Basel.

  2. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.

    1995-03-01

    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  3. In Vivo Toxicity Studies of Europium Hydroxide Nanorods in Mice

    Science.gov (United States)

    Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H; Mukhopadhyay, Debabrata

    2009-01-01

    Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence properties and pro-angiogenic to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [EuIII(OH)3] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mgKg−1day−1) and time dependent manner (8–60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice sacrificed on day 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods. PMID:19616569

  4. Temperature dependences in electron-stimulated desorption of neutral europium

    CERN Document Server

    Ageev, V N; Madey, T E

    2003-01-01

    The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...

  5. The Oxidation State of Europium in Halide Glasses

    Science.gov (United States)

    Weber, J.K.R.; Vu, M.; Paßlick, C.; Schweizer, S.; Brown, D.E.; Johnson, C.E.; Johnson, J.A.

    2012-01-01

    The luminescent properties of divalent europium ions can be exploited to produce storage phosphors for x-ray imaging applications. The relatively high cost and limited availability of divalent europium halides makes it desirable to synthesize them from the readily available trivalent salts. In this work, samples of pure EuCl3 and fluoride glass melts doped with EuCl3 were processed at 700-800 °C in an inert atmosphere furnace. The Eu oxidation state in the resulting materials was determined using fluorescence and Mössbauer spectroscopy. Heat treatment of pure EuCl3 for 10 minutes at 710 °C resulted in a material comprising approximately equal amounts of Eu2+ and Eu3+. Glasses made using mixtures of EuCl2 and EuCl3 in the starting material contained both oxidation states. This paper describes the sample preparation and analysis and discusses the results in the context of chemical equilibria in the melts. PMID:22101252

  6. Innovative triboluminescence study of multivitamin doped europium tetrakis

    Energy Technology Data Exchange (ETDEWEB)

    Fontenot, R.S. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, K.N.; Aggarwal, M.D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); Hollerman, W.A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States)

    2012-05-15

    As the Space Shuttle program ends, NASA is developing the next generation of space vehicles. These new concept designs will require new and innovative structural health monitoring capabilities. One way to solve this problem is with smart impact sensors that use triboluminescent materials. In 2011, the authors reported an 82% increase in the triboluminescence yield of europium dibenzoylmethide triethylammonium (EuD{sub 4}TEA) by changing the starting material. It has been shown that introduction of dopants tends to enhance the triboluminescent light yield. Here we report the successful synthesis of a multivitamin doped europium tetrakis which appears to be spherical in shape. Inductively Coupled Plasma - Optical Emission Spectroscopy analysis showed the presence of 3.6% calcium, 0.62% magnesium, 0.1% iron, 0.01% copper and manganese. This new product has no shift in the triboluminescent or photoluminescent emission peaks, but only a change in the intensity. In addition, the doped EuD{sub 4}TEA powder statistically emits more triboluminescence while having the same decay time. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  7. 40 CFR 131.11 - Criteria.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Criteria. 131.11 Section 131.11... Establishment of Water Quality Standards § 131.11 Criteria. (a) Inclusion of pollutants: (1) States must adopt those water quality criteria that protect the designated use. Such criteria must be based on sound...

  8. 46 CFR 131.720 - Use.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use. 131.720 Section 131.720 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Work Vests § 131.720 Use. (a) An approved buoyant work vest is an item of safety apparel and may be carried aboard for wear by a...

  9. 46 CFR 131.840 - Emergency lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting. 131.840 Section 131.840 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.840 Emergency lighting. Emergency lighting must be marked...

  10. 46 CFR 131.970 - Unauthorized lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Unauthorized lighting. 131.970 Section 131.970 Shipping... Miscellaneous § 131.970 Unauthorized lighting. No master of a vessel may authorize or permit the vessel's carrying of any lighting not required by law that will interfere in any way with any other vessel's ability...

  11. 46 CFR 502.131 - Requests; issuance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 9 2010-10-01 2010-10-01 false Requests; issuance. 502.131 Section 502.131 Shipping... § 502.131 Requests; issuance. Subpenas for the attendance of witnesses or the production of evidence shall be issued upon request of any party, without notice to any other party. Requests for subpenas for...

  12. 40 CFR 131.40 - Puerto Rico

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Puerto Rico 131.40 Section 131.40... Federally Promulgated Water Quality Standards § 131.40 Puerto Rico (a) Use designations for marine waters. In addition to the Commonwealth's adopted use designations, the following waterbodies in Puerto Rico...

  13. 46 CFR 131.899 - Fire dampers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire dampers. 131.899 Section 131.899 Shipping COAST... Equipment and Emergency Equipment § 131.899 Fire dampers. Each fire damper installed within the boundary of... whether the damper is open or closed and must be marked with red letters at least 13 millimeters (1/2-inch...

  14. 49 CFR 237.131 - Design.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Design. 237.131 Section 237.131 Transportation... TRANSPORTATION BRIDGE SAFETY STANDARDS Repair and Modification of Bridges § 237.131 Design. Each repair or... component of a bridge shall be designed by a railroad bridge engineer. The design shall specify the manner...

  15. 21 CFR 131.155 - Light cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light cream. 131.155 Section 131.155 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.155 Light cream. (a) Description. Light cream is cream which contains not less than 18 percent but less than 30 percent milkfat. It...

  16. 21 CFR 131.149 - Dry cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dry cream. 131.149 Section 131.149 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.149 Dry cream. (a) Description. Dry cream is the product obtained by removal of water only from pasteurized milk or cream or a...

  17. 21 CFR 131.150 - Heavy cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Heavy cream. 131.150 Section 131.150 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.150 Heavy cream. (a) Description. Heavy cream is cream which contains not less than 36 percent milkfat. It is pasteurized or ultra...

  18. 21 CFR 131.160 - Sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sour cream. 131.160 Section 131.160 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.160 Sour cream. (a) Description. Sour cream results from the souring, by lactic acid producing bacteria, of pasteurized cream...

  19. 9 CFR 3.131 - Sanitation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Sanitation. 3.131 Section 3.131... Mammals Animal Health and Husbandry Standards § 3.131 Sanitation. (a) Cleaning of enclosures. Excreta... being directly sprayed with the stream of water or wetted involuntarily. (b) Sanitation of enclosures...

  20. 19 CFR 191.131 - Drawback allowance.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Drawback allowance. 191.131 Section 191.131 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Foreign Ownership and Account § 191.131 Drawback allowance. Section 313(g) of the Act, as amended (19 U.S...

  1. Photoactive thin films of polycaprolactam doped with europium (III) complex using phenylalanine as ligand

    Energy Technology Data Exchange (ETDEWEB)

    Santos Garcia, Irene Teresinha, E-mail: irene@iq.ufrgs.br [Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil); Velleda Ribeiro, Patricia; Silva Correa, Diogo; Neto da Cunha, Igor Michel; Lenin Villarreal Carreno, Neftali [Instituto de Quimica e Geociencias, Universidade Federal de Pelotas, Campus Capao do Leao, s/n. CEP 96010-900, Pelotas, RS (Brazil); Ceretta Moreira, Eduardo [PPGEE, Universidade Federal do Pampa, Campus Bage, Bage- RS (Brazil); Severo Rodembusch, Fabiano [Departamento de Quimica Organica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil)

    2011-12-01

    A photoactive complex based on europium(III) using the amino acid phenylalanine as ligand was prepared and characterized. The obtained europium(III)/phenylalanine complex presents an effective energy transfer from ligands to the rare earth center. The observed photoluminescent behavior for europium(III)/phenylalanine complex was similar to the well known europium(III)/ acetyl-{beta}-acetonate hydrate. New photoactive polyamide thin films were prepared using polycaprolactam as host of these complexes. The structural characterizations of the films were studied through Rutherford backscattering (RBS), Fourier transform infrared (FTIR) and Raman spectroscopies. The polyamide films doped with the amino acid and acetyl-{beta}-acetonate rare earth complexes maintain the original photoluminescent behavior, narrow emission bands corresponding to transitions {sup 5}D{sub 0} {yields} {sup 7}F{sub 0-4}, which indicates that this polymer is an excellent host to these complexes.

  2. Synthesis and luminescence properties of salicylaldehyde isonicotinoyl hydrazone derivatives and their europium complexes.

    Science.gov (United States)

    Shan, Wenfei; Liu, Fen; Liu, Jiang; Chen, Yanwen; Yang, Zehui; Guo, Dongcai

    2015-09-01

    Four novel salicylaldehyde isonicotinoyl hydrazone derivatives and their corresponding europium ion complexes were synthesized and characterized, while the luminescence properties and the fluorescence quantum yields of the target complexes were investigated. The results indicated that the ligands favored energy transfers to the emitting energy level of europium ion, and four target europium complexes showed the characteristic luminescence of central europium ion. Besides the luminescence intensity of the complex with methoxy group, which possessed the highest fluorescence quantum yield (0.522), was stronger than that of other complexes. Furthermore, the electrochemical properties of the target complexes were further investigated by cyclic voltammetry, the results indicated that the highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO) energy levels and the oxidation potential of the complexes with electron donating group increased, however, that of the complexes with accepting electron group decreased. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. [Synthesis and luminescence properties of ternary complexes of europium with aromatic carboxylic acid and acrylonitrile].

    Science.gov (United States)

    Guo, Dong-cai; Yi, Li-ming; Shu, Wan-gen; Zhang, Zhen-zhen; Zeng, Zhao-rong; Zhang, Xi-qian

    2006-11-01

    Five ternary complexes were synthesized from europium with aromatic carboxylic acid (p-methylbenzoic acid, methoxybenzoic acid, m-chlorobenzoic acid and benzoic acid, p-hydroxylbenzoic acid) and acrylonitrile, and characterized by means of elemental analysis, thermal analysis, FTIR spectra and UV spectra. The fluorescence spectra show that five ternary complexes have good luminescence properties, and the sequence of the ability of the aromatic carboxylic acids to transfer light energy to europium ion is as follows: p-methylbenzoic acid>benzoic acid>m-chlorobenzoic acid>p-hydroxylbenzoic acid>methoxybenzoic acid. Meanwhile, the ternary europium complexes containing a reactive ligand acrylonitrile will possibly have a potential application to the fabrication of bonding-type europium polymer luminescent materials.

  4. Optical characterization of europium-doped indium hydroxide nanocubes obtained by Microwave-Assisted Hydrothermal method

    OpenAIRE

    Motta, Fabiana Villela da; Marques,Ana Paula de Azevedo; Araújo,Vinícius Dantas de; Tavares, Mara Tatiane De Souza; Delmonte,Mauricio Roberto Bomio; Paskocimas, Carlos Alberto; Li, Máximo Siu; Nascimento, Rubens Maribondo do; Longo, Elson [UNESP

    2014-01-01

    Crystalline europium-doped indium hydroxide (In(OH)3:Eu) nanostructures were prepared by rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of europium-doped indium hydroxide (IH:xEu) samples under excitation (350.7 nm) present...

  5. Structural and optical properties of europium doped zirconia single crystals fibers grown by laser floating zone

    OpenAIRE

    Soares, M.R.N.; Nico, C.; Peres, M.; Ferreira, N.; Fernandes, A.J.S.; Monteiro, T.; COSTA, F.M.

    2011-01-01

    Yttria stabilized zirconia single crystal fibers doped with europium ions were developed envisaging optical applications. The laser floating zone technique was used in order to grow millimetric high quality single crystal fibers. The as-grown fibers are completely transparent and inclusion free, exhibiting a cubic structure. Under ultraviolet (UV) excitation, a broad emission band appears at 551 nm. The europium doped fibers are translucent with a tetragonal structure and exhibit an intense r...

  6. A non-aqueous reduction process for purifying ¹⁵³Gd produced in natural europium targets.

    Science.gov (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2013-12-01

    Gadolinium-153 is a low-energy gamma-emitter used in nuclear medicine imaging quality assurance. Produced in nuclear reactors using natural Eu₂O₃ targets, ¹⁵³Gd is radiochemically separated from europium isotopes by europium reduction. However, conventional aqueous europium reduction produces hydrogen gas, a flammability hazard in radiological hot cells. We altered the traditional reduction method, using methanol as the process solvent to nearly eliminate hydrogen gas production. This new, non-aqueous reduction process demonstrates greater than 98% europium removal and gadolinium yields of 90%. © 2013 Elsevier Ltd. All rights reserved.

  7. Intercalated europium metal in epitaxial graphene on SiC

    Science.gov (United States)

    Anderson, Nathaniel A.; Hupalo, Myron; Keavney, David; Tringides, Michael C.; Vaknin, David

    2017-10-01

    X-ray magnetic circular dichroism (XMCD) reveals the magnetic properties of intercalated europium metal under graphene on SiC(0001). The intercalation of Eu nanoclusters (average size 2.5 nm) between graphene and SiC substate are formed by deposition of Eu on epitaxially grown graphene that is subsequently annealed at various temperatures while keeping the integrity of the graphene layer. Using sum-rules analysis of the XMCD of Eu M4 ,5 edges at T =15 K, our samples show paramagnetic-like behavior with distinct anomaly at T ≈90 K, which may be related to the Nèel transition, TN=91 K, of bulk metal Eu. We find no evidence of ferromagnetism due to EuO or antiferromagnetism due to Eu2O3 , indicating that the graphene layer protects the intercalated metallic Eu against oxidation over months of exposure to atmospheric environment.

  8. 40 CFR 721.9511 - Silicic acid (H6SiO2O7), magnesium, strontium salt(1:1:2), dysprosium and europium-doped.

    Science.gov (United States)

    2010-07-01

    ..., strontium salt(1:1:2), dysprosium and europium-doped. 721.9511 Section 721.9511 Protection of Environment...), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (a) Chemical substance and significant new..., strontium salt(1:1:2), dysprosium and europium-doped. (PMN P-98-848; CAS No.181828-07-9) is subject to...

  9. Fluorescent lifetime imaging microscopy using Europium complexes improves atherosclerotic plaques discrimination.

    Science.gov (United States)

    Sicchieri, Letícia Bonfante; de Andrade Natal, Rodrigo; Courrol, Lilia Coronato

    2016-10-01

    The objective of this study is to characterize arterial tissue with and without atherosclerosis by fluorescence lifetime imaging microscopy (FLIM) using Europium Chlortetracycline complex (EuCTc) as fluorescent marker. For this study, twelve rabbits were randomly divided into a control group (CG) and an experimental group (EG), where they were fed a normal and hypercholesterolemic diet, respectively, and were treated for 60 days. Cryosections of the aortic arch specimens were cut in a vertical plane, mounted on glass slides, and stained with Europium (Eu), Chlortetracycline (CTc), Europium Chlortetracycline (EuCTc), and Europium Chlortetracycline Magnesium (EuCTcMg) solutions. FLIM images were obtained with excitation at 405 nm. The average autofluorescence lifetime within plaque depositions was ~1.36 ns. Reduced plaque autofluorescence lifetimes of 0.23 and 0.31 ns were observed on incubation with EuCTc and EuCTcMg respectively. It was observed a quenching of collagen, cholesterol and TG emission spectra increasing EuCTc concentration. The drastic reduction in fluorescence lifetimes is due to a resonant energy transfer between collagen, triglycerides, cholesterol and europium complexes, quenching fluorescence.

  10. Visible-light sensitized luminescent europium(III)-β-diketonate complexes: bioprobes for cellular imaging.

    Science.gov (United States)

    Reddy, M L P; Divya, V; Pavithran, Rani

    2013-11-21

    Visible-light sensitized luminescent europium(III) molecular materials are of considerable importance because their outstanding photophysical properties make them well suited as labels in fluorescence-based bioassays and low-voltage driven pure red-emitters in optoelectronic technology. One challenge in this field is development of visible-light sensitizing ligands that can form highly emissive europium(III) complexes with sufficient stability and aqueous solubility for practical applications. Indeed, some of the recent reports have demonstrated that the excitation-window can be shifted to longer-wavelengths in europium(III)-β-diketonate complexes by appropriate molecular engineering and suitably expanded π-conjugation in the complex molecules. In this review, attention is focused on the latest innovations in the syntheses and photophysical properties of visible-light sensitized europium(III)-β-diketonate complexes and their application as bioprobes for cellular imaging. Furthermore, luminescent nanomaterials derived from long-wavelength sensitized europium(III)-β-diketonate complexes and their application in life sciences are also highlighted.

  11. The electronic properties of mixed valence hydrated europium chloride thin film.

    Science.gov (United States)

    Silly, M G; Charra, F; Lux, F; Lemercier, G; Sirotti, F

    2015-07-28

    We investigate the electronic properties of a model mixed-valence hydrated chloride europium salt by means of high resolution photoemission spectroscopy (HRPES) and resonant photoemission spectroscopy (RESPES) at the Eu 3d → 4f and 4d → 4f transitions. From the HRPES spectra, we have determined that the two europium oxidation states are homogeneously distributed in the bulk and that the hydrated salt film is exempt from surface mixed valence transition. From the RESPES spectra, the well separated resonant contributions characteristic of divalent and trivalent europium species (4f(6) and 4f(7) final states, respectively) are accurately extracted and quantitatively determined from the resonant features measured at the two edges. The partial absorption yield spectra, obtained by integrating the photoemission intensity in the valence-band region, can be well reproduced by atomic multiplet calculation at the M(4,5) (3d-4f) absorption edge and by an asymmetric Fano-like shape profile at the N(4,5) (4d-4f) absorption edge. The ratio of Eu(2+) and Eu(3+) species measured at the two absorption edges matches with the composition of the mixed valence europium salt as determined chemically. We have demonstrated that the observed spectroscopic features of the mixed valence salt are attributed to the mixed-valence ground state rather than surface valence transition. HRPES and RESPES spectra provide reference spectra for the study of europium salts and their derivatives.

  12. Europium-doped calcium titanate: Optical and structural evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: ilvrosa@ufscar.br [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)

    2014-02-05

    Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.

  13. 40 CFR 131.31 - Arizona.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Arizona. 131.31 Section 131.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS..., 3033 North Central Ave., Phoenix, AZ 85012): COLORADO MAIN STEM RIVER BASIN: Hualapai Wash MIDDLE GILA...

  14. 7 CFR 4279.131 - Credit quality.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Credit quality. 4279.131 Section 4279.131 Agriculture... Credit quality. The lender is primarily responsible for determining credit quality and must address all of the elements of credit quality in a written credit analysis including adequacy of equity, cash...

  15. Quality control of iodine-131-labeled metaiodobenzylguanidine.

    Science.gov (United States)

    Taşdelen, Betül; Kam, Erol; Asliyuksek, Hızır

    2014-01-01

    Iodine-131-m-iodobenzylguanidine ([(131)I]mIBG) is used worldwide for the diagnosis and therapy of neuroendocrine tumors, particularly adrenal medullae tumors. After the synthesis and preparation of a radioiodinated MIBG drug formulation, quality control testing to determine its radiochemical purity (RCP) should be performed. European Pharmacopoeia 8.0 requires that the quality control include a test for RCP for the determination of [(131)I]mIBG. Previously reported procedures using reversed-phase conditions require long retention times. Our system enables the separation of [(131)I]mIBG within a few minutes. The aim of this work was to carry out RCP testing for [(131)I]mIBG without any type of sample pretreatment. RCP testing for ([(131)I]mIBG has been carried out using high-performance liquid chromatography and thin-layer chromatography methods. A simple and rapid reversed-phase isocratic system enables the HPLC investigation of RCP testing for [(131)I]mIBG used for therapy within a few minutes. From the point of view of radiation protection, this method is safer, especially for therapeutic amounts of [(131)I]mIBG.

  16. 40 CFR 417.131 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.131 Section 417.131 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Chlorosulfonic Acid Sulfation...

  17. RBS and RNRA studies on sorption of europium by apatite

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi

    1997-03-01

    The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)

  18. Spectrofluorimetric determination of heparin using doxycycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Li Jing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Liu Jinkai [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Zhu Xiaojing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Peng Qian [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2005-06-15

    A new spectrofluorimetric method was developed for the determination of the trace amount of heparin (Hep). Using doxycycline (DC)-europium ion (Eu{sup 3+}) as a fluorescent probe, in the buffer solution of pH=8.9, Hep can remarkably enhance the fluorescence intensity of the DC-Eu{sup 3+} complex at {lambda}=612 nm and the enhanced fluorescence intensity of Eu{sup 3+} ion is in proportion to the concentration of Hep. Optimum conditions for the determination of Hep were also investigated. The linear range and detection limit for the determination of Hep are 0.04-0.8 {mu}g/mL and 19.7 ng/mL, respectively. This method is simple, practical, and relatively free of interference from coexisting substances and can be successfully applied to assess Hep in biological samples. By the Rosenthal graphic method, the association constant and binding numbers of Hep with the probe are 6.60x10{sup 4} L/mol and 33.9. Moreover, the enhancement mechanism of the fluorescence intensity in the DC-Eu{sup 3+} system and the DC-Eu{sup 3+}-Hep-CTMAB system have been also discussed.

  19. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    Energy Technology Data Exchange (ETDEWEB)

    Babain, V.A.; Alyapyshev, M.Yu.; Karavan, M.D. [V.G. Khlopin Radium Inst., St. Petersburg (Russian Federation); Boehmer, V.; Wang, L. [Johannes Guttenberg Univ., Mainz (Germany); Shokova, E.A.; Motornaya, A.E.; Vatsouro, I.M.; Kovalev, V.V. [M. V. Lomonosov Moscow State Univ., Moscow (Russian Federation)

    2005-07-01

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH{sub 2}){sub n}-NH-C(O)-CH{sub 2-}P(O)Ph{sub 2}] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO{sub 3} solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient D{sub Am}/D{sub Eu} for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (D{sub Am}/D{sub Eu}). (orig.)

  20. Preparation of europium-labelled DNA probes and their properties.

    Science.gov (United States)

    Hurskainen, P; Dahlén, P; Ylikoski, J; Kwiatkowski, M; Siitari, H; Lövgren, T

    1991-01-01

    A chemical method for labelling DNA with a europium chelate is presented. First, primary aliphatic amino groups are introduced onto DNA in a transamination reaction. The transamination reaction is altered by adjusting temperature and duration of the reaction. Subsequently, the modified DNA is reacted with an isothiocyanate derivative of a Eu chelate. The optimum amount of Eu chelates on a DNA probe is 4-8% of total nucleotides. There is a decrease of 0.7 degrees C in the melting temperature of DNA for each incorporated Eu chelate on 100 bases. Hybridization efficiency is lowered by the introduction of Eu chelates but this effect can be partly overcome by using high DNA probe concentrations. The detection limit of the Eu-labelled probe is 0.15 attomoles of target DNA in a mixed-phase hybridization assay on microtitration wells. In addition to high sensitivity the Eu-labelled probes offer convenience in use and results which are quantitative and easy to interpret. PMID:1826948

  1. Chloride, bromide and iodide scintillators with europium doping

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2014-08-26

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  2. Spectrofluorimetric determination of lecithin using a tetracycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ting [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2006-03-02

    Trace amount of lecithin (PC) was determined in the buffer solution of pH 5.7, using tetracycline (TC)-europium ion (Eu{sup 3+}) as a fluorescent probe. PC can remarkably enhance the fluorescence intensity of the TC-Eu{sup 3+} complex at {lambda} = 612 nm and the enhanced fluorescence intensity of Eu{sup 3+} is in proportion to the concentration of PC. Optimum conditions for the determination of PC were also investigated. The linear range and detection limit for the determination of PC are 4.0 x 10{sup -7} to 1.4 x 10{sup -5} mol/L and 3.9 x 10{sup -8} mol/L. This method is simple, practical and relatively free of interference from coexisting substances and can be successfully applied to assess PC in serum samples. Moreover, the enhancement mechanism of the fluorescence intensity in the TC-Eu{sup 3+} system, the TC-Eu{sup 3+}-PC system, and the TC-Eu{sup 3+}-PC-sodium dodecyl benzene sulfonate (SDS) system is also discussed.

  3. Artifacts in the determination of the binding of americium and europium to an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Lead, J.R.; Hamilton-Taylor, J.; Kelly, M. [Institute of Environmental and Biological Sciences, Lancaster University, Lancaster (United Kingdom)

    1995-11-23

    The binding of europium and americium by an aquatic fulvic acid was investigated using an equilibrium ion exchange technique (Schubert`s method). The results for europium were consistent with literature data. Americium gave anomalous results for both the D{sub o} values (partition coefficient of the metal between the resin and solution phases in the absence of the fulvic acid) and D values (partition coefficient of the metal between the resin and solution phases in the presence of the fulvic acid). The values for americium were unexpectedly low and, in the case of D values, only slightly pH dependent. The cause of the discrepancy was found to be the partial dissolution of the resin or the loss of small colloidal material from the resin. The effects on the europium results were minimal due to the use of lower resin weights and higher metal concentrations

  4. Synthesis and luminescence properties of 2-(benzylcarbamoyl)phenyl derivatives and their europium complexes.

    Science.gov (United States)

    Guo, Dongcai; He, Wei; Liu, Bang; Gou, Lining; Li, Ruixia

    2013-01-01

    Six novel 2-(benzylcarbamoyl)phenyl derivatives were synthesized and characterized by (1) H-NMR, mass spectrometry, infrared spectra and elemental analysis. Their europium complexes were prepared and characterized by elemental analysis, EDTA titrimetric analysis, IR and UV spectra as well as molar conductivity measurements. The luminescence properties of these complexes were investigated and results show that 2-(benzylcarbamoyl)phenyl derivatives possess high selectivity and good coordination with the europium ion. Complex Eu-2-(benzylcarbamoyl)phenyl-2-phenylacetate showed green luminescence that was emitted by the ligand of 2-(benzylcarbamoyl)phenyl-2-phenylacetate, while other complexes showed the characteristic red luminescence of europium ion and also possessed high luminescence intensity. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Induction of Circularly Polarized Luminescence from Europium by Amino Acid Based Ionic Liquids.

    Science.gov (United States)

    Zercher, Ben; Hopkins, Todd A

    2016-11-07

    Materials that emit circularly polarized light have application in several important industries. Because they show large optical activity and emit sharp visible light transitions, europium complexes are often exploited in applications that require circularly polarized luminescence (CPL). Chiral and coordinating ionic liquids based on prolinate, valinate, and aspartate anions are used to induce CPL from a simple achiral europium triflate salt. The sign of the induced CPL is dependent on the handedness (l vs d) of the amino acid anion. Comparison of the CPL spectra in ionic liquid with proline and valine vs aspartate shows that the number of carboxylate groups in the amino acid anion influences the europium coordination environment. DFT calculations predict a chiral eight-coordinate Eu(Pro)4- structure in the prolinate ionic liquid and a chiral seven- or eight-coordinate Eu(Asp)33- structure in the aspartate ionic liquid.

  6. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium.

    Science.gov (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier

    2014-07-07

    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dongwook, E-mail: dongwookleedl324@gmail.com [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: jiwonseo@yonsei.ac.kr [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)

    2015-08-15

    A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.

  8. Europium stearate additives delay oxidation of UHMWPE for orthopaedic applications: a pilot study.

    Science.gov (United States)

    Gallardo, Luis A; Carpentieri, Ilenia; Laurent, Michel P; Costa, Luigi; Wimmer, Markus A

    2011-08-01

    Ultrahigh-molecular-weight polyethylene (UHMWPE) is used as an articulating surface in prosthetic devices. Its failure under various mechanisms after oxidation is of utmost concern. Free radicals formed during the sterilization process using high-energy irradiation result in oxidation. Europium, an element of the lanthanide family, has a unique electron configuration with an unusual lack of preference for directional bonding and notable bonding to oxygen. Because of this, it currently is used in studies for stabilization of polymers such as polyvinyl chloride. We asked whether europium stearate could enhance the oxidation resistance after irradiation in nitrogen of UHMWPE. Conventional nonirradiated and gamma-irradiated in nitrogen UHMWPE were compared with polyethylene doped with 375 ppm and 3750 ppm europium(III) stearate under the same treatment conditions. Chemical characterization was performed by Fourier transform infrared (FTIR) microspectroscopy using 200-μm thin films. The oxidation of doped samples with time was compared with that of conventional samples using accelerated oven aging. The types of oxidation products were identified by FTIR and quantified per material and treatment condition as indications of the oxidation level and mechanism. The generation rate of hydroperoxides and ketones was decelerated proportionally with concentration of europium stearates. The oxidative mechanism appeared similar to that of conventional polyethylene with the same types of measurable end products as ketones and hydroperoxides. Yet, the rate of generation of the latter appeared to be slowed down by the action of europium stearate. Europium stearate mixed in UHMWPE decelerated the oxidation reactions triggered by gamma irradiation in nitrogen, seemingly without major alteration of the oxidation mechanism.

  9. Temperature dependent luminescence of a europium complex incorporated in poly(methyl methacrylate).

    Science.gov (United States)

    Liang, Hao; Xie, Fang; Ren, Xiaojun; Chen, Yifa; Chen, Biao; Guo, Fuquan

    2013-12-01

    An europium β-diketonate complex with a dipyrazolyltriazine derivative ligand, Eu(TTA)3DPBT, has been incorporated into poly(methyl methacryate) (PMMA). The influence of temperature on its luminescence properties has been investigated. The fluorescence emission spectra and luminescence lifetimes showed temperature sensitivity. The analysis of the relative intensity ratio (R) of (5)D0 → (7)F2 to (5)D0 → (7)F1 transition and Judd-Ofelt experimental intensity parameters Ω2 indicated that the local structure and asymmetry in the vicinity of europium ions show no obvious change when the temperature is increased. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Tositumomab and Iodine I 131 Tositumomab

    Science.gov (United States)

    This page contains brief information about tositumomab and iodine I 131 tositumomab and a collection of links to more information about the use of this drug combination, research results, and ongoing clinical trials.

  11. 28 CFR 13.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... Administration DEPARTMENT OF JUSTICE ATOMIC WEAPONS AND SPECIAL NUCLEAR MATERIALS REWARDS REGULATIONS § 13.1 Purpose. This part implements the responsibility given to the Attorney General under the Atomic Weapons... weapons and special nuclear material. ...

  12. Study of the europium behavior in aqueous media; Estudio sobre el comportamiento del europio en medios acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.

  13. Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions

    Energy Technology Data Exchange (ETDEWEB)

    Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)

    2008-07-01

    Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)

  14. A novel biocompatible europium ligand for sensitive time-gated immunodetection.

    Science.gov (United States)

    Sayyadi, Nima; Connally, Russell E; Try, Andrew

    2016-01-21

    We describe the synthesis of a novel hydrophilic derivative of a tetradentate β-diketone europium ligand that was used to prepare an immunoconjugate probe against Giardia lamblia cysts. We used a Gated Autosynchronous Luminescence Detector (GALD) to obtain high quality delayed luminescence images of cells 30-fold faster than ever previously reported.

  15. Europium-doped barium halide scintillators for x-ray and ?-ray detections

    NARCIS (Netherlands)

    Selling, J.; Birowosuto, M.D.; Dorenbos, P.; Schweizer, S.

    2007-01-01

    Single crystals of undoped or europium-doped barium chloride, bromide, and iodide were investigated under x-ray and ?-ray excitations. The Eu2+-related x-ray excited luminescence found in the Eu-doped barium halides occurs at 402, 404, and 425?nm for the chloride, bromide, and iodide, respectively.

  16. A europium luminescence assay of lactate and citrate in biological fluids†

    Science.gov (United States)

    Pal, Robert; Costello, Leslie C.

    2013-01-01

    Ratiometric methods of analysis have been developed for the selective determination of lactate or citrate in microlitre samples of human serum, urine or prostate fluids following comparison of anion binding affinities for a family of nine luminescent europium(III) complexes. PMID:19343236

  17. Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)

    Energy Technology Data Exchange (ETDEWEB)

    Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)

    2017-06-01

    With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.

  18. Europium doped In(Zn)P/ZnS colloidal quantum dots

    NARCIS (Netherlands)

    Thuy, Ung Thi Dieu; Maurice, Axel; Liem, Nguyen Quang; Reiss, Peter

    2013-01-01

    Chemically synthesised In(Zn)P alloy nanocrystals are doped with Eu(3+) ions using europium oleate as a molecular precursor and are subsequently covered with a ZnS shell. The presence of zinc in the synthesis of the InP core nanocrystals leads to the formation of an In(Zn)P alloy structure, making

  19. NO fluorescence sensing by europium tetracyclines complexes in the presence of H2O2.

    Science.gov (United States)

    Simões, Eliana F C; Leitão, João M M; Esteves da Silva, Joaquim C G

    2013-07-01

    The effect on the fluorescence of the europium:tetracycline (Eu:Tc), europium:oxytetracycline (Eu:OxyTc) and europium:chlortetracycline (Eu:ClTc) complexes in approximately 2:1 ratio of nitric oxide (NO), peroxynitrite (ONOO(-)), hydrogen peroxide (H2O2) and superoxide (O2 (·-)) was assessed at three ROS/RNS concentrations levels, 30 °C and pH 6.00, 7.00 and 8.00. Except for the NO, an enhancement of fluorescence intensity was observed at pH 7.00 for all the europium tetracyclines complexes-the high enhancement was observed for H2O2. The quenching of the fluorescence of the Tc complexes, without and with the presence of other ROS/RNS species, provoked by NO constituted the bases for an analytical strategy for NO detection. The quantification capability was evaluated in a NO donor and in a standard solution. Good quantification results were obtained with the Eu:Tc (3:1) and Eu:OxyTc (4:1) complexes in the presence of H2O2 200 μM with a detection limit of about 3 μM (Eu:OxyTc).

  20. Long-term tagging of elvers, Anguilla anguilla, with radioactive europium

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Fattah, A. T. A.

    1986-01-01

    -life of added europium of 1.6 .+-. 0.5 years. Thirteen hundred 155Eu-labelled elvers (50 Bq per eel), each weighing on average 0.21 g, were set out near Oskarshamn on the east coast of Sweden in June 1982. Three of these were caught nearby in May 1985 and one was caught in August 1985. They weighed...

  1. ULTRAVIOLET TRANSITIONS IN EUROPIUM STUDIED WITH A FREQUENCY-DOUBLED CW RING DYE-LASER

    NARCIS (Netherlands)

    Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.

    1981-01-01

    High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.

  2. Optical and Morphological Characterization of Sonochemically Assisted Europium Doped Copper (I) Oxide Nanostructures

    Science.gov (United States)

    Cosico, J. A. M.; Ruales, P. K.; Marquez, M. C.

    2017-06-01

    In the age where application of nanotechnology in our society has proven to be eminent, different routes of synthesizing nanoparticles have emerged. In this study nanoparticles of cuprous oxide (Cu2O) doped with different amounts of europium was prepared by using solution precursor route approach with the aid of ultrasonic sound. Copper sulphate and europium (III) nitrate pentahydrate was used as source for copper ions and europium ions respectively. X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR) were used to elucidate the cubic crystal structure and organic impurities present on Cu2Onanoparticles. UV-Vis spectroscopy was used to determine the absorption spectrum of the nanoparticles in the wavelength range of 400nm to 700nm. The bandgap of the undoped and doped Cu2O were found to fall between 2.1eV - 2.3eV. Scanning Electron Microscopy (SEM) coupled with energy dispersive x-ray was used to observe the dendritic and rodlike morphology and the presence of europium in the synthesized Cu2O nanoparticles. The observed effect on the absorbance of Cu2O upon adding Eu and a facile way of synthesizing Cu2O nanoparticles could bring a positive impact on the production of functional devices for optoelectronic and energy applications.

  3. Dicty_cDB: SLF131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF131 (Link to dictyBase) - G22459 DDB0231642 Contig-U09191-1 SLF1...31P (Link to Original site) SLF131F 321 SLF131Z 552 SLF131P 873 - - Show SLF131 Library SL (Link to library) Clone ID SLF1...ontig-U09191-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-B/SLF1...31Q.Seq.d/ Representative seq. ID SLF131P (Link to Original site) Representative DNA sequence >SLF131 (SLF131Q) /CSM/SL/SLF1...-B/SLF131Q.Seq.d/ GATTTTTGTGATTTGTTAAATAAAGCTGTGATGTTTTACAAAGTCCAACGTGCAGGTCGT TTACCAGA

  4. Dicty_cDB: CHR131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR131 (Link to dictyBase) - - - Contig-U16471-1 - (Link to Original site) - - CHR...131Z 757 - - - - Show CHR131 Library CH (Link to library) Clone ID CHR131 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR131Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ XXXXXXXXXXTGAAAAT...A/SFC806Q.Seq.d/ 944 0.0 CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ 944 0.0 CHQ337 (CHQ337Q) /CSM/CH/CHQ

  5. Occurrence of photoluminescence and onion like structures decorating graphene oxide with europium using sodium dodecyl sulfate surfactant

    Science.gov (United States)

    Cedeño, V. J.; Rangel, R.; Cervantes, J. L.; Lara, J.; Alvarado, J. J.; Galván, D. H.

    2017-07-01

    Graphene oxide decoration with europium was carried out using SDS (sodium dodecyl sulfate) as the surfactant. The reaction was performed in a microwave oven and subsequently underwent thermal treatment under hydrogen flow. The results found in the present work demonstrate that through the use of SDS surfactant aggregates of hemi-cylindrical and onion-like structures could be obtained; which propitiate an enhanced synergistic photoluminescence located at the red wavelength. On the other hand, after thermal treatment the aggregates disappear providing a good dispersion of europium, however a decrease in the photoluminescence signal is observed. The graphene oxide decorated with europium was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier infrared transform spectroscopy (FTIR), RAMAN spectroscopy, x-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) techniques, showing the characteristic features of graphene oxide and europium.

  6. Synthesis, characterization, and properties of reduced europium molybdates and tungstates

    Energy Technology Data Exchange (ETDEWEB)

    Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: zurloye@mailbox.sc.edu [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)

    2015-09-15

    Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.

  7. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate.

    Science.gov (United States)

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun

    2014-07-07

    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  8. The effect of two additional Eu3+ lumophors in two novel trinuclear europium complexes on their photoluminescent properties.

    Science.gov (United States)

    Yang, Chaolong; Xu, Jing; Ma, Jianying; Zhu, Dongyu; Zhang, Yunfei; Liang, Liyan; Lu, Mangeng

    2013-02-01

    Two novel trinuclear europium complexes based on trisphen(1,3,5-tris{4-((1,10-phenanthroline-[5,6-d]imidazol-2yl)phenoxy)methyl}-2,4,6-trimethyl-benzene) as a second ligand were designed, synthesized, and characterized by FT-IR, (1)H NMR, UV-visible, photoluminescence (PL) spectroscopy, elemental analysis (EA) and ESI-MS. The geometries of these two trinuclear europium complexes were predicted using the Sparkle/PM3 model and suggested a chemical environment of very low symmetry around the lanthanide ions (C(1)), which is in agreement with the luminescent spectra. CV analysis demonstrated that the trinuclear complexes possessed excellent electro-injection abilities. The effects of two additional Eu(3+) lumophors in these trinuclear europium complexes on their photoluminescent properties were investigated in detail. The results indicated that these trinuclear europium complexes exhibited highly luminescent quantum efficiencies and experimental intensity parameters in the solid state. Especially, due to the contribution of the two additional Eu(3+) lumophors in the trinuclear europium complexes, the quantum efficiency of the trinuclear complex Eu(3)(TTA)(9)trisphen was higher (ca. 34%) than the mononuclear europium complex Eu(TTA)(3)imidazophen.

  9. 14 CFR 151.131 - Forms.

    Science.gov (United States)

    2010-01-01

    ...- ance to be executed by the sponsor and certified by its attorney. (b) Advance planning agreement, FAA... AID TO AIRPORTS Rules and Procedures for Advance Planning and Engineering Proposals § 151.131 Forms. The forms used for the purpose of obtaining an advance planning and engineering grant are as follows...

  10. 21 CFR 131.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION MILK AND CREAM General Provisions § 131.3 Definitions. (a) Cream means the liquid milk product high in fat separated from milk, which may have been adjusted by adding thereto: Milk, concentrated...

  11. Cytogenetic study on {sup 131} Iodine effects

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, Claudia Lopes; Mello, Rossana Corbo; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia; Aranha, Ivar Pinheiro [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Dept. de Biologia Celular e Genetica

    2001-07-01

    There are no conclusive results, to these days, on the effect of {sup 131} I dosage used in scintigraphy on thyroid patients. The aim of this study was to evaluate the effect of that dosage on human lymphocyte chromosomes. Cells from 21 patients were placed in 1640 RPMI medium with bovine calf serum and incubated for 48 and 72 h at 37 deg C. Blood was collected 24 hours after administration of the radioisotope. Blood collected from the same patients prior to the administration of {sup 131} I was used as control. Chromosomes were stained with Giemsa Gurr 2% pH=6.8 and analyzed under optical microscope. Of the 6,300 metaphases analyzed from the 48 h cultures, 1,146 gaps and 682 breaks were found, in the test group. Of the 6,300 analyzed from the control group, 291 gaps and 119 breaks were observed. In the 72 h cultures, of 6,300 metaphases analyzed, 216 gaps and 52 breaks were found in the test group. Of 6,300 metaphases analyzed from the control group, 10 gaps and no breaks were found. These results were significant in a paired t-test (p < 0,05). Our results show that {sup 131} I is responsible for the observed chromosome alterations. We suggest re-evaluating the use of {sup 131} I, mainly on those patients at fertile age. (author)

  12. 14 CFR 13.131 - Other procedures.

    Science.gov (United States)

    2010-01-01

    ... Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES INVESTIGATIVE AND ENFORCEMENT PROCEDURES Formal Fact-Finding Investigation Under an Order of Investigation § 13.131 Other procedures. Any question concerning the scope or conduct of a formal investigation not...

  13. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  14. Incorporation of europium III complex into nanoparticles and films obtained by the Sol-Gel methodology

    Directory of Open Access Journals (Sweden)

    Faley Jean de Sousa

    2010-03-01

    Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.

  15. A Simple and Sensitive Method to Quantify Biodegradable Nanoparticle Biodistribution using Europium Chelates.

    Science.gov (United States)

    Crawford, Lindsey; Higgins, Jaclyn; Putnam, David

    2015-09-08

    The biodistribution of biodegradable nanoparticles can be difficult to quantify. We report a method using time resolved fluorescence (TRF) from a lanthanide chelate to minimize background autofluorescence and maximize the signal to noise ratio to detect biodegradable nanoparticle distribution in mice. Specifically, antenna chelates containing europium were entrapped within nanoparticles composed of polylactic acid-polyethylene glycol diblock copolymers. Tissue accumulation of nanoparticles following intravenous injection was quantified in mice. The TRF of the nanoparticles was found to diminish as a second order function in the presence of serum and tissue compositions interfered with the europium signal. Both phenomena were corrected by linearization of the signal function and calculation of tissue-specific interference, respectively. Overall, the method is simple and robust with a detection limit five times greater than standard fluorescent probes.

  16. A Comprehensive Strategy to Boost the Quantum Yield of Luminescence of Europium Complexes

    Science.gov (United States)

    Lima, Nathalia B. D.; Gonçalves, Simone M. C.; Júnior, Severino A.; Simas, Alfredo M.

    2013-01-01

    Lanthanide luminescence has many important applications in anion sensing, protein recognition, nanosized phosphorescent devices, optoelectronic devices, immunoassays, etc. Luminescent europium complexes, in particular, act as light conversion molecular devices by absorbing ultraviolet (UV) light and by emitting light in the red visible spectral region. The quantum yield of luminescence is defined as the ratio of the number of photons emitted over the number of UV photons absorbed. The higher the quantum yield of luminescence, the higher the sensitivity of the application. Here we advance a conjecture that allows the design of europium complexes with higher values of quantum yields by simply increasing the diversity of good ligands coordinated to the lanthanide ion. Indeed, for the studied cases, the percent boost obtained on the quantum yield proved to be strong: of up to 81%, accompanied by faster radiative rate constants, since the emission becomes less forbidden. PMID:23928866

  17. Assembly of europium organic framework–gold nanoparticle composite thin films on silicon substrate

    Energy Technology Data Exchange (ETDEWEB)

    Deep, Akash, E-mail: dr.akashdeep@gmail.com [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kaur, Rajnish [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kumar, Parveen [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Kumar, Pawan; Paul, A.K. [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India)

    2014-08-28

    Metal organic frameworks are a sub-class of coordination polymers and rapidly generating huge research interests in several technological areas. One of the emerging areas of their potential applications is the photovoltaics. The present study proposes the assembly of europium organic framework–gold nanoparticle nanocomposite thin film on silicon substrate. Microscopic, X-ray diffraction, surface area measurement and thermal studies have indicated the formation of the desired thin film. Spectral studies have been used to highlight their solid state optical property. Current–voltage studies have established semiconducting property of the above thin films. - Highlights: • Thin film of europium organic framework/gold nanoparticles is prepared on silicon. • Fairly homogeneous films with a roughness factor of 5–10 nm are obtained. • Above thin films offer solid-state photoluminescence and semiconducting properties.

  18. Synthesis and optical features of an europium organic-inorganic silicate hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Franville, A.C.; Zambon, D.; Mahiou, R.; Chou, S.; Cousseins, J.C. [Universite Blaise Pascal, Aubiere (France). Lab. des Materiaux Inorganiques; Troin, Y. [Laboratoire de Chimie des Heterocycles et des Glucides, EA 987, Universite Blaise-Pascal and ENSCCF, F-63177 Aubiere Cedex (France)

    1998-07-24

    A europium organic-inorganic silicate hybrid was synthesized by grafting a coordinative group (dipicolinic acid) to a silicate network precursor (3-aminopropyltriethoxysilane) via a covalent bonding. Sol-gel process and complexation were performed using different experimental conditions. The hybrid materials, in particular the Eu{sup 3+} coordination mode, were characterized by infrared and luminescence spectroscopies. Morphology of the materials and TG analysis showed that grafted silica enhanced thermal and mechanical resistances of the organic part. (orig.) 7 refs.

  19. Development of a microchip Europium nanoparticle immunoassay for sensitive point-of-care HIV detection.

    Science.gov (United States)

    Liu, Jikun; Du, Bingchen; Zhang, Panhe; Haleyurgirisetty, Mohan; Zhao, Jiangqin; Ragupathy, Viswanath; Lee, Sherwin; DeVoe, Don L; Hewlett, Indira K

    2014-11-15

    Rapid, sensitive and specific diagnostic assays play an indispensable role in determination of HIV infection stages and evaluation of efficacy of antiretroviral therapy. Recently, our laboratory developed a sensitive Europium nanoparticle-based microtiter-plate immunoassay capable of detecting target analytes at subpicogram per milliliter levels without the use of catalytic enzymes and signal amplification processes. Encouraged by its sensitivity and simplicity, we continued to miniaturize this assay to a microchip platform for the purpose of converting the benchtop assay technique to a point-of-care test. It was found that detection capability of the microchip platform could be readily improved using Europium nanoparticle probes. We were able to routinely detect 5 pg/mL (4.6 attomoles) of HIV-1 p24 antigen at a signal-to-blank ratio of 1.5, a sensitivity level reasonably close to that of microtiter-plate Europium nanoparticle assay. Meanwhile, use of the microchip platform effectively reduced sample/reagent consumption 4.5 fold and shortened total assay time 2 fold in comparison with microtiter plate assays. Complex matrix substance in plasma negatively affected the microchip assays and the effects could be minimized by diluting the samples before loading. With further improvements in sensitivity, reproducibility, usability, assay process simplification, and incorporation of portable time-resolved fluorescence reader, Europium nanoparticle immunoassay technology could be adapted to meet the challenges of point-of-care diagnosis of HIV or other health-threatening pathogens at bedside or in resource-limited settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Green Luminescence of Divalent Europium in the Hydride Chloride EuHCl

    NARCIS (Netherlands)

    Kunkel, Nathalie; Rudolph, Daniel; Meijerink, A; Rommel, Stefan; Weihrich, Richard; Kohlmann, Holger; Schleid, Thomas

    Luminescence properties of divalent europium in the mixed-anion hydride chloride EuHCl were studied for the first time. Olive-green single crystals of EuHCl (PbFCl-type structure: tetragonal, P4/nmm, a = 406.58(3) pm, c = 693.12(5) pm, c/a = 1.705, Z = 2) resulted from the reaction of elemental

  1. Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Stollenwerk, Tobias

    2013-09-15

    In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.

  2. Redox electrochemistry of europium fluoride complexes in an equimolar NaCl-KCl melt

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, S.A., E-mail: kuznet@chemy.kolasc.net.ru [Institute of Chemistry, Kola Science Centre RAS, 26 Akademgorodok., 184209 Apatity, Murmansk region (Russian Federation); Gaune-Escard, M. [Ecole Polytechnique, Mecanique Energetique, Technopole de Chateau Gombert, 5 rue Enrico Fermi, 13453 Marseille Cedex 13 (France)

    2011-07-15

    The electrochemical behavior of europium fluoride complexes was studied by different electrochemical methods at a glassy carbon electrode in the temperature range 973-1100 K in the NaCl-KCl melt. The diffusion coefficients of Eu(III) and Eu(II) were determined by linear sweep voltammetry. The standard rate constants of charge transfer for the Eu(III)/Eu(II) redox couple were found on the base cyclic voltammetry, impedance spectroscopy and chronoamperometry data. The formal standard redox potentials E{sub Eu(III)/Eu(II)}{sup *} were obtained by linear sweep and cyclic voltammetry. The electrochemical behavior of europium fluoride and europium chloride complexes in NaCl-KCl melt was compared and discussed in connection with the strength and stability of these complexes. It was shown that the formation of stronger fluoride complexes reduced values of diffusion coefficients, standard rate constants for charge transfer of the Eu(III)/Eu(II) redox couple and shifted the formal standard redox potentials to the more electronegative values.

  3. Lateral flow immunoassay using europium chelate-loaded silica nanoparticles as labels.

    Science.gov (United States)

    Xia, Xiaohu; Xu, Ye; Zhao, Xilin; Li, Qingge

    2009-01-01

    Despite their ease of use, lateral flow immunoassays (LFIAs) often suffer from poor quantitative discrimination and low analytical sensitivity. We explored the use of a novel class of europium chelate-loaded silica nanoparticles as labels to overcome these limitations. Antibodies were covalently conjugated onto europium chelate-loaded silica nanoparticles with dextran as a linker. The resulting conjugates were used as labels in LFIA for detection of hepatitis B surface antigen (HBsAg). We performed quantification with a digital camera and Adobe Photoshop software. We also used 286 clinical samples to compare the proposed method with a quantitative ELISA. A detection limit of 0.03 microg/L was achieved, which was 100 times lower than the colloidal gold-based LFIAs and lower than ELISA. A precise quantitative dose-response curve was obtained, and the linear measurement range was 0.05-3.13 microg/L, within which the CVs were 2.3%-10.4%. Regression analysis of LFIA on ELISA results gave: log (LFIA) = -0.14 log (ELISA) + 1.03 microg/L with r = 0.99 for the quantification of HBsAg in 35 positive serum samples. Complete agreement was observed for the qualitative comparison of 286 clinical samples assayed with LFIA and ELISA. Europium chelate-loaded silica nanoparticle labels have great potential to improve LFIAs, making them useful not only for simple screening applications but also for more sensitive and quantitative immunoassays.

  4. Luminescent solutions and films of new europium complexes with chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Ivanov, Alexey V.; Borisova, Nataliya E.; Kaminskaya, Tatiana P.; Patsaeva, Svetlana V.; Popov, Vladimir V.; Yuzhakov, Viktor I.

    2015-03-01

    The development of new complexes of rare earth elements (REE) with chelating organic ligands opens up the possibility of purposeful alteration in the composition and structure of the complexes, and therefore tuning their optical properties. New ligands possessing two pyridine rings in their structure were synthesized to improve coordination properties and photophysical characteristics of REE compounds. Complexes of trivalent europium with novel chelating ligands were investigated using luminescence and absorption spectroscopy, as well as atomic force microscopy. Luminescence properties of new compounds were studied both for solutions and films deposited on the solid support. All complexes exhibit the characteristic red luminescence of Eu (III) ion with the absolute lumenescence quantum yield in polar acetonitrile solution varying from 0.21 to 1.45 % and emission lifetime ranged from 0.1 to 1 ms. Excitation spectra of Eu coordination complexes correspond with absorption bands of chelating ligand. The energy levels of the triplet state of the new ligands were determined from the phosphorescence at 77 K of the corresponding Gd (III) complexes. The morphology of films of europium complexes with different substituents in the organic ligands was investigated by atomic force microscopy (AFM). It strongly depends both on the type of substituent in the organic ligand, and the rotation speed of the spin-coater. New europium complexes with chelating ligands containing additional pyridine fragments represent outstanding candidates for phosphors with improved luminescence properties.

  5. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength.

    Science.gov (United States)

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2013-01-01

    Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f'' = 11.17 e(-), at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules.

  6. Hydrothermal treatment for preparation of europium-lanthanum phosphates and exploration of their fluorescence properties

    Directory of Open Access Journals (Sweden)

    Hiroaki Onoda

    2014-04-01

    Full Text Available Europium-substituted lanthanum phosphates (Eu; 5 mol% were prepared from lanthanum nitrate, europium nitrate, and sodium polyphosphate solutions by a hydrothermal process at 120 and 160 °C up to 8 h. The obtained phosphates were studied using XRD, IR spectroscopy, TG–DTA, and SEM. UV–vis absorbance and reflectance, as well as fluorescence, were estimated as functional properties of these phosphate materials. We found that samples prepared without hydrothermal treatment were amorphous (as indicated by their XRD patterns, whereas those prepared by a hydrothermal treatment contained peaks corresponding to lanthanum orthophosphate, indicating that the hydrothermal process caused the polyphosphate(s to decompose into orthophosphate(s. The TG–DTA curves of the samples prepared by a hydrothermal treatment were different from those of the samples prepared without hydrothermal treatment. All samples reported herein had no specified shape despite using prolonged hydrothermal treatment times. Although the samples prepared without hydrothermal treatment showed only weak fluorescence peaks, those prepared by a hydrothermal treatment showed strong peaks at 556, 590, 615, and 690 nm. These peaks corresponded to transitions from 5D0 to 7F0, 7F1, 7F2, and 7F4, respectively. Collectively, these results indicate that the hydrothermal treatment is a useful method of obtaining europium-substituted lanthanum phosphates with fluorescence properties.

  7. Fabrication of coated graphite electrode for the selective determination of europium (III) ions.

    Science.gov (United States)

    Upadhyay, Anjali; Singh, Ashok Kumar; Bandi, Koteswara Rao; Jain, A K

    2013-10-15

    Preliminary complexation study showed that two ligands (ionophores) (2-((2-phenyl-2-(pyridin-2-yl)hydazono)methyl)pyridine) [L1], (2-((2-phenyl-2-(pyridin-2-yl)hydazono) methyl)phenol) [L2] can act as europium selective electrode. Europium selective coated graphite electrodes (CGE) were prepared by using ligands [L1] and [L2] and their potentiometric characteristics were determined. Membranes having different compositions of poly(vinylchloride) (PVC), the different plasticizers, anionic additives and ionophores were coated onto the graphite surface. The potential response measurements showed that the best performance was exhibited by the proposed CGE. This electrode had the widest working concentration range, Nernstian slope and fast response times of 10s. The selectivity studies showed that this electrode have higher selectivity towards Eu(3+) over a large number of cations. Furthermore, the electrode generated constant potentials in the pH range 2.7-9.0. This electrode can be used to quantify europium in soil, binary mixtures and also used as an indicator electrode in the potentiometric titration of Eu(3+) with EDTA. The proposed electrode was also successfully applied to the determination of fluoride ions in real samples. © 2013 Elsevier B.V. All rights reserved.

  8. Fluorescent Sulfur-Tagged Europium(III) Coordination Polymers for Monitoring Reactive Oxygen Species.

    Science.gov (United States)

    Wang, Huai-Song; Bao, Wen-Jing; Ren, Shi-Bin; Chen, Ming; Wang, Kang; Xia, Xing-Hua

    2015-07-07

    Oxidative stress caused by reactive oxygen species (ROS) is harmful to biological systems and implicated in various diseases. A variety of selective fluorescent probes have been developed for detecting ROS to uncover their biological functions. Generally, the preparation of the fluorescent probes usually undergoes multiple synthetic steps, and the successful fluorescent sensing usually relies on trial-and-error tests. Herein we present a simple way to prepare fluorescent ROS probes that can be used both in biological and environmental systems. The fluorescent europium(III) coordination polymers (CPs) are prepared by simply mixing the precursors [2,2'-thiodiacetic acid and Eu(NO3)3·6H2O] in ethanol. Interestingly, with the increase of reaction temperature, the product undergoes a morphological transformation from microcrystal to nanoparticle while the structure and fluorescent properties retain. The fluorescence of the sulfur-tagged europium(III) CPs can be selectively quenched by ROS, and thus, sensitive and selective monitoring of ROS in aerosols by the microcrystals and in live cells by the nanoparticles has been achieved. The results reveal that the sulfur-tagged europium(III) CPs provide a novel sensor for imaging ROS in biological and environmental systems.

  9. Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite

    Science.gov (United States)

    Niño-Martínez, Nereyda; Patiño-Marín, Nuria

    2016-01-01

    The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1) in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours. PMID:27965525

  10. Aplicaciones clínicas del radioyodo 131 (I131 en las enfermedades del tiroides Clinical applications of radioiodine 131 (I131 in the thyroid diseases

    Directory of Open Access Journals (Sweden)

    Levi González Rivero

    2012-12-01

    Full Text Available El radioyodo 131 es un isótopo radioactivo que se emplea exitosamente en el diagnóstico y tratamiento de las enfermedades benignas y malignas del tiroides. Su propiedad de integrarse selectivamente al metabolismo del tiroides y emitir una señal, le permite describir el funcionamiento glandular mediante estudios de captación, y delimitar la morfología y localización de los tejidos que capten yodo, a través de la gammagrafía. Es además una radioterapia sencilla, segura y coste-efectiva, usada como primera línea terapéutica en el control del hipertiroidismo, cuya dosis y momento de aplicación debería individualizarse según la etiología y la clínica de cada paciente. El radioyodo 131 ofrece una alternativa eficaz para reducir el tamaño del bocio no tóxico; además, respalda el tratamiento quirúrgico del carcinoma diferenciado del tiroides, y destruye a dosis ablativa los restos tisulares y las lesiones metastásicas que puede identificar durante el seguimiento gammagráfico. El empleo de radioyodo 131 está sujeto al cumplimiento de regulaciones de protección contra la radioactividad.Radioiodine 131 is a radioactive isotope that is successfully used for the diagnosis and the treatment of benign and malignant thyroid diseases. Its quality of selectively integrating to the thyroid metabolism and emitting a signal allows it to describe the gland functioning through capture studies, and to delimit the morphology and location of the tissues that capture iodine by means of gammagraphy. It is also a simple, safe and cost-effective radiotherapy used as first-line therapeutics in the control of hyperthyroidism. The dose and right time of application should be individualized according to the etiology and the clinic of each patient. Radioiodine 131 offers an efficient alternative to reduce the size of non-toxic goiter in addition to supporting the surgical treatment of the differentiated thyroid carcinoma and destroying with ablative doses

  11. Real-time in situ monitoring via europium emission of the photo-release of antitumor cisplatin from a Eu-Pt complex.

    Science.gov (United States)

    Li, Hongguang; Lan, Rongfeng; Chan, Chi-Fai; Jiang, Lijun; Dai, Lixiong; Kwong, Daniel W J; Lam, Michael Hon-Wah; Wong, Ka-Leung

    2015-09-25

    A water-soluble light-responsive antitumor agent, PtEuL, based on a cisplatin-linked europium-cyclen complex has been synthesized and evaluated for controlled cisplatin release by linear/two-photon excitation in vitro with concomitant turn-on and long-lived europium emission as a responsive traceable signal.

  12. Europium doping induced symmetry deviation and its impact on the second harmonic generation of doped ZnO nanowires

    Science.gov (United States)

    Dhara, Soumen; Imakita, Kenji; Mizuhata, Minoru; Fujii, Minoru

    2014-06-01

    In this work, we investigated the effects of europium doping on the second harmonic generation (SHG) of ZnO nanowires (NWs). A non-monotonic enhancement in the SHG is observed with the increase of the europium concentration. Maximum SHG is observed from the 1 at.% europium doped ZnO NWs with an enhancement factor of 4.5. To understand the underlying mechanism, the effective second order non-linear coefficient (deff) is calculated from the theoretical fitting with consideration of the absorption effect. Microstructural characterization reveals the structural deformation of the ZnO NWs caused by europium doping. We estimated the deviation in the crystal site symmetry around the Eu3+ ions (defined as the asymmetric factor) from photoluminescence measurement and it is found to be strongly correlated with the calculated deff value. A strong linear dependence between the magnitudes of deff and the asymmetric factor suggests that deviation in the local site symmetry of the ZnO crystal by europium doping could be the most probable origin of the observed large second order non-linearity.

  13. 27 CFR 19.131 - Restrictions as to locations.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Restrictions as to locations. 19.131 Section 19.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTILLED SPIRITS PLANTS Location and Use § 19.131...

  14. 19 CFR 181.131 - Rules of origin.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Rules of origin. 181.131 Section 181.131 Customs... (CONTINUED) NORTH AMERICAN FREE TRADE AGREEMENT Rules of Origin § 181.131 Rules of origin. (a) The regulations effective October 1, 1995, implementing the rules of origin provisions of General Note 12, HTSUS...

  15. 46 CFR 131.525 - Emergency lighting and power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting and power. 131.525 Section 131.525..., Drills, and Inspections § 131.525 Emergency lighting and power. (a) The master of each vessel shall ensure that the emergency lighting and power systems are tested at least once each week that the vessel...

  16. 46 CFR 131.935 - Prevention of oil pollution.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Prevention of oil pollution. 131.935 Section 131.935... Miscellaneous § 131.935 Prevention of oil pollution. Each vessel must be operated in compliance with— (a) Section 311 of the Federal Water Pollution Control Act, as amended (33 U.S.C. 1321); and (b) 33 CFR parts...

  17. 9 CFR 2.131 - Handling of animals.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling of animals. 2.131 Section 2.131 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.131 Handling of animals. (a) All licensees who maintain wild...

  18. 12 CFR 225.131 - Activities closely related to banking.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Activities closely related to banking. 225.131 Section 225.131 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL... Holding Companies Interpretations § 225.131 Activities closely related to banking. (a) Bank management...

  19. Merkel cell carcinoma and iodine-131 metaiodobenzylguanidine scan

    Energy Technology Data Exchange (ETDEWEB)

    Castagnoli, A.; Biti, G.; De Cristofaro, M.T.R.; Papi, M.G. (Florence Univ. (Italy). Dipt. di Fisiopatologia); Ferri, P. (Florence Univ. (Italy). U.O. Medicina Nuclear USL 10D); Magrini, S.M. (Florence Univ. (Italy). U.O. Radioterapia USL 10D); Bianchi, S. (Florence Univ. (Italy). Ist. di Anatomia Patologica)

    1992-10-01

    Two cases of Merkel cell carcinoma, a neuroendocrine neoplasia of the skin, investigated with iodine, 131 metaiodobenzylguanidine ({sup 131}I-mIBG) scintigraphy, are reported. Uptake in the tumor was evident only in 1 case. The possible diagnostic and therapeutic role of {sup 131}I-mIBG in patients with this rare neoplasm is discussed. (orig.).

  20. 46 CFR 131.965 - Sounding of whistle.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Sounding of whistle. 131.965 Section 131.965 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.965 Sounding of whistle. No vessel may sound its whistle within any harbor limits of the...

  1. 46 CFR 131.555 - Spare parts and repair equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Spare parts and repair equipment. 131.555 Section 131... OPERATIONS Tests, Drills, and Inspections § 131.555 Spare parts and repair equipment. Spare parts and repair... wear or consumption or needs to be replaced regularly. These parts and equipment must be kept aboard...

  2. 46 CFR 131.960 - Use of auto-pilot.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use of auto-pilot. 131.960 Section 131.960 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.960 Use of auto-pilot. When the automatic pilot is used in areas of high traffic density...

  3. 46 CFR 131.805 - General alarm bell, switch.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false General alarm bell, switch. 131.805 Section 131.805 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.805 General alarm bell, switch. The switch in the...

  4. 21 CFR 131.162 - Acidified sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Acidified sour cream. 131.162 Section 131.162 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.162 Acidified sour cream. (a) Description. Acidified sour cream results from the souring of pasteurized cream...

  5. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent but...

  6. 46 CFR 131.940 - Marine sanitation device.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Marine sanitation device. 131.940 Section 131.940... Miscellaneous § 131.940 Marine sanitation device. Each vessel with installed toilet facilities must have a marine sanitation device in compliance with 33 CFR part 159. ...

  7. 46 CFR 131.835 - Portable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Portable fire extinguishers. 131.835 Section 131.835... Markings for Fire Equipment and Emergency Equipment § 131.835 Portable fire extinguishers. (a) Except as provided by paragraph (b) of this section, ach portable fire extinguisher must be marked with a number, and...

  8. 27 CFR 70.131 - Conditions to allowance.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Conditions to allowance. 70.131 Section 70.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Excise and Special (Occupational) Tax Rule of Special Application § 70.131 Conditions to allowance. (a...

  9. 46 CFR 131.945 - Display of plans.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of plans. 131.945 Section 131.945 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.945 Display of plans. Each vessel must have a permanently exhibited, for the guidance of the...

  10. Charge growth, dispersion in europium manganite (EuMnO{sub 3-{delta}}) ceramics revealed using opto-impedance probe

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, S. [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India); Jagannathan, R., E-mail: jags57_99@yahoo.com [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India)

    2011-05-19

    Highlights: > In this study, using opto-, magneto-opto impedance techniques, experimental proof for charge growth in europium manganite (EuMnO{sub 3}) near the region of its Neel temperature is presented. > This study gives data related to dielectric properties of europium manganite. > This study may open-up new avenues for investigating the dielectric characteristics of many electronic-ceramics. - Abstract: In this preliminary report, we present the impedance characteristics of poly-crystalline europium manganite, a promising colossal magneto resistance (CMR) system investigated under optical ({approx}5 eV) and magnetic (0.1 T) perturbations yielding some clues on the charge build-up and dispersion processes. This may possibly be resulting from switching between ferromagnetic and anti-ferromagnetic phases through a charge transfer transition mediated process centering Mn{sup 3+/4+} 3d spins thereby meriting a more detailed study correlating with magnetic measurements.

  11. Rapid and accurate tumor-target bio-imaging through specific in vivo biosynthesis of a fluorescent europium complex.

    Science.gov (United States)

    Ye, Jing; Wang, Jianling; Li, Qiwei; Dong, Xiawei; Ge, Wei; Chen, Yun; Jiang, Xuerui; Liu, Hongde; Jiang, Hui; Wang, Xuemei

    2016-04-01

    A new and facile method for rapidly and accurately achieving tumor targeting fluorescent images has been explored using a specifically biosynthesized europium (Eu) complex in vivo and in vitro. It demonstrated that a fluorescent Eu complex could be bio-synthesized through a spontaneous molecular process in cancerous cells and tumors, but not prepared in normal cells and tissues. In addition, the proteomics analyses show that some biological pathways of metabolism, especially for NADPH production and glutamine metabolism, are remarkably affected during the relevant biosynthesis process, where molecular precursors of europium ions are reduced to fluorescent europium complexes inside cancerous cells or tumor tissues. These results proved that the specific self-biosynthesis of a fluorescent Eu complex by cancer cells or tumor tissues can provide a new strategy for accurate diagnosis and treatment strategies in the early stages of cancers and thus is beneficial for realizing precise surgical intervention based on the relevant cheap and readily available agents.

  12. Polystyrene latex particles containing europium complexes prepared by miniemulsion polymerization using bovine serum albumin as a surfactant for biochemical diagnosis.

    Science.gov (United States)

    Aikawa, Tatsuo; Mizuno, Akihiro; Kohri, Michinari; Taniguchi, Tatsuo; Kishikawa, Keiki; Nakahira, Takayuki

    2016-09-01

    Luminescent particles have been attracting significant attention because they can be used in biochemical applications, such as detecting and imaging biomolecules. In this study, luminescent polystyrene latex particles were prepared through miniemulsion polymerization of styrene with dissolved europium complexes in the presence of bovine serum albumin (BSA) and poly(ethylene glycol) monomethoxy methacrylate as surfactants. The solubility of the europium complex in styrene has a strong effect on the yield of the particle. Europium tris(2-thenoyl trifluoroacetonate) di(tri-n-octyl phosphine oxide), which has a high solubility in styrene, was sufficiently incorporated into the polystyrene particles compared to europium tris(2-thenoyl trifluoroacetonate), which has a low solubility in styrene. The luminescence property of the europium complex could remain intact even after its incorporation through the miniemulsion polymerization. In the aqueous dispersion, the resulting particles could emit strong luminescence, which is a characteristic of the europium complex. The antibody fragments were covalently attached to BSA-covered particles after a reaction with a bifunctional linker, N-(6-maleimidocaproyloxy)succinimide. The time-resolved fluoroimmunoassay technique showed that 3.3pg/mL of human α-fetoproteins (AFP) can be detected by using the resulting luminescent particles. An immunochromatographic assay using the resulting particles was also performed as a convenient method to qualitatively detect biomolecules. The detection limit of AFP measured by the immunochromatographic assay was determined to be 2000pg/mL. These results revealed that the luminescent particles obtained in this study can be utilized for the highly sensitive detection of biomolecules and in vitro biochemical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)

    2016-07-01

    The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.

  14. Electron-induced desorption of europium atoms from oxidized tungsten surface: concentration dependence of low-energy peak

    CERN Document Server

    Davydov, S Y

    2002-01-01

    One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms

  15. Optical properties of europium(III) {beta}-diketonate/polymer-doped systems using supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimova, V.I., E-mail: vis@srd.sinp.msu.ru [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Antoshkov, A.A.; Zavorotny, Yu.S.; Rybaltovskii, A.O. [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Lemenovskii, D.A., E-mail: dali@org.chem.msu.ru [Chemistry Department, Moscow State University, Leninskie Gory 1-3, GSP-1, 119991 Moscow (Russian Federation)

    2013-02-15

    The optical properties of fluoropolymers and polypropylene doped with europium(III) {beta}-diketonates Eu(L){sub 3}{center_dot}2H{sub 2}O and Eu(L){sub 3}phen (L: fod=6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato, bta=4,4,4-trifluoro-1-phenyl-1,3-butanedione, tta=4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione, and phen=1,10-phenanthroline) using supercritical carbon dioxide were investigated by absorption and emission spectra. A comparative analysis of the PL decay times of Eu{sup 3+} ions in the initial europium (III) {beta}-diketonates and impregnated fluoropolymers was carried out. The supercritical fluid (SCF) impregnation of polymer samples with europium(III) {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed differently depending on the type of ligand in the entire investigated impregnation temperature range (T{sub SCF}=50-90 Degree-Sign S). It is shown that from the variety of Eu(L){sub 3}phen only Eu(fod){sub 3}phen can be introduced into the polymer matrix by this method. - Highlights: Black-Right-Pointing-Pointer The optical properties of polymers doped with Eu{sup 3+} {beta}-diketonates using SC CO{sub 2} were investigated. Black-Right-Pointing-Pointer A comparative analysis of the PL decay times in the initial Eu{sup 3+} {beta}-diketonates and doped polymers was carried out. Black-Right-Pointing-Pointer The SC CO{sub 2} impregnation of polymers with Eu{sup 3+} {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed.

  16. Reverse lyotropic liquid crystals from europium nitrate and P123 with enhanced luminescence efficiency.

    Science.gov (United States)

    Yi, Sijing; Li, Qintang; Liu, Hongguo; Chen, Xiao

    2014-10-02

    Fabrication of lyotropic aggregates containing the lanthanide ions is becoming a preferable way to prepare novel functional materials. Here, the lyotropic liquid crystals (LLCs) of reverse hexagonal, reverse bicontinuous cubic, and lamellar phases have been constructed in sequence directly from the mixtures of Eu(NO3)3·6H2O and Pluronic P123 amphiphilc block copolymer with increasing the salt proportion. Their phase types and structural characteristics were analyzed using polarized optical microscopy (POM) and small-angle X-ray scattering (SAXS) measurements. The driving forces of reverse LLC phase formation were investigated using Fourier-transformed infrared spectroscopy (FTIR) and rheological measurements. The hydrated europium salt was found to act not only as a solvent here, but also as the bridge to form hydrogen bonding between coordinated water molecules and PEO blocks, which played a key role in the reverse LLCs formation. Compared to those in aqueous solutions and solid state, the enhanced luminescence quantum yields and prolonged excited state lifetimes were observed in two europium containing reverse mesophases. The luminescence quenching effect of lanthanide ions was efficiently suppressed, probably due to the substitution of coordinated water molecules by oxyethyl groups of P123 and ordered phase structures of LLCs, where the coordinated europium ions were confined and isolated by PEO blocks. The optimum luminescence performance was then found to exist in the reverse hexagonal phase. The obtained results on such lanthanide-induced reverse LLCs should be referable for designing new luminescent soft materials construction to expand their application fields.

  17. How Do Radionuclides Accumulate in Marine Organisms? A Case Study of Europium with Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Shuh, David K; Minasian, Stefan G; Pacold, Joseph I; Solari, Pier-Lorenzo; Michel, Hervé; Oberhaensli, François R; Bottein, Yasmine; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2016-10-04

    In the ocean, complex interactions between natural and anthropogenic radionuclides, seawater, and diverse marine biota provide a unique window through which to examine ecosystem and trophic transfer mechanisms in cases of accidental dissemination. The nature of interaction between radionuclides, the marine environment, and marine species is therefore essential for better understanding transfer mechanisms from the hydrosphere to the biosphere. Although data pertaining to the rate of global transfer are often available, little is known regarding the mechanism of environmental transport and uptake of heavy radionuclides by marine species. Among marine species, sponges are immobile active filter feeders and have been identified as hyperaccumulators of several heavy metals. We have selected the Mediterranean sponge Aplysina cavernicola as a model species for this study. Actinide elements are not the only source of radioactive release in cases of civilian nuclear events; however, their physicochemical transfer mechanisms to marine species remain largely unknown. We have targeted europium(III) as a representative of the trivalent actinides such as americium or curium. To unravel biological uptake mechanisms of europium in A. cavernicola, we have combined radiometric (γ) measurements with spectroscopic (time-resolved laser-induced fluorescence spectroscopy, TRLIFS, and X-ray absorption near-edge structure, XANES) and imaging (transmission electron microscopy, TEM, and scanning transmission X-ray microscopy, STXM) techniques. We have observed that the colloids of NaEu(CO3)2·nH2O formed in seawater are taken up by A. cavernicola with no evidence that lethal dose has been reached in our working conditions. Spectroscopic results suggest that there is no change of speciation during uptake. Finally, TEM and STXM images recorded at different locations across a sponge cross section, together with differential cell separation, indicate the presence of europium particles (around

  18. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova

    2012-03-01

    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  19. Synergistic extraction of europium and americium into nitrobenzene by using hydrogen dicarbollylcobaltate and dodecaethylene glycol.

    Science.gov (United States)

    Makrlík, Emanuel; Vaňura, Petr; Selucký, Pavel

    2013-01-01

    Extraction of microamounts of europium and americium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of dodecaethylene glycol (DDEG, L) has been investigated. The equilibrium data have been explained assuming that the species HL+, H2L2+, ML3+ and MH-1L2+ (M3+ = Eu3+, Am3+; L = DDEG) are extracted into the organic phase. The values of extraction and stability constants of the complex species in nitrobenzene saturated with water have been determined. It was found that in this nitrobenzene medium, the stability constant of the EuL3+ complex is comparable with that of AmL3+.

  20. Red/blue electroluminescence from europium-doped organic light emitting diodes

    Science.gov (United States)

    Hagen, Joshua A.; Li, Wayne X.; Grote, James G.; Steckl, Andrew J.

    2006-02-01

    Red/Blue emitting organic light emitting diodes (OLED) devices have been obtained using a Europium-doped organic emitting layer (NPB:Eu). The Eu-doped OLEDs emit in 2 color ranges: a broad blue (~420-500nm) band due to NPB emission and a narrow red peak at 620nm due to Eu emission. The red/blue devices achieve a brightness ~13x more intense than a similarly structured green (Alq 3) emitting OLED. These NPB:Eu emitting structures also reach a maximum efficiency of 0.2 cd/A at brightnesses above 100 cd/m2.

  1. Test of zircon materials for sorption of europium; Pruebas de materiales circoniferos para sorcion de europio

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-01

    In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)

  2. Sol-Gel Synthesis, X-Ray Diffraction Studies, and Electric Conductivity of Sodium Europium Silicate

    Directory of Open Access Journals (Sweden)

    Ekaterina V. Borisova

    2013-01-01

    Full Text Available Sodium europium silicate, NaEu9(SiO46O2, with apatite structure has been obtained and studied using X-ray diffraction and SEM. It has been shown that sodium sublimation does not take place upon synthesis by the sol-gel method. Rietveld refinement has revealed that sodium atoms are ordered and occupy the 4f position. O(4 atoms not related to silicate ions are placed at the centers of Eu(2 triangles. DC and AC electric conductivity and activation energy have been determined for the compound studied.

  3. New Class of Bright and Highly Stable Chiral Cyclen Europium Complexes for Circularly Polarized Luminescence Applications.

    Science.gov (United States)

    Dai, Lixiong; Lo, Wai-Sum; Coates, Ian D; Pal, Robert; Law, Ga-Lai

    2016-09-06

    High glum values of +0.30 (ΔJ = 1, 591 nm, in DMSO) and -0.23 (ΔJ = 1, 589 nm, in H2O) were recorded in our series of newly designed macrocyclic europium(III) complexes. A sterically locking approach involving a bidentate chromophore is adopted to control the formation of one stereoisomer, giving rise to extreme rigidity, high stability, and high emission intensity. The combination of a chiral substituent on a macrocyclic chelate for lanthanide ions opens up new perspectives for the further development of circulary polarized luminescent chiral tags in optical and bioapplications.

  4. A microemulsion preparation of nanoparticles of europium in silica with luminescence enhancement using silver

    Science.gov (United States)

    Ma, Zhi Ya; Dosev, Dosi; Kennedy, Ian M

    2010-01-01

    A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core–silica shell (Ag@SiO2) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag@SiO2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability. PMID:19417456

  5. Metal Controlled Diastereoselective Self-assembly and Circularly Polarized Luminescence of a Chiral Heptanuclear Europium Wheel

    Science.gov (United States)

    Bozoklu, Gülay; Gateau, Christelle; Imbert, Daniel; Pécaut, Jacques; Robeyns, Koen; Filinchuk, Yaroslav; Memon, Farah; Muller, Gilles

    2012-01-01

    The chiral dissymmetric tetradentate ligand SPhbipox (6’-(4-phenyloxazolin-2-yl)-2,2’-bipyridine-6-carboxylic acid) leads to the diastereoselective assembly of a homochiral Eu(III) triangle and of a highly emissive (QY=27%) heptanuclear wheel which is the largest example of chiral luminescent complex of Eu(III) reported to date. We show that the nuclearity of the assembly is controlled by the solvent and the europium cation. All the compounds show large circularly polarized luminescence with an activity which varies with the nature of the assembly (highest for the homochiral trimer). PMID:22548280

  6. A europium(III)-based PARACEST agent for sensing singlet oxygen by MRI

    Science.gov (United States)

    Song, Bo; Wu, Yunkou; Yu, Mengxiao; Zhao, Piyu; Zhou, Cheng; Kiefer, Garry E.

    2013-01-01

    A europium (III) DOTA-tetraamide complex was designed as a MRI sensor of singlet oxygen (1O2). The water soluble, thermodynamically stable complex reacts rapidly with 1O2 to form an endoperoxide derivative that results in an ∼3 ppm shift in the position of the Eu(III)-bound water chemical exchange saturation transfer (CEST) peak. The potential of using this probe to detect accumulation of the endoperoxide derivative in biological media by ratiometric CEST imaging was demonstrated. PMID:23575743

  7. Methodology to administer therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment of the thyroid cancer with Iodine-131, as well as the use of citric fruits to stimulate the salivation, the post-dose administration of liquids to accelerate the gastric emptying avoiding the secondary effects as the vomit is included. (Author)

  8. Volatility of radiopharmacy-prepared sodium iodide-131 capsules.

    Science.gov (United States)

    Bright, J M; Rees, T T; Baca, L E; Green, R L

    2000-03-01

    The aims of this study were to quantify the extent of volatilization from 131I-NaI therapeutic capsules prepared in a centralized radiopharmacy and to quantify the amount of volatile 131I released from a dispensing vial containing a compounded 131I-NaI therapy capsule. Therapy capsules were prepared by injecting 131I oral solution into capsules containing anhydrous dibasic sodium phosphate. Volatilized activity was obtained by filtering air drawn across samples that were placed open on the bottom of a sample holder cup. Volatile 131I was captured by filtering it through 3 triethylenediamine-impregnated carbon cartridge filters, arranged in series. To quantify the amount of volatile 131I released from a dispensing vial during a simulated patient administration, a vial containing a compounded 131I therapy capsule was opened inside a collapsible plastic bag and all the air was drawn across TEDA-impregnated carbon cartridge filters. The 370-MBq (10-mCi) 131I capsules from the first part of the experiment released an average of 0.035% (SD 0.031%) of the capsule activity on the first day, 0.012% (SD 0.002%) on the second day, and 0.012% (SD < 0.001%) for days 3 through 5. The 37-MBq (1-mCi) 131I capsules released an average of 0.058% (SD 0.025%) on the first day, 0.029% (SD 0.009%) on the second day, and 0.020% (SD 0.004%) on the third day. The activity released from the vial during a simulated patient administration was 0.00093% of the 131I capsule activity. The amount of 131I, which volatilized daily from the exposed therapy capsules, was a small percentage of the capsule activity. The volatile 131I that would be released during a patient administration was much less than the activity that volatilized from the exposed therapy capsules.

  9. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  10. Colloidal europium nanoparticles via a solvated metal atom dispersion approach and their surface enhanced Raman scattering studies.

    Science.gov (United States)

    Urumese, Ancila; Jenjeti, Ramesh Naidu; Sampath, S; Jagirdar, Balaji R

    2016-08-15

    Chemistry of lanthanide metals in their zerovalent state at the nanoscale remains unexplored due to the high chemical reactivity and difficulty in synthesizing nanoparticles by conventional reduction methods. In the present study, europium(0) nanoparticles, the most reactive of all the rare earth metals have been synthesized by solvated metal atom dispersion (SMAD) method using hexadecyl amine as the capping agent. The as-prepared europium nanoparticles show surface Plasmon resonance (SPR) band in the visible region of the electromagnetic spectrum. This lead to the investigation of its surface enhanced Raman scattering (SERS) using visible light excitation source. The SERS activity of europium nanoparticles has been followed using 4-aminothiophenol and biologically important molecules such as hemoglobin and Cyt-c as the analytes. This is the first example of lanthanide metal nanoparticles as SERS substrate which can possibly be extended to other rare-earth metals. Since hemoglobin absorbs in the visible region, the use of visible light excitation source leads to surface enhanced resonance Raman spectroscopy (SERRS). The interaction of biomolecules with Eu(0) has been followed using FT-IR and UV-visible spectroscopy techniques. The results indicate that there is no major irreversible change in the structure of biomolecules upon interaction with europium nanoparticles. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Rapid screening of oxytetracycline residue in catfish muscle by dispersive liquid-liquid microextraction and europium-sensitized luminescence

    Science.gov (United States)

    Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...

  12. Luminescence variations in europium-doped silicon-substituted hydroxyapatite nanobiophosphor via three different methods

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Cao Xuan; Pham, Vuong-Hung, E-mail: vuong.phamhung@hust.edu.vn

    2015-07-15

    Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.

  13. Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS

    CERN Document Server

    AUTHOR|(CDS)2099873; Marsh, Bruce Alan

    The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...

  14. Structural and electrical properties of the europium-doped indium zinc oxide thin film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Chu-Chi, E-mail: ccting@ccu.edu.tw [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Advanced Institute for Manufacturing with High-Tech Innovations, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Li, Wei-Yang; Wang, Ching-Hua; Yong, Hua-En [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China)

    2014-07-01

    The EuInZnO (EIZO) thin film transistor (TFT) devices were fabricated by the sol–gel spin-coating technique. The EIZO TFT operates in the n-channel depletion mode and exhibits a well-defined pinch-off and saturation region. Because europium ion possesses lower electronegativity (1.2) and standard electrode potential (− 1.991 V), it can act as the carrier suppressor to reduce the carrier concentrations of the IZO (In:Zn = 1:1) thin film. Eu{sup 3+} (13 mol%)-doped IZO TFT possesses the optimum performance, and its field-effect mobility in the saturated regime, threshold voltage, on–off ratio, and S-factor are 1.23 cm{sup 2}/Vs, 3.28 V, 1.07 × 10{sup 6}, and 2.28 V/decade, respectively. - Highlights: • Europium ions can act as the carrier suppressor in the InZnO system. • The EuInZnO forms an n-channel material for the thin film transistor (TFT) device. • The optimum performance of the EuInZnO TFT is the sample with 13 mol% Eu{sup 3+} doping.

  15. Europium phosphomolybdate and osmium metallopolymer multi-functional LbL films: redox and electrocatalytic properties.

    Science.gov (United States)

    Fernandes, Diana M; Vos, Johannes G; Freire, Cristina

    2014-04-15

    Hybrid multilayer films composed by osmium metallopolymer [Os(bpy)2(PVP)10Cl]Cl (Os-poly) and europium phosphomolybdate, K₁₁[Eu(III)(PMo₁₁O₃₉)₂] (Eu(PMo11)2), were prepared using the electrostatic layer-by-layer (LbL) self-assembly method. The film build-up, monitored by electronic spectroscopy, showed a regular stepwise growth indicating a strong interaction between layers. The XPS measurements corroborated the successful fabrication of the hybrid films with the Os-poly/Eu(PMo11)2 composition. SEM images revealed a completely covered surface with a highly roughened texture. Electrochemical characterisation of films by cyclic voltammetry revealed three Mo-based reduction processes (Mo(VI)→Mo(V)) in the potential range between -0.4 and 0.1 V and one Os reduction process (Os(III)→Os(II)) at ≈0.270 V. The cyclic voltammograms of two electroactive probes, [Fe(CN)₆](3-/4-) and [Ru(NH₃)₆](3+/2+) on {Os-poly/Eu(PMo11)2}n modified electrodes revealed redox mediation between film and the probes. Furthermore, the {Os-poly/Eu(PMo11)2}n multilayer films also showed excellent Mo-based electrocatalytic activity towards reduction of nitrite and iodate, confirming the multi-functional properties of the hybrid europium phosphomolybdate - osmium metallopolymer LbL films. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  17. pH-controlled delivery of luminescent europium coated nanoparticles into platelets

    Science.gov (United States)

    Davies, Amy; Lewis, David J.; Watson, Stephen P.; Thomas, Steven G.; Pikramenou, Zoe

    2012-01-01

    Water soluble, luminescent gold nanoparticles are delivered into human platelets via a rapid, pH-controlled mechanism using a pH low insertion peptide, pHLIP. The approach introduces cocoating of gold nanoparticles with a europium luminescent complex, EuL and the pHLIP peptide to give pHLIP•EuL•Au. The 13-nm diameter gold nanoparticles act as a scaffold for the attachment of both the luminescent probe and the peptide to target delivery. Their size allows delivery of approximately 640 lanthanide probes per nanoparticle to be internalized in human platelets, which are not susceptible to transfection or microinjection. The internalization of pHLIP•EuL•Au in platelets, which takes just minutes, was studied with a variety of imaging modalities including luminescence, confocal reflection, and transmission electron microscopy. The results show that pHLIP•EuL•Au only enters the platelets in low pH conditions, pH 6.5, mediated by the pHLIP translocation across the membrane, and not at pH 7.4. Luminescence microscopy images of the treated platelets show clearly the red luminescence signal from the europium probe and confocal reflection microscopy confirms the presence of the gold particles. Furthermore, transmission electron microscopy gives a detailed insight of the internalization and spatial localization of the gold nanoparticles in the platelets. Thus, we demonstrate the potential of the design to translocate multimodal nanoparticle probes into cells in a pH dependent manner. PMID:22308346

  18. Analysis of metal surfaces coated with europium-doped titanium dioxide by laser induced breakdown spectroscopy.

    Science.gov (United States)

    Głogocka, Daria; Noculak, Agnieszka; Pucińska, Joanna; Jopek, Wojciech; Podbielska, Halina; Langner, Marek; Przybyło, Magdalena

    2015-01-01

    The surface passivation with titanium sol-gel coatings is a frequently used technique to control the adsorption of selected biological macromolecules and to reduce the exposure of the bulk material to biological matter. Due to the increasing number of new coating-preparation methods and new gel compositions with various types of additives, the quality and homogeneity determination of the surface covering is a critical factor affecting performance of any implanted material. While coating thickness is easy to determine, the homogeneity of the surface distribution of coating materials requires more elaborate methodologies. In the paper, the laser induced breakdown spectroscopy (LIBS) based method, capable to quantitate the homogeneity and uniformity of the europium in titanium dioxide sol-gel coatings on stainless steel surfaces prepared with two different procedures: spin-coating and dip-coating, is presented. The emission intensity of titanium has been used to determine the coating thickness whereas the relative values of europium and titanium emission intensities provide data on the coating homogeneity. The obtained results show that the spin-coating technique provides better surface coverage with titanium dioxide. However, when the surface coating compositions were compared the dip-coating technique was more reliable.

  19. Europium(III) Macrocyclic Complexes with Alcohol Pendant Groups as Chemical Exchange Saturation Transfer Agents

    Science.gov (United States)

    Woods, Mark; Woessner, Donald E.; Zhao, Piyu; Pasha, Azhar; Yang, Meng-Yin; Huang, Ching-Hui; Vasalitiy, Olga; Morrow, Janet R.; Sherry, A. Dean

    2009-01-01

    Paramagnetic lanthanide(III) complexes that contain hyperfine-shifted exchangeable protons offer considerable advantages over diamagnetic molecules as chemical exchange saturation transfer (CEST) agents for MRI. As part of a program to investigate avenues to improve the sensitivity of such agents, the CEST characteristics of europium(III) macrocyclic complexes having appended hydroxyethyl groups were investigated. The CEST spectrum of the asymmetrical complex, EuCNPHC3+, shows five distinct peaks for each magnetically nonequivalent exchangeable proton in the molecule. The CEST spectra of this complex were fitted to NMR Bloch theory to yield exchange rates between each of six exchanging proton pools (five on the agent plus bulk water). Exchange between the Eu3+-bound hydroxyl protons and bulk water protons was slow in dry acetonitrile but accelerated incrementally upon stepwise addition of water. In pure water, exchange was too fast to observe a CEST effect. The utility of this class of europium(III) complex for CEST imaging applications is ultimately limited by the small chemical shifts induced by the hydroxyl-appended ligands of this type and the resulting small Δω values for the exchangeable hydroxyl protons. PMID:16881645

  20. Red light emission from europium doped zinc sodium bismuth borate glasses

    Science.gov (United States)

    Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.

    2017-12-01

    Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.

  1. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  2. Induced Europium Circularly Polarized Luminescence Monitors Reversible Drug Binding to Native α1 -Acid Glycoprotein.

    Science.gov (United States)

    Jennings, Laura; Waters, Ryan S; Pal, Robert; Parker, David

    2017-02-03

    Alpha-1-acid glycoprotein (α1 -AGP) is an important blood plasma glycoprotein. Following an acute-phase reaction such as stress, inflammation, burn, or infection, the bloodstream concentration of α1 -AGP can increase up to 400 % of its normal concentration. A wide range of drugs is known to bind α1 -AGP. Increased binding of pharmacologically active compounds to α1 -AGP moderates their clinical effect by decreasing the amount of unbound drug in the bloodstream. This has important clinical ramifications for such applications as the duration of anesthesia and in determining dosage for drug therapy. In this study, the competitive binding to α1 -AGP of a dynamically racemic europium(III) complex with seven pharmacologically active drugs absorbing in the range λ 250-290 nm was monitored by following changes in europium total emission and in induced circularly polarized luminescence (CPL). Binding affinities corresponding to Kd values in the range 0.5-100 μm were measured, in good agreement with published data. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

    Directory of Open Access Journals (Sweden)

    Zhang Kui-Hua

    2011-01-01

    Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

  4. Escherichia coli ST131, an intriguing clonal group.

    Science.gov (United States)

    Nicolas-Chanoine, Marie-Hélène; Bertrand, Xavier; Madec, Jean-Yves

    2014-07-01

    In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Escherichia coli ST131, an Intriguing Clonal Group

    Science.gov (United States)

    Bertrand, Xavier; Madec, Jean-Yves

    2014-01-01

    SUMMARY In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. PMID:24982321

  6. "Rigid" Luminescent Soft Materials: Europium-Containing Lyotropic Liquid Crystals Based on Polyoxyethylene Phytosterols and Ionic Liquids.

    Science.gov (United States)

    Yi, Sijing; Wang, Jiao; Feng, Zhenyu; Chen, Xiao

    2017-10-05

    Soft materials of europium β-diketonate complexes constructed in lyotropic liquid crystals (LLCs) mediated by ionic liquids (ILs) are impressive for their excellent luminescence performance and stability. For the aim to further improve their mechanical processability and luminescent tunablility, the polyoxyethylene phytosterols (BPS-n) were introduced here as structure directing agents to prepare relatively "rigid" lamellar luminescent LLCs in 1-butyl-3-methyl-imidazolium hexafluorophosphate by doping europium β-diketonate complexes with different imidazolium counterions. As a result of the solvophobic sterol ring structure of BPS-n, the more effective isolation and confinement effects of europium complexes could be achieved. The longest fluorescence lifetime and the highest quantum efficiency reported so far for europium containing lyotropic organized soft materials were thus obtained. Changing the molecular structures of BPS-n with different oxyethylene chains or doped complexes with imidazolium counterions of different alkyl chain lengths, the spacings of lamellar LLC matrixes and position of dispersed complexes became tunable. The measured luminescent and rheological properties for such composite LLCs showed a dependence on the rigidity and isolation capability afforded by sterol molecules. It was also found that the increase of counterion alkyl chain length would weaken the LLC matrix's confinement and isolation effects and therefore exhibit the deteriorated luminescence performance. The enhanced luminescence efficiency and stability of doped BPS-n LLCs reflected the excellent segregation of europium complexes from each other and therefore the reduced self-quenching process. The obtained results here present the designability of LLC matrixes and their great potential to promote achieving the luminescence tunability of soft materials.

  7. Preparation and photoluminescence of some europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dunjia, E-mail: dunjiawang@163.com; Pi, Yan; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Wei, Xianhong

    2013-10-15

    Highlights: •Preparation of europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands. •Photoluminescence behavior of europium (III) ternary complexes. •Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), the lifetime (τ) and the luminescent quantum yield (η). -- Abstract: Preparation and photoluminescence behavior of four new europium (III) ternary complexes with β-diketones (1-(6-methoxy-naphthalen-2-yl)-3-phenyl-propane-1,3-dione (MNPPD) and 1-(4-tert-butyl-phenyl)-3-(6-methoxy-naphthalen-2-yl)-propane-1,3-dione (BPMPD)) and 2,2-dipyridine (Bipy) or 1,10-phenanthroline (Phen) were reported, in the solid state. Complexes Eu(MPPD){sub 3}·Bipy, Eu(BMPD){sub 3}·Bipy, Eu(MPPD){sub 3}·Phen and Eu(BMPD){sub 3}·Phen were characterized by elemental analysis, FT-IR, {sup 1}H NMR, UV–vis absorption. The emission spectra show narrow emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion. Based on the emission spectra and luminescence decay curves in solid state, the intensity parameters (Ω{sub t}), lifetime (τ) and emission quantum efficiency (η) were determined. The Ω{sub 2} values indicate that the Eu(III) ion in these complexes is in a highly polarizable chemical environment. Complexes Eu(MPPD){sub 3}·Bipy and Eu(MPPD){sub 3}·Phen showed a longer lifetime (τ) and a higher luminescence quantum efficiency (η), which indicated that the energy transfer to the europium ion from MNPPD ligand is more efficient than that from BPMPD ligand.

  8. Renal 131I-hippuran extraction in man

    DEFF Research Database (Denmark)

    Hutchings, M; Hesse, B; Grønvall, J

    2002-01-01

    This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine.......This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine....

  9. 29 CFR 452.131 - Casting of ballots; delegate elections.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Casting of ballots; delegate elections. 452.131 Section 452... REPORTING AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.131 Casting of ballots; delegate elections. The manner in which the votes of the representatives are cast in the convention is not...

  10. 46 CFR 131.320 - Safety orientation for offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Safety orientation for offshore workers. 131.320 Section... OPERATIONS Preparations for Emergencies § 131.320 Safety orientation for offshore workers. (a) Before a... informing each offshore worker of— (1) In general terms, emergency and evacuation procedures; (2) Locations...

  11. 28 CFR 35.131 - Illegal use of drugs.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Illegal use of drugs. 35.131 Section 35... STATE AND LOCAL GOVERNMENT SERVICES General Requirements § 35.131 Illegal use of drugs. (a) General. (1... an individual based on that individual's current illegal use of drugs. (2) A public entity shall not...

  12. 21 CFR 155.131 - Canned field corn.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned field corn. 155.131 Section 155.131 Food... Canned field corn. (a) Identity. (1) Canned field corn conforms to the definition and standard of... corn by § 155.130(a), except that the corn ingredient consists of succulent field corn or a mixture of...

  13. 41 CFR 105-71.131 - Real property.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Real property. 105-71.131 Section 105-71.131 Public Contracts and Property Management Federal Property Management... any actual and reasonable selling and fixing-up expenses. If the grant is still active, the net...

  14. 10 CFR 71.131 - Nonconforming materials, parts, or components.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Nonconforming materials, parts, or components. 71.131... RADIOACTIVE MATERIAL Quality Assurance § 71.131 Nonconforming materials, parts, or components. The licensee..., segregation, disposition, and notification to affected organizations. Nonconforming items must be reviewed and...

  15. 47 CFR 22.131 - Procedures for mutually exclusive applications.

    Science.gov (United States)

    2010-10-01

    .... 22.131 Section 22.131 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER... public in advance. (c) Procedures. Generally, the Commission may grant one application in a filing group... excluded by that grant, pursuant to § 1.945 of this chapter. (1) Selection methods. In selecting the...

  16. 46 CFR 131.545 - Maintenance in general.

    Science.gov (United States)

    2010-10-01

    ... points with the recommended lubricants. (5) A list of replaceable parts. (6) A list of sources of spare parts. (7) A log for records of inspections, maintenance, and repair. (b) The master shall ensure that... 46 Shipping 4 2010-10-01 2010-10-01 false Maintenance in general. 131.545 Section 131.545 Shipping...

  17. 45 CFR 96.131 - Treatment services for pregnant women.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Treatment services for pregnant women. 96.131... Substance Abuse Prevention and Treatment Block Grant § 96.131 Treatment services for pregnant women. (a) The State is required to, in accordance with this section, ensure that each pregnant woman in the State who...

  18. 46 CFR 131.955 - Display of merchant mariner credential.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of merchant mariner credential. 131.955 Section... OPERATIONS Miscellaneous § 131.955 Display of merchant mariner credential. Each officer on a vessel must conspicuously display his or her license or officer endorsements as required by 46 U.S.C. 7110. ...

  19. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.

    1982-03-01

    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  20. Syntheses and electroluminescent properties of two europium ternary complexes Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT)

    Energy Technology Data Exchange (ETDEWEB)

    Guan Min [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Gao Lihua [Department of Chemistry, Beijing Normal University, Beijing 100875 (China); Wang Shanshan [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Huang Chunhui [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China)], E-mail: chhuang@pku.edu.cn; Wang Kezhi [Department of Chemistry, Beijing Normal University, Beijing 100875 (China)

    2007-12-15

    Two europium complexes, Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT) (DBM=dibenzoylmethanato, PBO=2-(2-pyridyl)benzoxazole, PBT=2-(2-pyridyl)benzothiazole), were prepared and used as emitting materials in organic electroluminescent (EL) devices. The devices with the structures ITO/TPD/Eu(DBM){sub 3}(PBO) (or Eu(DBM){sub 3}(PBT)/BCP/Alq{sub 3}/Mg:Ag/Ag emit red light originating from the europium complexes.

  1. [sup 131]I-metaiodobenzylguanidine therapy for malignant pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Sakahara, Harumi; Saga, Tsuneo; Hosono, Makoto; Kobayashi, Hisataka; Konishi, Junji (Kyoto Univ. (Japan). Faculty of Medicine); Endo, Keigo

    1994-05-01

    [sup 131]I-metaiodobenzylguanidine (MIBG) therapy was given to five patients with malignant pheochromocytoma. The patients received 1-3 doses of 3.33-4.625 GBq (total dose: 3.7 to 10.73 GBq). Partial tumor regression was observed in two patients, the tumor was unchanged in two patients, and slow progression was noted in one patient. Marked improvement in clinical symptoms was achieved in four patients. The other patients had no symptoms before [sup 131]I-MIBG treatment, but the serum epinephrine and dopamine decreased. There were no severe untoward responses in four patients. However, one patient developed transient but severe orthostatic hypotension, hypertension, and hyperglycemia from 1 week to 1 month after [sup 131]I-MIBG administration. Although complete remission was not obtained, all the patients achieved some benefit from [sup 131]I-MIBG therapy. Thus, [sup 131]I-MIBG appears to be useful for the palliation of malignant pheochromocytoma. (author).

  2. Stability constants of europium complexes with a nitrogen heterocycle substituted methane-1,1-diphosphonic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, M.P.; Rickert, P.G.; Schmidt, M.A.; Nash, K.L.

    1996-06-01

    Even in moderately acidic solutions ([H{sup +}] > 0.01 M), N-piperidinomethane-1,1-diphosphonic acid (H{sub 4}PMDPA) is a strong complexant of trivalent lanthanide ions that shows enhanced complex solubility over previously studied 1,1-diphosphonic acids. The protonation constants of PMDPA in 2.0 M H/NaClO{sub 4} were determined by potentiometric and NMR titrations, and the stability constants for formation of complexes with Eu{sup 3+} were determined by solvent extraction. Difference in protonation equilibria induced by addition of the nitrogen heterocycle results in an increase in the complexation strength of PMDPA. In solutions containing 0.1 M H{sup +} and ligand concentrations greater than 0.02 M, PMDPA is the most effective 1,1-diphosphonic acid for europium complexation studied thus far.

  3. Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio

    Energy Technology Data Exchange (ETDEWEB)

    Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)

  4. First principles description of the insulator-metal transition in europium monoxide

    KAUST Repository

    Wang, Hao

    2012-02-01

    Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.

  5. Development of europium doped BaSO4 TL OSL dual phosphor for radiation dosimetry applications

    Science.gov (United States)

    Patle, Anita; Patil, R. R.; Kulkarni, M. S.; Bhatt, B. C.; Moharil, S. V.

    2015-08-01

    This paper presents the results on the preparation and characterization of Europium-doped Barium sulfate (BaSO4: Eu) TL /OSL dual phosphor. The OSL sensitivity was found to be 11% of the commercially available Al2O3: C, using area integration method. The sample also shows good TL sensitivity and the dosimetric peak appears around 190°C with a shoulder at 282°C. After OSL readout, No change in the TL glow curve is observed. Since the observed TL peaks are not responsible for the observed OSL, good OSL as well as TL sensitivity and low fading will make this phosphor suitable for applications in radiation dosimetry using OSL as well as TL.

  6. Chemiluminescence determination of tetracyclines using Fenton system in the presence europium(III) ions

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan, E-mail: blis@amu.edu.pl [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)

    2009-04-20

    A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.

  7. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A., E-mail: japojman@lsu.edu [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803-1804 (United States)

    2014-06-15

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  8. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics.

    Science.gov (United States)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A

    2014-06-01

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  9. Electrochemiluminescence Study of Europium (III Complex with Coumarin3-Carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Stefan Lis

    2008-01-01

    Full Text Available The europium (III complex of coumarin-3-carboxylic acid (C3CA has been prepared and characterized on the basis of elemental analysis, IR, and emission (photoluminescence and electrochemiluminescence spectroscopy. The synthesised complex having a formula Eu(C3CA2(NO3(H2O2 was photophysically characterized in solution and in the solid state. Electrochemiluminescence, ECL, of the system containing the Eu(III/C3CA complex was studied using an oxide-covered aluminium electrode. The goal of these studies was to show the possibility of the use of electrochemical excitation of the Eu(III ion in aqueous solution for emission generation. The generated ECL emission was very weak, and therefore its measurements and spectral analysis were carried out with the use of cut-off filters method. The studies proved a predominate role of the ligand-to-metal energy transfer (LMET in the generated ECL.

  10. Europium incorporated in silica matrix obtained by sol-gel: luminescent materials

    Directory of Open Access Journals (Sweden)

    Nassar Eduardo José

    2003-01-01

    Full Text Available In this work we report some aspects of the chemistry involved in the preparation of modified silicon oxide by the sol-gel process. Europium III compounds were used as luminescent probe. An organic-inorganic hybrid was obtained by hydrolysis of tetraethylorthosilicate (TEOS and 3-aminopropyltriethoxysilane (APTS. The Eu III compounds were added in different ways. In the first, silica was prepared in the presence of Eu III, and in the second, Eu III was added on the silica surface. These materials were studied by luminescence, infrared spectroscopy and termogravimetric analysis. The results obtained for the hybrid material show different behavior for Eu III emission, which could be excited by the antenna effect and the influence of the surrounding in the luminescence quenching. The thermogravimetric data present different mass loss in samples to range temperature 50 - 150 °C. Thermogravimetric and infrared spectra showed that inorganic polymers incorporated the organic part.

  11. Europium as an inhibitor of Amyloid-β(1-42) induced membrane permeation.

    Science.gov (United States)

    Williams, Thomas L; Urbanc, Brigita; Marshall, Karen E; Vadukul, Devkee M; Jenkins, A Toby A; Serpell, Louise C

    2015-10-24

    Soluble Amyloid-beta (Aβ) oligomers are a source of cytotoxicity in Alzheimer's disease (AD). The toxicity of Aβ oligomers may arise from their ability to interact with and disrupt cellular membranes mediated by GM1 ganglioside receptors within these membranes. Therefore, inhibition of Aβ-membrane interactions could provide a means of preventing the toxicity associated with Aβ. Here, using Surface Plasmon field-enhanced Fluorescence Spectroscopy, we determine that the lanthanide, Europium III chloride (Eu(3+)), strongly binds to GM1 ganglioside-containing membranes and prevents the interaction with Aβ42 leading to a loss of the peptides ability to cause membrane permeation. Here we discuss the molecular mechanism by which Eu(3+) inhibits Aβ42-membrane interactions and this may lead to protection of membrane integrity against Aβ42 induced toxicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Radiation effects on beta /10.6/ of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as the result of X-ray and electron bombardment of pure monocrystalline and polycrystalline KCl and of divalent europium doped polycrystalline KCl were determined. A constant heat flow calorimetric method was used to measure the optical absorption coefficients. Both 300 kV X-ray irradiation and 2 MeV electron irradiation produced increases in the optical absorption coefficient at room temperature. X-ray irradiation produced more significant changes in pure monocrystalline KCl than equivalent amounts of electron irradiation. Electron irradiation of pure and Eu-doped polycrystalline KCl produced increases in the absorption by as much as a factor of 20 over untreated material. Bleaching of the electron-irradiated doped KCl with 649 millimicron light produced a further increase.

  13. Excitation functions for the formation of longer lived isotopes by deuteron irradiation of Europium

    Energy Technology Data Exchange (ETDEWEB)

    Takács, S., E-mail: stakacs@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Hermanne, A.; Adam-Rebeles, R. [Cyclotron Laboratory, Vrije Universiteit Brussel, Brussels 1090 (Belgium); Takács, M.P. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Institute of Physics, University of Debrecen, 4026 Debrecen (Hungary)

    2013-09-01

    Excitation functions for nuclear reactions induced on natural europium targets by energetic deuterons were studied up to 50 MeV. A standard stacked foil technique was used for irradiation and high resolution gamma spectrometry was applied for activity assessment. Direct or cumulative cross sections for reaction products with half-life longer than 2 h were determined. Reactions leading to the formation of the radionuclides {sup 147,149,151,153}Gd, {sup 147,148,149,150m,150g,152m,152g,154g}Eu, {sup 153}Sm and {sup 150}Pm were studied. In most cases no earlier data were available in the literature. The new experimental results were compared with values tabulated in the on-line TENDL2011 library.

  14. Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Klobes, B., E-mail: b.klobes@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail: y.arinicheva@fz-juelich.de; Neumeier, S., E-mail: s.neumeier@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail: r.simon@fz-juelich.de; Jafari, A., E-mail: a.jafari@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: d.bosbach@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: hermannrp@ornl.gov [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)

    2016-12-15

    Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.

  15. Photoluminescent polymer electrolyte based on agar and containing europium picrate for electrochemical devices

    Energy Technology Data Exchange (ETDEWEB)

    Lima, E. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Raphael, E.; Sentanin, F. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil); Rodrigues, L.C. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Ferreira, R.A.S.; Carlos, L.D. [Departamento de Fisica, CICECO, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Silva, M.M., E-mail: nini@quimica.uminho.pt [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Pawlicka, A. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer We prepared ionic conducting membranes for the specific requirements of the device. Black-Right-Pointing-Pointer Luminescent reporter groups, with many applications in biotechnology. Black-Right-Pointing-Pointer Thermal and electrochemical stability of electrolytes is adequate for application. - Abstract: Dispersion of photoluminescent rare earth metal complexes in polymer matrices is of great interest due to the possibility of avoiding the saturation of the photoluminescent signal. The possibility of using a natural ionic conducting polymer matrix was investigated in this study. Samples of agar-based electrolytes containing europium picrate were prepared and characterized by physical and chemical analyses. The FTIR spectra indicated strong interaction of agar O-H and 3,6-anhydro-galactose C-O groups with glycerol and europium picrate. The DSC analyses revealed no glass transition temperature of the samples in the -60 to 250 Degree-Sign C range. From the thermogravimetry (TG), a thermal stability of the samples of up to 180 Degree-Sign C was stated. The membranes were subjected to ionic conductivity measurement, which provided the values of 2.6 Multiplication-Sign 10{sup -6} S/cm for the samples with acetic acid and 1.6 Multiplication-Sign 10{sup -5} S/cm for the samples without acetic acid. Moreover, the temperature-dependent ionic conductivity measurements revealed both Arrhenius and VTF models of the conductivity depending on the sample. Surface visualization through scanning electron microscopy (SEM) demonstrated good uniformity. The samples were also applied in small electrochromic devices and showed good electrochemical stability. The present work confirmed that these materials may perform as satisfactory multifunctional component layers in the field of electrochemical devices.

  16. Spectroscopic investigation on europium doped heavy metal borate glasses for red luminescent application

    Energy Technology Data Exchange (ETDEWEB)

    Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)

    2017-05-15

    The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)

  17. Europium nanoparticle-based high performing immunoassay for the screening of treponemal antibodies.

    Directory of Open Access Journals (Sweden)

    Sheikh M Talha

    Full Text Available Treponema pallidum subspecies pallidum (Tp is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co ratios obtained with the two immunoassays (p=0.06. Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood

  18. Visible-light-excited and europium-emissive nanoparticles for highly-luminescent bioimaging in vivo.

    Science.gov (United States)

    Wu, Yongquan; Shi, Mei; Zhao, Lingzhi; Feng, Wei; Li, Fuyou; Huang, Chunhui

    2014-07-01

    Europium(III)-based material showing special milliseconds photoluminescence lifetime has been considered as an ideal time-gated luminescence probe for bioimaging, but is still limited in application in luminescent small-animal bioimaging in vivo. Here, a water-soluble, stable, highly-luminescent nanosystem, Ir-Eu-MSN (MSN = mesoporous silica nanoparticles, Ir-Eu = [Ir(dfppy)2(pic-OH)]3Eu·2H2O, dfppy = 2-(2,4-difluorophenyl)pyridine, pic-OH = 3-hydroxy-2-carboxypyridine), was developed by an in situ coordination reaction to form an insoluble dinuclear iridium(III) complex-sensitized-europium(III) emissive complex within mesoporous silica nanoparticles (MSNs) which had high loading efficiency. Compared with the usual approach of physical adsorption, this in-situ reaction strategy provided 20-fold the loading efficiency (43.2%) of the insoluble Ir-Eu complex in MSNs. These nanoparticles in solid state showed bright red luminescence with high quantum yield of 55.2%, and the excitation window extended up to 470 nm. These Ir-Eu-MSN nanoparticles were used for luminescence imaging in living cells under excitation at 458 nm with confocal microscopy, which was confirmed by flow cytometry. Furthermore, the Ir-Eu-MSN nanoparticles were successfully applied into high-contrast luminescent lymphatic imaging in vivo under low power density excitation of 5 mW cm(-2). This synthetic method provides a universal strategy of combining hydrophobic complexes with hydrophilic MSNs for in vivo bioimaging. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Europium Nanoparticle-Based High Performing Immunoassay for the Screening of Treponemal Antibodies

    Science.gov (United States)

    Talha, Sheikh M.; Hytönen, Jukka; Westhorpe, Adam; Kumar, Sushil; Khanna, Navin; Pettersson, Kim

    2013-01-01

    Treponema pallidum subspecies pallidum (Tp) is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF) immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co) ratios obtained with the two immunoassays (p = 0.06). Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood-bank settings as a

  20. Semiconducting polymer encapsulated mesoporous silica particles with conjugated Europium complexes: toward enhanced luminescence under aqueous conditions.

    Science.gov (United States)

    Zhang, Jixi; Prabhakar, Neeraj; Näreoja, Tuomas; Rosenholm, Jessica M

    2014-01-01

    Immobilization of lanthanide organic complexes in meso-organized hybrid materials for luminescence applications have attracted immense interest due to the possibility of controlled segregation at the nanoscopic level for novel optical properties. Aimed at enhancing the luminescence intensity and stability of the hybrid materials in aqueous media, we developed polyvinylpyrrolidone (PVP) stabilized, semiconducting polymer (poly(9-vinylcarbazole), PVK) encapsulated mesoporous silica hybrid particles grafted with Europium(III) complexes. Monosilylated β-diketonate ligands (1-(2-naphthoyl)-3,3,3-trifluoroacetonate, NTA) were first co-condensed in the mesoporous silica particles as pendent groups for bridging and anchoring the lanthanide complexes, resulting in particles with an mean diameter of ∼ 450 nm and a bimodal pore size distribution centered at 3.5 and 5.3 nm. PVK was encapsulated on the resulted particles by a solvent-induced surface precipitation process, in order to seal the mesopores and protect Europium ions from luminescence quenching by producing a hydrophobic environment. The obtained polymer encapsulated MSN-EuLC@PVK-PVP particles exhibit significantly higher intrinsic quantum yield (Φ(Ln) = 39%) and longer lifetime (τ(obs) = 0.51 ms), as compared with those without polymer encapsulation. Most importantly, a high luminescence stability was realized when MSN-EuLC@PVK-PVP particles were dispersed in various aqueous media, showing no noticeable quenching effect. The beneficial features and positive attributes of both mesoporous silica and semiconducting polymers as lanthanide-complex host were merged in a single hybrid carrier, opening up the possibility of using these hybrid luminescent materials under complex aqueous conditions such as biological/physiological environments.

  1. Surface-imprinted nanofilaments for europium-amplified luminescent detection of fluoroquinolone antibiotics.

    Science.gov (United States)

    Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C

    2013-07-29

    The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Faster Synthesis of Beta-Diketonate Ternary Europium Complexes: Elapsed Times & Reaction Yields.

    Science.gov (United States)

    Lima, Nathalia B D; Silva, Anderson I S; Gerson, P C; Gonçalves, Simone M C; Simas, Alfredo M

    2015-01-01

    β-diketonates are customary bidentate ligands in highly luminescent ternary europium complexes, such as Eu(β-diketonate)3(L)2, where L stands for a nonionic ligand. Usually, the syntheses of these complexes start by adding, to an europium salt such as EuCl3(H2O)6, three equivalents of β-diketonate ligands to form the complexes Eu(β-diketonate)3(H2O)2. The nonionic ligands are subsequently added to form the target complexes Eu(β-diketonate)3(L)2. However, the Eu(β-diketonate)3(H2O)2 intermediates are frequently both difficult and slow to purify by recrystallization, a step which usually takes a long time, varying from days to several weeks, depending on the chosen β-diketonate. In this article, we advance a novel synthetic technique which does not use Eu(β-diketonate)3(H2O)2 as an intermediate. Instead, we start by adding 4 equivalents of a monodentate nonionic ligand L straight to EuCl3(H2O)6 to form a new intermediate: EuCl3(L)4(H2O)n, with n being either 3 or 4. The advantage is that these intermediates can now be easily, quickly, and efficiently purified. The β-diketonates are then carefully added to this intermediate to form the target complexes Eu(β-diketonate)3(L)2. For the cases studied, the 20-day average elapsed time reduced to 10 days for the faster synthesis, together with an improvement in the overall yield from 42% to 69%.

  3. Modified magnetic and optical properties of manganese nanoparticles incorporated europium doped magnesium borotellurite glass

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, Siti Maisarah; Sahar, M.R., E-mail: mrahim057@gmail.com; Ghoshal, S.K.

    2017-02-01

    This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)

  4. Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yu, E-mail: liuyu03b@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Wang, Yafei [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Li, Chun [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China); Huang, Ying; Dang, Dongfeng; Zhu, Meixiang [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Zhu, Weiguo, E-mail: zhuwg18@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Cao, Yong, E-mail: yongcao@scut.edu.cn [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China)

    2014-02-14

    A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM){sub 3}(BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM){sub 3}(BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu{sup 3+} ion emission, based on the {sup 5}D{sub 0} → {sup 7}F{sub 2} transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE{sub ext}) of 1.26% at current density of 1.65 mA cm{sup −2}, with a maximum brightness of 568 cd m{sup −2} at 137.8 mA cm{sup −2} was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM){sub 3}(BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM){sub 3}(BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices.

  5. Electron paramagnetic resonance and photoluminescence investigation of europium local structure in oxyfluoride glass ceramics containing SrF2 nanocrystals

    Science.gov (United States)

    Antuzevics, A.; Kemere, M.; Krieke, G.; Ignatans, R.

    2017-10-01

    Different compositions of europium doped aluminosilicate oxyfluoride glass ceramics prepared in air atmosphere have been studied by electron paramagnetic resonance (EPR) and optical spectroscopy methods. X-ray diffraction (XRD) and transmission electron microscopy (TEM) measurements show presence of homogenously distributed SrF2 nanocrystals after the heat treatment of the precursor glass. Efficient Eu3+ incorporation in the high symmetry environment of glass ceramics is observed from the photoluminescence spectra. EPR spectra indicate Eu3+ → Eu2+ reduction upon precipitation of crystalline phases in the glass matrix. For composition abundant with Eu2+ in the glassy state such behaviour is not detected. Local structure around europium ions is discussed based on differences in chemical compositions.

  6. Bright, highly water-soluble triazacyclononane europium complexes to detect ligand binding with time-resolved FRET microscopy.

    Science.gov (United States)

    Delbianco, Martina; Sadovnikova, Victoria; Bourrier, Emmanuel; Mathis, Gérard; Lamarque, Laurent; Zwier, Jurriaan M; Parker, David

    2014-09-26

    Luminescent europium complexes are used in a broad range of applications as a result of their particular emissive properties. The synthesis and application of bright, highly water-soluble, and negatively charged sulfonic- or carboxylic acid derivatives of para-substituted aryl-alkynyl triazacyclononane complexes are described. Introduction of the charged solubilizing moieties suppresses cellular uptake or adsorption to living cells making them applicable for labeling and performing assays on membrane receptors. These europium complexes are applied to monitor fluorescent ligand binding on cell-surface proteins with time-resolved Förster resonance energy transfer (TR-FRET) assays in plate-based format and using TR-FRET microscopy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Optical and spectral studies on pure and europium doped olgite type Na(Sr,Ba)PO4 ceramics.

    Science.gov (United States)

    Jawaher, K Rackesh; Jagannathan, R; Das, S Jerome; Krishnan, S

    2015-04-05

    Europium ion doped olgite type Na(Sr,Ba)PO4 ceramics, a new generation of light emitting bulb, was prepared by a high temperature solid-state reaction method. The synthesized materials were subjected to various characterizations such as X-ray powder diffraction, Scanning electron microscopy and FT-IR spectra measurements. The EPR spectrum of the sample exhibits a well-resolved hyperfine structure of 151Eu2+ and 153Eu2+ isotopes and the g value has been calculated. Fluorescence spectra revealed that europium ions were present in divalent as well as in the trivalent oxidation states. The critical distance for energy transfer between Eu2+ and Eu2+ ion is calculated as 20Å, which is in good agreement with that of experimental data. The FTIR analysis reveals all the vibrations of PO4(3-) ions. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. A highly sensitive europium nanoparticle-based immunoassay for detection of influenza A/B virus antigen in clinical specimens.

    Science.gov (United States)

    Zhang, Panhe; Vemula, Sai Vikram; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L; Hewlett, Indira

    2014-12-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Semiconducting polymer dots doped with europium complexes showing ultranarrow emission and long luminescence lifetime for time-gated cellular imaging.

    Science.gov (United States)

    Sun, Wei; Yu, Jiangbo; Deng, Ruiping; Rong, Yu; Fujimoto, Bryant; Wu, Changfeng; Zhang, Hongjie; Chiu, Daniel T

    2013-10-18

    Bright dots: Semiconducting polymer dots (Pdots) doped with europium complexes possess line-like fluorescence emission, high quantum yield, and long fluorescence lifetime. The Pdots successfully labeled receptors on cells. The long fluorescence lifetime of the Pdots was used to distinguish them from other red fluorescence emitting nanoparticles, and improve the signal-to-noise ratio for time-gated cellular imaging. PVK=poly(9-vinylcarbazole). Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Translocation and biokinetic behavior of nanoscaled europium oxide particles within 5 days following an acute inhalation in rats.

    Science.gov (United States)

    Creutzenberg, Otto; Kock, Heiko; Schaudien, Dirk

    2016-03-01

    Nanoscaled europium oxide (Eu2O3) particles were inhaled by rats after acute exposure and the potential translocation of particles followed by chemical analysis and transmission electron microscopy (TEM) was investigated. An aqueous dispersion (phosphate buffer/bovine serum albumin) of a commercially available Eu2O3 particle fraction consisting partially of nanoscaled particles was aerosolized with pressurized air. After rapid evaporation, rats inhaled the dry aerosol for 6 h in a single exposure resulting in an alveolar calculated dose of approximately 39.5 μg Eu2O3. Using chemical analysis, 36.8 μg Eu2O3 was detected 1 h after lung inhalation. The amount declined slightly to 34.5 μg after 1 day and 35.0 μg after 5 days. The liver showed an increase of Eu2O3 from 32.3 ng 1 h up to 294 ng 5 days after inhalation. Additionally, lung-associated lymph nodes, thymus, kidneys, heart and testis exhibited an increase of europium over the period investigated. In the blood, the highest amount of europium was found 1 h after treatment whereas feces, urine and mesenteric lymph nodes revealed the highest amount 1 day after treatment. Using TEM analysis, particles could be detected only in lungs, and in the liver, no particles were detectable. In conclusion, the translocation of Eu2O3 within 5 days following inhalation could be determined very precisely by chemical analysis. A translocation of Eu2O3 particulate matter to liver was not detectable by TEM analysis; thus, the overproportional level of 0.8% of the lung load observed in the liver after 5 days suggests a filtering effect of dissolved europium with accumulation. Copyright © 2015 John Wiley & Sons, Ltd.

  11. A Highly Sensitive Europium Nanoparticle-Based Immunoassay for Detection of Influenza A/B Virus Antigen in Clinical Specimens

    Science.gov (United States)

    Zhang, Panhe; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L.

    2014-01-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. PMID:25297327

  12. Nature of the concentration thresholds of europium atom yield from the oxidized tungsten surface under electron stimulated desorption

    CERN Document Server

    Davydov, S Y

    2002-01-01

    The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level

  13. Adrenal scanning with {sup 131}I-cholesterol; Diagnostik von Nebennierenrindenerkrankungen mit {sup 131}I-Cholesterol

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, K. [Klinik und Poliklinik fuer Nuklearmedizin, Klinikum der Ludwig-Maximilians-Univ. Muenchen (Germany)

    2009-03-15

    Adrenal scanning with {sup 131}I-19-cholesterol is used in patients with various forms of adrenal malfunction (adreno-cortical carcinoma or adenoma, hypothalamic-hypophyseal form of Cushing's syndrome, adrenal hirsutism, primary or secondary adrenocortical insufficiency). Adrenal scanning is optimal between the fourth and tenth day after intravenous injection of {sup 131}I-19-cholesterol. This method makes it possible to estimate the size and functional status of the adrenals. Limitation of the method is the relatively high radiation dose of {sup 131}I-19-cholesterol. (orig.)

  14. Ultrasmall Superparamagnetic Iron Oxide Nanoparticles with Europium(III) DO3A as a Bimodal Imaging Probe.

    Science.gov (United States)

    Carron, Sophie; Bloemen, Maarten; Vander Elst, Luce; Laurent, Sophie; Verbiest, Thierry; Parac-Vogt, Tatjana N

    2016-03-18

    A new prototype consisting of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles decorated with europium(III) ions encapsulated in a DO3A organic scaffold was designed as a platform for further development of bimodal contrast agents for MRI and optical imaging. The USPIO nanoparticles act as negative MRI contrast agents, whereas the europium(III) ion is a luminophore that is suitable for use in optical imaging detection. The functionalized USPIO nanoparticles were characterized by TEM, DLS, XRD, FTIR, and TXRF analysis, and a full investigation of the relaxometric and optical properties was conducted. The typical luminescence emission of europium(III) was observed and the main red emission wavelength was found at 614 nm. The relaxometric study of these ultrasmall nanoparticles showed r2 values of 114.8 mM(-1) Fes(-1) at 60 MHz, which is nearly double the r2 relaxivity of Sinerem(®). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A lysosome targetable luminescent bioprobe based on a europium β-diketonate complex for cellular imaging applications.

    Science.gov (United States)

    George, T M; Krishna, Mahesh S; Reddy, M L P

    2016-11-22

    Herein, we report a novel lysosome targetable luminescent bioprobe derived from a europium coordination compound, namely Eu(pfphOCH3IN)3(DDXPO) 4 [where HpfphOCH3IN = 4,4,5,5,5-pentafluoro-3-hydroxy-1-(1-(4-methoxyphenyl)-1H-indol-3-yl)pent-2-en-1-one and DDXPO = 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene oxide]. Notably, the newly designed europium complex exhibits significant quantum yield (Φoverall = 25 ± 3%) and 5D0 excited state lifetime (τ = 398 ± 3 μs) values under physiological pH (7.2) conditions when excited at 405 nm. Hence the developed europium complex has been evaluated for live cell imaging applications using mouse pre-adipocyte cell lines (3T3L1). Colocalization studies of the designed bio-probe with commercial Lysosome-GFP in 3T3L1 cells demonstrated the specific localization of the probe in the lysosome with a high colocalization coefficient (A = 0.83). Most importantly, the developed bioprobe exhibits good cell permeability, photostability and non-cytotoxicity.

  16. Mössbauer spectroscopy of europium-doped fluorochlorozirconate glasses and glass ceramics: optimization of storage phosphors in computed radiography.

    Science.gov (United States)

    Pfau, C; Paßlick, C; Gray, S K; Johnson, J A; Johnson, C E; Schweizer, S

    2013-05-22

    Eu(2+)-doped fluorochlorozirconate (FCZ) glasses and glass ceramics, which are being developed for medical and photovoltaic applications, have been analysed by Mössbauer spectroscopy. The oxidation state and chemical environment of the europium ions, which are important for the performance of these materials, were investigated. Routes for maximizing the divalent europium content were also investigated. By using EuCl2 instead of EuF2 in the starting material a fraction of about 90% of the europium was maintained in the Eu(2+) state as opposed to about 70% when using EuF2. The glass ceramics produced by subsequent thermal processing contain BaCl2 nanocrystals in which Eu(2+) is incorporated, as shown by the narrower linewidth in the Mössbauer spectrum. Debye temperatures of 147 K and 186 K for Eu(2+) and Eu(3+), respectively, were determined from temperature dependent Mössbauer measurements. The f-factors were used to obtain the Eu(2+)/Eu(3+) ratio from the area ratio of the corresponding absorption lines.

  17. Get the Facts About Exposure to I-131 Radiation

    Science.gov (United States)

    ... the Fukushima accident in 2011 (primarily Americans in Japan) Releases from atomic weapons production plants (such as ... approximately 2 to 3 times more common in women Reliable information about I-131's impact on human ...

  18. The psychodynamics of work with iodine-131 in nuclear medicine

    National Research Council Canada - National Science Library

    Leila Cunha da Silveira; Maria Cristina Rodrigues Guilam; Sergio Ricardo de Oliveira

    2013-01-01

      This paper seeks to demonstrate to what extent alternative forms adopted in the working process of professionals with iodine-131 in nuclear medicine can assist in managing risks of ionizing radiation...

  19. Resveratrol Sensitizes Selectively Thyroid Cancer Cell to 131-Iodine Toxicity

    Directory of Open Access Journals (Sweden)

    Seyed Jalal Hosseinimehr

    2014-01-01

    Full Text Available Background. In this study, the radiosensitizing effect of resveratrol as a natural product was investigated on cell toxicity induced by 131I in thyroid cancer cell. Methods. Human thyroid cancer cell and human nonmalignant fibroblast cell (HFFF2 were treated with 131I and/or resveratrol at different concentrations for 48 h. The cell proliferation was measured by determination of the percent of the survival cells using 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Results. Findings of this study show that resveratrol enhanced the cell death induced by 131I on thyroid cancer cell. Also, resveratrol exhibited a protective effect on normal cells against 131I toxicity. Conclusion. This result indicates a promising effect of resveratrol on improvement of cellular toxicity during iodine therapy.

  20. Treatment of malignant pheochromocytomas with 131-I metaiodobenzylguanidine and chemotherapy.

    Science.gov (United States)

    Sisson, J C; Shapiro, B; Shulkin, B L; Urba, S; Zempel, S; Spaulding, S

    1999-08-01

    Malignant pheochromocytomas have exhibited partial responses to treatments with 131-I metaiodobenzylguanidine (MIBG) and with chemotherapy. The authors combined these two therapeutic methods to determine if beneficial effects from each would be additive. Patients with documented malignant pheochromocytomas were recruited with the intent of administering 131-I MIBG in three substantial amounts of radioactivity at 3-month intervals followed by a year of chemotherapy in which cyclophosphamide, dacarbazine, and vincristine were to be given in 21-day cycles. Six patients entered the protocol. After the 131-I MIBG treatments, three patients manifested declines in the presence of tumor (smaller tumor volume or abnormalities on bone and 131-I MIBG scans) and the function of tumor (decreased rate of normetanephrine excretion as the major index). Two patients completed at least 9 months of chemotherapy and showed further reductions in the presence and function of tumors and were classified as having partial responses. Progressive disease afflicted three of the other four subjects. Even though toxicity was minimal from 131-I MIBG, it was sufficient to force reduction in the dosages or duration of chemotherapy. A combination of 131-I MIBG treatments and chemotherapy produced additive effects in reducing malignant pheochromocytomas. Toxicity moderately curtailed the proposed chemotherapy protocol.

  1. Additional effective dose by patients undergoing NAI-131 capsules therapy

    Energy Technology Data Exchange (ETDEWEB)

    Orlic, M.; Jovanovic, M.; Spasic Jokic, V.; Cuknic, O.; Ilic, Z.; Vranjes Djuric, S. [VINCA - Institute of Nuclear Sciences, Belgrade, Serbia and Montenegro (Yugoslavia)

    2006-07-01

    Capsules or solutions containing Na{sup 131}I are indicated for the therapy of some thyroid carcinomas such as functioning metastatic papillary or follicular carcinoma of the thyroid; and for the treatment of hyperthyroidism (diffuse toxic goiter and single or multiple toxic nodular goiter). The recommended dosage ranges of Na{sup 131}I capsules or solution for the therapy of the average patient (70 kg) are: (3.7-5.55) GBq for ablation of normal thyroid tissue; (3.7-7.4) GBq for subsequent treatments; a (148-370) MBq for hyperthyroidism. The purpose of this paper is to calculate effective dose as a result of iodine-131 capsules remaining in stomach before absorption starts. This result can determine the disadvantage of capsule versus solution containing sodium iodine-131 (Na{sup 131}I) in radionuclide therapy application from radiation protection point of view. The Monte Carlo code MCNP4b was used to model transport of gamma and beta particles emitted by radionuclide {sup 131}I treated as a point source at the bottom of stomach. Absorbed energy per unit transformation in stomach and surrounding organs has been calculated. (authors)

  2. Prevalence of Escherichia Coli sequence type 131 (ST131 among extraintestinal clinical isolates in different phylogenetic groups

    Directory of Open Access Journals (Sweden)

    Al-hetar Khadega Yahyah Abdullah

    2016-03-01

    Full Text Available Escherichia coli sequence type O25b-ST131 has emerged in recent years around the world in combination with CTX-M-15 among extra-intestinal infections and it has caused considerable morbidity and mortality. Management of infections can be done by controlling the source of infections or contamination. In India there are not many studies on O25b-ST131 clone, This study was done to investigate ST131’s prevalence in different phylogenetic groups among isolates from different extra-intestinal infections. Hundred E. coli isolates were isolated from different clinical samples including urine, blood, sputum and exudates from Krishna Rajendra (K.R Hospital, Mysore. Polymerase chain reaction (PCR method was used to determine the Phylogenetic groups and O25b-ST131 clone. Out of 100 E. coli strains 55%, 30%, 8% and 7% were isolated from urine, exudates, sputum, and blood respectively. Phylogenetically, B2 group was the dominant group (34% followed by D, B1 and A groups (28, 26, and12 respectively, 87% E. coli samples belonged to O25b-ST131 clone which were distributed among groups; B2, D, B1 and (32, 25, 22 and 8 isolates respectively. Diversity of Phylogenetic groups among O25b-ST131 E. coli strains may refer to the source of infections. Further studies are needed to highlight the source of infection which may help to control the dissemination of E. coli clone.

  3. Fast and Selective Preconcentration of Europium from Wastewater and Coal Soil by Graphene Oxide/Silane@Fe3O4 Dendritic Nanostructure.

    Science.gov (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K

    2015-05-19

    In this study, nanocomposite of graphene oxide and silane modified magnetic nanoparticles (silane@Fe3O4) were synthesized in a form of dendritic structure. For this, silane@Fe3O4 nanoparticle gets sandwiched between two layers of graphene oxide by chemical synthesis route. The synthesized dendritic structure was used as a monomer for synthesis of europium ion imprinted polymer. The synthesis of imprinted polymer was contemplated onto the surface of the vinyl group modified silica fiber by activated generated free radical atom-transfer radical polymerization, that is, AGET-ATRP technique. The synthesized dendritic monomer was characterized by XRD, FT-IR, VSM, FE-SEM, and TEM analyses. The imprinted polymer modified silica fiber was first validated in the aqueous and blood samples for successful extraction and detection of europium ion with limit of detection = 0.050 pg mL(-1) (signal/noise = 3). The imprinted polymer modified silica fiber was also used for preconcentration and separation of europium metal ion from various soil samples of coal mine areas. However, the same silica fiber was also used for wastewater treatment and shows 100% performance for europium removal. The findings herein suggested that dendritic nanocomposite could be potentially used as a highly effective material for the enrichment and preconcentration of europium or other trivalent lanthanides/actinides in nuclear waste management.

  4. Development of europium doped core-shell silica cobalt ferrite functionalized nanoparticles for magnetic resonance imaging.

    Science.gov (United States)

    Kevadiya, Bhavesh D; Bade, Aditya N; Woldstad, Christopher; Edagwa, Benson J; McMillan, JoEllyn M; Sajja, Balasrinivasa R; Boska, Michael D; Gendelman, Howard E

    2017-02-01

    The size, shape and chemical composition of europium (Eu3+) cobalt ferrite (CFEu) nanoparticles were optimized for use as a "multimodal imaging nanoprobe" for combined fluorescence and magnetic resonance bioimaging. Doping Eu3+ ions into a CF structure imparts unique bioimaging and magnetic properties to the nanostructure that can be used for real-time screening of targeted nanoformulations for tissue biodistribution assessment. The CFEu nanoparticles (size ∼7.2nm) were prepared by solvothermal techniques and encapsulated into poloxamer 407-coated mesoporous silica (Si-P407) to form superparamagnetic monodisperse Si-CFEu nanoparticles with a size of ∼140nm. Folic acid (FA) nanoparticle decoration (FA-Si-CFEu, size ∼140nm) facilitated monocyte-derived macrophage (MDM) targeting. FA-Si-CFEu MDM uptake and retention was higher than seen with Si-CFEu nanoparticles. The transverse relaxivity of both Si-CFEu and FA-Si-CFEu particles were r2=433.42mM-1s-1 and r2=419.52mM-1s-1 (in saline) and r2=736.57mM-1s-1 and r2=814.41mM-1s-1 (in MDM), respectively. The results were greater than a log order-of-magnitude than what was observed at replicate iron concentrations for ultrasmall superparamagnetic iron oxide (USPIO) particles (r2=31.15mM-1s-1 in saline) and paralleled data sets obtained for T2 magnetic resonance imaging. We now provide a developmental opportunity to employ these novel particles for theranostic drug distribution and efficacy evaluations. A novel europium (Eu3+) doped cobalt ferrite (Si-CFEu) nanoparticle was produced for use as a bioimaging probe. Its notable multifunctional, fluorescence and imaging properties, allows rapid screening of future drug biodistribution. Decoration of the Si-CFEu particles with folic acid increased its sensitivity and specificity for magnetic resonance imaging over a more conventional ultrasmall superparamagnetic iron oxide particles. The future use of these particles in theranostic tests will serve as a platform for

  5. Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal, A., E-mail: antonio.mariscal@csic.es [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)

    2016-06-30

    Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.

  6. Different outcomes for relapsed vs. refractory neuroblastoma after therapy with 131I-metaiodobenzylguanidine (131I-MIBG)

    Science.gov (United States)

    Zhou, Margaret J.; Doral, Michelle Y.; DuBois, Steven G.; Villablanca, Judith G.; Yanik, Gregory A.; Matthay, Katherine K.

    2015-01-01

    Background 131I-metaiodobenzylguanidine (131I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to 131I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. Methods This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with 131I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. Results The response rate (complete and partial response) to 131I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after 131I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p = 0.02). Among all patients, the 24-month OS was 47.0% (95% CI 39.9%–53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8%–75.9%), compared to 38.7% (95% CI 30.4%–46.8%) for relapsed patients (p refractory neuroblastoma, patients with prior relapse had higher rates of progressive disease and had lower 2-year overall survival after 131I-MIBG compared to patients with refractory disease. PMID:26254811

  7. In vivo biological evaluation of {sup 131}I radiolabeled-paclitaxel glucuronide ({sup 131}I-PAC-G)

    Energy Technology Data Exchange (ETDEWEB)

    Aslan, O.; Biber Muftuler, F.Z.; Yurt Kilcar, A.; Ichedef, C.; Unak, P. [Ege Univ., Izmir (Turkey). Dept. of Nuclear Applications

    2012-07-01

    Paclitaxel (PAC) is a natural occurring diterpene alkoloid originally isolated from the bark of Taxus Brevifolia. It is one of the most important antitumor agents for clinical treatment of ovarian, breast non-small cell lung and prostate cancers. It is known that these types of cancer cells have high {beta}-glucuronidase enzyme which can catalyze the hydrolysis of glucuronides. This is why the synthesis compounds which undergo glucuronidation come into question in the imaging and therapy of these cancer cells. The aim of current study is conjugation of glucuronic acid (G) to the starting substance PAC, labeling with {sup 131}I and to perform its in vivo biological evaluation. Glucuronic acid derived paclitaxel compound [paclitaxel-glucuronide (PAC-G)] was labeled with {sup 131}I using iodogen method. According to thin layer radio chromatography (TLRC) method, the radiochemical yield of {sup 131}I-PAC-G was 84.30 {+-} 7.40% (n=10). The biodistribution of {sup 131}I-PAC-G in healthy female and male Wistar Albino rats has been investigated. Imaging studies on male Balb-C mice were performed by using the Kodak FX PRO in vivo Imaging System. The range of the breast/blood, breast/muscle; ovary/blood, ovary/muscle ratios is approximately between 1.29 and 11.34 in 240 min, and between 0.71 and 8.24 in 240 min for female rats. The prostate/blood and prostate/muscle ratio is between 1.94 and 6.95 in 30 min for male rats. All these experimental studies indicate that {sup 131}I-PAC-G may potentially be used in breast, ovary and prostate tissues as an imaging agent. Also it is thought that {sup 131}I-PAC-G bears a therapy potential because of the {sup 131}I radionuclide and can be improved with further investigations. (orig.)

  8. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)

    2012-05-15

    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  9. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Science.gov (United States)

    Bicho, Rita C.; Soares, Amadeu M. V. M.; Nogueira, Helena I. S.; Amorim, Mónica J. B.

    2016-12-01

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of "no effect" are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  10. Spectral Interferences Manganese (Mn) - Europium (Eu) Lines in X-Ray Fluorescence Spectrometry Spectrum

    Science.gov (United States)

    Tanc, Beril; Kaya, Mustafa; Gumus, Lokman; Kumral, Mustafa

    2016-04-01

    X-ray fluorescence (XRF) spectrometry is widely used for quantitative and semi quantitative analysis of many major, minor and trace elements in geological samples. Some advantages of the XRF method are; non-destructive sample preparation, applicability for powder, solid, paste and liquid samples and simple spectrum that are independent from chemical state. On the other hand, there are some disadvantages of the XRF methods such as poor sensitivity for low atomic number elements, matrix effect (physical matrix effects, such as fine versus course grain materials, may impact XRF performance) and interference effect (the spectral lines of elements may overlap distorting results for one or more elements). Especially, spectral interferences are very significant factors for accurate results. In this study, semi-quantitative analyzed manganese (II) oxide (MnO, 99.99%) was examined. Samples were pelleted and analyzed with XRF spectrometry (Bruker S8 Tiger). Unexpected peaks were obtained at the side of the major Mn peaks. Although sample does not contain Eu element, in results 0,3% Eu2O3 was observed. These result can occur high concentration of MnO and proximity of Mn and Eu lines. It can be eliminated by using correction equation or Mn concentration can confirm with other methods (such as Atomic absorption spectroscopy). Keywords: Spectral Interferences; Manganese (Mn); Europium (Eu); X-Ray Fluorescence Spectrometry Spectrum.

  11. Performance of fluorescent europium(III) nanoparticles and colloidal gold reporters in lateral flow bioaffinity assay.

    Science.gov (United States)

    Juntunen, Etvi; Myyryläinen, Tiina; Salminen, Teppo; Soukka, Tero; Pettersson, Kim

    2012-09-01

    Lateral flow (LF) immunoassays (i.e., immunochromatographic assays) have traditionally been applied to analytes that do not require very high analytical sensitivity or quantitative results. The selection of potential analytes is often limited by the performance characteristics of the assay technology. Analytes with more demanding sensitivity requirements call for reporter systems enabling high analytical sensitivity. In this study, we systematically compared the performance of fluorescent europium(III) [Eu(III)] chelate dyed polystyrene nanoparticles and colloidal gold particles in lateral flow assays. The effect of time-resolved measurement mode was also studied. Because binder molecules used in immunoassays might not behave similarly when conjugated to different reporter particles, two model assays were constructed to provide reliable technical comparison of the two reporter systems. The comparative experiment demonstrated that the fluorescent nanoparticles yielded 7- and 300-fold better sensitivity compared with colloidal gold in the two test systems, respectively. Although the two reporter particles may induce variable effects using individual binders, overall the high specific activity of Eu(III) nanoparticles has superior potential over colloidal gold particles for the development of robust high-sensitivity bioaffinity assays. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Carbon nanotube-loaded Nafion film electrochemical sensor for metal ions: europium.

    Science.gov (United States)

    Wang, Tingting; Zhao, Daoli; Guo, Xuefei; Correa, Jaime; Riehl, Bill L; Heineman, William R

    2014-05-06

    A Nafion film loaded with novel catalyst-free multiwalled carbon nanotubes (MWCNTs) was used to modify a glassy carbon (GC) electrode to detect trace concentrations of metal ions, with europium ion (Eu(3+)) as a model. The interaction between the sidewalls of MWCNTs and the hydrophobic backbone of Nafion allows the MWCNTs to be dispersed in Nafion, which was then coated as a thin film on the GC electrode surface. The electrochemical response to Eu(3+) was found to be ∼10 times improved by MWCNT concentrations between 0.5 and 2 mg/mL, which effectively expanded the electrode surface into the Nafion film and thereby reduced the diffusion distance of Eu(3+) to the electrode surface. At low MWCNT concentrations of 0.25 and 0.5 mg/mL, no significant improvement in signal was obtained compared with Nafion alone. Scanning electron microscopy and electrochemical impedance spectroscopy were used to characterize the structure of the MWCNT-Nafion film, followed by electrochemical characterization with Eu(3+) via cyclic voltammetry and preconcentration voltammetry. Under the optimized conditions, a linear range of 1-100 nM with a calculated detection limit of 0.37 nM (signal/noise = 3) was obtained for determination of Eu(3+) by Osteryoung square-wave voltammetry after a preconcentration time of 480 s.

  13. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Energy Technology Data Exchange (ETDEWEB)

    Bicho, Rita C., E-mail: ritabicho@ua.pt; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)

    2016-12-15

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  14. EUROPIUM ION INFLUENCE ON THE FORMATION OF Ag-NANOPARTICLES IN FLUORINE PHOSPHATE GLASSES

    Directory of Open Access Journals (Sweden)

    R. O. Pysh'ev

    2015-05-01

    Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.

  15. Nanoparticles in the zirconia-europium niobate system via hydrothermal route.

    Science.gov (United States)

    Hirano, Masanori; Dozono, Hayato

    2013-10-01

    The effect of the composition on the hydrothermal formation, structure, and properties of nanocrystalline luminescent materials in the zirconia (ZrO2)-europium niobate 1/4(Eu3NbO7) system was investigated. In the composition range 40 particles with crystallite size 6.0-7.6 nm that were hydrothermally formed from the precursor solutions of NbCl5, ZrOCI2, and EuCl3 under weakly basic conditions at 240 degrees C showed cubic structure. The lattice parameter when estimated as a single cubic phase linearly decreased as the concentration of ZrO2 increased. The presence of zirconia component effectively promoted the formation of nanocrystals containing the niobate, Eu3NbO7 under hydrothermal condition. The nanocrystalline particles could be excited by ultraviolet light 395 nm (f-f transition) and emitted orange (590 nm) and red light (610 nm) corresponding to 5D0 --> 7F1 and 5D0 --> 7F2 transitions of Eu3+, respectively. The intensity of the electric dipole transition (5D0 --> 7F2) that was expressed in values relative to the magnetic dipole transition (5D0 --> 7F1) increased with increased heat-treatment temperature in the range from 950 to 1200 degrees C.

  16. Photoluminescence of monocrystalline and stain-etched porous silicon doped with high temperature annealed europium

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Lemus, R; Montesdeoca-Santana, A; Gonzalez-Diaz, B; Diaz-Herrera, B; Hernandez-Rodriguez, C; Jimenez-Rodriguez, E [Departamento de Fisica Basica, Universidad de La Laguna (ULL), Avenida AstrofIsico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain); Velazquez, J J, E-mail: rglemus@ull.es [Departamento de Fisica Fundamental y Experimental, Electronica y Sistemas, Universidad de La Laguna (ULL), Avenida Astrofisico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain)

    2011-08-24

    In this work, for the first time, the photoluminescent emission and excitation spectra of non-textured layers and stain-etched porous silicon layers (PSLs) doped with high temperature annealed europium (Eu) are evaluated. The PSLs are evaluated as a host for rare earth ions and as an antireflection coating. The applied doping process, which consists in a simple impregnation method followed by a high-temperature annealing step, is compatible with the standard processes in the fabrication of solar cells. The results show down-shifting processes with a maximum photoluminescent intensity at 615 nm, related to the transition {sup 5}D{sub 0} {yields} {sup 7}F{sub 2}. Different initial concentrations of Eu(NO{sub 3}){sub 3} are evaluated to study the influence of the rare earth concentration on the photoluminescent intensity. The chemical composition and the morphology of Eu-doped PSLs are examined by means of x-ray dispersion spectroscopy, Fourier-transform infrared spectroscopy and scanning electron microscopy. These Eu-doped layers are considered to be applied as energy converters in silicon-based third generation solar cells.

  17. Europium (III) and Uranium (VI) complexation by natural organic matter (NOM): Effect of source.

    Science.gov (United States)

    Kautenburger, Ralf; Sander, Jonas M; Hein, Christina

    2017-03-01

    For the safe long-term storage of high-level radioactive waste (HLW), detailed information about geo-chemical behavior of radioactive and toxic metal ions under environmental conditions is important. Natural organic matter (NOM) can play a crucial role in the immobilization or mobilization of these metal ions due to its complexation and colloid formation tendency. In this study, the complexation of europium (as chemical homologue of trivalent actinides such as americium) and uranium (as main component of HLW) by ten humic acids (HA) from different sources and Suwannee NOM river extract has been analyzed. Capillary electrophoresis in combination with inductively coupled plasma mass spectrometry has been used for the evaluation of complex stability constants log β. In order to determine the complex stability constants a conservative single site model was used in this study. In dependence of their source and thus of NOM structure the log β values for the analyzed humic acids are in the range of 6.1-7.0 for Eu(III) and 5.2-6.4 for U(VI) (UO 2 2+ ), respectively. In contrast to the results for HA the used Suwannee river NOM reveals log β values in the range of nearly two orders of magnitude lower (4.6 for Eu 3+ and 4.5 for UO 2 2+ ) under the geochemical conditions applied in this study. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Europium incorporated into titanium oxide by the sol-gel method

    Directory of Open Access Journals (Sweden)

    Lucas Alonso Rocha

    2005-09-01

    Full Text Available In this work titanium sol was prepared from tetraethylorthotitanate (TEOT in ethanol, stabilized with beta-diketonate 2,4 pentanedione in molar ratio 1:1 homogenized by magnetic stirring, europium ion was add as structural probe. The xerogels were heat treated at 500, 750 and 1000 °C and the characterization was realized by x-ray diffraction (XRD, transmission electron microscopy (TEM, thermogravimetric analysis (TGA/DSC and photoluminescence (PL. The excitation spectra of Eu (III ion present maximum in 394 nm correspondent to 5L6 level and emission spectra present bands characteristic transitions arising from the 5 D0 -> 7F J (J = 0, 1, 2, 3, 4 manifolds to samples treat at 500 and 750 °C. The Eu (III emission disappear, when heated at 1000 °C, probably due to phase transition anatase to rutile and migrations of ions to the external surface that was proved by x-ray diffraction, transmission electronic microscopy and the thermogravimetric analyses of xerogels.

  19. Luminescence studies on the europium doped strontium metasilicate phosphor prepared by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2017-03-01

    Full Text Available Europium doped strontium meta-silicate (namely SrSiO3:Eu3+ phosphor was prepared by a high temperature solid state reaction method. The sintered SrSiO3:Eu3+ phosphor possesses a monoclinic structure by the XRD. Energy dispersive X-ray spectrum (EDS confirms the presence of elements in the desired sample. Thermoluminescence (TL kinetic parameters such as activation energy (E, order of kinetics (b, and frequency factor (s were calculated by the peak shape method. The orange–red emission was shown to originate from the 5D0–7FJ (J = 0, 1, 2, 3, 4 transitions of Eu3+ ions as the sample was excited at 396 nm. The SrSiO3:Eu3+ phosphor with almost pure orange-red color purity (99.62% shows the quantum efficiency of 10.2% (excited by 396 nm, which is higher than those of commercial red phosphors Y2O3:Eu3+ and Y2O2S:Eu3+ with quantum efficiencies of 9.6% (excited by 394 nm and 4.2% (excited by 395 nm, respectively. Mechanoluminescence (ML intensity of the SrSiO3:Eu3+ phosphor was also found to increase linearly with increasing the impact velocity of the moving piston, suggesting that the discussed phosphor can be used as a stress sensor.

  20. Europium Luminescence Used for Logic Gate and Ions Sensing with Enoxacin As the Antenna.

    Science.gov (United States)

    Lu, Lixia; Chen, Chuanxia; Zhao, Dan; Sun, Jian; Yang, Xiurong

    2016-01-19

    Luminescent lanthanide ion complexes have received increasing attention because of their unique optical properties. Herein, we discovered that the luminescence of europium(III) (Eu(3+)) could be regulated by Ag(+) and SCN(-) in seconds with enoxacin (ENX) as the antenna. Under given conditions, only the simultaneous introduction of Ag(+) and SCN(-) could remarkably enhance the luminescence intensity of Eu(3+)-ENX complexes. This phenomenon has been exploited to design an "AND" logic gate and specific luminescence turn-on assays for sensitively sensing Ag(+) and SCN(-) for the first time. Furthermore, the addition of S(2-) resulted in efficient luminescence quenching of the Eu(3+)/ENX/Ag(+)/SCN(-) system due to the strong affinity between Ag(+) and S(2-). Thus, a new luminescent sensing platform for S(2-) was established, which exhibited excellent selectivity and high sensitivity. S(2-) could be detected within the concentration range of 100 nM to 12.5 μM with a detection limit of 60 nM. Such sensing system features simplicity, rapidity, and flexibility. Moreover, this proposed Eu(3+)-based luminescent assay could be successfully applied in the real environmental water sample analysis.

  1. Radiation effects on beta 10.6 of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as a result of X-ray and electron bombardment of pure KCl (monocrystalline and polycrystalline), and divalent europium doped polycrystalline KCl were determined. The optical absorption coefficients were measured by a constant heat flow calorimetric method. Both 300 KV X-irradiation and 2 MeV electron irradiation produced significant increases in beta 10.6, measured at room temperature. The X-irradiation of pure moncrystalline KCl increased beta 10.6 by 0.005/cm for a 113 MR dose. For an equivalent dose, 2 MeV electrons were found less efficient in changing beta 10.6. However, electron irradiation of pure and Eu-doped polycrystalline KCl produced marked increases in adsorption. Beta increased to over 0.25/cm in Eu-doped material for a 30 x 10 to the 14th power electrons/sq cm dose, a factor of 20 increase over unirradiated material. Moreover, bleaching the electron irradiated doped KCl with 649 m light produced and additional factor of 1.5 increase. These findings will be discussed in light of known defect-center properties in KCl.

  2. Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods.

    Science.gov (United States)

    Wei, Peng-Fei; Zhang, Li; Nethi, Susheel Kumar; Barui, Ayan Kumar; Lin, Jun; Zhou, Wei; Shen, Yi; Man, Na; Zhang, Yun-Jiao; Xu, Jing; Patra, Chitta Ranjan; Wen, Long-Ping

    2014-01-01

    Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. High-resolution Thermal Micro-imaging Using Europium Chelate Luminescent Coatings.

    Science.gov (United States)

    Benseman, Timothy M; Hao, Yang; Vlasko-Vlasov, Vitalii K; Welp, Ulrich; Koshelev, Alexei E; Kwok, Wai-Kwong; Divan, Ralu; Keiser, Courtney; Watanabe, Chiharu; Kadowaki, Kazuo

    2017-04-16

    Micro-electronic devices often undergo significant self-heating when biased to their typical operating conditions. This paper describes a convenient optical micro-imaging technique which can be used to map and quantify such behavior. Europium thenoyltrifluoroacetonate (EuTFC) has a 612 nm luminescence line whose activation efficiency drops strongly with increasing temperature, due to T-dependent interactions between the Eu3+ ion and the organic chelating compound. This material may be readily coated on to a sample surface by thermal sublimation in vacuum. When the coating is excited with ultraviolet light (337 nm) an optical micro-image of the 612 nm luminescent response can be converted directly into a map of the sample surface temperature. This technique offers spatial resolution limited only by the microscope optics (about 1 micron) and time resolution limited by the speed of the camera employed. It offers the additional advantages of only requiring comparatively simple and non-specialized equipment, and giving a quantitative probe of sample temperature.

  4. In vivo synthesis of europium selenide nanoparticles and related cytotoxicity evaluation of human cells.

    Science.gov (United States)

    Kim, Eun Bee; Seo, Ji Min; Kim, Gi Wook; Lee, Sang Yup; Park, Tae Jung

    2016-12-01

    Nanotechnology strives to combine new materials for development of noble nanoparticles. As the nanoparticles exhibit unique optical, electronic, and magnetic properties depending on their composition, developing safe, cost-effective and environmentally friendly technologies for the synthesis have become an important issue. In this study, in vivo synthesis of europium selenide (EuSe) nanoparticles was performed using recombinant Escherichia coli cells expressing heavy-metal binding proteins, phytochelatin synthase and metallothionein. The formation of EuSe nanoparticles was confirmed by using UV-vis spectroscopy, spectrofluorometry, X-ray diffraction, energy dispersive X-ray and transmission electron microscopy. The synthesized EuSe nanoparticles exhibited high fluorescence intensities as well as strong magnetic properties. Furthermore, anti-cancer effect of EuSe nanoparticles against cancer cell lines was investigated. This strategy for the biogenic synthesis of nanoparticles has a great potential as bioimaging tools and drug carrying agents in biomedical fields due to its simplicity and nontoxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands

    Science.gov (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.

    2009-01-01

    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  6. Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes.

    Science.gov (United States)

    Taha, Mohamed; Khan, Imran; Coutinho, João A P

    2016-04-01

    With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Luminescent single-walled carbon nanotube-sensitized europium nanoprobes for cellular imaging

    Science.gov (United States)

    Avti, Pramod K; Sitharaman, Balaji

    2012-01-01

    Lanthanoid-based optical probes with excitation wavelengths in the ultra-violet (UV) range (300–325 nm) have been widely developed as imaging probes. Efficient cellular imaging requires that lanthanoid optical probes be excited at visible wavelengths, to avoid UV damage to cells. The efficacy of europium-catalyzed single-walled carbon nanotubes (Eu-SWCNTs), as visible nanoprobes for cellular imaging, is reported in this study. Confocal fluorescence microscopy images of breast cancer cells (SK-BR-3 and MCF-7) and normal cells (NIH 3T3), treated with Eu-SWCNT at 0.2 μg/mL concentration, showed bright red luminescence after excitation at 365 nm and 458 nm wavelengths. Cell viability analysis showed no cytotoxic effects after the incubation of cells with Eu-SWCNTs at this concentration. Eu-SWCNT uptake is via the endocytosis mechanism. Labeling efficiency, defined as the percentage of incubated cells that uptake Eu-SWCNT, was 95%–100% for all cell types. The average cellular uptake concentration was 6.68 ng Eu per cell. Intracellular localization was further corroborated by transmission electron microscopy and Raman microscopy. The results indicate that Eu-SWCNT shows potential as a novel cellular imaging probe, wherein SWCNT sensitizes Eu3+ ions to allow excitation at visible wavelengths, and stable time-resolved red emission. The ability to functionalize biomolecules on the exterior surface of Eu-SWCNT makes it an excellent candidate for targeted cellular imaging. PMID:22619533

  8. Europium(III) DOTA-derivatives having ketone donor pendant arms display dramatically slower water exchange

    Science.gov (United States)

    Green, Kayla N.; Viswanathan, Subha; Rojas-Quijano, Federico A.; Kovacs, Zoltan; Sherry, A. Dean

    2011-01-01

    A series of new 1,4,7,10-tetraazacyclododecane-derivatives having a combination of amide and ketone donor groups as side-arms were prepared and their complexes with europium(III) studied in detail by high resolution NMR spectroscopy. The chemical shift of the Eu3+-bound water resonance, the chemical exchange saturation transfer (CEST) characteristics of the complexes, and the bound water residence lifetimes (τm) were found to vary dramatically with the chemical structure of the side-arms. Substitution of ketone oxygen donor atoms for amide oxygen donor atoms resulted in an increase in residence water lifetimes (τm) and a decrease in chemical shift of the Eu3+-bound water molecule (Δω). These experimental results along with density functional theory (DFT) calculations demonstrate that introduction of weakly donating oxygen atoms in these complexes results in a much weaker ligand field, more positive charge on the Eu3+ ion and an increased water residence lifetime as expected for a dissociative mechanism. These results provide new insights into the design of paramagnetic CEST agents with even slower water exchange kinetics that will make them more efficient for in vivo imaging applications. PMID:21306137

  9. Urinary monitoring of exposure to yttrium, scandium, and europium in male Wistar rats.

    Science.gov (United States)

    Kitamura, Yasuhiro; Usuda, Kan; Shimizu, Hiroyasu; Fujimoto, Keiichi; Kono, Rei; Fujita, Aiko; Kono, Koichi

    2012-12-01

    On the assumption that rare earth elements (REEs) are nontoxic, they are being utilized as replacements of toxic heavy metals in novel technological applications. However, REEs are not entirely innocuous, and their impact on health is still uncertain. In the past decade, our laboratory has studied the urinary excretion of REEs in male Wistar rats given chlorides of europium, scandium, and yttrium solutions by one-shot intraperitoneal injection or oral dose. The present paper describes three experiments for the suitability and appropriateness of a method to use urine for biological monitoring of exposure to these REEs. The concentrations of REEs were determined in cumulative urine samples taken at 0-24 h by inductively coupled plasma atomic emission spectroscopy, showing that the urinary excretion of REEs is <2 %. Rare earth elements form colloidal conjugates in the bloodstream, which make high REEs accumulation in the reticuloendothelial system and glomeruli and low urinary excretion. The high sensitivity of inductively coupled plasma-argon emission spectrometry analytical methods, with detection limits of <2 μg/L, makes urine a comprehensive assessment tool that reflects REE exposure. The analytical method and animal experimental model described in this study will be of great importance and encourage further discussion for future studies.

  10. Europium Luminescence: Electronic Densities and Superdelocalizabilities for a Unique Adjustment of Theoretical Intensity Parameters

    Science.gov (United States)

    Dutra, José Diogo L.; Lima, Nathalia B. D.; Freire, Ricardo O.; Simas, Alfredo M.

    2015-09-01

    We advance the concept that the charge factors of the simple overlap model and the polarizabilities of Judd-Ofelt theory for the luminescence of europium complexes can be effectively and uniquely modeled by perturbation theory on the semiempirical electronic wave function of the complex. With only three adjustable constants, we introduce expressions that relate: (i) the charge factors to electronic densities, and (ii) the polarizabilities to superdelocalizabilities that we derived specifically for this purpose. The three constants are then adjusted iteratively until the calculated intensity parameters, corresponding to the 5D0→7F2 and 5D0→7F4 transitions, converge to the experimentally determined ones. This adjustment yields a single unique set of only three constants per complex and semiempirical model used. From these constants, we then define a binary outcome acceptance attribute for the adjustment, and show that when the adjustment is acceptable, the predicted geometry is, in average, closer to the experimental one. An important consequence is that the terms of the intensity parameters related to dynamic coupling and electric dipole mechanisms will be unique. Hence, the important energy transfer rates will also be unique, leading to a single predicted intensity parameter for the 5D0→7F6 transition.

  11. Structural and spectroscopic analyses of europium doped yttrium oxyfluoride powders prepared by combustion synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Rakov, Nikifor [PG-Ciência dos Materiais, Universidade Federal do Vale do São Francisco, 48902-300 Juazeiro, BA (Brazil); Guimarães, R. B.; Maciel, Glauco S. [Instituto de Física, Universidade Federal Fluminense, 24210-346 Niterói, RJ (Brazil); Lozano B, W. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)

    2013-07-28

    A facile widely spread technique employed to produce low-cost high-yield oxide powders, combustion synthesis, was used to prepare yttrium oxyfluoride crystalline ceramic powders. The structure of the powders was analyzed by X-ray powder diffraction and Rietveld refinement. Samples heat treated at 700 °C had a predominance of vernier orthorhombic Y{sub 6}O{sub 5}F{sub 8} phase, while samples heat treated at 800 °C crystallized in stoichiometric rhombohedral YOF phase. The samples were doped with luminescent europium trivalent ions (Eu{sup 3+}) in different concentrations (1–15 wt.%) and Judd-Ofelt theory was used to probe the distortion from the inversion symmetry of the local crystal field and the degree of covalency between the rare-earth ion and the surrounding ligands. The luminescence lifetime was measured and the luminescence quantum efficiency (LQE) was estimated. We observed that Eu{sup 3+}:Y{sub 6}O{sub 5}F{sub 8} samples presented higher LQE in spite of the larger local crystal field anisotropy found for Eu{sup 3+}:YOF samples.

  12. 131I-induced changes in rat thyroid gland function

    Directory of Open Access Journals (Sweden)

    V. Torlak

    2007-08-01

    Full Text Available Therapeutic doses of 131I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of 131I (64-277 µCi. Thirty male Fisher rats in the experimental group and 30 in the control group (untreated were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before 131I administration (4-month-old animals and three times following 131I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 ± 8.16 to 55.0 ± 6.1 nM in the control group and from 69.4 ± 6.9 to 25.4 ± 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after 131I administration to rats, which was not 131I dose dependent.

  13. Synthesis, photophysics, electrochemistry, thermal stability and electroluminescent performances of a new europium complex with bis(β-diketone) ligand containing carbazole group.

    Science.gov (United States)

    Liu, Jian; Liang, Quan-Bin; Wu, Hong-Bin

    2017-05-01

    We synthesized a new europium complex [Eu(ecbpd)3 (Phen)] with bis(β-diketone) ligand containing a carbazole group, in which ecbpd and Phen are dehydro-3,3'-(9-ethyl-9H-carbazole-3,6-diyl)bis(1-phenylpropane-1,3-dione) and 1,10-phenanthroline, respectively. Its UV/vis and photoluminescent spectra, quantum yield, luminescence lifetime, electrochemistry, thermal stability and electroluminescent performances were studied. This europium complex showed low efficiency luminescence, which is probably due to the mismatching energy levels of its ligand and Eu3+ , as well as the double Eu3+ core resonance. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Experimental release of 131I: the Green Run.

    Science.gov (United States)

    Robkin, M A

    1992-06-01

    In December 1949, a large amount of 131I was released to the air at Hanford during the dissolving of irradiated uranium fuel for a classified military experiment called the "Green Run." Reports of the release have varied from about 0.15-0.3 PBq. Using, as a guide, the reported measurements of 133Xe released during the experiment, the amount of 131I released has been reanalyzed. The results indicate that about 0.40 +/- 0.12 PBq (11 +/- 3 kCi) was released, somewhat larger than the largest previous estimates.

  15. Europium (III) PVC membrane sensor based on N-pyridine-2-carboxamido-8-aminoquinoline as a sensing material

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2012-04-01

    Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.

  16. A novel tridentate bis(phosphinic acid)phosphine oxide based europium(III)-selective Nafion membrane luminescent sensor.

    Science.gov (United States)

    Sainz-Gonzalo, F J; Popovici, C; Casimiro, M; Raya-Barón, A; López-Ortiz, F; Fernández, I; Fernández-Sánchez, J F; Fernández-Gutiérrez, A

    2013-10-21

    A new europium(III) membrane luminescent sensor based on a new tridentate bis(phosphinic acid)phosphine oxide (3) system has been developed. The synthesis of this new ligand is described and its full characterization by NMR, IR and elemental analyses is provided. The luminescent complex formed between europium(III) chloride and ligand 3 was evaluated in solution, observing that its spectroscopic and chemical characteristics are excellent for measuring in polymer inclusion membranes. Included in a Nafion membrane, all the parameters (ligand and ionic additives) that can affect the sensitivity and selectivity of the sensing membrane as well as the instrumental conditions were carefully optimized. The best luminescence signal (λexc = 229.06 nm and λem = 616.02 nm) was exhibited by the sensing film having a Nafion : ligand composition of 262.3 : 0.6 mg mL(-1). The membrane sensor showed a short response time (t95 = 5.0 ± 0.2 min) and an optimum working pH of 5.0 (25 mM acetate buffer solution). The membrane sensor manifested a good selectivity toward europium(III) ions with respect to other trivalent metals (iron, chromium and aluminium) and lanthanide(III) ions (lanthanum, samarium, terbium and ytterbium), although a small positive interference of terbium(III) ions was observed. It provided a linear range from 1.9 × 10(-8) to 5.0 × 10(-6) M with a very low detection limit (5.8 × 10(-9) M) and sensitivity (8.57 × 10(-7) a.u. per M). The applicability of this sensing film has been demonstrated by analyzing different kinds of spiked water samples obtaining recovery percentages of 95-97%.

  17. A Responsive Europium(III) Chelate that Provides a Direct Readout of pH by MRI

    Science.gov (United States)

    Wu, Yunkou; Soesbe, Todd C.; Kiefer, Garry E.; Zhao, Piyu; Sherry, A. Dean

    2010-01-01

    A europium(III) DO3A-tris(amide) complex is reported for imaging pH by MRI using ratiometric CEST principles. Deprotonation of a single phenolic proton between pH 6 and 7.6 results in an ~5 ppm shift in the water exchange CEST peak that is easily detected by MRI. Collection of two CEST images at two slightly different activation frequencies provides a direct readout of solution pH without the need of a concentration marker. PMID:20853833

  18. Different outcomes for relapsed versus refractory neuroblastoma after therapy with (131)I-metaiodobenzylguanidine ((131)I-MIBG).

    Science.gov (United States)

    Zhou, Margaret J; Doral, Michelle Y; DuBois, Steven G; Villablanca, Judith G; Yanik, Gregory A; Matthay, Katherine K

    2015-11-01

    (131)I-metaiodobenzylguanidine ((131)I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to (131)I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with (131)I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. The response rate (complete and partial response) to (131)I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after (131)I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p=0.02). Among all patients, the 24-month OS was 47.0% (95% confidence interval (CI) 39.9-53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8-75.9%), compared to 38.7% (95% CI 30.4-46.8%) for relapsed patients (prefractory disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Iodine-131 Tositumomab: (131)I-anti-B1 antibody, (131)I-tositumomab, anti-CD20 murine monoclonal antibody-I-131, B1, Bexxar, (131)I-anti-B1 antibody, iodine-131 tositumomab, iodine-131 anti-B1 antibody, tositumomab.

    Science.gov (United States)

    2003-01-01

    Iodine-131 tositumomab [B1, Bexxar , iodine-131 anti-B1 antibody] is a murine antibody conjugated to iodine 131 that recognises and binds to the B1 (CD20) antigen which is found specifically on B lymphocytes. Iodine-131 tositumomab has a dual mechanism of action. It is capable of initiating a host immune response to those B cells to which it is attached, and it also triggers apoptosis in a significant proportion of the cells to which it binds. The product was first discovered by Coulter Corporation, Miami, in collaboration with the Dana-Farber Cancer Institute and the University of Michigan. The spin-off company Coulter Pharmaceutical, upon its formation, obtained worldwide rights to iodine-131 tositumomab. (Coulter Corporation was acquired subsequently by Beckman Instruments in October 1997. The union of the two companies produced Beckman Coulter.) In December 2000, Coulter Pharmaceutical was acquired by, and merged into, Corixa Corporation.Iodine-131 tositumomab is available for licencing in Japan. Corixa Corporation and GlaxoSmithKline signed an agreement to jointly develop and commercialise iodine-131 tositumomab. The total agreement has a potential value of up to $US132 million, plus shared profits and royalties. The two companies will jointly market the antibody in the US following regulatory approval. Corixa Corporation has announced it expects iodine-131 tositumomab to be approved in the US for non-Hodgkin's lymphoma (NHL). Under the terms of the original agreement, GlaxoSmithKline will receive exclusive marketing rights outside the US, excluding Japan. However, an amended agreement between the two companies will allow Corixa Corporation to also market the product outside the US. In February 2003, the European Commission granted iodine-131 tositumomab orphan-drug designation. Corixa Corporation and GlaxoSmithKline also intend to jointly investigate the use of the product in other indications. GlaxoSmithKline may also receive access to second generation anti

  20. Comparative biodistribution profile of [131I]VIP and [131I]VIP10-28

    Directory of Open Access Journals (Sweden)

    Maria Tereza Colturato

    2005-10-01

    Full Text Available Various tumor cells express significantly higher amounts of VIP receptors (VIPR that provided the basis for the clinical use of radiolabeled VIP for the in vivo localization of tumors. This work studied the labeling of VIP and VIP10-28 with iodine-131 to compare the biological distribution of the labeled compounds in Nuce mice and the affinity for tumor cells. Both VIP and VIP10-28 peptides contain two tyrosine residues, in positions 10 and 22, that are theoretically equally susceptible to radioiodination employing oxidative electrophilic substitution using oxidizing agents like Chloramine T. Radiochemical purity of the reaction mixture was determined by electrophoresis and HPLC. The VIP peptide and the fragment were labeled with radioiodine with good radiochemical yield (above 96%. Suitable, but important differences can be observed in biological distribution studies. Comparatively, blood clearance was faster for labeled VIP and perhaps because of this, the uptake in tumor was lower, especially during the first hour. These differences observed in the biological distribution of the compounds can be related to the lipophilicity of the labeled compounds.Várias células tumorais expressam significantemente uma alta quantidade de receptores VIP (VIPR que determinam a base para o uso clínico de VIP radiomarcado para localização de tumores in vivo. Foi estudado neste trabalho a marcação do VIP e do fragmento VIP10-28 com iodo-131 comparando a distribuição biológica dos compostos marcados em camundongos Nude e sua afinidade pelas células tumorais. Ambos os peptídeos, VIP e VIP10-28. contém dois resíduos de tirosina nas posições 10 e 22, que teoricamente são igualmente susceptíveis pela substituição eletrofílica oxidativa do radioiodo utilizando Cloramina T como agente oxidante. A pureza radioquímica da mistura de reação foi determinada por eletroforese e cromatografia líquida de alta eficiência (CLAE. O VIP e fragmento foram

  1. 40 CFR 92.131 - Smoke, data analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Smoke, data analysis. 92.131 Section... analysis. The following procedure shall be used to analyze the smoke test data: (a) Locate each throttle... following procedure: (1) Locate the highest reading, and integrate the highest 3-second average reading...

  2. Growth and bacteriocin production kinetics of Leuconostoc mesenteroides E131.

    Science.gov (United States)

    Drosinos, E H; Mataragas, M; Nasis, P; Galiotou, M; Metaxopoulos, J

    2005-01-01

    The aim of this study was to investigate the effect of pH, temperature, sodium chloride, type and level of sugar used in fermented sausages, on the occurrence and the concentration of the maximum bacteriocin activity, in order to optimize the bacteriocin synthesis during the growth cycle of Leuconostoc mesenteroides E131. In order to study the effect of the environmental factors on growth and bacteriocin production of Leuc. mesenteroides E131 fermentations were carried out in fermentor as well as in flasks. Mathematical equations were used to describe the kinetic parameters of the strain. When the micro-organism was grown in lower pH value (5.5) than optimum for growth (pH 6.5) the bacteriocin production was enhanced. On the contrary, bacteriocin production was favoured when the micro-organism was grown at temperatures close to the optimum for growth (25 degrees C). Finally, the level and the type of the sugar used as carbon source affected both growth and bacteriocin production with glucose being better source for biomass production and fructose more suitable for bacteriocin production. Leuconostoc mesenteroides E131 has a potential use as protective culture or its bacteriocin as protective agent in combination with another starter culture in fermented meats. Better understanding of the influence of environmental factors, such as pH, temperature and carbon source on the kinetic behaviour of Leuc. mesenteroides E131.

  3. Iodine Symporter Targeting with 124I/131I Theranostics

    NARCIS (Netherlands)

    Nagarajah, J.; Janssen, M.; Hetkamp, P.; Jentzen, W.

    2017-01-01

    Theranostics, a modern approach combining therapeutics and diagnostics, is among the most promising concepts in nuclear medicine for optimizing and individualizing treatments for many cancer entities. Theranostics has been used in clinical routines in nuclear medicine for more than 60 y-as 131I for

  4. Microdeletion in distal 17p13.1

    DEFF Research Database (Denmark)

    Zeesman, Susan; Kjaergaard, Susanne; Hove, Hanne Buciek

    2012-01-01

    Array comparative genomic hybridization has led to the identification of new syndromes by identifying genomic imbalances not detectable by standard karyotyping methods and by allowing correlations with physical findings. Deletions in the 17p13.1 region have been reported in patients with dysmorph...

  5. Spectroscopic properties and luminescence behaviour of europium doped lithium borate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Anjaiah, J., E-mail: anjaiah.juluru@gmail.com [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Department of Physics, Geethanjali College of Engineering and Technology, Keesara, RR Dist., Hyderabad 501 301 (India); Laxmikanth, C. [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Veeraiah, N. [Department of Physics, Acharya Nagarjuna University, Nagarjuna Nagar, Guntur 522 510, AP. (India)

    2014-12-01

    Li{sub 2}O–MO–B{sub 2}O{sub 3} (MO=ZnO, CaO and CdO) glasses doped with europium are prepared by using the melt quenching technique to study their absorption and luminescence properties to understand their lasing potentialities. The XRD pattern of the glasses confirmed the amorphous nature and the IR spectra reveal the presence of BO{sub 3} and BO{sub 4} units in the glass network. Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) are evaluated from the intensities of various absorption bands of optical absorption spectra. The J–O parameters have been used to calculate transition probabilities (A), lifetime (τ{sub R}), branching ratios (β{sub R}) and stimulated emission cross-section (σ{sub P}) for the {sup 5}D{sub 0}→{sup 7}F{sub J} (J=1–4) transitions of the Eu{sup 3+} ions. The decay from the {sup 5}D{sub 0} level of Eu{sup 3+} ions in these glasses has been measured and analysed. Branching ratios and stimulated emission cross-sections measured for all these glasses show that the {sup 5}D{sub 0}→{sup 7}F{sub 1} transition under investigation has the potential for laser applications. The high stimulated emission cross-section and branching ratios from the present glasses suggests their potential for infra red lasers. The study of the thermoluminescence is also carried out and the data suggests that the CdBEu glass is suitable for thermoluminescence emission output among the three Eu{sup 3+} doped glasses.

  6. Size-dependent cytotoxicity of europium doped NaYF{sub 4} nanoparticles in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang, E-mail: wsx@hbu.edu.cn; Zhang, Jinchao, E-mail: jczhang6970@163.com

    2014-10-01

    Lanthanide-doped sodium yttrium fluoride (NaYF{sub 4}) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF{sub 4} (NaYF{sub 4}:Eu{sup 3+}) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF{sub 4}:Eu{sup 3+} nanoparticles with three diameters have been synthesized. • NaYF{sub 4}:Eu{sup 3+} nanoparticles could be uptaken by endothelial cells (ECs). • NaYF{sub 4}:Eu{sup 3+} nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF{sub 4}:Eu{sup 3+} nanoparticles may be important to their toxicology effect.

  7. Two-dimensional high spatial-resolution dosimeter using europium doped potassium chloride: a feasibility study

    Science.gov (United States)

    Li, H. Harold; Driewer, Joseph P.; Han, Zhaohui; Low, Daniel A.; Yang, Deshan; Xiao, Zhiyan

    2014-01-01

    Recent research has shown that KCl:Eu2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had completed been incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl-) centers were the electron storage centers post×ray irradiation and that Eu2+ cations acted as luminescence centers in the photostimulation process. The 150-µm thick casted KCl:Eu2+ SPF showed sub-millimeter spatial resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu2+ and 80% low Z polymer binder exhibited almost no energy dependence in a 6 MV beam. KCl:Eu2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl’s intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu2+ based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. PMID:24651448

  8. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay

    Science.gov (United States)

    Shen, Yifeng; Xu, Shaohan; He, Donghua

    2015-01-01

    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0) respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5μg/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145μg/L). We propose that it can fulfill clinical applications. PMID:26056826

  9. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay.

    Directory of Open Access Journals (Sweden)

    Yifeng Shen

    Full Text Available A novel europium ligand 2,2',2'',2'''-(4,7-diphenyl-1,10-phenanthroline-2,9-diyl bis (methylene bis (azanetriyl tetra acetic acid (BC-EDTA was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm. It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0 respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5 μg/L. It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA reagents (0.2-145 μg/L. We propose that it can fulfill clinical applications.

  10. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: ntwaeab@ufs.ac.za [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)

    2014-03-15

    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  11. Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: jorgeiriqui@gimmunison.com [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)

    2015-10-15

    Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)

  12. Data on repeated (131)I-WB scans and the incidence of positive Tg and negative (131)I-WBS in DTC patients from a 24 months study.

    Science.gov (United States)

    Adedapo, Kayode S; Vangu, Mboyo Di Tamba

    2011-01-01

    We present data on repeated iodine-131 whole body scans ((131)I-WBS) in differentiated thyroid cancer patients (DTC) after surgery and (131)I remnant ablation and on increased thyroglobulin (Tg) with negative (131)I-WBS, in a retrospective study at our hospital. A total of 106 patients (91 female and 15 male) treated with (131)I for DTC met the inclusion criteria. The mean age of the patients was 45 years, age range 16-81 years. A total of 101 patients had complete 24 months follow-up following (131)I remnant ablation treatment. The mean (131)I dose administered after the first 6 months of follow- up was 3GBq while mean total dose was 4.9GBq, range 1.1-7.4GBq. Our results showed that at the end of the first 6 months post treatment, 58/101 patients had a negative (131)I-WBS. By the end of the 4th (131)I treatment at 24th months, the remaining 43 patients became negative for (131)I-WBS. We found increased Tg and negative (131)I-WBS in 2 of the 101 patients at the 24th months examination the so called Tg elevated negative (131)I-WBS (TENIS syndrome). The possible explanation of this syndrome is discussed. In conclusion, our study in DTC operated patients does not support the use of repeated diagnostic (131)I-WBS after an undetectable Tg because we found no Tg rebound in patients with negative (131)I-WBS, after 24 months of follow-up with serial measurements of Tg on and of suppression with L thyroxine.

  13. Evaluation of {sup 131}I retention in several adsorbers

    Energy Technology Data Exchange (ETDEWEB)

    Catanoso, Marcela F.; Osso Junior, Joao Alberto, E-mail: marcela.forli@gmail.co, E-mail: jaosso@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Diretoria de Radiofarmacia

    2011-07-01

    Several iodine radioisotopes are used in nuclear medicine for treatment and diagnostic purposes. The radioisotope {sup 131}I is used both in diagnosis and therapy due to its physical characteristics of decay by {beta}{sup -} and its {gamma}-ray emissions suitable for diagnosis. It is routinely produced at IPEN through the irradiation of TeO{sub 2} targets in the IEA-R1m nuclear reactor. After the irradiation, the {sup 131}I is separated by dry distillation, where the targets are put in an oven, heated at 760 deg C for 2 hours and the {sup 131}I, volatile, is carried by an O{sub 2} gas stream. The aim of this work was to evaluate the retention and elution of {sup 131}I samples produced at IPEN in several adsorbers as part of a project aiming the purification of these radioisotopes, allowing the labeling of biomolecules. Samples of {sup 131}I were used for retention and elution studies with the following adsorbers: commercial cartridges, anionic resin columns and cationic resin column. The results showed that Ag cartridges and anionic resins Dowex 1X8, Dowex 3 and IRA 400 had a great iodine retention but no elution after using specific eluents. The QMA light, acid alumina, neutral alumina and cationic resin Dowex 50WX4 showed high retention and elution and QMA plus and cationic resin Dowex 50WX8 and Dowex 50WX12 had a good retention but lower elution. Regarding to the better retention and elution, Ag cartridges and resins showed a higher percentage of iodine retention but lower elution yield and QMA light, acid and neutral alumina cartridges showed better results. (author)

  14. Methodology for management of therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment previously described with a therapeutic dose bigger than ablative of Iodine 131, as well as the use of citric fruits to stimulate the salivation, the administration of liquid post-dose is included to accelerate the gastric emptying avoiding the secondary effects as the vomit. (Author)

  15. Treatment of hyperthyroidism by 131-iodine; Traitement des hyperthyroidies par l'iode 131: dose calculee versus dose fixe

    Energy Technology Data Exchange (ETDEWEB)

    Fieffe, S.; Cuif-Joba, A.; Testard, A.; Fortuna, I.; Pocharta, J.M.; Papathanassioua, D.; Schvartz, C. [Service d' endocrinologie et medecine nucleaires, institut Jean-Godinot, 1, rue du General Koeing, 51056 Reims, (France)

    2009-05-15

    In a first time, we chose to modify the dose to be administered, on using always the Marinelli formula but on increasing the absorbed dose. In a second time, we wanted to simplify the determination of the dose to be administered by modulating it only in function of the thyroid volume. Two groups of patients were managed for hyperthyroidism recurrence. In a first group the iodine dose ({sup 131}I) was determined with the help of the simplified Marinelli formula: chosen absorbed dose was 150 Gy, gland volume determined by echography, measurement of the fixation at the sixth hour. In the second group, the thyroid volume was determined by echography. The patients with a thyroid from 5 to 30 g received 185 MBq, from 30 to 50 g 370 MBq and superior to 50 g 555 MBq of iodine 131. The two groups of patients have the same characteristics. the results of treatment by iodine 131, evaluated on the dosages of T4L and TSH at three and six months, show the preservation of euthyroidism or the passage in hypothyroidism among 94% of patients in the group 1 and 80% of patients in the group 2. These results are not significantly different. The easiness of the realisation of the treatment in the group 2 lead us to continue this simplified therapy scheme that allows equally to improve the radiation protection of medical personnel by avoiding the use of iodine 131. (N.C.)

  16. Synthesis and characterization of barium titanate, doped with europium and neodymium; Sintese e caracterizacao de titanato de bario, dopados com europio e neodimio

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: nanda_louise@yahoo.com.br [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica

    2013-07-01

    This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.

  17. Stability constants of the Europium complexes with the chloride ions; Constantes de estabilidad de los complejos del europio con los iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  18. LA-ICP-MS Allows Quantitative Microscopy of Europium-Doped Iron Oxide Nanoparticles and is a Possible Alternative to Ambiguous Prussian Blue Iron Staining.

    Science.gov (United States)

    Scharlach, Constantin; Müller, Larissa; Wagner, Susanne; Kobayashi, Yuske; Kratz, Harald; Ebert, Monika; Jakubowski, Norbert; Schellenberger, Eyk

    2016-05-01

    The development of iron oxide nanoparticles for biomedical applications requires accurate histological evaluation. Prussian blue iron staining is widely used but may be unspecific when tissues contain substantial endogenous iron. Here we tested whether microscopy by laser ablation coupled to inductively coupled plasma mass spectrometry (LA-ICP-MS) is sensitive enough to analyze accumulation of very small iron oxide particles (VSOP) doped with europium in tissue sections. For synthesis of VSOP, a fraction of Fe3+ (5 wt%) was replaced by Eu3+, resulting in particles with 0.66 mol% europium relative to iron (Eu-VSOP) but with otherwise similar properties as VSOP. Eu-VSOP or VSOP was intravenously injected into ApoE-/- mice on Western cholesterol diet and accumulated in atherosclerotic plaques of these animals. Prussian blue staining was positive for ApoE-/- mice with particle injection but also for controls. LA-ICP-MS microscopy resulted in sensitive and specific detection of the europium of Eu-VSOP in liver and atherosclerotic plaques. Furthermore, calibration with Eu-VSOP allowed calculation of iron and particle concentrations in tissue sections. The combination of europium-doped iron oxide particles and LA-ICP-MS microscopy provides a new tool for specific and quantitative analysis of particle distribution at the tissue level and allows correlation with other elements such as endogenous iron.

  19. Novel Time-Resolved Fluorescence Europium Nanoparticle Immunoassay for Detection of Human Immunodeficiency Virus-1 Group O Viruses Using Microplate and Microchip Platforms.

    Science.gov (United States)

    Haleyur Giri Setty, Mohan Kumar; Liu, Jikun; Mahtani, Prerna; Zhang, Panhe; Du, Bingchen; Ragupathy, Viswanath; Devadas, Krishnakumar; Hewlett, Indira K

    2016-06-01

    Accurate detection and quantification of HIV-1 group O viruses have been challenging for currently available HIV assays. We have developed a novel time-resolved fluorescence (TRF) europium nanoparticle immunoassay for HIV-1 group O detection using a conventional microplate enzyme-linked immunosorbent assay (ELISA) and a microchip platform. We screened several antibodies for optimal reactivity with several HIV-1 group O strains and identified antibodies that can detect all the strains of HIV-1 group O that were available for testing. The antibodies were used to develop a conventional ELISA format assay and an in-house developed europium nanoparticle-based assay for sensitivity. The method was evaluated on both microwell plate and microchip platforms. We identified two specific and sensitive antibodies among the six we screened. The antibodies, C65691 and ANT-152, were able to quantify 15 and detect all 17 group O viruses, respectively, as they were broadly cross-reactive with all HIV-1 group O strains and yielded better signals compared with other antibodies. We have developed a sensitive assay that reflects the actual viral load in group O samples by using an appropriate combination of p24 antibodies that enhance group O detection and a highly sensitive TRF-based europium nanoparticle for detection. The combination of ANT-152 and C65690M in the ratio 3:1 was able to give significantly higher signals in our europium-based assay compared with using any single antibody.

  20. Lanthanide-to-lanthanide energy-transfer processes operating in discrete polynuclear complexes: can trivalent europium be used as a local structural probe?

    Science.gov (United States)

    Zaïm, Amir; Eliseeva, Svetlana V; Guénée, Laure; Nozary, Homayoun; Petoud, Stéphane; Piguet, Claude

    2014-09-15

    This work, based on the synthesis and analysis of chemical compounds, describes a kinetic approach for identifying intramolecular intermetallic energy-transfer processes operating in discrete polynuclear lanthanide complexes, with a special emphasis on europium-containing entities. When all coordination sites are identical in a (supra)molecular complex, only heterometallic communications are experimentally accessible and a Tb → Eu energy transfer could be evidenced in [TbEu(L5)(hfac)6] (hfac = hexafluoroacetylacetonate), in which the intermetallic separation amounts to 12.6 Å. In the presence of different coordination sites, as found in the trinuclear complex [Eu3(L2)(hfac)9], homometallic communication can be induced by selective laser excitation and monitored with the help of high-resolution emission spectroscopy. The narrow and non-degenerated character of the Eu((5)D0 ↔ (7)F0) transition excludes significant spectral overlap between donor and acceptor europium cations. Intramolecular energy-transfer processes in discrete polynuclear europium complexes are therefore limited to short distances, in agreement with the Fermi golden rule and with the kinetic data collected for [Eu3(L2)(hfac)9] in the solid state and in solution. Consequently, trivalent europium can be considered as a valuable local structural probe in discrete polynuclear complexes displaying intermetallic separation in the sub-nanometric domain, a useful property for probing lanthanido-polymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide coordinated to europium(III) ions as reliable circularly polarized luminescence calibration standards†

    Science.gov (United States)

    Bonsall, Steven D.; Houcheime, Mona; Straus, Daniel A.; Muller, Gilles

    2009-01-01

    The synthesis of two optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide and the constant circularly polarized luminescence (CPL) activity of their acetonitrile trivalent europium complex solutions over a long period of time open new perspectives for performing accurate routine CPL calibration tests at low cost. PMID:17728891

  2. Photoluminescence behavior of europium (III) complexes containing 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione ligand.

    Science.gov (United States)

    Wang, Dunjia; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Zheng, Jing

    2014-01-03

    Three novel europium complexes with 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione (TNPD) and 2,2-dipyridine (Bipy) or 1,10-phenan-throline (Phen) were synthesized and confirmed by FT-IR, (1)H NMR, UV-vis absorption and elemental analysis. Photoluminescence behavior of complexes Eu(TNPD)3, Eu(TNPD)3·Bipy and Eu(TNPD)3·Phen were investigated in detail. Their emission spectra exhibited the characteristic emission bands that arise from the (5)D0→(7)FJ (J=0-4) transitions of the europium ion in solid state. Meanwhile, the results of their lifetime decay curves indicated that only one chemical environment existed around the europium ion. The intrinsic luminescence quantum efficiency (η) and the experimental intensity parameters (Ωt) of europium complexes were determined according to the emission spectra and luminescence decay curves in solid state. The complex Eu(TNPD)3·Phen showed much longer lifetime (τ) and higher luminescence quantum efficiency (η) than complexes Eu(TNPD)3 and Eu(TNPD)3·Bipy. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.

    2007-01-01

    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  4. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes.

    Science.gov (United States)

    Souza, E R; Mazali, I O; Sigoli, F A

    2014-01-01

    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  5. Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles

    Science.gov (United States)

    Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.

    2018-03-01

    The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

  6. A microwave-assisted solution combustion synthesis to produce europium-doped calcium phosphate nanowhiskers for bioimaging applications.

    Science.gov (United States)

    Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B

    2013-09-01

    Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  7. Europium nanoparticle-based simple to perform dry-reagent immunoassay for the detection of hepatitis B surface antigen.

    Science.gov (United States)

    Talha, Sheikh M; Salminen, Teppo; Juntunen, Etvi; Spangar, Anni; Gurramkonda, Chandrasekhar; Vuorinen, Tytti; Khanna, Navin; Pettersson, Kim

    2016-03-01

    Hepatitis B infection, caused by hepatitis B virus (HBV), presents a huge global health burden. Serological diagnosis of HBV mainly relies on the detection of hepatitis B surface antigen (HBsAg). Although there are high sensitivity commercial HBsAg enzyme immunoassays (EIAs) available, many low-resource laboratories lacking trained technicians continue to use rapid point-of-care assays with low sensitivities for HBsAg detection, due to their simplicity to operate. We developed a time-resolved fluorometric dry-reagent HBsAg immunoassay which meets the detection limit of high sensitivity EIAs but is simple to operate. To develop the assay, anti-HBsAg monoclonal antibody coated on europium nanoparticles was dried atop of biotinylated anti-HBsAg polyclonal antibody immobilized on streptavidin-coated microtiter wells. To test a sample in dry-reagent assay, serum sample and assay buffer were added to the wells, incubated, washed and europium signals were measured. The assay showed a detection limit of 0.25 ng/ml using HBsAg spiked in serum sample. When evaluated with 24 HBV positive and 37 negative serum samples, assay showed 100% sensitivity and specificity. Assay wells are stable for at least 26 weeks when stored at 4°C, and can tolerate elevated temperatures of up to 35°C for two weeks. The developed assay has high potential to be used in low-resource laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Bright mono-aqua europium complexes based on triazacyclononane that bind anions reversibly and permeate cells efficiently.

    Science.gov (United States)

    Butler, Stephen J; McMahon, Brian K; Pal, Robert; Parker, David; Walton, James W

    2013-07-15

    A series of five europium(III) complexes has been prepared from heptadentate N5O2 ligands that possess a brightness of more than 10 mM(-1) cm(-1) in water, following excitation over the range λ=330-355 nm. Binding of several oxy anions has been assessed by emission spectral titrimetric analysis, with the binding of simple carboxylates, lactate and citrate involving a common ligation mode following displacement of the coordinated water. Selectivity for bicarbonate allows the rapid determination of this anion in human serum, with K(d)=37 mM (295 K). The complexes are internalised quickly into mammalian cells and exhibit a mitochondrial localisation at early time points, migrating after a few hours to reveal a predominant lysosomal distribution. Herein, we report the synthesis and complexation behaviour of strongly emissive europium (III) complexes that bind oxy-anions in aqueous media with an affinity and selectivity profile that is distinctively different from previously studied systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands.

    Science.gov (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario

    2015-09-21

    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  10. Highly Sensitive Luminescence Assessment of Bile Acid Using a Balofloxacin-Europium(III) Probe in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong [Shihezi Univ., Shihezi (China)

    2012-12-15

    A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10{sup -9} - 7.0 Χ 10{sup -7} mol L{sup -1} with a detection limit of 1.3 Χ 10{sup -9} mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10{sup -8} mol L{sup -1} bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly.

  11. Investigation of the influence of silver and tin on the luminescence of trivalent europium ions in glass

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.A. [Department of Chemistry, University of Puerto Rico, Mayagueez, PR 00681 (United States); Lysenko, S. [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Liu, H., E-mail: hliu@uprm.ed [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Fachini, E.; Cabrera, C.R. [Center for Nanoscale Materials, University of Puerto Rico, Rio Piedras, PR 00931 (Puerto Rico)

    2010-01-15

    Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu{sup 3+} ions luminescence have been assessed. For the glass system containing only europium, Eu{sup 3+} PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu{sup 3+} PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag{sup +} ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu{sup 3+} PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu{sup 3+}->Eu{sup 2+} reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu{sup 3+} PL.

  12. Behaviour of europium (III) and its hydroxo and carbonate complexes in a solvent extraction system with HDBM in 2 M NaCl at 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico); Solache-Rios, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Rojas-Hernandez, A. [Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico)

    1999-07-01

    The behaviour of europium in the solvent extraction system Eu{sup 3+}-water-2 M NaCl-HDBM-benzene was studied, taking into account the pC{sub H} and the carbonate ion concentration in the solutions. The stability constants for the hydrolysis and carbonate complexes of europium were determined at 303 K in the same medium by pH titration followed by a computational refinement. The obtained data were: log {beta}{sub Eu,H} = -8.29 {+-} 0.02, log {beta}{sub Eu,2H} = -16.37 {+-} 0.02, log {beta}{sub Eu,3H} = -24.54 {+-} 0.11, log {beta}{sub Eu,4H} = -34.91 {+-} 0.26, log {beta}{sub CO{sub 2}{sup 2-},H} = 9.30 {+-} 0.05, log {beta}{sub Eu,CO{sub 3}{sup 2-}} = 5.96 {+-} 0.03, log {beta}{sub Eu,CO{sub 3}{sup 2-},H} = -1.24 {+-} 0.05 and log {beta}{sub Eu,CO{sub 3}{sup 2-},2H} = -11.39 {+-} 0.11. Log K{sub W} was -13.78 {+-} 0.06. The behaviour of europium in this solvent extraction system was simulated, taking into account the hydrolysis and carbonate complexes plus the formation of Eu(DBM){sub 3}(OH){sup 1-} and Eu(DBM){sub 3}(CO{sub 3}){sup 2-} in the aqueous phase. The only europium species considered in the organic phase was Eu(DBM){sub 3}. The first hydrolysis constant of europium was also determined by using this solvent extraction system under the same conditions. A good conformity was found with the results obtained by both techniques. (orig.)

  13. Bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex a new apoptotic agent through Flk-1 down regulation, caspase-3 activation and oligonucleosomes DNA fragmentation.

    Science.gov (United States)

    Azab, Hassan A; Hussein, Belal H M; El-Azab, Mona F; Gomaa, Mohamed; El-Falouji, Abdullah I

    2013-01-01

    New bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex was synthesized and characterized. In vivo anti-angiogenic activities of bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex against Ehrlich ascites carcinoma (EAC) cells are described. The newly synthesized complex resulted in inhibition of proliferation of EAC cells and ascites formation. The anti-tumor effect was found to be through anti-angiogenic activity as evident by the reduction of microvessel density in EAC solid tumors. The anti-angiogenic effect is mediated through down-regulation of VEGF receptor type-2 (Flk-1). The complex was also found to significantly increase the level of caspase-3 in laboratory animals compared to the acridine ligand and to the control group. This was also consistent with the DNA fragmentation detected by capillary electrophoresis that proved the apoptotic effect of the new complex. Our complex exhibited anti-angiogenic and apoptotic activity in vivo, a thing that makes it a potential effective chemotherapeutic agent. The interaction of calf thymus DNA (ct-DNA) with bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex has been investigated using fluorescence technique. A competitive experiment of the europium(III)-acridine complex with ethidium bromide (EB) to bind DNA revealed that interaction between the europium(III)-acridine and DNA was via intercalation. The interaction of the synthesized complex with tyrosine kinases was also studied using molecular docking simulation to further substantiate its mode of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Sulfates, Clouds and Radiation Brazil (SCAR-B) University of Washington C131A Data

    Data.gov (United States)

    National Aeronautics and Space Administration — SCAR_B_UWC131A data are Smoke/Sulfates, Clouds and Radiation Experiment in Brazil data from instruments on board the University of Washington C131A aircraft in...

  15. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Detailed results of the Hanford Environmental Dose Reconstruction project (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  16. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1992-10-01

    Detailed results of the Hanford Environmental Dose Reconstruction (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  17. Choriocarcinoma: blocking factor and monoclonal antibody iodine 131 imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pattillo, R.A.; Khazaeli, M.B.; Ruckert, A.C.; Hussa, R.O.; Collier, B.D.; Beierwaltes, W.; Mattingly, R.F.

    1984-04-01

    Postoperative iodine 131 monoclonal antibody localization in metastatic choriocarcinoma was accomplished in this study. The monoclonal antibody was prepared to male choriocarcinoma which cross reacted with gestational choriocarcinoma. The antibody was raised against whole choriocarcinoma cells and human chorionic gonadotropin (hCG) cross reactivity was excluded. The purified antibody was iodinated with /sup 131/I and successfully imaged BeWo choriocarcinoma transplanted in nude mice; however, imaging of choriocarcinoma in a patient was verified only after resection. It is our belief that failure to sufficiently concentrate the antibody in the tumor before operation was due to blocking factor in the serum of the patient. Blocking factor and hCG dropped postoperatively. Blocking factor activity in 15 patients with metastatic trophoblastic disease was monitored and, like hCG, was found to be a sensitive indicator of the presence of disease. Its efficacy may be in the small number of patients without hCG but with persistent disease.

  18. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Releases of fission product iodine-131 are calculated for the 1944 through 1947 period from the Hanford Reservation. Releases to the atmosphere were from the ventilation stacks of T and B separation plants. A reconstruction of daily separation plant operations forms the basis of the releases. The reconstruction traces the iodine-131 content of each fuel discharge from the B, D, and F Reactors to the dissolving step in the separation plants. Statistical computer modeling techniques are used to estimate hourly release histories based on sampling mathematical distribution functions that express the uncertainties in the source data and timing. The reported daily, monthly, and yearly estimates are averages and uncertainty ranges are based on 100 independent Monte Carlo realizations'' of the hourly release histories.

  19. Transcriptional response to 131I exposure of rat thyroid gland.

    Science.gov (United States)

    Rudqvist, Nils; Spetz, Johan; Schüler, Emil; Parris, Toshima Z; Langen, Britta; Helou, Khalil; Forssell-Aronsson, Eva

    2017-01-01

    Humans are exposed to 131I in medical diagnostics and treatment but also from nuclear accidents, and better knowledge of the molecular response in thyroid is needed. The aim of the study was to examine the transcriptional response in thyroid tissue 24 h after 131I administration in rats. The exposure levels were chosen to simulate both the clinical situation and the case of nuclear fallout. Thirty-six male rats were i.v. injected with 0-4700 kBq 131I, and killed at 24 h after injection (Dthyroid = 0.0058-3.0 Gy). Total RNA was extracted from individual thyroid tissue samples and mRNA levels were determined using oligonucleotide microarray technique. Differentially expressed transcripts were determined using Nexus Expression 3.0. Hierarchical clustering was performed in the R statistical computing environment. Pathway analysis was performed using the Ingenuity Pathway Analysis tool and the Gene Ontology database. T4 and TSH plasma concentrations were measured using ELISA. Totally, 429 differentially regulated transcripts were identified. Downregulation of thyroid hormone biosynthesis associated genes (e.g. thyroglobulin, thyroid peroxidase, the sodium-iodine symporter) was identified in some groups, and an impact on thyroid function was supported by the pathway analysis. Recurring downregulation of Dbp and Slc47a2 was found. Dbp exhibited a pattern with monotonous reduction of downregulation with absorbed dose at 0.0058-0.22 Gy. T4 plasma levels were increased and decreased in rats whose thyroids were exposed to 0.057 and 0.22 Gy, respectively. Different amounts of injected 131I gave distinct transcriptional responses in the rat thyroid. Transcriptional response related to thyroid function and changes in T4 plasma levels were found already at very low absorbed doses to thyroid.

  20. Europium(III) reduction and speciation within a Wells-Dawson heteropolytungstate.

    Science.gov (United States)

    Jing, Jing; Burton-Pye, Benjamin P; Francesconi, Lynn C; Antonio, Mark R

    2008-08-04

    The redox speciation of Eu(III) in the 1:1 stoichiometric complex with the alpha-1 isomer of the Wells-Dawson anion, [alpha-1-P 2W 17O 61] (10-), was studied by electrochemical techniques (cyclic voltammetry and bulk electrolysis), in situ XAFS (X-ray absorption fine structure) spectroelectrochemistry, NMR spectroscopy ( (31)P), and optical luminescence. Solutions of K 7[(H 2O) 4Eu(alpha-1-P 2W 17O 61)] in a 0.2 M Li 2SO 4 aqueous electrolyte (pH 3.0) show a pronounced concentration dependence to the voltammetric response. The fully oxidized anion and its reduced forms were probed by Eu L 3-edge XANES (X-ray absorption near edge structure) measurements in simultaneous combination with controlled potential electrolysis, demonstrating that Eu(III) in the original complex is reduced to Eu(II) in conjunction with the reduction of polyoxometalate (POM) ligand. After exhaustive reduction, the heteropoly blue species with Eu(II) is unstable with respect to cluster isomerization, fragmentation, and recombination to form three other Eu-POMs as well as the parent Wells-Dawson anion, alpha-[P 2W 18O 62] (6-). EXAFS data obtained for the reduced, metastable Eu(II)-POM before the onset of Eu(II) autoxidation provides an average Eu-O bond length of 2.55(4) A, which is 0.17 A longer than that for the oxidized anion, and consistent with the 0.184 A difference between the Eu(II) and Eu(III) ionic radii. The reduction of Eu(III) is unusual among POM complexes with Lindqvist and alpha-2 isomers of Wells-Dawson anions, that is, [Eu(W 5O 18) 2] (9-) and [Eu(alpha-2-As 2W 17O 61) 2] (17-), but not to the Preyssler complex anion, [EuP 5W 30O 110] (12-), and fundamental studies of materials based on coupling Eu and POM redox properties are still needed to address new avenues of research in europium hydrometallurgy, separations, and catalysis sciences.

  1. Structural, optical and electrical properties of europium picrate tetraethylene glycol complex as emissive material for OLED

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: ekusrini@che.ui.ac.id [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I.; Adnan, Rohana [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Sha Shiong, Ng; Fun, H.K. [School of Physics, Universiti Sains Malaysia, 11800 Penang (Malaysia); Adhha Abdullah, M.A.; Mamat, Mazidah [Department of Chemical Sciences, Faculty of Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu Darul Iman (Malaysia); Za' aba, N.K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)

    2012-01-15

    A new europium complex [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O was synthesized and used as the emission material for the single layer device structure of ITO/EO4-Eu-Pic/Al, using a spin-coating technique. Study on the optical properties of the [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O complex where EO4=tetraethylene glycol and Pic=picrate anion, had to be undertaken before being applicable to the study of an organic light emitting diode (OLED). The electrical property of an OLED using current-voltage (I-V) measurement was also studied. In complex, the Eu(III) ion was coordinated with the EO4 ligand as a pentadentate mode, one water molecule, and with two Pic anions as bidentate and monodentate modes, forming a nine-coordination number. The photoluminescence (PL) spectra of the crystalline complex in the solid state and its thin film showed a hypersensitive peak at 613.5-614.9 nm that assigned to the {sup 5}D{sub 0}{yields}{sup 7}F{sub 2} transition. A narrow band emission from the thin film EO4-Eu-Pic was obtained. The typical semiconductor I-V curve of device ITO/EO4-Eu-Pic/Al showed the threshold and turn on voltages at 1.08 and 4.6 V, respectively. The energy transfer process from the ligand to the Eu(III) ion was discussed by investigating the excitation and PL characteristics. Effect of the picrate anion on the device performance was also studied. - Highlights: > The [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75(H{sub 2}O) is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in single layer device structure of ITO/EO4-Eu-Pic/Al. > The complex displays a red luminescence in both the crystalline complex and its thin film state. > The low turn on voltage of the device (4.6 V), indicating that this material is suitable for OLED. > The roughness and morphology of the thin film affects luminance and electrical properties of OLED.

  2. 10 CFR 1.31 - Office of the Chief Financial Officer.

    Science.gov (United States)

    2010-01-01

    ... comply with the Federal Manager's Financial Integrity Act of 1982; (e) Develops and manages an agencywide... 10 Energy 1 2010-01-01 2010-01-01 false Office of the Chief Financial Officer. 1.31 Section 1.31... Financial Officer § 1.31 Office of the Chief Financial Officer. The Office of the Chief Financial Officer...

  3. 40 CFR 131.42 - Antidegradation Implementation Methods for the Commonwealth of Puerto Rico.

    Science.gov (United States)

    2010-07-01

    ... for the Commonwealth of Puerto Rico. 131.42 Section 131.42 Protection of Environment ENVIRONMENTAL... Standards § 131.42 Antidegradation Implementation Methods for the Commonwealth of Puerto Rico. (a) General... February 2, 1989 Resolution R-89-2-2 of the Governing Board of the Puerto Rico Environmental Quality Board...

  4. 26 CFR 1.381(c)(13)-1 - Involuntary conversions.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Involuntary conversions. 1.381(c)(13)-1 Section 1.381(c)(13)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.381(c)(13)-1 Involuntary conversions...

  5. Transcription pattern of UL131A-128 mRNA in clinical strains of ...

    Indian Academy of Sciences (India)

    Mean while, clones containing UL131A-128 transcripts in an HCMV cDNA library of a clinical strain were selected and sequenced. It was demonstrated that UL131A-128 mRNA was expressed with immediately early, early and late kinetics. Sequences obtained by RT-PCR showed that the UL131A gene consisted of two ...

  6. 21 CFR 516.131 - Refuse to file a request for determination of eligibility for indexing.

    Science.gov (United States)

    2010-04-01

    ... eligibility for indexing. 516.131 Section 516.131 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... § 516.131 Refuse to file a request for determination of eligibility for indexing. (a) If a request for determination of eligibility for indexing contains all of the information required by § 516.129, FDA shall file...

  7. 42 CFR 137.131 - When should a final offer be submitted?

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false When should a final offer be submitted? 137.131 Section 137.131 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Final Offer § 137.131 When should...

  8. Interventional therapy for human breast cancer in nude mice with 131I gelatin microspheres (131I-GMSs) following intratumoral injection

    OpenAIRE

    Li, Chuan-Chao; Chi, Jun-Lin; Ma, Yu; Li, Jian-Hong; Xia, Chuan-Qin; LI, Lin; Chen, Zhuo; Chen, Xiao-li

    2014-01-01

    Introduction The aim of this study was to investigate the effects of 131I gelatin microspheres (131I-GMS) on human breast cancer cells (MCF-7) in nude mice and the biodistribution of 131I-GMSs following intratumoral injections. Methods A total of 20 tumor-bearing mice were divided into a treatment group and control group and received intratumoral injections of 2.5 mci 131I-GMSs and nonradioactive GMSs, respectively. Tumor size was measured once per week. Another 16 mice received intratumoral ...

  9. Epidemiology and characteristics of Escherichia coli sequence type 131 (ST131) from long-term care facility residents colonized intestinally with fluoroquinolone-resistant Escherichia coli.

    Science.gov (United States)

    Han, Jennifer H; Garrigan, Charles; Johnston, Brian; Nachamkin, Irving; Clabots, Connie; Bilker, Warren B; Santana, Evelyn; Tolomeo, Pam; Maslow, Joel; Myers, Janice; Carson, Lesley; Lautenbach, Ebbing; Johnson, James R

    2017-03-01

    The objective of this study was to evaluate molecular and epidemiologic factors associated with Escherichia coli sequence type 131 (ST131) among long-term care facility (LTCF) residents who acquired gastrointestinal tract colonization with fluoroquinolone-resistant E. coli (FQREC). Colonizing isolates from 37 residents who newly developed FQREC colonization at three LTCFs from 2006 to 2008 were evaluated. Twenty-nine (78%) of 37 total FQREC colonizing isolates were ST131. Most ST131 isolates had a distinctive combination of gyrA and parC replacement mutations. The ST131 and non-ST131 isolates differed significantly for the prevalence of many individual virulence factors but not for the proportion that qualified molecularly as extraintestinal pathogenic E. coli (ExPEC) or aggregate virulence factor scores. E. coli ST131 was highly prevalent among LTCF residents with FQREC colonization. Future studies should determine the risk factors for infection among ST131-colonized residents, and assess the potential for increased transmissibility of ST131 in the long-term care setting. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Toxicity of upfront {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) therapy in newly diagnosed neuroblastoma patients: a retrospective analysis

    Energy Technology Data Exchange (ETDEWEB)

    Bleeker, Gitta; Schoot, Reineke A.; Caron, Huib N.; Kraker, Jan de; Tytgat, Godelieve A. [Emma Children' s Hospital, Academic Medical Centre (AMC), Department of Paediatric Oncology, PO Box 22700, Amsterdam (Netherlands); Hoefnagel, Cees A. [National Cancer Institute (NKI-AvL), Department of Nuclear Medicine, Amsterdam (Netherlands); Eck, Berthe L. van [Academic Medical Centre (AMC), Department of Nuclear Medicine, Amsterdam (Netherlands)

    2013-10-15

    In the treatment of patients with high-risk neuroblastoma, different doses of {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) are administered at different time points during treatment. Toxicity, mainly haematological (thrombocytopenia), from {sup 131}I-MIBG therapy is known to occur in extensively chemotherapy pretreated neuroblastoma patients. Up to now, acute toxicity from {sup 131}I-MIBG as initial treatment has never been studied in a large cohort. The aim of this retrospective study was to document acute toxicity related to upfront {sup 131}I-MIBG. All neuroblastoma patients (stages 1-4 and 4S) treated upfront with {sup 131}I-MIBG at the Emma Children's Hospital, Academic Medical Centre (1992 - 2008) were included in this retrospective analysis. The acute toxicity (during therapy) and short-term toxicity (1st month following therapy) of the first two {sup 131}I-MIBG therapies were studied. Of 66 patients (34 boys, 32 girls; median age 2.2 years, range 0.1 - 9.4 years), 49 had stage 4 disease, 5 stage 4S, 6 stage 3, 1 stage 2 and 5 stage 1. The median first dose was 441 MBq/kg (range 157 - 804 MBq/kg). The median second dose was 328 MBq/kg (range 113 - 727 MBq/kg). The most frequently observed symptoms were nausea and vomiting (21 %, maximum grade II). The main toxicity was grade IV haematological, occurring only in stage 4 patients, after the first and second {sup 131}I-MIBG therapies: anaemia (5 % and 4 %, respectively), leucocytopenia (3 % and 4 %) and thrombocytopenia (2 % and 4 %). No stem cell rescue was needed. The main acute toxicity observed was haematological followed by nausea and vomiting. One patient developed posterior reversible encephalopathy syndrome during {sup 131}I-MIBG therapy, possibly related to {sup 131}I-MIBG. We consider {sup 131}I-MIBG therapy to be a safe treatment modality. (orig.)

  11. Synthesis of Luminescent Ink from Europium-Doped Y2O3 Dispersed in Polyvinyl Alcohol Solution

    Directory of Open Access Journals (Sweden)

    Astuti

    2009-01-01

    Full Text Available Luminescent ink from europium-doped Y2O3 ( Y2O3:Eu has been synthesized by two steps method: first, synthesis of luminescent powder of Y2O3:Eu by simple heating of metallic nitrates in a polymer solution and second, dispersing the powder in a polyvinyl alcohol (PVA solution. The stability of the ink (luminescent colloid was strongly affected by mixing process of the powder and the solution. Mixing process must be performed for a long time (about 8 hours at above room temperature to product stable colloids. We observed that mixing at 30–40∘C resulted in a stable and highly dispersed colloid. The writing test was performed on a white paper to show the potential use of the colloid for making security codes.

  12. Induced europium CPL for the selective signalling of phosphorylated amino-acids and O-phosphorylated hexapeptides.

    Science.gov (United States)

    Neil, Emily R; Fox, Mark A; Pal, Robert; Parker, David

    2016-05-17

    Two bright, europium(iii) complexes based on an achiral heptadentate triazacyclononane ligand bearing two strongly absorbing chromophores have been evaluated for the selective emission and CPL signalling of various chiral O-phosphono-anions. Binding of O-phosphono-Ser and Thr gives rise to a strong induced CPL signature and a favoured Δ complex configuration is adopted. A similarly large induced CPL signal arises when [Eu·](2+) binds to lysophosphatidic acid (LPA), where the strong binding (log K 5.25 (295 K)) in methanol allowed its detection over the range 5 to 40 μM. Strong and chemoselective binding to the phosphorylated amino-acid residues was also observed with a set of four structurally related hexapeptides: in one case, the sign of the gem value in the ΔJ = 1 transition allowed differentiation between the binding to O-P-Ser and O-P-Tyr residues.

  13. A new europium(III)-β-diketonate complex based on diphenylethyne as red phosphors applied in LED

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guang, E-mail: shaog@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Na; Lin, Duan [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Feng, Kenjun [Department of Chemical Engineering, Hui-Zhou University, Huizhou 516007 (China); Cao, Rihui, E-mail: caorihui@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Gong, Menglian [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China)

    2013-06-15

    A new europium(III) ternary complex based on a fluorinated β-diketonate ligand and 1,10-phenanthroline as an ancillary ligand has been prepared and evaluated as a candidate for light-emitting diode (LED). The complex exhibits a high decomposition temperature (316 °C). Photophysical properties such as FT-IR spectra, UV–vis absorption spectra, excitation and emission spectra, luminescence decay curve and quantum yield were investigated. The excitation band is well matched with the characteristic emission of 395 nm-emitting InGaN chips. The complex exhibits an efficient energy transfer pathway from the ligands to the central Eu{sup 3+} ion via a ligand-sensitized luminescence process. An intense red-emitting LED was fabricated by coating the complex onto a 395 nm-emitting InGaN chip, and its Commission International de I'Eclairage (CIE) chromaticity coordinate (x=0.6389, y=0.3255) is close to the National Television Standard Committee (NTSC) standard value for red color. Meanwhile, the energy transfer from the InGaN chip to the complex is very efficient. All the findings demonstrate the potential application of the Eu(III) complex as red-emitting phosphors for UV-based white LEDs. -- Highlights: ► A new europium(III)-β-diketonate complex was synthesized and characterized. ► Thermal stability and photophysical properties were investigated in detail. ► PL mechanism was proposed to involve a ligand-sensitized luminescence process. ► An intense red-emitting LED was fabricated by using the complex. ► CIE chromaticity coordinate is close to NTSC standard value for red color.

  14. Mitochondria Targetable Time-Gated Luminescence Probe for Singlet Oxygen Based on a β-Diketonate-Europium Complex.

    Science.gov (United States)

    Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli

    2015-12-21

    Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.

  15. Risk Factors of 131I-Induced Salivary Gland Damage in Thyroid Cancer Patients.

    Science.gov (United States)

    Hollingsworth, Brynn; Senter, Leigha; Zhang, Xiaoli; Brock, Guy N; Jarjour, Wael; Nagy, Rebecca; Brock, Pamela; Coombes, Kevin R; Kloos, Richard T; Ringel, Matthew D; Sipos, Jennifer; Lattimer, Ilene; Carrau, Ricardo; Jhiang, Sissy M

    2016-11-01

    Sialadenitis and xerostomia are major adverse effects of 131I therapy in thyroid cancer patients. The risk factors for these adverse effects, other than administered activity of 131I, have not been investigated. The aim of this study is to identify risk factors for 131I-induced salivary gland damage among follicular cell-derived thyroid cancer patients. We enrolled 216 thyroid cancer patients who visited The Ohio State University Wexner Medical Center between April 2013 and April 2014. Symptoms of xerostomia and sialadenitis were identified via questionnaire and medical record search. To validate the findings in a large cohort, we retrospectively searched for ICD-9/10 codes for sialadenitis, xerostomia, and autoimmune disease associated with Sjögren's syndrome (AID-SS) in our existing database (n = 1507). Demographic and clinical information was extracted from medical records. Multivariate analyses were performed to identify independent predictors for salivary gland damage. 131I treatment associated with higher incidence of xerostomia and sialadenitis. Patients with xerostomia had 46 mCi higher mean cumulative 131I activity and 21 mCi higher mean first-administered 131I activity than patients without xerostomia. Increased age associated with higher incidence of xerostomia, and females had a higher incidence of sialadenitis. Patients who experienced sialadenitis before 131I therapy had higher sialadenitis incidence after 131I therapy. 131I-treated patients diagnosed with AID-SS, whether before or after 131I treatment, had a higher incidence of xerostomia and sialadenitis among 131I-treated patients. Risk factors for 131I-induced salivary gland damage include administered 131I activity, age, gender, history of sialadenitis before 131I treatment, and AID-SS diagnosis.

  16. Iodine 131 ablation of an obstructive lingual thyroid

    Directory of Open Access Journals (Sweden)

    Lester Johnson

    2009-01-01

    Full Text Available A 48-year-old woman undergoing surgery could not be intubated because of an oropharyngeal mass. CT and MRI revealed a 3 cm possible lingual thyroid mass, confirmed by Iodine-123 SPECT/CT. The patient underwent successful Iodine-131 ablation and has done well on thyroid hormone-replacement therapy. This case also demonstrates how modern cross-sectional imaging like SPECT/CT can appropriately be used in the patient diagnosis and management, and is of additional interest for including pre- and post-therapy MRI documenting efficacy morphologically.

  17. Excitation energy transfer in europium chelate with doxycycline in the presence of a second ligand in micellar solutions of nonionic surfactants

    Science.gov (United States)

    Smirnova, T. D.; Shtykov, S. N.; Kochubei, V. I.; Khryachkova, E. S.

    2011-01-01

    The complexation of Eu3+ with doxycycline (DC) antibiotic in the presence of several second ligands and surfactant micelles of different types is studied by the spectrophotometric and luminescence methods. It is found that the efficiency of excitation energy transfer in Eu3+-DC chelate depends on the nature of the second ligand and surfactant micelles. Using thenoyltrifluoroacetone (TTA) as an example, it is shown that the second ligand additionally sensitizes the europium fluorescence, and the possibility of intermediate sensitization of DC and then of europium is shown by the example of 1,10-phenanthroline. In all cases, the excitation energy transfer efficiency was increased due to the so-called antenna effect. The decay kinetics of the sensitized fluorescence of the binary and mixed-ligand chelates in aqueous and micellar solutions of nonionic surfactants is studied and the relative quantum yields and lifetimes of fluorescence are determined.

  18. A Smart Europium-Ruthenium Complex as Anticancer Prodrug: Controllable Drug Release and Real-Time Monitoring under Different Light Excitations.

    Science.gov (United States)

    Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung

    2017-11-09

    A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λirr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.

  19. Structural and optical analysis on europium doped AZrO{sub 3} (A=Ba, Ca, Sr) phosphor for display devices application

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, Vikas, E-mail: jsvikasdubey@gmail.com [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)

    2016-05-06

    Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.

  20. Metal-organic framework luminescence in the yellow gap by codoping of the homoleptic imidazolate ∞(3)[Ba(Im)2] with divalent europium.

    Science.gov (United States)

    Rybak, Jens-Christoph; Hailmann, Michael; Matthes, Philipp R; Zurawski, Alexander; Nitsch, Jörn; Steffen, Andreas; Heck, Joachim G; Feldmann, Claus; Götzendörfer, Stefan; Meinhardt, Jürgen; Sextl, Gerhard; Kohlmann, Holger; Sedlmaier, Stefan J; Schnick, Wolfgang; Müller-Buschbaum, Klaus

    2013-05-08

    The rare case of a metal-triggered broad-band yellow emitter among inorganic-organic hybrid materials was achieved by in situ codoping of the novel imidazolate metal-organic framework ∞(3)[Ba(Im)2] with divalent europium. The emission maximum of this dense framework is in the center of the yellow gap of primary light-emitting diode phosphors. Up to 20% Eu2+ can be added to replace Ba2+ as connectivity centers without causing observable phase segregation. High-resolution energy-dispersive X-ray spectroscopy showed that incorporation of even 30% Eu2+ is possible on an atomic level, with 2-10% Eu2+ giving the peak quantum efficiency (QE = 0.32). The yellow emission can be triggered by two processes: direct excitation of Eu2+ and an antenna effect of the imidazolate linkers. The emission is fully europium-centered, involving 5d → 4f transitions, and depends on the imidazolate surroundings of the metal ions. The framework can be obtained by a solvent-free in situ approach starting from barium metal, europium metal, and a melt of imidazole in a redox reaction. Better homogeneity for the distribution of the luminescence centers was achieved by utilizing the hydrides BaH2 and EuH2 instead of the metals.

  1. α-Titanium phosphate intercalated with propylamine: An alternative pathway for efficient europium(III uptake into layered tetravalent metal phosphates

    Directory of Open Access Journals (Sweden)

    Jorge García-Glez

    2017-09-01

    Full Text Available α-Ti(HPO42·H2O (α-TiP and its propylamine intercalation product, Ti(HPO42·2C3H7NH2·H2O (α-TiPPr, have been synthesized and characterized. Later, their sorption capacity for europium(III was investigated, and this purpose was accomplished by treating α-TiP and α-TiPPr with europium(III nitrate solutions at different concentrations until the equilibrium is reached. All samples were characterized, among others, by powder X-ray diffraction (PXRD, scanning and transmission electron microscopies (SEM, TEM, STEM-EDX, SAED, thermogravimetric analysis (TGA, and photoluminescence (PL measurements. The results show that the Eu3+ uptake is limited to surface when α-TiP is used as sorbent. Nevertheless, the Eu-retention is considerably enhanced with α-TiPPr as a consequence of an ion-exchange process into the interlayer space of the layered titanium phosphate (involving propylammonium cations, C3H7NH3+, and hexahydrate europium(III species, [Eu(H2O6]3+, and the crystal structure of a hypothetical final product, α-[Eu(H2O6]2/3Ti(PO42·[(H2O6]1/3, has been proposed by using DFT calculations.

  2. /sup 131/I uptake in a benign serous crystadenoma of the ovary

    Energy Technology Data Exchange (ETDEWEB)

    Kim, E.E.; Pjura, G.; Gobuty, A.; Verani, R.

    1984-09-01

    A patient with well-differentiated thyroid carcinoma had a whole body scan using 5 mCi /sup 131/I which demonstrated abnormal uptake of /sup 131/I in a palpable pelvic mass. Approximately 24 years ago the patient had a total thyroidectomy followed by /sup 131/I treatment. The histologic examination of the mass was consistent with serous cystadenoma of the ovary. No thyroid tissue or teratoma was identified. The mechanism for the unusual uptake of /sup 131/I in a benign ovarian tumor is not clear, and the differential diagnosis of metastatic thyroid cancer is briefly reviewed.

  3. I-131-Metaiodobenzylguanidine therapy with allogeneic cord blood stem cell transplantation for recurrent neuroblastoma

    Directory of Open Access Journals (Sweden)

    Sato Yuya

    2012-10-01

    Full Text Available Abstract Iodine-131-metaiodiobenzylguanidine (131I-MIBG therapy combined with allogeneic cord blood stem cell transplantation (SCT was used to treat a 4-year-old girl with recurrent neuroblastoma. The patient experienced relapse 2 years after receiving first-line therapies, which included chemotherapy, surgical resection, irradiation, and autologous peripheral SCT. Although 131I-MIBG treatment did not achieve complete remission, the size of the tumor was reduced after treatment. Based on our findings, we suggest that 131I-MIBG treatment with myeloablative allogeneic SCT should be considered as first-line therapy for high-risk neuroblastoma patients when possible.

  4. Electron tunneling transport across heterojunctions between europium sulfide and indium arsenide

    Science.gov (United States)

    Kallaher, Raymond L.

    This dissertation presents research done on utilizing the ferromagnetic semiconductor europium sulfide (EuS) to inject spin polarized electrons into the non-magnetic semiconductor indium arsenide (InAs). There is great interest in expanding the functionality of modern day electronic circuits by creating devices that depend not only on the flow of charge in the device, but also on the transport of spin through the device. Within this mindset, there is a concerted effort to establish an efficient means of injecting and detecting spin polarized electrons in a two dimensional electron system (2DES) as the first step in developing a spin based field effect transistor. Thus, the research presented in this thesis has focused on the feasibility of using EuS, in direct electrical contact with InAs, as a spin injecting electrode into an InAs 2DES. Doped EuS is a concentrated ferromagnetic semiconductor, whose conduction band undergoes a giant Zeeman splitting when the material becomes ferromagnetic. The concomitant difference in energy between the spin-up and spin-down energy bands makes the itinerant electrons in EuS highly spin polarized. Thus, in principle, EuS is a good candidate to be used as an injector of spin polarized electrons into non-magnetic materials. In addition, the ability to adjust the conductivity of EuS by varying the doping level in the material makes EuS particularly suited for injecting spins into non-magnetic semiconductors and 2DES. For this research, thin films of EuS have been grown via e-beam evaporation of EuS powder. This growth technique produces EuS films that are sulfur deficient; these sulfur vacancies act as intrinsic electron donors and the resulting EuS films behave like heavily doped ferromagnetic semiconductors. The growth parameters and deposition procedures were varied and optimized in order to fabricate films that have minimal crystalline defects. Various properties and characteristics of these EuS films were measured and compared to

  5. Liquid discharges from patients undergoing {sup 131}I treatments

    Energy Technology Data Exchange (ETDEWEB)

    Barquero, R. [Servicio de Radiofisica y Proteccion Radiologica, Hospital Universitario Rio Hortega, E-47010 Valladolid (Spain)], E-mail: rbarquero@hurh.sacyl.es; Basurto, F. [Departamento de Fisica Teorica, Atomica y Optica, Universidad de Valladolid, E-47010 Valladolid (Spain); Nunez, C. [Servicio de Radiofisica y Proteccion Radiologica, Fundacion Jimenez Diaz, FJD, E-82001 Madrid (Spain); Esteban, R. [Servicio de Radiologia, Hospital Clinico Universitario, E-47005 Valladolid (Spain)

    2008-10-15

    This work discusses the production and management of liquid radioactive wastes as excretas from patients undergoing therapy procedures with {sup 131}I radiopharmaceuticals in Spain. The activity in the sewage has been estimated with and without waste radioactive decay tanks. Two common therapy procedures have been considered, the thyroid cancer (4.14 GBq administered per treatment), and the hyperthyroidism (414 MBq administered per treatment). The calculations were based on measurements of external exposure around the 244 hyperthyroidism patients and 23 thyroid cancer patients. The estimated direct activity discharged to the sewage for two thyroid carcinomas and three hyperthyroidisms was 14.57 GBq and 1.27 GBq, respectively, per week; the annual doses received by the most exposed individual (sewage worker) were 164 {mu}Sv and 13 {mu}Sv, respectively. General equations to calculate the activity as a function of the number of patient treated each week were also obtained.

  6. Synthesis, Optical Investigation and Biological Properties of Europium(III) Complexes with 2-(4-Chlorophenyl)-1-(2-Hydroxy-4-Methoxyphenyl)Ethan-1-one and Ancillary Ligands.

    Science.gov (United States)

    Nandal, Poonam; Khatkar, S P; Kumar, Rajesh; Khatkar, Avni; Taxak, V B

    2017-01-01

    Synthesis and photoluminescence behaviour of six novel europium complexes with novel β-hydroxyketone ligand, 2-(4-chlorophenyl)-1-(2-hydroxy-4-methoxyphenyl)ethan-1-one (CHME) and 2,2'-bipyridine (bipy) or neocuproine (neo) or 1,10-phenanthroline (phen) or 5,6-dimethyl-1,10-phenanthroline (dmphen) or bathophenanthroline (bathophen) were reported in solid state. The free ligand CHME and europium complexes, Eu(CHME)3.2H2O [1] Eu(CHME)3.bipy [2], Eu(CHME)3.neo [3], Eu(CHME)3.phen [4], Eu(CHME)3.dmphen [5] and Eu(CHME)3.bathophen [6]were characterized by elemental analysis, FT-IR and 1H-NMR. The photoluminescence emission spectra exhibited four characteristic peaks arising from the 5D0 → 7FJ (J = 1-4) transitions of the europium ion in the solid state on monitoring excitation at λex = 395 nm. The luminescence decay curves of these europium complexes possess single exponential behaviour indicating the presence of a single luminescent species and having only one site symmetry in the complexes. The luminescence quantum efficiency (η) and the experimental intensity parameters, Ω 2 and Ω 4 of europium complexes have also been calculated on the basis of emission spectra and luminescence decay curves. In addition, the antimicrobial and antioxidant activities were also studied of the investigated complexes.

  7. Highly luminescent pure-red-emitting fluorinated β-diketonate europium(III) complex for full solution-processed OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: carmen.coya@urjc.es [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)

    2015-03-15

    Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.

  8. Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Kautenburger, R.; Nowotka, K.; Beck, H.P. [Institut fuer Anorganische und Analytische Chemie und Radiochemie, Universitaet des Saarlandes, P.O. Box 151150, 66041 Saarbruecken (Germany)

    2005-07-01

    Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu{sup 3+}) and gadolinium (Gd{sup 3+}) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 {mu}l nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for {sup 153}Eu and 125 ppt for {sup 158}Gd. With this optimized CE

  9. Temperature effects on the interaction mechanisms between the europium (III) and uranyl ions and zirconium diphosphate; Effets de la temperature sur les mecanismes d'interaction entre les ions europium (3) et uranyle et le diphosphate de zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Finck, N

    2006-10-15

    Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)

  10. Quantum dot based on tin/titanium mixed oxide doped with europium synthesized by protein sol-gel method

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f

    2011-07-01

    Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)

  11. 340nm UV LED excitation in time-resolved fluorescence system for europium-based immunoassays detection

    Science.gov (United States)

    Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian

    2017-02-01

    In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.

  12. Interaction of europium and nickel with calcite studied by Rutherford Backscattering Spectrometry and Time-Resolved Laser Fluorescence Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sabau, A. [Agence Nationale pour la gestion des Déchets RAdioactifs, 1-7 rue J. Monnet, Parc de la Croix Blanche, 92298 Châtenay-Malabry Cedex (France); Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Pipon, Y., E-mail: pipon@ipnl.in2p3.fr [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Institut Universitaire de Technologie (IUT) Lyon-1, Université Claude Bernard Lyon 1, 69 622 Villeurbanne Cedex (France); Toulhoat, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); CEA/DEN, Saclay, 91191 Gif sur Yvette (France); Lomenech, C. [Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Jordan, N. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); Moncoffre, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Barkleit, A. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); and others

    2014-08-01

    This study aims at elucidating the mechanisms regulating the interaction of Eu and Ni with calcite (CaCO{sub 3}). Calcite powders or single crystals (some mm sized) were put into contact with Eu or Ni solutions at concentrations ranging from 10{sup −3} to 10{sup −5} mol L{sup −1} for Eu and 10{sup −3} mol L{sup −1} for Ni. The sorption durations ranged from 1 week to 1 month. Rutherford Backscattering Spectrometry (RBS) well adapted to discriminate incorporation processes such as: (i) adsorption or co precipitation at the mineral surfaces or, (ii) incorporation into the mineral structure (through diffusion for instance), has been carried out. Moreover, using the fluorescence properties of europium, the results have been compared to those obtained by Time-Resolved Laser Fluorescence Spectroscopy (TRLFS) on calcite powders. For the single crystals, complementary SEM observations of the mineral surfaces at low voltage were also performed. Results showed that Ni accumulates at the calcite surface whereas Eu is also incorporated at a greater depth. Eu seems therefore to be incorporated into two different states in calcite: (i) heterogeneous surface accumulation and (ii) incorporation at depth greater than 160 nm after 1 month of sorption. Ni was found to accumulate at the surface of calcite without incorporation.

  13. Orange-red emitting europium doped strontium ortho-silicate phosphor prepared by a solid state reaction method.

    Science.gov (United States)

    Sahu, Ishwar Prasad

    2017-05-01

    In the present article we report europium-doped strontium ortho-silicates, namely Sr 2 SiO 4 :xEu 3+ (x = 1.0, 1.5, 2.0, 2.5 or 3.0 mol%) phosphors, prepared by solid state reaction method. The crystal structures of the sintered phosphors were consistent with orthorhombic crystallography with a Pmna space group. The chemical compositions of the sintered phosphors were confirmed by energy dispersive X-ray spectroscopy (EDS). Thermoluminescence (TL) kinetic parameters such as activation energy, order of kinetics and frequency factors were calculated by the peak shape method. Orange-red emission originating from the 5 D 0 - 7 F J (J = 0, 1, 2, 3) transitions of Eu 3+ ions could clearly be observed after samples were excited at 395 nm. The combination of these emissions constituted orange-red light as indicated on the Commission Internationale de l'Eclairage (CIE) chromaticity diagram. Mechanoluminescence (ML) intensity of the prepared phosphor increased linearly with increasing impact velocity of the moving piston that suggests that these phosphors can also be used as sensors to detect the stress of an object. Thus, the present investigation indicates that the piezo-electricity was responsible for producing ML in the prepared phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Application of Europium Multiwalled Carbon Nanotubes as Novel Luminophores in an Electrochemiluminescent Aptasensor for Thrombin Using Multiple Amplification Strategies.

    Science.gov (United States)

    Wu, Dan; Xin, Xia; Pang, Xuehui; Pietraszkiewicz, Marek; Hozyst, Robert; Sun, Xian'ge; Wei, Qin

    2015-06-17

    A novel electrochemiluminescent (ECL) aptasensor was proposed for the determination of thrombin (TB) using exonuclease-catalyzed target recycling and hybridization chain reaction (HCR) to amplify the signal. The capture probe was immobilized on an Au-GS-modified electrode through a Au-S bond. Subsequently, the hybrid between the capture probe and the complementary thrombin binding aptamer (TBA) was aimed at obtaining double-stranded DNA (dsDNA). The interaction between TB and its aptamer led to the dissociation of dsDNA because TB has a higher affinity to TBA than the complementary strands. In the presence of exonuclease, aptamer was selectively digested and TB could be released for target recycling. Extended dsDNA was formed through HCR of the capture probe and two hairpin DNA strands (NH2-DNA1 and NH2-DNA1). Then, numerous europium multiwalled carbon nanotubes (Eu-MWCNTs) could be introduced through amidation reaction between NH2-terminated DNA strands and carboxyl groups on the Eu-MWCNTs, resulting in an increased ECL signal. The multiple amplification strategies, including the amplification of analyte recycling and HCR, and high ECL efficiency of Eu-MWCNTs lead to a wide linear range (1.0×10(-12)-5.0×10(-9) mol/L) and a low detection limit (0.23 pmol/L). The method was applied to serum sample analysis with satisfactory results.

  15. Spectrophotometric Determination and Removal of Unchelated Europium Ions from Solutions Containing Eu-Diethylenetriaminepentaacetic Acid Chelate-Peptide Conjugates1

    Science.gov (United States)

    Dayan Elshan, N. G. R.; Patek, Renata; Vagner, Josef; Mash, Eugene A.

    2014-01-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination, as well as the success of metal ion removal upon attempted purification. We compared the use of Empore™ chelating disks and Chelex® 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore™ chelating disks were found to give much higher recoveries of the probes under the conditions utilized. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. PMID:25058927

  16. Reusable temperature-sensitive luminescent material based on vitrified film of europium(III) β-diketonate complex

    Science.gov (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Lobkov, Vladimir S.; Knyazev, Andrey A.; Galyametdinov, Yury G.

    2018-01-01

    We have proposed a novel temperature-sensitive luminescent material which is a 20 μm thick vitrified film (sandwiched between two quartz plates) fabricated from an amorphous powder of a mesogenic europium(III) β-diketonate complex through a melt-processing technique. The film photoexcited by a 337 nm pulsed nitrogen laser displays a typical Eu3+ ion luminescence bands with the strongest peak at 612 nm and with the decay time of 537 μs at 298 K. It is obtained that both the mean luminescence intensity and the luminescence decay time at 612 nm decrease significantly with temperature increasing from 298 to 348 K; the average values of the relative and absolute temperature sensitivities of the luminescence decay time in the range of 298-348 K are -1.2%·K-1 and -6.5 μs·K-1, respectively. The thermal quenching mechanism of the luminescent properties was analyzed and discussed. The experiments showed that, the luminescent properties of the film is insensitive to oxygen, the film is photostable under UV light, there is full reversibility of the temperature-dependent luminescence intensity and the decay time, and the high luminescence brightness of the film can be observed with violet light excitation. These factors indicated that the film is promising material for reusable luminescent thermometers, suitable for long-term monitoring in the range of 298-348 K.

  17. Differential ERK activation during autophagy induced by europium hydroxide nanorods and trehalose: Maximum clearance of huntingtin aggregates through combined treatment.

    Science.gov (United States)

    Wei, Peng-Fei; Jin, Pei-Pei; Barui, Ayan Kumar; Hu, Yi; Zhang, Li; Zhang, Ji-Qian; Shi, Shan-Shan; Zhang, Hou-Rui; Lin, Jun; Zhou, Wei; Zhang, Yun-Jiao; Ruan, Ren-Quan; Patra, Chitta Ranjan; Wen, Long-Ping

    2015-12-01

    Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Synthesis of europium-doped VSOP, customized enhancer solution and improved microscopy fluorescence methodology for unambiguous histological detection.

    Science.gov (United States)

    de Schellenberger, Angela Ariza; Hauptmann, Ralf; Millward, Jason M; Schellenberger, Eyk; Kobayashi, Yuske; Taupitz, Matthias; Infante-Duarte, Carmen; Schnorr, Jörg; Wagner, Susanne

    2017-10-10

    Intrinsic iron in biological tissues frequently precludes unambiguous the identification of iron oxide nanoparticles when iron-based detection methods are used. Here we report the full methodology for synthesizing very small iron oxide nanoparticles (VSOP) doped with europium (Eu) in their iron oxide core (Eu-VSOP) and their unambiguous qualitative and quantitative detection by fluorescence. The resulting Eu-VSOP contained 0.7 to 2.7% Eu relative to iron, which was sufficient for fluorescent detection while not altering other important particle parameters such as size, surface charge, or relaxivity. A customized enhancer solution with high buffer capacity and nearly neutral pH was developed to provide an antenna system that allowed fluorescent detection of Eu-VSOP in cells and histologic tissue slices as well as in solutions even under acidic conditions as frequently obtained from dissolved organic material. This enhancer solution allowed detection of Eu-VSOP using a standard fluorescence spectrophotometer and a fluorescence microscope equipped with a custom filter set with an excitation wavelength (λex) of 338 nm and an emission wavelength (λem) of 616 nm. The fluorescent detection of Eu-doped very small iron oxide nanoparticles (Eu-VSOP) provides a straightforward tool to unambiguously characterize VSOP biodistribution and toxicology at tissue, and cellular levels, providing a sensitive analytical tool to detect Eu-doped IONP in dissolved organ tissue and biological fluids with fluorescence instruments.

  19. Efficient solution-processed double-layer red OLEDs based on a new europium complex with a carbazole group.

    Science.gov (United States)

    Liu, Jian; Miao, Jing-Sheng; Wu, Hong-Bin

    2015-06-01

    A new europium complex EuL3 (Phen) was used as guest dopant, and a blend of Polyvinylcarbazole and 2-(biphenyl-4-yl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole (PVK and PBD) as host matrix. Efficient red organic light-emitting devices (OLEDs) with double-layer structures were manufactured via a solution-processed technique. The guest-doped levels were 1, 3 and 5 wt% relative to the blend mass, respectively. For the 1 wt% doping-level device, the luminous efficiency and luminance were up to 2.96 cd/A and 635.78 cd/m(2) with emissions from both EuL3 (Phen) and from the host; for the 3 wt% doping-level device, the maximum luminous efficiency and luminance were 1.01 cd/A and 370.91 cd/m(2) for the single emission from EuL3 (Phen) only. Copyright © 2014 John Wiley & Sons, Ltd.

  20. Europium Nanospheres-Based Time-Resolved Fluorescence for Rapid and Ultrasensitive Determination of Total Aflatoxin in Feed.

    Science.gov (United States)

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen

    2015-12-02

    Immunochromatographic (IC) assays are considered suitable diagnostic tools for the determination of mycotoxins. A europium nanospheres-based time-resolved fluorescence immunoassay (Eu-Nano-TRFIA), based on a monoclonal antibody and a portable TRFIA reader, was developed to determine total aflatoxin (including aflatoxins B1, B2, G1, and G2) levels in feed samples. Under optimized conditions, the Eu-Nano-TRFIA method detected total aflatoxin within 12 min. It showed good linearity (R(2) > 0.985), LOD of 0.16 μg/kg, a wide dynamic range of 0.48-30.0 μg/kg, recovery rates of 83.9-113.9%, and coefficients of variation (CVs) of 3.5-8.8%. In the 397 samples from company and livestock farms throughout China, the detection rate was 78.3%, concentrations were 0.50-145.30 μg/kg, the highest total aflatoxin content was found in cottonseed meal, and corn was found to be the most commonly contaminated feed. This method could be a powerful alternative for the rapid and ultrasensitive determination of total aflatoxin in quality control and meet the required Chinese maximum residue limits.

  1. Spectrophotometric determination and removal of unchelated europium ions from solutions containing Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates.

    Science.gov (United States)

    Elshan, N G R Dayan; Patek, Renata; Vagner, Josef; Mash, Eugene A

    2014-11-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination as well as the success of metal ion removal on attempted purification. We compared the use of Empore chelating disks and Chelex 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore chelating disks were found to give much higher recoveries of the probes under the conditions used. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Formation and structural characterization of a europium(II mono(scorpionate complex and a sterically crowded pyrazabole

    Directory of Open Access Journals (Sweden)

    Phil Liebing

    2017-12-01

    Full Text Available The reaction of EuI2(THF2 with potassium hydrotris(3,5-diisopropylpyrazolylborate (K[HB(3,5-iPr2pz3] (= KTpiPr2, pz = pyrazolyl in a molar ratio of 1:1.5 resulted in extensive ligand fragmentation and formation of the europium(II mono(scorpionate complex bis(3,5-diisopropyl-1H-pyrazole[hydrotris(3,5-diisopropylpyrazolylborato]iodidoeuropium(II, [Eu(C27H46BN6I(C9H16N22] or (TpiPr2(3,5-iPr2pzH2EuIII, 1, in high yield (78%. As a typical by-product, small amounts of the sterically crowded pyrazabole derivative trans-4,8-bis(3,5-diisopropylpyrazol-1-yl-1,3,5,7-tetraisopropylpyrazabole, C36H62B2H8 or trans-{(3,5-iPr2pzHB(μ-3,5-iPr2pz}2, 2, were formed. Both title compounds have been structurally characterized through single-crystal X-ray diffraction. In 1, two isopropyl groups are each disordered over two orientations with occupancy ratios of 0.574 (10:0.426 (10 and 0.719 (16:0.281 (16. In 2, one isopropyl group is similarly disordered, occupancy ratio 0.649 (9:0.351 (9.

  3. Spectrofluorimetric study of the interaction between europium(III) and moxifloxacin in micellar solution and its analytical application

    Science.gov (United States)

    Kamruzzaman, Mohammad; Alam, Al-Mahmnur; Lee, Sang Hak; Ragupathy, Dhanusuraman; Kim, Young Ho; Park, Sang-Ryoul; Kim, Sung Hong

    2012-02-01

    A sensitive spectrofluorimetric method has been developed for the determination of moxifloxacin (MOX) using europium(III)-MOX complex as a fluorescence probe in the presence of an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS). The fluorescence (FL) intensity of Eu 3+ was enhanced by complexation with MOX at 614 nm after excitation at 373 nm. The FL intensity of the Eu 3+-MOX complex was significantly intensified in the presence of SDBS. Under the optimum conditions, it was found that the enhanced FL intensity of the system showed a good linear relationship with the concentration of MOX over the range of 1.8 × 10 -11-7.3 × 10 -9 g mL -1 with a correlation coefficient of 0.9998. The limit of detection of MOX was found to be 2.8 × 10 -12 g mL -1 with relative standard deviation (RSD) of 1.25% for 5 replicate determination of 1.5 × 10 -8 g mL -1 MOX. The proposed method is simple, offers higher sensitivity with wide linear range and can be successfully applied to determine MOX in pharmaceutical and biological samples with good reproducibility. The luminescence mechanism is also discussed in detail with ultraviolet absorption spectra.

  4. Photoluminescence properties of europium doped di-strontium magnesium di-silicate phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-01-01

    Full Text Available Europium doped di-strontium magnesium di-silicate phosphor namely (Sr2MgSi2O7:Eu3+ was prepared by the traditional high temperature solid state reaction method. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P42¯1m, this structure is a member of the melilite group and forms a layered compound. The EDX and FTIR spectra confirm the present elements in Sr2MgSi2O7:Eu3+ phosphor. Photoluminescence measurements showed that the phosphor exhibited strong emission peak with good intensity, corresponding to 5D0 → 7F2 (613 nm red emission and weak 5D0 → 7F1 (590 nm orange emission. The excitation spectra monitored at 613 nm show broad band from 220 to 300 nm ascribed to O–Eu charge-transfer band (CTB centered at about 269 nm, and the other peaks in the range of 300–400 nm originated from f–f transitions of Eu3+ ions. The strongest band at 395 nm can be assigned to 7F0 / 5L6 transition of Eu3+ ions due to the typical f–f transitions within Eu3+ of 4f6 configuration.

  5. Highly selective luminescent sensing of picric acid based on a water-stable europium metal-organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Tifeng; Zhu, Fengliang; Cui, Yuanjing, E-mail: cuiyj@zju.edu.cn; Yang, Yu; Wang, Zhiyu; Qian, Guodong, E-mail: gdqian@zju.edu.cn

    2017-01-15

    A water-stable metal-organic framework (MOF) EuNDC has been synthesized for selective detection of the well-known contaminant and toxicant picric acid (PA) in aqueous solution. Due to the photo-induced electron transfer and self-absorption mechanism, EuNDC displayed rapid, selective and sensitive detection of PA with a detection limit of 37.6 ppb. Recyclability experiments revealed that EuNDC retains its initial luminescent intensity and same quenching efficiency in each cycle, suggesting high photostability and reusability for long-term sensing applications. The excellent detection performance of EuNDC makes it a promising PA sensing material for practical applications. - Graphical abstract: A water-stable europium-based metal-organic framework has been reported for highly selective sensing of picric acid (PA) with a detection limit of 37.6 ppb in aqueous solution. - Highlights: • A water-stable metal-organic framework (MOF) EuNDC was synthesized. • The highly selective detection of picric acid with a detection limit of 37.6 ppb was realized. • The detection mechanism were also presented and discussed.

  6. One-pot carbonization synthesis of europium-doped carbon quantum dots for highly selective detection of tetracycline

    Science.gov (United States)

    Li Liu, Meng; Chen, Bin Bin; Yang, Tong; Wang, Jian; Liu, Xi Dong; Zhi Huang, Cheng

    2017-03-01

    The detection of tetracycline is of great significance because of its damaging effects on human health, such as renal toxicity and hemolytic anemia. Any release of tetracycline into the surrounding environment can produce bacterial drug resistance. We develop a new sensitive and selective detection approach for tetracycline in complex water samples by preparing europium-doped carbon quantum dots (Eu-CQDs) through a simple and rapid carbonization method operating at 200 °C for 5 min. The Eu-CQDs are characterized by blue photoluminescence, excitation-wavelength-dependent emission and excellent stability. Importantly, the fluorescence of the Eu-CQDs can be quenched efficiently by tetracycline, based on the strong inner filter effect mechanism between Eu-CQDs and tetracycline, making the fluorescence intensity ratio (I 0/I) of the Eu-CQDs at 465 nm correlate linearly with the concentration of tetracycline in the range of 0.5-200 μM, with a limit of detection of 0.3 μM. This shows the broad applicability of the Eu-CQDs in pursuing the concepts of simplicity and specificity for analytical purposes.

  7. Mesoporous Europium-Doped Titania Nanoparticles (Eu-MTNs) for Luminescence-Based Intracellular Bio-Imaging.

    Science.gov (United States)

    Chen, Kuan-Chou; Dutta, Saikat; Yamauchi, Yusuke; Alshehri, Saad M; Nguyen, Mai Thanh; Yonezawa, Tetsu; Shen, Kun-Hung; Wu, Kevin C W

    2015-12-01

    Monodisperse and mesoporous europium (Eu)-doped titania nanoparticles (denoted as Eu-MTNs) were prepared by a co-synthesis method with the presence of a cationic surfactant (i.e., CTAB). A maximum loading amount of 8 mol% of Eu could be successfully incorporated into the framework of MTNs. The synthesized Eu-MTNs samples were characterized with X-ray diffraction (XRD) and scanning electron microscopy (SEM), with their luminescent property examined by photoluminescence (PL). Under ultraviolet irradiation, the Eu-MTNs samples exhibit several characteristic luminescence corresponding to 5D0-7F(j) for Eu+3 ions, which can be attributed to the energy transfer from titania nanocrystallite to Eu3+ ions dispersed in amorphous mesoporous titania region. The potential intracellular bio-imaging application of the synthesized Eu-MTN nanoparticles was demonstrated with a breast cancer cell line (i.e., BT-20). High biocompatibility and strong luminescence of the Eu-MTNs show great potential in biomedical applications.

  8. 19p13.1 Is a triple-negative-specific breast cancer susceptibility locus

    NARCIS (Netherlands)

    K. Stevens (Kristen); Z. Fredericksen (Zachary); C. Vachon (Celine); X. Wang (Xing); S. Margolin (Sara); A. Lindblom (Annika); H. Nevanlinna (Heli); D. Greco (Dario); K. Aittomäki (Kristiina); C. Blomqvist (Carl); J. Chang-Claude (Jenny); A. Vrieling (Alina); D. Flesch-Janys (Dieter); H.-P. Sinn (Hans-Peter); S. Wang-Gohrke (Shan); S. Nickels (Stefan); H. Brauch (Hiltrud); Y-D. Ko (Yon-Dschun); H.-P. Fischer; R.K. Schmutzler (Rita); A. Meindl (Alfons); C.R. Bartram (Claus); S. Schott (Sarah); C. Engel (Christoph); A.K. Godwin (Andrew); J. Weaver (JoEllen); S.S. Pathak; P. Sharma (Pankaj); H. Brenner (Hermann); H. Mul̈ler (Heiko); V. Arndt (Volker); C. Stegmaier (Christa); P. Miron (Penelope); D. Yannoukakos (Drakoulis); A. Stavropoulou (Alexandra); G. Fountzilas (George); H. Gogas (Helen); R. Swann (Ruth); M. Dwek (Miriam); A. Perkins (Annie); R.L. Milne (Roger); J. Benítez (Javier); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); S.E. Bojesen (Stig); S.F. Nielsen (Sune); B.G. Nordestgaard (Børge); H. Flyger (Henrik); P. Guénel (Pascal); T. Truong (Thérèse); F. Menegaux (Florence); E. Cordina-Duverger (Emilie); B. Burwinkel (Barbara); F. Marme (Federick); A. Schneeweiss (Andreas); C. Sohn (Christof); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); J. Peto (Julian); N. Johnson (Nichola); O. Fletcher (Olivia); I. dos Santos Silva (Isabel); P.A. Fasching (Peter); M.W. Beckmann (Matthias); A. Hartmann; A.B. Ekici (Arif); A. Lophatananon (Artitaya); K.R. Muir (Kenneth); P. Puttawibul (Puttisak); S. Wiangnon (Surapon); M.K. Schmidt (Marjanka); A. Broeks (Annegien); L.M. Braaf (Linde); E.H. Rosenberg (Efraim); J.L. Hopper (John); C. Apicella (Carmel); D.J. Park (Daniel); M.C. Southey (Melissa); A.J. Swerdlow (Anthony ); A. Ashworth (Alan); O. Nicholas (Orr); M. Schoemaker (Minouk); H. Anton-Culver (Hoda); A. Ziogas (Argyrios); L. Bernstein (Leslie); C.C. Dur (Christina Clarke); C-Y. Shen (Chen-Yang); J-C. Yu (Jyh-Cherng); H.-M. Hsu (Huan-Ming); C.-N. Hsiung (Chia-Ni); U. Hamann (Ute); T. Dun̈nebier (Thomas); T. Rud̈iger (Thomas); H.U. Ulmer (Hans); P.D.P. Pharoah (Paul); A.M. Dunning (Alison); M.K. Humphreys (Manjeet); Q. Wang (Qing); A. Cox (Angela); S.S. Cross (Simon); M.W.R. Reed (Malcolm); P. Hall (Per); K. Czene (Kamila); C.B. Ambrosone (Christine); F. Ademuyiwa (Foluso); H. Hwang (Helena); D. Eccles (Diana); M. García-Closas (Montserrat); J.D. Figueroa (Jonine); M.E. Sherman (Mark); J. Lissowska (Jolanta); P. Devilee (Peter); C.M. Seynaeve (Caroline); R.A.E.M. Tollenaar (Rob); M.J. Hooning (Maartje); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.M. Mulligan (Anna Marie); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); E.M. John (Esther); A. Miron (Alexander); G.G. Alnæs (Grethe); V. Kristensen (Vessela); A.-L. Brøresen-Dale (Anne-Lise); G.G. Giles (Graham); L. Baglietto (Laura); C.A. McLean (Catriona Ann); G. Severi (Gianluca); M. Kosel (Matthew); V.S. Pankratz (Shane); S. Slager (Susan); J.E. Olson (Janet); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); M. Barile (Monica); D. Lambrechts (Diether); S. Hatse (Sigrid); A.-S. Dieudonné (Anne-Sophie); M.R. Christiaens (Marie Rose); G. Chenevix-Trench (Georgia); J. Beesley (Jonathan); X. Chen (Xiaoqing); A. Mannermaa (Arto); V-M. Kosma (Veli-Matti); J. Hartikainen (Jaana); Y. Soini (Ylermi); D.F. Easton (Douglas); F.J. Couch (Fergus)

    2012-01-01

    textabstractThe 19p13.1 breast cancer susceptibility locus is a modifier of breast cancer risk in BRCA1 mutation carriers and is also associated with the risk of ovarian cancer. Here, we investigated 19p13.1 variation and risk of breast cancer subtypes, defined by estrogen receptor (ER),

  9. 26 CFR 1.501(c)(13)-1 - Cemetery companies and crematoria.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Cemetery companies and crematoria. 1.501(c)(13)-1...) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Exempt Organizations § 1.501(c)(13)-1 Cemetery companies and crematoria. (a) Nonprofit mutual cemetery companies. A nonprofit cemetery company may be entitled...

  10. 46 CFR 131.310 - List of crew members and offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false List of crew members and offshore workers. 131.310... OPERATIONS Preparations for Emergencies § 131.310 List of crew members and offshore workers. (a) The master... members and offshore workers embarked; (2) In a well-marked place at the vessel's normal berth; or (3...

  11. 29 CFR 794.131 - “Customer * * * engaged in bulk distribution”.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âCustomer * * * engaged in bulk distributionâ. 794.131... Sales Made to Other Bulk Distributors § 794.131 “Customer * * * engaged in bulk distribution”. A sale to a customer of an enterprise engaged in the wholesale or bulk distribution of petroleum products will...

  12. 46 CFR 131.915 - Persons allowed in pilothouse and on navigational bridge.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Persons allowed in pilothouse and on navigational bridge. 131.915 Section 131.915 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE... bridge. No person may be in the pilothouse while the vessel is under way, unless connected with the...

  13. 131I-MIBG as a first-line treatment in high-risk neuroblastoma patients

    NARCIS (Netherlands)

    Hoefnagel, C. A.; de Kraker, J.; Valdés Olmos, R. A.; Voûte, P. A.

    1994-01-01

    The observed response to 131I-metaiodobenzylguanidine (MIBG) therapy in advanced neuroblastoma after conventional therapy, the non-invasiveness of the procedure, and the high metabolic activity which is frequently observed in untreated tumours led to the concept of substituting 131I-MIBG therapy for

  14. Clinical significance of /sup 131/I meta-iodobenzylguanidine scintigraphy in neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Odano, Ikuo; Takeda, Masayuki; Kimura, Motomasa; Sakai, Kunio

    1988-05-01

    /sup 131/I meta-iodobenzylguanidine (/sup 131/I-MIBG) scintigraphy was performed in sixteen children of neuroblastoma with ages ranging 1 - 9 years old. Eleven were male and 5 female. Scintigrams were obtained 24 hours and 48 hours after injection of /sup 131/I-MIBG (0.3 approx. 0.5 mCi/0.5 ml). In 5 patients being free from tumor recurrence with negative urinary VMA, positive accumulation of /sup 131/I-MIBG was not observed. In 8 cases with positive urinary VMA, abnormal accumulation was noted in all cases. It was supposed close relationship to be present between urinary VMA and abnormal accumulation of /sup 131/I-MIBG. In 8 preoperative cases, 7 primary lesions were clearly demonstrated (sensitivity 88 %); 5 were in adrenal gland and one was in mediastinal and hilar lesion. The smallest size of the visualized tumor was about 1.0 cm in diameter. In 8 metastatic bone lesions detected by radiography and X-ray CT, 7 (88 %) were demonstrated on /sup 131/I-MIBG scintigram. In 2 liver metastases, 1 (50 %) was demonstrated. In 4 distant lymphnode metastases, 3 (75 %) were imaged. In 8 cases with bone marrow involvement proved by bone marrow biopsy, 3 (38 %) were clearly demonstrated by /sup 131/I-MIBG scintigraphy. It was supposed that /sup 131/I-MIBG scintigraphy was useful in demonstrating not only primary lesions but also bone and bone marrow involvement of neuroblastoma.

  15. 27 CFR 478.131 - Firearms transactions not subject to a NICS check.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Firearms transactions not subject to a NICS check. 478.131 Section 478.131 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... prescribed for the retention of Form 5300.35 in § 478.129(c). (b) The requirements of this section shall be...

  16. 46 CFR 131.825 - Controls of fire-extinguishing system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Controls of fire-extinguishing system. 131.825 Section... OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.825 Controls of fire-extinguishing system. Each control cabinet or space containing a valve or manifold for a fire extinguishing system must...

  17. 27 CFR 28.131 - Application for return of wines withdrawn without payment of tax.

    Science.gov (United States)

    2010-04-01

    ... numbers of the containers to be returned. In the case of bottled wines, the number and size of the bottles... wines withdrawn without payment of tax. 28.131 Section 28.131 Alcohol, Tobacco Products and Firearms... Withdrawal of Wine Without Payment of Tax for Exportation, Use on Vessels and Aircraft, Transfer to a Foreign...

  18. Virulence potential and genomic mapping of the worldwide clone Escherichia coli ST131.

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Lavigne

    Full Text Available Recently, the worldwide propagation of clonal CTX-M-15-producing Escherichia coli isolates, namely ST131 and O25b:H4, has been reported. Like the majority of extra-intestinal pathogenic E. coli isolates, the pandemic clone ST131 belongs to phylogenetic group B2, and has recently been shown to be highly virulent in a mouse model, even though it lacks several genes encoding key virulence factors (Pap, Cnf1 and HlyA. Using two animal models, Caenorhabditis elegans and zebrafish embryos, we assessed the virulence of three E. coli ST131 strains (2 CTX-M-15- producing urine and 1 non-ESBL-producing faecal isolate, comparing them with five non-ST131 B2 and a group A uropathogenic E. coli (UPEC. In C. elegans, the three ST131 strains showed intermediate virulence between the non virulent group A isolate and the virulent non-ST131 B2 strains. In zebrafish, the CTX-M-15-producing ST131 UPEC isolates were also less virulent than the non-ST131 B2 strains, suggesting that the production of CTX-M-15 is not correlated with enhanced virulence. Amongst the non-ST131 B2 group isolates, variation in pathogenic potential in zebrafish embryos was observed ranging from intermediate to highly virulent. Interestingly, the ST131 strains were equally persistent in surviving embryos as the non-ST131-group B2 strains, suggesting similar mechanisms may account for development of persistent infection. Optical maps of the genome of the ST131 strains were compared with those of 24 reference E. coli strains. Although small differences were seen within the ST131 strains, the tree built on the optical maps showed that these strains belonged to a specific cluster (86% similarity with only 45% similarity with the other group B2 strains and 25% with strains of group A and D. Thus, the ST131 clone has a genetic composition that differs from other group B2 strains, and appears to be less virulent than previously suspected.

  19. 131I activity quantification of gamma camera planar images

    Science.gov (United States)

    Barquero, Raquel; Garcia, Hugo P.; Incio, Monica G.; Minguez, Pablo; Cardenas, Alexander; Martínez, Daniel; Lassmann, Michael

    2017-02-01

    A procedure to estimate the activity in target tissues in patients during the therapeutic administration of 131I radiopharmaceutical treatment for thyroid conditions (hyperthyroidism and differentiated thyroid cancer) using a gamma camera (GC) with a high energy (HE) collimator, is proposed. Planar images are acquired for lesions of different sizes r, and at different distances d, in two HE GC systems. Defining a region of interest (ROI) on the image of size r, total counts n g are measured. Sensitivity S (cps MBq-1) in each acquisition is estimated as the product of the geometric G and the intrinsic efficiency η 0. The mean fluence of 364 keV photons arriving at the ROI per disintegration G, is calculated with the MCNPX code, simulating the entire GC and the HE collimator. Intrinsic efficiency η 0 is estimated from a calibration measurement of a plane reference source of 131I in air. Values of G and S for two GC systems—Philips Skylight and Siemens e-cam—are calculated. The total range of possible sensitivity values in thyroidal imaging in the e-cam and skylight GC measure from 7 cps MBq-1 to 35 cps MBq-1, and from 6 cps MBq-1 to 29 cps MBq-1, respectively. These sensitivity values have been verified with the SIMIND code, with good agreement between them. The results have been validated with experimental measurements in air, and in a medium with scatter and attenuation. The counts in the ROI can be produced by direct, scatter and penetration photons. The fluence value for direct photons is constant for any r and d values, but scatter and penetration photons show different values related to specific r and d values, resulting in the large sensitivity differences found. The sensitivity in thyroidal GC planar imaging is strongly dependent on uptake size, and distance from the GC. An individual value for the acquisition sensitivity of each lesion can significantly alleviate the level of uncertainty in the measurement of thyroid uptake activity for each patient.

  20. Iodine-131 uptake in a patient with thyroid cancer and rheumatoid arthritis during acupuncture treatment

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, N.; Fukunaga, M.; Morita, K.; Ono, S.; Nagai, K.; Katagiri, M.; Harada, T.; Morita, R. (Kawasaki Medical School, Okayama (Japan))

    1990-01-01

    A patient with thyroid carcinoma had abnormal accumulation of I-131 in the areas of both feet and hands on whole body scan. The sites of abnormal accumulation of I-131 were similar to those on bone scintigraphy. The radiographic examination of the lesions showed characteristic findings of rheumatoid arthritis, and the presence of small gold needles for acupuncture treatment was demonstrated. There were no findings of bone metastases. Although the mechanism of accumulation of I-131 in this patient is unknown, interpreters of I-131 whole body scintigraphs should keep this case in mind when acupuncture treatment has been done. The authors can only speculate on a common blood flow mechanism for enhanced HMDP and I-131 uptake in this arthritic patient who had been treated by acupuncture.

  1. Relative Biological Effectiveness (RBE) of (131)I Radiation Relative to (60)Co Gamma Rays.

    Science.gov (United States)

    Neshasteh-Riz, Ali; Mahmoud Pashazadeh, Ali; Mahdavi, Seyed Rabie

    2013-01-01

    To assess relative biological effectiveness (RBE) of (131)I radiation relative to (60)Co gamma rays in glioblastoma spheroid cells. : In this experimental study, glioblastoma spheroid cells were exposed to (131)I radiation and (60)Co gamma rays. Radiation induced DNA damage was evaluated by alkaline comet assay. Samples of spheroid cells were treated by radiation from (131)I for four different periods of time to find the dose-response equation. Spheroid cells were also exposed by 200 cGy of (60)Co gamma rays as reference radiation to induce DNA damage as endpoint. Resulted RBE of (131)I radiation relative to (60)Co gamma rays in 100 µm giloblastoma spheroid cells was equal to 1.16. The finding of this study suggests that (131)I photons and electrons can be more effective than (60)Co gamma rays to produce DNA damage in glioblastoma spheroid cells.

  2. Beta-endorphin 1-31 biotransformation and cAMP modulation in inflammation.

    Directory of Open Access Journals (Sweden)

    Naghmeh Hajarol Asvadi

    Full Text Available A large body of evidence now exists for the immune cell expression, production, and the release of beta-endorphin (BE 1-31 within inflamed tissue. The inflammatory milieu is characterised by increased acidity, temperature and metabolic activity. Within these harsh conditions BE 1-31 is even more susceptible to increased enzymatic degradation over that of plasma or other non-injured tissue. To elucidate the biotransformation pathways of BE 1-31 and provide an insight to the impact of inflamed tissue environments, BE 1-31 and three of its major N-terminal fragments (BE 1-11, BE 1-13 and BE 1-17 were incubated in inflamed tissue homogenates at pH 5.5 for 2 hrs. In addition, the potency of BE 1-31 and five main N--terminal fragments (BE 1-9, BE 1-11, BE 1-13, BE 1-17, BE 1-20 was assessed at mu-opioid receptors (MOR, delta-opioid receptors (DOR, and kappa-opioid receptors (KOR. Opioid receptor potency was investigated by examining the modulation of forskolin induced cAMP accumulation. The majority of the N-terminal fragment of BE 1-31 had similar efficacy to BE 1-31 at MOR. The shortest of the major N-terminal fragments (BE 1-9, had partial agonist activity at MOR but possessed the highest potency of all tested peptides at DOR. There was limited effect for BE 1-31 and the biotransformed peptides at KOR. Major N-terminal fragments produced within inflamed tissue have increased presence within inflamed tissue over that of the parent molecule BE 1-31 and may therefore contribute to BE 1-31 efficacy within disease states that involve inflammation.

  3. Excretion and toxicity evaluation of (131)I-Sennoside A as a necrosis-avid agent.

    Science.gov (United States)

    Yin, Zhiqi; Sun, Lidan; Jin, Qiaomei; Song, Shaoli; Feng, Yuanbo; Liao, Hong; Ni, Yicheng; Zhang, Jian; Liu, Wei

    2017-11-01

    1. Sennoside A (SA) is a newly identified necrosis-avid agent that shows capability for imaging diagnosis and tumor necrosis targeted radiotherapy. As a water-soluble compound, (131)I-Sennoside A ((131)I-SA) might be excreted predominately through the kidneys with the possibility of nephrotoxicity. 2. To further verify excretion pathway and examine nephrotoxicity of (131)I-SA, excretion and nephrotoxicity were appraised. The pharmacokinetics, hepatotoxicity and hematotoxicity of (131)I-SA were also evaluated to accelerate its possible clinical translation. All these studies were conducted in mice with ethanol-induced muscular necrosis following a single intravenous administration of 131I-SA at 18.5 MBq/kg or 370 MBq/kg. 3. Excretion data revealed that (131)I-SA was predominately (73.5% of the injected dose (% ID)) excreted via the kidneys with 69.5% ID detected in urine within 72 h post injection. Biodistribution study indicated that (131)I-SA exhibited initial high distribution in the kidneys but subsequently a fast renal clearance, which was further confirmed by the results of autoradiography and single-photon emission computed tomography-computed tomography (SPECT-CT) imaging. The maximum necrotic to normal muscle ratio reached to 7.9-fold at 48 h post injection, which further verified the necrosis avidity of (131)I-SA. Pharmacokinetic parameters showed that (131)I-SA had fast blood clearance with an elimination half-life of 6.7 h. Various functional indexes were no significant difference (p > 0.05) between before administration and 1 d, 8 d, 16 d after administration. Histopathology showed no signs of tissue damage. 4. These data suggest (131)I-SA is a safe and promising necrosis-avid agent applicable in imaging diagnosis and tumor necrosis targeted radiotherapy.

  4. The europium and praseodymium hydrolysis in a 2M NaCl environment; La hidrolisis del europio y del praseodimio en un medio 2M de NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1998-07-01

    It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)

  5. Can calcification predict {sup 131}I accumulation on metastatic lymph nodes in papillary thyroid carcinoma patients receiving {sup 131}I therapy? Comparison of CT, {sup 131}I WBS and {sup 18}F-FDG PET/CT

    Energy Technology Data Exchange (ETDEWEB)

    Kaneko, Koichiro; Abe, Koichiro; Baba, Shingo; Tanabe, Yoshitaka; Yabuuchi, Hidetake; Hatakenaka, Masamitsu; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan); Sasaki, Masayuki [Kyushu University, Department of Health Sciences, School of Medicine, 3-1-1 Maidashi, Higashi-ku, Fukuoka (Japan)

    2010-02-15

    The aim of this study was to clarify the predictive significance of nodal calcification in terms of the therapeutic option of {sup 131}I therapy in papillary thyroid carcinoma (PTC) patients. We reviewed 19 computed tomography (CT) examinations of PTC patients on receiving {sup 131}I therapy for the presence of nodal calcification, and compared the {sup 131}I whole-body scintigraphy and {sup 18}F-2-fluoro-2-deoxy-D-glucose (FDG) positron emission tomography (PET)/CT findings. The metastatic lymph nodes (mLNs) were divided into three groups: A, those with calcification; B, those without calcification but belonging to patients who had calcified mLNs; C, those without calcification and belonging to patients who had no calcified mLNs. The incidences of {sup 131}I accumulation and maximum standardised uptake values (SUV max) in the three groups were compared. A total of 70 mLNs were evaluated. Twelve mLNs belonged to group A, 13 to group B and 45 to group C. The incidences of {sup 131}I accumulation were significantly higher in groups A (100%) and B (100%) than in group C (11.1%) (p < 0.0001 for both). The SUVmax was significantly lower in groups A (4.1 {+-} 1.9) and B (3.9 {+-} 1.4) than in group C (7.1 {+-} 4.4) (p = 0.01, p = 0.002, respectively). Our results indicated that calcification in mLNs related to the ability of {sup 131}I accumulation and less dedifferentiation. (orig.)

  6. Specific chiral sensing of amino acids using induced circularly polarized luminescence of bis(diimine)dicarboxylic acid europium(III) complexes.

    Science.gov (United States)

    Okutani, Kazuhiro; Nozaki, Koichi; Iwamura, Munetaka

    2014-06-02

    The circularly polarized luminescence (CPL) from [Eu(pda)2](-) (pda = 1,10-phenanthroline-2,9-dicarboxylic acid) and [Eu(bda)2](-) (bda = 2,2'-bipyridine-6,6'-dicarboxylic acid) in aqueous solutions containing various amino acids was investigated. The europium(III) complexes exhibited bright-red luminescence assignable to the f-f transition of the Eu(III) ion when irradiated with UV light. Although the luminescence was not circularly polarized in the solid state or in aqueous solutions, in accordance with the achiral crystal structure, the complexes exhibited detectable induced CPL (iCPL) in aqueous solutions containing chiral amino acids. In the presence of L-pyrrolidonecarboxylic acid, both [Eu(pda)2](-) and [Eu(bda)2](-) showed similar iCPL intensity (glum ∼ 0.03 for the (5)D0 → (7)F1 transition at 1 mol·dm(-3) of the amino acid). On the other hand, in the presence of L-histidine or L-arginine, [Eu(pda)2](-) exhibited intense CPL (glum ∼ 0.08 for the (5)D0 → (7)F1 transition at 0.10 mol·dm(-3) of the amino acid), whereas quite weak CPL was observed for [Eu(bda)2](-) under the same conditions (glum europium(III) complexes possess coordination structures similar to that in the crystal with slight distortion to form a chiral structure due to specific interaction with two zwitterionic amino acids. This mechanism was in stark contrast to that of the europium(III) complex-pyrrolidonecarboxylic acid system in which one amino acid coordinates to the Eu(III) ion to yield an achiral coordination structure.

  7. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    Science.gov (United States)

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  8. Europium-activated phosphors containing oxides of rare-earth and group-IIIB metals and method of making the same

    Science.gov (United States)

    Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan

    2004-07-13

    Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.

  9. Synthesis and pharmacological characterization of a europium-labelled single-chain antagonist for binding studies of the relaxin-3 receptor RXFP3.

    Science.gov (United States)

    Haugaard-Kedström, Linda M; Wong, Lilian L L; Bathgate, Ross A D; Rosengren, K Johan

    2015-06-01

    Relaxin-3 and its endogenous receptor RXFP3 are involved in fundamental neurological signalling pathways, such as learning and memory, stress, feeding and addictive behaviour. Consequently, this signalling system has emerged as an attractive drug target. Development of leads targeting RXFP3 relies on assays for screening and ligand optimization. Here, we present the synthesis and in vitro characterization of a fluorescent europium-labelled antagonist of RXFP3. This ligand represents a cheap and safe but powerful tool for future mechanistic and cell-based receptor-ligand interaction studies of the RXFP3 receptor.

  10. Bis{[6-methoxy-2-(4-methylphenyliminiomethyl]phenolate-κ2O,O′}tris(nitrato-κ2O,O′europium(III

    Directory of Open Access Journals (Sweden)

    Hang-Ming Guo

    2010-11-01

    Full Text Available The crystal structure of title compound, [Eu(NO33(C15H15NO22], contains two Schiff base 6-methoxy-2-[(4-methylphenyliminomethyl]phenolate (L ligands and three independent nitrate ions that chelate to the europium(III ion via the O atoms. The coordination number of the EuIII ion is ten. The L ligands chelate with a strong Eu—O(deprotonated phenolate bond and a weak Eu—O(methoxy contact, the latter can be interpreted as the apices of the bicapped square-antiprismatic EuIII polyhedron. Intramolecular N—H...O hydrogen bonds occur.

  11. Tropospheric Aerosol Radiative Forcing Observational eXperiment - University of Washington instrumented C-131A aircraft Data Set

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A is the Tropospheric Aerosol Radiative Forcing Observational eXperiment (TARFOX) - University of Washington instrumented C-131A aircraft data set. The...

  12. Tropospheric Aerosol Radiative Forcing Observational eXperiment - Ames Sun Photometer - University of Washington C-131A aircraft

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A_SUNP Data Set was collected from the 6-channel Sun Photometer flown on the University of Washington C-131A aircraft during the Tropospheric Aerosol...

  13. Cytogenetic in thyroid carcinoma and therapy with 131{sup I}; Citogenetica en cancer de tiroides y terapia con 131''I

    Energy Technology Data Exchange (ETDEWEB)

    Popova, L.; Hadjidekova, V.; Christova, R.; Agova, S.; Grudeva, V.; Hadjieva, T.; Dominguez, I.

    2007-07-01

    In order to assess the genotoxic risk of the therapy with radioiodine-131(''131I), the production of micronuclei (MN) and chromosome aberrations (CA) were analyzed in the peripheral blood lymphocytes of group of 26 patients undergoing therapy with this radionuclide for differentiated thyroid carcinoma (DTC). Blood samples were taken immediately before ''131 I administration and 1 month later. The patients underwent radioiodine ablation (RIA) or radioiodine therapy (RIT) after radical thyroidectomy. The amount of orally administered ''131I activity varied from 3330 to 4030 MBq according to the king of therapy (RIA or RIT). results show that after radioiodine therapy there is a significant increase in the frequency of MN and CA. The mean frequencies of MN {+-} Sd before and after the therapy were 10.72 % {+-} 5.84 % and 25.28 %{+-} 12.6% respectively. For CA, the mean frequencies obtained were 1.16% {+-} 0.36% before and 2.3% {+-} 0.87% after the therapy. These findings indicate a genotoxic activity of ''131I therapy estimated after a period of one month. (Author) 38 refs.

  14. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  15. 131I-Traced PLGA-Lipid Nanoparticles as Drug Delivery Carriers for the Targeted Chemotherapeutic Treatment of Melanoma

    Science.gov (United States)

    Wang, Haiyan; Sheng, Weizhong

    2017-05-01

    Herein, folic acid (FA) conjugated Poly(d,l-lactide-co-glycolide) (PLGA)-lipid composites (FA-PL) were developed as nanocarriers for the targeted delivery of insoluble anti-cancer drug paclitaxel (PTX), resulting FA-PLP nanoparticles. Furthermore, 131I, as a radioactive tracer, was used to label FA-PLP nanoparticles (FA-PLP-131I) to evaluate their cell uptake activity, in vivo blood circulation, and biodistribution. The FA-PLP-131I nanoparticles had a spherical morphology with great stability, a narrow size distribution (165.6 and 181.2 nm), and -22.1 mV in average zeta potential. Confocal laser scanning microscopy indicated that the targeting molecule FA promotes PLP-131I uptake by melanoma B16F10 cells, which was further confirmed by the cell incorporation rate via 131I activity detection as measured by a gamma counter. FA-PLP-131I without PTX (FA-PL-131I) shows minor cytotoxicity, good biocompatibility, while FA-PLP-131I was demonstrated to have efficient cell viability suppression compared to free PTX and PLP-131I. Following intravenous injection, the blood circulation half-life of free PTX ( t 1/2 = 5.4 ± 0.23 h) was prolonged to 18.5 ± 0.5 h by FA-PLP-131I. Through FA targeting, the tumor uptake of FA-PLP-131I was approximately 4.41- and 12.8-fold higher compared to that of PLP-131I and free PTX-131I, respectively. Moreover, following 40 days of treatment, FA-PLP-131I showed an improved tumor inhibition effect compared to free PTX and PLP-131I, with no relapse and no remarkable systemic in vivo toxicity. The results demonstrate that the 131I-labeled PLGA-lipid nanoparticle can be simultaneously applied for targeted drug delivery and reliable tracking of drugs in vivo.

  16. {sup 131}I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Mu [Taipei Medical University - Shuang Ho Hospital, Department of Nuclear Medicine, Taipei (China); Taipei Medical University, Department of Radiology, College of Medicine, Taipei (China); Doyle, Pat [London School of Hygiene and Tropical Medicine, Faculty of Epidemiology and Population Health, London (United Kingdom); Tsan, Yu-Tse [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); Taichung Veterans General Hospital, Department of Emergency Medicine, Taichung (China); Chung Shan Medical University, School of Medicine, Taichung (China); Lee, Chang-Hsing [Ton Yen General Hospital, Department of Occupational Medicine, Hsinchu County (China); Wang, Jung-Der [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Cheng Kung University College of Medicine, Department of Public Health, Tainan (China); Chen, Pau-Chung [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Taiwan University College of Public Health, Department of Public Health, Taipei (China); National Taiwan University College of Medicine and Hospital, Department of Environmental and Occupational Medicine, Taipei (China); Collaboration: Health Data Analysis in Taiwan (hDATa) Research Group

    2014-02-15

    To evaluate the association between {sup 131}I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative {sup 131}I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of {sup 131}I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10{sup 5} person-years. {sup 131}I was used in the treatment of 6,153 patients (68.8 %) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative {sup 131}I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing {sup 131}I dose (test for trend p = 0.51). No interaction was found between {sup 131}I dose and age (p = 0.94) or {sup 131}I dose and sex (p = 0.99). {sup 131}I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years. (orig.)

  17. 131I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study.

    Science.gov (United States)

    Lin, Chien-Mu; Doyle, Pat; Tsan, Yu-Tse; Lee, Chang-Hsing; Wang, Jung-Der; Chen, Pau-Chung

    2014-02-01

    To evaluate the association between (131)I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative (131)I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of (131)I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10(5) person-years. (131)I was used in the treatment of 6,153 patients (68.8%) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative (131)I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing (131)I dose (test for trend p = 0.51). No interaction was found between (131)I dose and age (p = 0.94) or (131)I dose and sex (p = 0.99). (131)I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years.

  18. THERAPY OF GRAVES’ DISEASE WITH SODIUM IODIDE-131

    Directory of Open Access Journals (Sweden)

    I Wayan Hartadi Noor

    2013-11-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Graves’ disease is the most common form of thyrotoxicosis, with a peak incidence in the 20-40 year of age group. Females are involved about five times more commonly than male. The easiest sign to recognize patients with Graves’ disease is the present of Graves’ ophthalmopathy. The diagnosis of Graves’ disease may sometimes base only on a physical examination and a medical history. Diffuse thyroid enlargement and sign of thyrotoxicosis, mainly ophthalmopathy and to lesser extent dermopathy, usually adequate for diagnosis. TSH test combined with FT4 test is usually the first laboratory test performs in these patients. The patients suffered Graves’ disease can be treated with antithyroid drug therapy or undergo subtotal Thyroidectomy. Another therapy is by using sodium iodide-131, where this therapy has advantages including easy administration, effectiveness, low expense, and absence of pain. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  19. Carbon footprint assessment of recycling technologies for rare earth elements: A case study of recycling yttrium and europium from phosphor.

    Science.gov (United States)

    Hu, Allen H; Kuo, Chien-Hung; Huang, Lance H; Su, Chao-Chin

    2017-02-01

    Rare earth elements are key raw materials in high-technology industries. Mining activities and manufacturing processes of such industries have caused considerable environmental impacts, such as soil erosion, vegetation destruction, and various forms of pollution. Sustaining the long-term supply of rare earth elements is difficult because of the global shortage of rare earth resources. The diminishing supply of rare earth elements has attracted considerable concern because many industrialized countries regarded such elements as important strategic resources for economic growth. This study aims to explore the carbon footprints of yttrium and europium recovery techniques from phosphor. Two extraction recovery methods, namely, acid extraction and solvent extraction, were selected for the analysis and comparison of carbon footprints. The two following functional units were used: (1) the same phosphor amounts for specific Y and Eu recovery concentrations, and (2) the same phosphor amounts for extraction. For acid extraction method, two acidic solutions (H2SO4 and HCl) were used at two different temperatures (60 and 90°C). For solvent extraction method, acid leaching was performed followed by ionic liquid extraction. Carbon footprints from acid and solvent extraction methods were estimated to be 10.1 and 10.6kgCO2eq, respectively. Comparison of the carbon emissions of the two extraction methods shows that the solvent extraction method has significantly higher extraction efficiency, even though acid extraction method has a lower carbon footprint. These results may be used to develop strategies for life cycle management of rare earth resources to realize sustainable usage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Europium doped di-calcium magnesium di-silicate orange–red emitting phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-07-01

    Full Text Available A new orange–red europium doped di-calcium magnesium di-silicate (Ca2MgSi2O7:Eu3+ phosphor was prepared by the traditional high temperature solid state reaction method. The prepared Ca2MgSi2O7:Eu3+ phosphor was characterized by X-ray diffractometer (XRD, transmission electron microscopy (TEM, field emission scanning electron microscopy (FESEM with energy dispersive x-ray spectroscopy (EDX, fourier transform infrared spectra (FTIR, photoluminescence (PL and decay characteristics. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P4¯21m, this structure is a member of the melilite group and forms a layered compound. The chemical composition of the sintered Ca2MgSi2O7:Eu3+ phosphor was confirmed by EDX spectra. The PL spectra indicate that Ca2MgSi2O7:Eu3+ can be excited effectively by near ultraviolet (NUV light and exhibit bright orange–red emission with excellent color stability. The fluorescence lifetime of Ca2MgSi2O7:Eu3+ phosphor was found to be 28.47 ms. CIE color coordinates of Ca2MgSi2O7:Eu3+ phosphor is suitable as orange-red light emitting phosphor with a CIE value of (X = 0.5554, Y = 0.4397. Therefore, it is considered to be a new promising orange–red emitting phosphor for white light emitting diode (LED application.

  1. Evaluation of in vivo cytogenetic toxicity of europium hydroxide nanorods (EHNs) in male and female Swiss albino mice.

    Science.gov (United States)

    Bollu, Vishnu Sravan; Nethi, Susheel Kumar; Dasari, Rama Krishna; Rao, Soma Shiva Nageshwara; Misra, Sunil; Patra, Chitta Ranjan

    2016-01-01

    Our group already demonstrated that europium hydroxide nanorods (EHNs) show none or mild toxicity in C57BL/6 mice even at high dose and exhibited excellent pro-angiogenic activity towards in vitro and in vivo models. In the present study, we evaluated the in vivo cytogenetic toxicity of intraperitoneally administered EHNs (12.5-250 mg/kg/b.w.) in male and female Swiss albino mice by analyzing chromosomal aberrations (CAs), mitotic index (MI), micronucleus (MN) from bone marrow and peripheral blood. Furthermore, we performed the cytogenetic toxicity study of EHNs towards Chinese hamster ovary (CHO) cells, in order to compare with the in vivo results. The results of CA assay of mice treated with EHNs (12.5-125 mg/kg/b.w.) showed no significant change in the formation of aberrant metaphases compared to the control group. Also, there was no significant difference in the number of dividing cells between the control group and EHNs-treated groups observed by MI study, suggesting the non-cytotoxicity of EHNs. Additionally, FACS study revealed that EHNs do not arrest cells at any phase of cell cycle in the mouse model. Furthermore, MN test of both bone marrow and peripheral blood showed no significant differences in the induction of MNs when compared with the control group. In vitro results from CHO cells also support our in vivo observations. Considering the role of angiogenesis by EHNs and the absence of its genotoxicity in mouse model, we strongly believe the future application of EHNs in treating various diseases, where angiogenesis plays an important role such as cardiovascular diseases, ischemic diseases and wound healing.

  2. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

    Science.gov (United States)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

    2017-06-01

    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  3. Investigation on the co-luminescence effect of europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system and its application.

    Science.gov (United States)

    Si, Hailin; Zhao, Fang; Cai, Huan

    2013-01-01

    A novel luminescence, enhancement phenomenon in the europium(III)-dopamine-sodium dodecylbenzene sulfonate system was observed when lanthanum(III) was added. Based on this, a sensitive co-luminescence method was established for the determination of dopamine. The luminescence signal for the europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system was monitored at λ(ex) = 300 nm, λ(em) = 618 nm and pH 8.3. Under optimized conditions, the enhanced luminescence signal responded linearly to the concentration of dopamine in the range 1.0 × 10(-10)-5.0 × 10(-7) mol/L with a correlation coefficient of 0.9993 (n = 11). The detection limit (3σ) was 2.7 × 10(-11) mol/L and the relative standard deviation for 11 parallel measurements of 3.0 × 10(-8) mol/L dopamine was 1.9%. The presented method was successfully applied for the estimation of dopamine in samples of pharmaceutical preparations, human serum and urine. The possible luminescence enhancement mechanism of the system is discussed briefly. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Europium-phenolic network coated BaGdF5 nanocomposites for tri-modal computed tomography/magnetic resonance/luminescence imaging.

    Science.gov (United States)

    Zhu, Wei; Liang, Shuang; Wang, Jing; Yang, Zhe; Zhang, Li; Yuan, Tianmeng; Xu, Zushun; Xu, Haibo; Li, Penghui

    2017-05-01

    Multifunctional nanocomposites based on BaGdF5 nanoparticles (NPs) and metal phenolic network (MPN) have been engineered as novel contrast agents for potential applications in X-ray computed tomography, magnetic resonance and luminescence imaging. The BaGdF5@MPN nanocomposites were synthesized at room temperature by coating BaGdF5 NPs with europium-phenolic network, which was obtained by the coordination of europium (III) with tannic acid (TA). The in vitro cytotoxicity assays against HepG2 cells revealed that the BaGdF5@MPN nanocomposites presented better cytocompatibility and lower cytotoxity than pure BaGdF5 NPs. In addition, vivid red and green luminescence can be observed by confocal laser scanning microscope (CLSM) from the BaGdF5@MPN nanocomposites laden HepG2 cells under the excitation of UV (390 nm) and visible light (440 nm), respectively. The longitudinal relaxivity value (r1) of the nanocomposites was 2.457 mM-1s-1. Moreover, the nanocomoposites exhibited X-ray computed tomography (CT) and T1-weighted magnetic resonance (MR) imaging capacities, and the intensities of the enhanced signals of in vitro CT and MR images were proportional to the concentrations of the nanocomposites. These results indicated that the as-prepared BaGdF5@MPN nanocomposites are promising contrast agents for CT/MR/luminescence imaging.

  5. Effective visible light-active boron and europium co-doped BiVO4 synthesized by sol-gel method for photodegradion of methyl orange.

    Science.gov (United States)

    Wang, Min; Che, Yinsheng; Niu, Chao; Dang, Mingyan; Dong, Duo

    2013-11-15

    Eu-B co-doped BiVO4 visible-light-driven photocatalysts have been synthesized using the sol-gel method. The resulting materials were characterized by a series of joint techniques, including XPS, XRD, SEM, BET, and UV-vis DRS analyses. Compared with BiVO4 and B-BiVO4 photocatalysts, the Eu-B-BiVO4 photocatalysts exhibited much higher photocatalytic activity for methyl orange (MO) degradation under visible light irradiation. The optimal Eu doping content is 0.8 mol%. It was revealed that boron and europium were doped into the lattice of BiVO4 and this led to more surface oxygen vacancies, high specific surface areas, small crystallite size, a narrower band gap and intense light absorbance in the visible region. The doped Eu(III) cations can help in the separation of photogenerated electrons. The synergistic effects of boron and europium in doped BiVO4 were the main reason for improving visible light photocatalytic activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Emission tunability and local environment in europium-doped OH{sup −}-free calcium aluminosilicate glasses for artificial lighting applications

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others

    2015-04-15

    The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.

  7. Radiosensitive effect of curcumin on thyroid cancer cell death induced by radioiodine-131

    Directory of Open Access Journals (Sweden)

    Hosseinimehr Seyed Jalal

    2014-06-01

    Full Text Available Curcumin is a natural product widely consumed by humans. It has many biological properties. In this study, we investigated the radiosensitive effect of curcumin on thyroid cancer cells against cellular toxicity induced by 131-I. Human thyroid cancer and human non-malignant fibroblast cells (HFFF2 were treated with 131-I and/or curcumin at different concentrations (5, 10 and 25 μg/ml for 48 h. The cell proliferation was measured by determination of the surviving cells by using MTT assay. Our results showed that curcumin increased the killing effect of 131-I on thyroid cancer cells, while it exerted no toxicity on HFFF2 cells. This result shows a promising effect of curcumin on the enhancement of therapeutic effects of 131-I in patients

  8. Cystic thyroid mass following I-131 treatment of papillary thyroid carcinoma: An unusual complication

    Energy Technology Data Exchange (ETDEWEB)

    Morrish, D.W.; Jackson, F.I.; Lalani, Z.H.; Catz, Z.; Sloboda, R. (Univ. of Alberta, Edmonton (Canada))

    1989-12-01

    Several unusual complications of I-131 therapy for thyroid carcinoma are known. Two patients who developed a further unusual event that consisted of a palpable mass and cystic degeneration are described.

  9. The presynaptic Munc13-1 binds alcohol and modulates alcohol self-administration in Drosophila

    Science.gov (United States)

    Das, Joydip; Xu, Shiyu; Pany, Satyabrata; Guillory, Ashley; Shah, Vrutant; Roman, Gregg W.

    2013-01-01

    Munc13-1 is a presynaptic active-zone protein essential for neurotransmitter release and involved in presynaptic plasticity in brain. Ethanol, butanol and octanol quenched the intrinsic fluorescence of the C1 domain of Munc13-1 with EC50s of 52 mM, 26 mM and 0.7 mM, respectively. Photoactive azialcohols photolabeled Munc13-1 C1 exclusively at Glu-582, which was identified by mass spectrometry. Mutation of Glu-582 to alanine, leucine and histidine reduced the alcohol binding two- to five-fold. Circular dichroism studies suggested that binding of alcohol increased the stability of the wild type Munc13-1 compared with the mutants. If Munc13-1 plays some role in the neural effects of alcohol in vivo, changes in the activity of this protein should produce differences in the behavioral responses to ethanol. We tested this prediction with a loss-of-function mutation in the conserved Dunc-13 in Drosophila melanogaster. The Dunc-13P84200/+ heterozygotes have 50% wild type levels of Dunc-13 mRNA and display a very robust increase in ethanol self-administration. This phenotype is reversed by the expression of the rat Munc13-1 protein within the Drosophila nervous system. The present studies indicate that Munc13-1 C1 has binding site(s) for alcohols and Munc13-1 activity is sufficient to restore normal self-administration to Drosophila mutants deficient in Dunc-13 activity. PMID:23692447

  10. Comparative Analysis of Direct and Indirect 131I Measurement Methods from the Stack to Outdoor

    Directory of Open Access Journals (Sweden)

    G. Suhariyono

    2017-11-01

    Full Text Available The radioisotope production facility at PUSPIPTEK Serpong produces and processes 131I that can disperse to the settlements (community and the environment around the Serpong Nuclear Area (SNA. 131I is produced routinely for medical uses in hospitals and pharmacies, for both domestic uses and export. 131I is a beta and gamma emitting radioactive material and can cause thyroid cancer. The problem was that there was so far no research and in-depth assessment of the aerial dispersion of 131I radioactivity emitted from the radioisotope production stack to the environment at actual conditions. The research was conducted through simultaneous measurement of 131I radioactivity in the stack of the 131I radioisotope production facility, Serpong, and outdoor in house courtyards around SNA in normal condition (no accident based on the variations of the distance and wind direction. Direct measurements were carried out with a portable in-situ NaI(Tl detector at outdoor, and with a LaBr3 detector in the stack. Indirect measurements were carried out by using charcoal filter and vacuum pump in the stack and outdoor. The direct measurement method has many advantages over the indirect measurement. The direct measurement method was found to be more accurate, less expensive, easier to operate, needing just one operator in its implementation, portable, and can be operated continuously and for long durations. The overall activity concentrations of 131I on average obtained by either direct or indirect method were still below the upper limit of 131I activity concentration in the air (530 Bq/m3 stipulated by the Regulation of the Chairman of BAPETEN (Perka BAPETEN No. 7/2013. 

  11. Uso do TSH recombinante humano no tratamento do bócio multinodular com iodo 131

    OpenAIRE

    Mesa Júnior, Cléo Otaviano; Graf, Hans

    2003-01-01

    Orientador : Hans Graf Dissertaçao (mestrado) - Universidade Federal do Paraná, Setor de Ciencias da Saúde Resumo: O uso do iodo 131 (131l) no tratamento de pacientes com bocio multinodular (BMN) ja esta bem estabelecido, porem devido as baixas captacoes de 1311 destes bocios, geralmente sao necessarias altas doses terapeuticas de iodo radioativo. Este estudo tem como objetivos verificar em pacientes com BMN, apos uso de TSH recombinante humano (rhTSH - recombinant human TSH), o aumento...

  12. Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131

    Science.gov (United States)

    2014-05-01

    solution, and a pit is subsequently formed. Dislocation of the particle may have been facilitated by the AFM tip, formation of corrosion products, or...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 by Joseph P. Labukas and Kenneth E. Strawhecker ARL-TR-6925 May...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 Joseph P. Labukas and Kenneth E. Strawhecker Weapons and Materials

  13. 32 CFR 935.131 - Right-hand side of the road.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Right-hand side of the road. 935.131 Section 935... INSULAR REGULATIONS WAKE ISLAND CODE Motor Vehicle Code § 935.131 Right-hand side of the road. Each person driving a motor vehicle on Wake Island shall drive on the right-hand side of the road, except where...

  14. Detection and tracing of the medical radioisotope 131I in the Canberra environment

    Science.gov (United States)

    Gilfillan, Nathan R.; Timmers, Heiko

    2012-10-01

    The transport and radioecology of the therapeutical radioisotope 131I has been studied in Canberra, Australia. The isotope has been detected in water samples and its activity quantified via characteristic J-ray photo peaks. A comparison of measurements on samples from upstream and downstream of the Canberra waste water treatment plant shows that 131I is discharged from the plant outflow into the local Molonglo river. This is consistent with observations in other urban environments. A time-correlation between the measured activities in the outflow and the therapeutical treatment cycle at the hospital identifies the medical treatment as the source of the isotope. Enhanced activity levels of 131I have been measured for fish samples. This may permit conclusions on 131I uptake by the biosphere. Due to the well-defined and intermittent input of 131I into the sewage, the Canberra situation is ideally suited for radioecological studies. Furthermore, the 131I activity may be applied in tracer studies of sewage transport to and through the treatment plant and as an indicator of outflow dilution following discharge to the environment.

  15. Iodine-131 Metaiodobenzylguanidine Therapy for Neuroblastoma: Reports So Far and Future Perspective

    Directory of Open Access Journals (Sweden)

    Daiki Kayano

    2015-01-01

    Full Text Available Neuroblastoma, which derives from neural crest, is the most common extracranial solid cancer in childhood. The tumors express the norepinephrine (NE transporters on their cell membrane and take in metaiodobenzylguanidine (MIBG via a NE transporter. Since iodine-131 (I-131 MIBG therapy was firstly reported, many trails of MIBG therapy in patients with neuroblastoma were performed. Though monotherapy with a low dose of I-131 MIBG could achieve high-probability pain reduction, the objective response was poor. In contrast, more than 12 mCi/kg I-131 MIBG administrations with or without hematopoietic cell transplantation (HCT obtain relatively good responses in patients with refractory or relapsed neuroblastoma. The combination therapy with I-131 MIBG and other modalities such as nonmyeloablative chemotherapy and myeloablative chemotherapy with HCT improved the therapeutic response in patients with refractory or relapsed neuroblastoma. In addition, I-131 MIBG therapy incorporated in the induction therapy was proved to be feasible in patients with newly diagnosed neuroblastoma. To expand more the use of MIBG therapy for neuroblastoma, further studies will be needed especially in the use at an earlier stage from diagnosis, in the use with other radionuclide formations of MIBG, and in combined use with other therapeutic agents.

  16. Observation of radioactive iodine ({sup 131}I, {sup 129}I) in cropland soil after the Fukushima nuclear accident

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Hideshi, E-mail: hfuji@affrc.go.jp

    2016-10-01

    During the early stages of the Fukushima nuclear accident, the temporal variations of {sup 131}I deposited on the ground and of {sup 131}I accumulated in cropland soil were monitored at a fixed location in Japan. Moreover, concentrations of long-lived radioactive iodine ({sup 129}I) in atmospheric deposits and soil were measured to examine the feasibility of retrospectively reconstructing {sup 131}I levels from the levels of accident-derived {sup 129}I. The exceptionally high levels of {sup 131}I in deposits and soil were attributed to rainfall-related deposition of radionuclides. In the crop field studied, the losses of deposited {sup 131}I and {sup 129}I due to volatilization were small. The atomic ratio {sup 129}I/{sup 131}I in the topsoil corresponded to the same ratio in deposits. The {sup 131}I concentrations measured in the topsoil were very consistent with the {sup 131}I concentrations reconstructed from the {sup 129}I concentrations in the soil. - Highlights: • A high level of {sup 131}I contamination occurs through rainfall-related deposition. • Only a small loss of deposited radioactive iodine occurs via volatilization. • The {sup 129}I/{sup 131}I ratio in soil corresponds to the ratio in atmospheric deposit. • The feasibility of retrospectively reconstructing {sup 131}I is confirmed.

  17. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133; Produccion de los radionucleidos de fision: Molibdeno-99, Yodo-131 y Xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Carrillo, D.

    1982-07-01

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs.

  18. Radioactive Body Burden Measurements in 131Iodine Therapy for Differentiated Thyroid Cancer: Effect of Recombinant Thyroid Stimulating Hormone in Whole Body 131Iodine Clearance

    OpenAIRE

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive 131I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation...

  19. Radioimmunotherapy in refractory b-cell nonhodgkins lymphoma with I-131-labeled chimeric anti cd-20 c2b8 (I-131 rituximab): preliminary result

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hye Jin; Park, Yeon Hee; Kim, Sung Eun and others [Korea University Medical School, Seoul (Korea, Republic of)

    2005-07-01

    Recently, the native chimeric human-mouse anti CD-20 antibody IDEC-C2B8 (Rituximab) has been widely applied in NHL. This ongoing phase study was to evaluate whether radioimmunotherapy (RIT) with I-131 rituximab is effective in refractory B-cell NHL. Inclusion criteria were as follows: B-cell NHL with relapsed or refractory to primary standard therapy, measurable disease, adequate hematologic, renal, and hepatic function, informed consent. The rituximab (Mabthera, Roach) was radiolabeled with iodine-131(I-131) using a modified chloramine T method with high radiochemical purity (95%) and preservation of immuno-reactivity. All patients received loading doses of unlabeled rituximab (median, 40 mg: range, 20{approx}70 mg) immediately prior to administration of therapeutic dose (51.4{approx}152.2 MBq/kg), and then underwent gamma camera scan. 11 patients were enrolled (4 low-grade B-cell NHL, 7 DLBCL, median age 63 years). Patients had received a median of three prior chemotherapy regimens. The objective response rate was 36.4% (1 CR, 3 PRs). These all responses were observed in low-grade B-cell NHL, except one with DLBCL. Adverse events were primarily hematologic toxicities; the incidence of grade 3/4 neutropenia, thrombocytopenia, and anemia was 27.3%, 45.5%, and 18.2%, respectively. The treatment-related mortality was observed in one patient, who had been previously treated with high-dose chemotherapy plus TBI with autologous stem cell transplantation. RIT with I-131 rituximab seems to be effective tolerable in refractory low-grade B-cell NHL, although modest activity in refractory DLBCL. Further studies to define the efficacy of I-131 rituximab in DLBCL are warranted.

  20. Pulmonary scintiscanning using /sup 131/iodine-labeled Aprindin in experimental pneumonia and pulmonary embolism. Lungenszintigraphie mit /sup 131/Jod-Aprindin bei experimenteller Pneumonie und Lungenembolie

    Energy Technology Data Exchange (ETDEWEB)

    Doll, M.

    1983-10-25

    An antiarrhythmic agent generally known as Aprindin showed to be accumulated in a highly selective way in the lungs (labeled with iodine-125) and its pharmacokinetic properties were observed to remain largely unchanged following iodination. Unlike human albumin particles labeled with iodine-131 or 99mTc, which are used for conventional 'perfusion' scans, this substance is assumed to enable 'parenchymal' scintiscanning. The study described here was performed to find out whether the distribution pattern of iodine-131-labeled Aprindin is altered due to pathological changes in the parenchymal structure of the lungs. For this purpose, pulmonary embolism and pneumonia were chosen, which are often difficult to differentiate from each other, and studied in animal experiments. Moreover, a relatively simple method of iodination is described. Following administration of 131-I-Aprindin and 99mTc-MAA two successive scintigrams were obtained from rabbits previously assigned to three different study groups. The first group included healthy control animals, while pulmonary embolism was provoked in the second group prior to the examinations. The scintigrams recorded after administration of 131-I-Aprindin gave no evidence of changes in the animals showing embolism as compared to healthy rabbits, whereas the 'perfusion' scintiscans showed the anticipated regions of reduced activity. In the third group, where pneumonia had been induced, the scintigrams obtained following injection of 131-I-Aprindin were marked by considerably reduced levels of activity in the diseased areas. It was concluded that the combined use of the methods tested here enables diagnostic differentiation between pulmonary embolism and pneumonia, the two pathological conditions chosen for this study. It still remains to be investigated in further studies, in which way this combination method can be used in clinical practice. (TRV).

  1. 131I-MIBG myocardial scintigraphy in patients with Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Tuan-feng YANG

    2016-06-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG, which can be taken by cardiac sympathetic postganglionic fibers, is an imaging agent to assess the cardiac sympathetic nerve function. The present study is to assess the cardiac sympathetic nerve function of patients with Parkinson's disease (PD by 131I-MIBG myocardial scintigraphy and preliminarily explore its applications in the early diagnosis of PD.  Methods Twenty-one eligible PD patients (16 early PD and 5 late PD and 9 normal controls were enrolled in the study. Unified Parkinson's Disease Rating Scale (UPDRS and Hoehn-Yahr stage were used to evaluate the severity of PD. Planar images of chest were obtained at different time points (15 min, 4 h and 24 h after injection of 3 mCi 131I-MIBG, and then the 131I-MIBG myocardial uptake ratios were calculated.  Results 1 The 131I-MIBG myocardial uptake ratios in PD group at 15 min (1.67 ± 0.38, 4 h (1.53 ± 0.47 and 24 h (1.35 ± 0.42 after injection were lower than those in the normal control group respectively (P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the PD group reduced over time (P = 0.002, 0.000, 0.000. 2 The 131I-MIBG myocardial uptake ratios in the early and late PD groups at 15 min [(1.73 ± 0.40 and (1.50 ± 0.30], 4 h [(1.58 ± 0.51 and (1.37 ± 0.31], 24 h [(1.39 ± 0.46 and (1.24 ± 0.29] after injection were lower than those in the normal control group respectively (early PD: P = 0.000, 0.000, 0.000; late PD: P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the early and late PD groups reduced over time (early PD: P = 0.012, 0.000, 0.000; late PD: P = 0.039, 0.001, 0.024.  Conclusions Cardiac sympathetic nerve damage could occur in PD patients, even at an early stage of PD. 131I-MIBG myocardial scintigraphy may help in the early diagnosis of PD. DOI: 10.3969/j.issn.1672-6731.2016.06.008

  2. Evolutionary History of the Global Emergence of the Escherichia coli Epidemic Clone ST131.

    Science.gov (United States)

    Stoesser, Nicole; Sheppard, Anna E; Pankhurst, Louise; De Maio, Nicola; Moore, Catrin E; Sebra, Robert; Turner, Paul; Anson, Luke W; Kasarskis, Andrew; Batty, Elizabeth M; Kos, Veronica; Wilson, Daniel J; Phetsouvanh, Rattanaphone; Wyllie, David; Sokurenko, Evgeni; Manges, Amee R; Johnson, Timothy J; Price, Lance B; Peto, Timothy E A; Johnson, James R; Didelot, Xavier; Walker, A Sarah; Crook, Derrick W

    2016-03-22

    Escherichia colisequence type 131 (ST131) has emerged globally as the most predominant extraintestinal pathogenic lineage within this clinically important species, and its association with fluoroquinolone and extended-spectrum cephalosporin resistance impacts significantly on treatment. The evolutionary histories of this lineage, and of important antimicrobial resistance elements within it, remain unclearly defined. This study of the largest worldwide collection (n= 215) of sequenced ST131E. coliisolates to date demonstrates that the clonal expansion of two previously recognized antimicrobial-resistant clades, C1/H30R and C2/H30Rx, started around 25 years ago, consistent with the widespread introduction of fluoroquinolones and extended-spectrum cephalosporins in clinical medicine. These two clades appear to have emerged in the United States, with the expansion of the C2/H30Rx clade driven by the acquisition of ablaCTX-M-15-containing IncFII-like plasmid that has subsequently undergone extensive rearrangement. Several other evolutionary processes influencing the trajectory of this drug-resistant lineage are described, including sporadic acquisitions of CTX-M resistance plasmids and chromosomal integration ofblaCTX-Mwithin subclusters followed by vertical evolution. These processes are also occurring for another family of CTX-M gene variants more recently observed among ST131, theblaCTX-M-14/14-likegroup. The complexity of the evolutionary history of ST131 has important implications for antimicrobial resistance surveillance, epidemiological analysis, and control of emerging clinical lineages ofE. coli These data also highlight the global imperative to reduce specific antibiotic selection pressures and demonstrate the important and varied roles played by plasmids and other mobile genetic elements in the perpetuation of antimicrobial resistance within lineages. Escherichia coli, perennially a major bacterial pathogen, is becoming increasingly difficult to manage due to

  3. Determination of the hydrolysis constants of Europium (III), in ion strength media 4, 5 and 6 M NaClO{sub 4} at 303 K; Determinacion de las constantes de hidrolisis del Europio (III), en medios de fuerza ionica 4, 5 y 6 M de NaClO{sub 4} a 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado B, A.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC{sub H} values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)

  4. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  5. Europium-Labeled Synthetic C3a Protein as a Novel Fluorescent Probe for Human Complement C3a Receptor.

    Science.gov (United States)

    Dantas de Araujo, Aline; Wu, Chongyang; Wu, Kai-Chen; Reid, Robert C; Durek, Thomas; Lim, Junxian; Fairlie, David P

    2017-06-21

    Measuring ligand affinity for a G protein-coupled receptor is often a crucial step in drug discovery. It has been traditionally determined by binding putative new ligands in competition with native ligand labeled with a radioisotope of finite lifetime. Competing instead with a lanthanide-based fluorescent ligand is more attractive due to greater longevity, stability, and safety. Here, we have chemically synthesized the 77 residue human C3a protein and conjugated its N-terminus to europium diethylenetriaminepentaacetate to produce a novel fluorescent protein (Eu-DTPA-hC3a). Time-resolved fluorescence analysis has demonstrated that Eu-DTPA-hC3a binds selectively to its cognate G protein-coupled receptor C3aR with full agonist activity and similar potency and selectivity as native C3a in inducing calcium mobilization and phosphorylation of extracellular signal-regulated kinases in HEK293 cells that stably expressed C3aR. Time-resolved fluorescence analysis for saturation and competitive binding gave a dissociation constant (Kd) of 8.7 ± 1.4 nM for Eu-DTPA-hC3a and binding affinities for hC3a (pKi of 8.6 ± 0.2 and Ki of 2.5 nM) and C3aR ligands TR16 (pKi of 6.8 ± 0.1 and Ki of 138 nM), BR103 (pKi of 6.7 ± 0.1 and Ki of 185 nM), BR111 (pKi of 6.3 ± 0.2 and Ki of 544 nM) and SB290157 (pKi of 6.3 ± 0.1 and Ki of 517 nM) via displacement of Eu-DTPA-hC3a from hC3aR. The macromolecular conjugate Eu-DTPA-hC3a is a novel nonradioactive probe suitable for studying ligand-C3aR interactions with potential value in accelerating drug development for human C3aR in physiology and disease.

  6. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  7. Radioactive body burden measurements in (131)iodine therapy for differentiated thyroid cancer: effect of recombinant thyroid stimulating hormone in whole body (131)iodine clearance.

    Science.gov (United States)

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive (131)I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation safety applications call for the need to understand radioactive (131)I (RA(131)I) clearance pattern to estimate whole body doses when this new methodology is used in our institution. A study of radiation body burden estimation was undertaken in two groups of patients treated with RA(131)I; (a) one group of patients having thyroxine medication suspended for 5 weeks prior to therapy and (b) in the other group retaining thyroxine support with two rhTSH injections prior to therapy with RA(131)I. Sequential exposure rates at 1 m in the air were measured in these patients using a digital auto-ranging beta gamma survey instrument calibrated for measurement of exposure rates. The mean measured exposure rates at 1 m in μSv/h immediately after administration and at 24 h intervals until 3 days are used for calculating of effective ½ time of clearance of administered activity in both groups of patients, 81 patients in conventionally treated group (stop thyroxine) and 22 patients with rhTSH administration. The (131)I activities ranged from 2.6 to 7.9 GBq. The mean administered (131)I activities were 4.24 ± 0.95 GBq (n = 81) in "stop hormone" group and 5.11 ± 1.40 GBq (n = 22) in rhTSH group. The fall of radioactive body burden showed two clearance patterns within observed 72 h. Calculated T½eff values were 16.45 h (stop hormone group) 12.35 h (rhTSH group) for elapsed period of 48 h. Beyond 48 h post administration, clearance of RA(131)I takes place with T½eff> 20 h in both groups

  8. Radiochemical purity, at expiry, and radiochemical stability of iodine-131 labelled meta-iodobenzylguanidine concentrates for intravenous infusion.

    Science.gov (United States)

    Wafelman, A R; Hoefnagel, C A; Maes, R A; Beijnen, J H

    1996-08-01

    The determination of the amount of free [131I]iodide in [131I]metaiodobenzylguanidine ([131I]MIBG) concentrates for intravenous infusion under different storage conditions derived from daily practice. The percentage of free [131I]iodide was determined in [131I]MIBG concentrates (1.6-3.9 GBq in 7.5 ml), kept on dry ice (up to expiry, 3 days after production) or, after thawing, at room temperature (up to 24 h). A validated solid phase extraction (SPE) assay was used. Free [131I]iodide increased from 1.9% +/- 0.34% at production to 4.4% +/- 0.67% (mean +/- SD; n = 5) at expiry in 3.7 GBq per 7.5 ml [131I]MIBG infusion concentrates stored on dry ice (-78 degrees C). At room temperature, formation of free [131I]iodide was found to be dependent on the radioactive concentration of the fluid. [131I]iodide levels increased from 3.1%, immediately after thawing, to 6.6% and 16.6% at t = 5 and 24 h, respectively, for a 3.9 GBq per 7.5 ml concentrate. The investigated formulation of [131I]MIBG concentrates, stored in its original packing containing dry ice, can generally be used up to expiry. After thawing, the undiluted concentrates should be administered to a patient within 3.5 h.

  9. Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

    Energy Technology Data Exchange (ETDEWEB)

    Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee

    2004-07-01

    This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

  10. Radioiodine (1-131) Dose for the Treatment of Hyperthyroidism in Rajavithi Hospital.

    Science.gov (United States)

    Kuanrakcharoen, Pichit

    2016-02-01

    The main cause of hyperthyroidism is diffuse toxic goiter (Graves' disease), and the treatment of choice after medical therapy failure is radioiodine (I-131). There are two common methods of determining the optimal I-131 dose: calculated dose or fixed dose. The calculated dose method is based on the following formula: 75-200 microcuri/gram of thyroid gland divided by the percentage of radioiodine uptake at 24 hours (24-hour RAIU). As this is quite complex, some centers use fixed doses, such as 5, 10 or 15 mCi because it is simpler. At Rajavithi Hospital, the applied dose of I-131 is determined based on the thyroid gland weight assessed by palpation and other clinical factors. To study the mean I-131 dose for the initial treatment of hyperthyroidism in Rajavithi Hospital, to find the clinical factors that correlate with I-131 treatment dose, and to devise a formula to predict the optimal I-131 treatment dose. This was a retrospective study of 510 patients with a diagnosis of hyperthyroidism who received initial I-131 treatment at the Department of Nuclear Medicine in Rajavithi Hospital between January 2014 and June 2015. Baseline characteristics including age, sex, age at diagnosis, duration of antithyroid drug (ATD) therapy, gland weight (g), 3-hour RAIU and I-131 treatment dose were reviewed from medical records. The mean age ± SD was 41.93 ± 14.11 years (range 14-81 years), and the male to female ratio was 4.1:1. The mean duration of ATD therapy was 3.54 ± 4.02 years (min-max, 0.8-40.6 years). The mean gland weight was 54.35 ± 32.95 grams, and the mean 3-hour RAIU was 55.5 ± 23.69%. The mean I-131 treatment dose was 14.84 ± 5.71 mCi (min-max, 7-30 mCi). There was no significant correlation between dose and age, age at diagnosis, duration of A TD therapy or 3-hour RAIU. The study showed a significant correlation between I-131 dose and gland size, r = 0.938 (p hyperthyroidism after medical therapy failure, and there are various techniques for determining the

  11. Use of /sup 131/I-MIBG scintigraphy in the evaluation of suspected pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Swensen, S.J.; Brown, M.L.; Sheps, S.G.; Sizemore, G.W.; Gharib, H.; Grant, C.S.; van Heerden, J.A.

    1985-05-01

    Studies at the University of Michigan have shown that /sup 131/I-metaiodobenzylguanidine (/sup 131/I-MIBG) is an effective agent for the diagnosis and localization of pheochromocytomas and paragangliomas. The authors conducted a study that confirmed and expanded that finding. From January 1983 to March 1984, 48 patients at our institution had 51 /sup 131/I-MIBG scans during the workup of suspected sporadic or metastatic pheochromocytoma. Scintigrams were obtained after 500 microCI of /sup 131/I-MIBG had been administered intravenously. The final diagnosis (true-positive, false-negative, or false-positive result) was made at operation and pathologic examination. A true-negative diagnosis was confirmed by normal plasma and fractionated urinary levels of catecholamines and metabolites and, in most patients, computed tomography (CT). The overall sensitivity of /sup 131/I-MIBG scanning was 77%, specificity was 96%, and accuracy was 86%. This test is fairly sensitive in the workup of patients with known or suspected recurrent or metastatic pheochromocytoma. It may also be helpful in the evaluation of suspected sporadic pheochromocytoma when CT findings are normal.

  12. Subchronic toxicity and mutagenicity/genotoxicity studies of Irvingia gabonensis extract (IGOB131).

    Science.gov (United States)

    Kothari, Shil C; Shivarudraiah, Prasad; Venkataramaiah, Suresh Babu; Gavara, Swapna; Soni, Madhu G

    2012-05-01

    African Bush Mango from Irvingia gabonensis is a West African culinary fruit and the mucilage from this fruit seed is used to make traditional soups and sauces. Extract from the kernel (IGOB131) has been claimed for its health benefits. In the present investigations, potential adverse effects, if any, of IGOB131 were investigated in dose-response 90-day study and genotoxicity studies. In the subchronic study, Sprague Dawley rats (20/sex/group) were gavaged with I. gabonensis extract (IGOB131) at dose levels of 0, 100, 1000 and 2500 mg/kg body weight (bw)/day for 90-days. No treatment-related changes in clinical signs, functional observations, mortality, ophthalmologic observations, body weights, body weight gain or feed consumption were noted. Similarly, hematological, clinical chemistry, urine analysis parameters, and organ weights did not reveal any toxicologically significant treatment-related changes. No treatment-related macroscopic and microscopic abnormalities were noted at the end of treatment period. The mutagenicity as evaluated by Ames assay, in vitro and in vivo chromosomal aberration test and in vivo micronucleus assay did not reveal any genotoxicity of IGOB131. The results of subchronic toxicity study suggest the no-observed-adverse-effect level (NOAEL) for I. gabonensis extract (IGOB131) as ≥ 2500 mg/kg bw/day, the highest dose tested. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Detection of multiple endocrine tumours using {sup 131}I-MIBG

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, C.A. [Royal Brisbane Hospital, Herston, QLD (Australia). Department of Nuclear Medicine

    1998-03-01

    Full text: An {sup 131}l-MIBG scan was requested in an effort to locate an endocrine tumour after the patient presented with a history of funny turns, intermittent hypertension and elevated urinary catecholamines. The patient was injected with {sup 131}l-MIBG, and scanned 48 and 72 hours post-injection. Anterior and posterior static images of the torso identified several abnormal accumulations of {sup 131}l-MIBG. To help with the diagnosis a {sup 99}mTc-MPP scan followed. Blood pool images showed areas of intense activity matching some of the abnormalities on the {sup 131}l-MIBG scan. The delayed images were unremarkable. Some of these abnormalities were palpable on physical examination and the patient was aware of these lesions since childhood. Surgical excision of five tumours was performed. Histology of {sup 131}l tumours confirmed the diagnosis of ganglioneuroma. The nuclear medicine scans successfully identified the location and type of tumour responsible for the patient``s hormonal problems.

  14. False-positive I-131 scan by contaminated muffler in a patient with thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Han Kyung; Kim, Min Woo; Jeong, Hwan Jeong; Sohn, Myung Hee [Chonbuk National University Hospital, Chonju (Korea, Republic of)

    2006-02-15

    A 39-year-old female patient who had undergone a total thyroidectomy for a papillary thyroid carcinoma underwent a whole body scan with I-131. The I-131 scan was performed 72 hours after administering 185 MBq (5 mGi) of an I-131 solution. The anterior image of head, neck, and upper chest showed multiple areas of increased uptake in the mediastinal area considering of functional metastasis. However, radioactivity was not evident in the image taken after removing her clothes and muffler. The image obtained after placing the muffler on the pallet showed that the radioactivity was still present. It is well known that artifacts on an I-131 scan can be produced by styling hair sputum, drooling during sleep, chewing gum, and paper or a cloth handkerchief that is contaminated with the radioactive iodine from either perspiration or saliva. This activity might be mistaken for a functional metastasis. Therefore, it is essential that an image be obtained after removing the patient's clothes. In this study, artifacts due to a contaminated muffler on the I-131 scan were found. These mimicked a functional metastasis of the mediastinal area in a patient with a papillary thyroid carcinoma.

  15. Complexation of lactate with neodymium(III) and europium(III) at variable temperatures: studies by potentiometry, microcalorimetry, optical absorption, and luminescence spectroscopy.

    Science.gov (United States)

    Tian, Guoxin; Martin, Leigh R; Rao, Linfeng

    2010-11-15

    The complexation of neodymium(III) and europium(III) with lactate was studied at variable temperatures by potentiometry, absorption spectrophotometry, luminescence spectroscopy, and microcalorimetry. The stability constants of three successive lactate complexes (ML(2+), ML(2)(+), and ML(3)(aq), where M stands for Nd and Eu and L stands for lactate) at 10, 25, 40, 55, and 70 °C were determined. The enthalpies of complexation at 25 °C were determined by microcalorimetry. Thermodynamic data show that the complexation of trivalent lanthanides (Nd(3+) and Eu(3+)) with lactate is exothermic and the complexation becomes weaker at higher temperatures. Results from optical absorption and luminescence spectroscopy suggest that the complexes are inner-sphere chelate complexes in which the protonated α-hydroxyl group of lactate participates in the complexation.

  16. Selective separation of americium from europium using 2,9-bis(triazine)-1,10-phenanthrolines in ionic liquids: a new twist on an old story.

    Science.gov (United States)

    Williams, Neil J; Dehaudt, Jérémy; Bryantsev, Vyacheslav S; Luo, Huimin; Abney, Carter W; Dai, Sheng

    2017-02-28

    Bis-triazine phenanthrolines have shown great promise for f-block metal separations, attributable to their highly preorganized structure, nitrogen donors, and more enhanced covalent bonding with actinides over lanthanides. However, their limited solubility in traditional solvents remains a technological bottleneck. Herein we report our recent work using a simple 2,9-bis(triazine)-1,10-phenanthroline (Me-BTPhen) dissolved in an ionic liquid (IL), demonstrating the efficacy of IL extraction systems for the selective separation of americium from europium, achieving separation factors in excess of 7500 and selectively removing up to 99% of the americium. Characterization of the coordination environment was performed using a combination of X-ray absorption fine structure spectroscopy (XAFS) and density functional theory (DFT) calculations.

  17. Experimental and Theoretical Studies on the Structure and Photoluminescent Properties of New Mononuclear and Homodinuclear Europium(III β-Diketonate Complexes

    Directory of Open Access Journals (Sweden)

    João P. Martins

    2015-01-01

    Full Text Available Two novel europium(III complexes, a monomer and a homodimer, with 1-(4-chlorophenyl-4,4,4-trifluoro-1,3-butanedione (Hcbtfa and 5-chloro-1,10-phenanthroline (cphen ligands, formulated as [Eu(cbtfa3(cphen] and [Eu2(cbtfa4(cphen2(CH3O2], have been synthesized. Their structures have been elucidated by X-ray diffraction and their absorption and emission properties have been studied in the solid state. The experimental data has then been used to test the recently released LUMPAC software, a promising tool which can facilitate the design of more efficient lanthanide light-conversion molecular devices by combining ground state geometry, excited state energy, and luminescent properties calculations.

  18. Optical Temperature Probe Based on the Fluorescence Decay Time of Tris-(dibenzoylmethane mono (5-amino-1,10-phenanthroline-europium(III

    Directory of Open Access Journals (Sweden)

    Hung T. LAM

    2010-08-01

    Full Text Available The measurement of temperature is essential in defining the physical and chemical properties of any system. This is particularly true in dynamic systems where the temperature may fluctuate during the process. In this paper we investigated the potential of tris-(dibenzoylmethane mono (5-amino-1, 10-phenanthroline-europium(III ( Eu[tdap] as an optical temperature probe. The principle of the measurement is based on the temperature dependence of the fluorescence decay time of Eu(tdap embedded in polystyrene. Within the investigated temperature range between 3 and 70°C a linear correlation between temperature and decay time was found. The probe is accurate and repeatable and there is no cross-sensitivity to pH changes. Continuous measurement for more than 2.5 hours at which the temperature is switched between two different temperatures shows no signal drift. The relative standard deviation is less than 0.65 percent.

  19. Crystal structure and luminescence of a europium coordination polymer {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞

    Science.gov (United States)

    Li, X.; Zheng, X.; Jin, L.; Lu, S.; Qin, W.

    2000-02-01

    The structure of the complex [Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy) ( m-MOBA: m-methoxybenzoate, 4,4'-bpy: 4,4'-bipyridine) was determined by single crystal X-ray diffraction. The bonding around each europium consists of two oxygen atoms of the chelated carboxyl group, two oxygen atoms of two water molecules and four oxygen atoms of the bidentate bridging carboxylate groups, forming an infinite polymeric chain structure. The luminescence behaviour of Eu 3+ in {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞ was observed at 77 K. The emission spectra of 5D 1→ 7F J ( J=1-3) and 5D 0→ 7F J ( J=0-4) transitions were recorded. The complex displays intense luminescence which may be related to the m-MOBA ligand and the polymeric coordination.

  20. Optimization of the therapeutic dose of {sup 131}I for thyroid differentiated carcinoma; Otimizacao da dose terapeutica com {sup 131}I para carcinoma diferenciado da tiroide

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Fabiana Farias de

    2002-09-01

    I-131 thyroid cancer therapy is based on the strategy of concentrating radioactive iodine in the thyroid tissue, to completetly eliminate thyroid tissue and functioning thyroid cancer metastases remaining after thyroidectomy. In Brazil, fixed activities of {sup 131} I generally are given, sometimes either delivering insufficient activities to ablate all of the remnants, or unnecessarily high activities, with patients remaining in the hospital for some period of time. This investigation proposes a protocol of individualized planning of ablative doses, based on individual patients metabolisms and measured thyroid remnant masses. Simulated thyroid remnants were fabricated in various forms, volumes and activities, and optimum image acquisition parameters were determined using Single-Photon Emission Computed Tomography 9SPECT). Resultant images were evaluated, to determine the apparent volumes and the {sup 131} I concentrations. I-131 metabolism was studied in 9 patients who had undergone thyroidectomies. Their thyroid remnant masses were determined applying the same parameters used in SPECT simulation studies, and the optimum activity for their therapy was calculated and compared to the established fixed activity of 3.7 GBq (100 mCi), which would have normally been assigned. Background subtraction using the method of percent maximum counts, using a value of 67.5%, combined with scatter correction (triple energy window method), was shown to be optimum for SPECT quantification of volumes between 3-10 ml. Errors in the method were below 9% for sources with regular geometries and around 11% for sources with irregular geometries. In the patient studies, it was observed that 78% of patients could have received reduced activities of {sup 131} (from 0.8-3-2. GBq (20-87 nCi). In addition, 33% of these patients could have received low enough activities to have discharged from the hospital, using an individualized administration scheme. This could also have resulted in a dose

  1. Melanoma vectorized radiotherapy: preclinical evaluation of a new marker labelled by iodine 131; Radiotherapie vectorisee du melanome: evaluation preclinique d un nouveau vecteur marque par l iode 131

    Energy Technology Data Exchange (ETDEWEB)

    Bonnet, M.; Papon, J.; Miot-Noirault, E.; Madelmont, J.C.; Chezal, J.M.; Moins, N. [INSERM/UdA, EA4231, UMR 990, 63 - Clermont Ferrand (France); Mishellany, F.; Penault-Llorca, F.; Cayre, A. [laboratoire d anatomopathologie, CJP, 63 - Clermont-Ferrand (France)

    2010-05-15

    A significant anti tumoral effect of the internal vectorized radiotherapy using the compound {sup 131}I-ICF01012 is demonstrated on different models of melanomas, whatever be their aggressive potential, the quantity and localisation of the melanoma target. this effect is associated to an inhibition of the tumors cells dissemination towards lungs. The optimization of the protocol therapy is underway to get a maximum therapy efficiency associated to a toxicity controlled on non target-organs. (N.C.)

  2. Place of synthesis anti thyroids in the hyperthyroidism treatment by iodine 131; Place des antithyroidiens de synthese dans le traitement par iode 131 des hyperthyroidies

    Energy Technology Data Exchange (ETDEWEB)

    Clerc, J. [Hopital Necker, 75 - Paris (France)

    2000-01-01

    The prescription of synthesis anti thyroids allows to get a fast control of hyperthyroidism when the average time of curing after iodine 131 varies from 6 to 12 weeks, according to the level of radiation doses. It allows to treat the patients in euthyroidism and to avoid aggravation of thyrotoxicosis in the following of the iodine and is particularly useful for the old patients with a cardio vascular risk.

  3. Synthesis and luminescence properties of two novel europium (III) perchlorate complexes with bis(benzylsulfinyl)methane and 1,10-phenanthroline

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail: nmglwx@163.com [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Guo, Feng [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-Fang; Feng, Shu-Yan; Bai, Juan; Xin, Xiao-Dong [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)

    2014-09-15

    Two novel binary and ternary Europium (III) perchlorate complexes were synthesized. The binary complex was prepared with bis(benzylsulfinyl)methane as ligand, and the ternary complex was with bis(benzylsulfinyl)methane as first ligand and 1,10-Phenanthroline as second ligand. They were characterized by element analysis, molar conductivity, coordination titration analysis, IR, TG-DSC, {sup 1}HNMR and UV spectra. The results indicated that the composition of binary and ternary complexes was EuL{sub 2.5}·(ClO{sub 4}){sub 3}·3H{sub 2}O and Eu{sub 2}L{sub 4}·phen·(ClO{sub 4}){sub 6}·12H{sub 2}O (L=C{sub 6}H{sub 5}CH{sub 2}SOCH{sub 2}SOCH{sub 2}C{sub 6}H{sub 5}), respectively. The fluorescent spectra illustrated that the complexes displayed characteristic Europium (III) ion fluorescence in solid state, indicating the ligands favored energy transfer to the excitation state energy level of it. The strongest characteristic fluorescence emission intensity of the ternary system was 1.87 times as strong as that of the binary system. The fluorescent quantum yields of the Eu (III) ternary and binary complexes were also calculated. Additionally, the phosphorescence spectra and the luminescence mechanisms of the complexes were studied and explained. - Highlights: • Two rare earth complexes are new. And they are stabilized. • The intensities of the two rare earth complexes were all stronger and the lifetimes were longer. • The introduction of the second organic ligand1,10-Phenanthroline enhanced the fluorescence intensity. • The fluorescent quantum yields of two complexes being calculated are both very high.

  4. Micronuclei induction by {sup 131}I exposure. Study in hyperthyroidism patients

    Energy Technology Data Exchange (ETDEWEB)

    Gutierrez, S.; Carbonell, E.; Creus, A.; Marcos, R. [Grup de Mutagenesi, Departament de Genetica i de Microbiologia, Edifici Cn, Universitat Autonoma de Barcelona, Bellaterra (Spain); Galofre, P. [Servei de Medicina Nuclear, Ciutat Sanitaria i Universitaria Vall d`Hebron, Barcelona (Spain)

    1997-01-03

    To evaluate the eventual genetic damage induced by therapeutic exposure to {sup 131}I, we have studied the presence of micronuclei (MN) in binucleated peripheral blood lymphocytes from a group of 28 hyperthyroidism patients who received {sup 131}I sodium iodide, via oral administration. The study was conducted over time and blood samples were obtained before the treatment, and 1 week, 1 month and 3 months after it. The results obtained indicate a positive relationship between dose and BNMN frequency as calculated by the linear regression coefficient, showing significant increases in the frequency of MN and BNMN (binucleated cells with MN) in the subgroup of patients that received more than 500 MBq. Taking into account that the patients studied were treated with relatively low doses of {sup 131}I, our positive results support the view that the MN assay is sensitive enough to monitor the chromosome damage resulting from the exposure.

  5. Breast ultrasound in 22,131 asymptomatic women with negative mammography.

    Science.gov (United States)

    Girardi, Veronica; Tonegutti, Mara; Ciatto, Stefano; Bonetti, Franco

    2013-10-01

    To evaluate increment cancer detection rate generated by ultrasound (US). US only detected cancers were assessed for 22,131 self-referring asymptomatic women with negative mammography and subgroups by age, previous cancer, breast density. Invasive assessment and surgical biopsy rate were evaluated. The overall US detection was 1.85 per thousand (41/22,131). In the subgroups it was: 1.95 per thousand (22/11,274) in women breasts (p = 0.17) vs 1.56 per thousand (19/12,171) in fatty breasts. The US generated invasive assessment was 1.9% (422/22,131). The benign to malignant open surgical biopsy ratio was 0.17 (7/41). Adding US to negative mammography allowed for substantial incremental cancer detection rate (1.85 per thousand), particularly at age breast cancer and in dense breasts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Transfer of /sup 131/I and /sup 95m/Tc from pasture to goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Bondietti, E.A.; Garten, C.T. Jr.

    1984-01-01

    Field measurements were made in 1983 on the transfer of /sup 131/I and /sup 95m/Tc from spray-contaminated pasture to goat's milk. The transfer of /sup 131/I to milk was similar to that used for mathematical models in US Nuclear Regulatory Commission Regulatory Guide 1.109, which was derived from stall-feeding experiments using capsulized doses. Compared to /sup 131/I, the /sup 95m/Tc transferred to milk was about 5600 times less. The lower transfer resulted from both immobilization of technetium on pasture prior to ingestion as well as reduced gastrointestinal absorption. The results show that the food chain transfer of technetium to milk is much less than that previously expected based on inferences made from metabolism studies. 6 references, 4 figures, 1 table.

  7. Radionuclide 131I-labeled multifunctional dendrimers for targeted SPECT imaging and radiotherapy of tumors

    Science.gov (United States)

    Zhu, Jingyi; Zhao, Lingzhou; Cheng, Yongjun; Xiong, Zhijuan; Tang, Yueqin; Shen, Mingwu; Zhao, Jinhua; Shi, Xiangyang

    2015-10-01

    We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and labeling of radioactive iodine-131 (131I). The generated multifunctional 131I-G5.NHAc-HPAO-PEG-FA dendrimers were characterized via different methods. We show that prior to 131I labeling, the G5.NHAc-HPAO-PEG-FA dendrimers conjugated with approximately 9.4 HPAO moieties per dendrimer are noncytotoxic at a concentration up to 20 μM and are able to target cancer cells overexpressing FA receptors (FAR), thanks to the modified FA ligands. In the presence of a phenol group, radioactive 131I is able to be efficiently labeled onto the dendrimer platform with good stability and high radiochemical purity, and render the platform with an ability for targeted SPECT imaging and radiotherapy of an FAR-overexpressing xenografted tumor model in vivo. The designed strategy to use the facile dendrimer nanotechnology may be extended to develop various radioactive theranostic nanoplatforms for targeted SPECT imaging and radiotherapy of different types of cancer.We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and

  8. Unexpected Uptake by the Gallbladder in Post-Ablative I-131 Scan

    Directory of Open Access Journals (Sweden)

    Kemal Ünal

    2015-06-01

    Full Text Available A 47-year-old woman was diagnosed as papillary thyroid carcinoma. I-131 ablation therapy was applied following total thyroidectomy, and the whole-body scan revealed a focus of increased uptake in the right upper quadrant. Lateral view images of the uptake site showed that the focus was located near the right liver lobe. The patient was referred to radiology department for correlative abdominal Computed Tomography (CT and Ultrasonography (US to rule out a possible liver metastasis. CT images detected a gallstone in the corresponding area, which was verified by US. These methods did not reveal any metastatic disease in the liver or in other abdominal organs. This is the first published case report documents a rare false-positive finding of I-131 scan that was associated with an asymptomatic gallstone, and emphasizes the importance of correlative imaging in gallbladder related I-131 uptake.

  9. Phenotypic Microarrays Suggest Escherichia coli ST131 Is Not a Metabolically Distinct Lineage of Extra-Intestinal Pathogenic E. coli

    OpenAIRE

    Alqasim, Abdulaziz; Emes, Richard; Clark, Gemma; Newcombe, Jane; La Ragione, Roberto; McNally, Alan

    2014-01-01

    Extraintestinal pathogenic E. coli (ExPEC) are the major aetiological agent of urinary tract infections (UTIs) in humans. The emergence of the CTX-M producing clone E. coli ST131 represents a major challenge to public health worldwide. A recent study on the metabolic potential of E. coli isolates demonstrated an association between the E. coli ST131 clone and enhanced utilisation of a panel of metabolic substrates. The studies presented here investigated the metabolic potential of ST131 and o...

  10. Therapy of hepatocellular carcinoma with iodine-131-lipiodol. Results in a large German cohort

    Energy Technology Data Exchange (ETDEWEB)

    Risse, J.H. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Rabe, C. [Univ. Clinic of Internal Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Pauleit, D. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Inst. of Medicine, Research Center Juelich (Germany); Reichmann, K.; Biersack, H.J.; Palmedo, H. [Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Menzel, C.; Gruenwald, F. [Univ. Clinic of Nuclear Medicine, Johann-Wolfgang-Goethe-Univ., Frankfurt am Main (Germany); Strunk, H. [Univ. Clinic of Radiology, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany)

    2006-07-01

    Aim: to evaluate the efficacy and tolerance of iodine-131-lipiodol ({sup 131}I-lipiodol) for hepatocellular carcinoma (HCC) in German long term patients and comparison with medically treated controls. Patients, Methods: 38 courses of intra-arterial {sup 131}I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC (6 with portal vein thrombosis). Liver and tumour volume and lipiodol deposition were measured by computed tomography and {sup 131}I activity by scintigraphy. Therapeutic efficacy was determined by tumour volume change and matched-pairs analysis in comparison to medically (i.e. tamoxifen or medical support) treated patients. Results: tumour volume decreased in 20/32 index nodules (63%) after the first course. Repeated therapy frequently resulted in further tumour reduction. Overall response to treatment was partial in 11 nodules, minor response in 4 nodules, and disease was stable in 12 and progressive in 5. Significant response was associated with pretherapeutic nodule volume up to 150 ml (diameter of 6.6 cm). Survival rate after 3, 6, 9, 12, 24 and 36 months was 78, 61, 50, 39, 17, and 6%. Matched-pairs analysis of survival revealed {sup 131}I-lipiodol to be superior to medical treatment. The most important side effect was a pancreatitis-like syndrome whereas overall tolerance was good. Conclusions: The long term results confirm that HCC therapy with {sup 131}I-lipiodol is effective and probably superior to medical treatment. Tumour nodules of up to 6 cm diameter are well suited for this therapy even in the presence of portal vein thrombosis. (orig.)

  11. S values for 131I based on the ICRP adult voxel phantoms.

    Science.gov (United States)

    Lamart, Stephanie; Simon, Steven L; Bouville, Andre; Moroz, Brian E; Lee, Choonsik

    2016-01-01

    To improve the estimates of organ doses from nuclear medicine procedures using (131)I, the authors calculated a comprehensive set of (131)I S values, defined as absorbed doses in target tissues per unit of nuclear transition in source regions, for different source and target combinations. The authors used the latest reference adult male and female voxel phantoms published by the International Commission on Radiological Protection (ICRP Publication 110) and the (131)I photon and electron spectra from the ICRP Publication 107 to perform Monte Carlo radiation transport calculations using MCNPX2.7 to compute the S values. For each phantom, the authors simulated 55 source regions with an assumed uniform distribution of (131)I. They computed the S values for 42 target tissues directly, without calculating specific absorbed fractions. From these calculations, the authors derived a comprehensive set of S values for (131)I for 55 source regions and 42 target tissues in the ICRP male and female voxel phantoms. Compared with the stylised phantoms from Oak Ridge National Laboratory (ORNL) that consist of 22 source regions and 24 target regions, the new data set includes 1662 additional S values corresponding to additional combinations of source-target tissues that are not available in the stylised phantoms. In a comparison of S values derived from the ICRP and ORNL phantoms, the authors found that the S values to the radiosensitive tissues in the ICRP phantoms were 1.1 (median, female) and 1.3 (median, male) times greater than the values based on the ORNL phantoms. However, for several source-target pairs, the difference was up to 10-fold. The new set of S values can be applied prospectively or retrospectively to the calculation of radiation doses in adults internally exposed to (131)I, including nuclear medicine patients treated for thyroid cancer or hyperthyroidism. Published by Oxford University Press 2015. This work is written by (a) US Government employee(s) and is in the

  12. Cardiac 131I-MIBG scintigraphy in patients with multiple system atrophy

    Directory of Open Access Journals (Sweden)

    Li WANG

    2014-03-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG can be intaked by cardiac sympathetic postganglionic fibre, thus becomes the imaging agent to evaluate cardiac sympathetic nerve function. The aim of this study is to investigate the autonomic nerve dysfunction of patients with multiple system atrophy (MSA by using cardiac 131I-MIBG scintigraphy.  Methods Clinical data of 12 MSA patients conforming to the "secord consensus statement on the diagnosis of MSA" was analyzed by Unified Multiple System Atrophy Rating Scale (UMSARS. 131I-MIBG scintigraphy was performed in 12 MSA patients and 7 age-matched controls. Planar images of the chest were obtained 15 min, 4 h and 24 h after the intravenous injection of 3 mCi 13131I-MIBG. Cardiac 131I-MIBG uptake was quantified by comparing region of interest (ROI over heart/mediastinum (H/M ratio.  Results Cardiac 131131I-MIBG uptake ratio in MSA group was significantly less than that in control group in 15 min (1.90 ± 0.41 vs 2.38 ± 0.32, P = 0.017 and 4 h (1.96 ± 0.63 vs 2.60 ± 0.55, P = 0.039. There were significant difference (P < 0.05 between MSA group and control group.  Conclusions Cardiac 131I-MIBG uptake ratio in MSA group was less than that in control group. This finding suggests cardiac sympathetic degeneration may occur in MSA patients. doi: 10.3969/j.issn.1672-6731.2014.03.018

  13. {sup 131}I-induced changes in rat thyroid gland function

    Energy Technology Data Exchange (ETDEWEB)

    Torlak, V.; Capkun, V.; Stanicic, A. [Clinical Hospital Split, Split (Croatia). Dept. of Nuclear Medicine; Zemunik, T. [University of Split, Split (Croatia). Dept. of Medical Biology]. E-mail: tzemunik@bsb.mefst.hr; Modun, D. [University of Split, Split (Croatia). Dept. of Pharmacology; Pesutic-Pisac, V. [Clinical Hospital Split, Split (Croatia). Dept. of Pathology; Markotic, A. [University of Split, Split (Croatia). School of Medicine. Dept. of Biochemistry; Pavela-Vrancic, M. [University of Split, Split (Croatia). Faculty of Natural Sciences. Dept. of Chemistry

    2007-08-15

    Therapeutic doses of {sup 131}I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of {sup 131}I (64-277 {mu}Ci). Thirty male Fisher rats in the experimental group and 30 in the control group (untreated) were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before {sup 131}I administration (4-month-old animals) and three times following {sup 131}I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 {+-} 8.16 to 55.0 {+-} 6.1 nM in the control group and from 69.4 {+-} 6.9 to 25.4 {+-} 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after {sup 131}I administration to rats, which was not {sup 131}I dose dependent. (author)

  14. 131I therapy for 345 patients with refractory severe hyperthyroidism: Without antithyroid drug pretreatment.

    Science.gov (United States)

    Ding, Yong; Xing, Jialiu; Fang, Yi; Wang, Yong; Zhang, Youren; Long, Yahong

    2016-02-01

    The aim of this study is to evaluate the safety and long-term results of (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment. From January 2002 to December 2012, 408 patients with refractory severe hyperthyroidism were treated with (131)I alone. Among them, 345 were followed up for 1 to 10 years for physical examination, thyroid function, and thyroid ultrasound. Complete Blood Count (CBC) liver function, electrocardiogram, echocardiogram, and Emission Computed Tomography (ECT) thyroid imaging were performed as indicated. The 345 patients had concomitant conditions including thyrotoxic heart disease, severe liver dysfunction, enlarged thyroid weighing 80 to 400 g, severe cytopenia, and vasculitis. One to two weeks prior to (131)I therapy, all patients were given low-iodine diet. The dose of (131)I therapy was 2.59 to 6.66 MBq (70 to180 µCi) per gram of thyroid with an average of 3.83 ± 0.6 MBq (103.6 ± 16.4 µCi); and the total (131)I activity administrated for the individuals was 111 to 3507.6 MBq (3.0 to 94.8 mCi, mean 444 ± 336.7 MBq (12.0 ± 9.1 mCi)). Out of the 408 patients, 283 were cured, 15 with complete remission, and 47 with incomplete remission. No treatment failure or significant clinical worsening was noted in these patients. Our data indicated that (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment is safe and effective. © 2015 by the Society for Experimental Biology and Medicine.

  15. 131I therapy for 345 patients with refractory severe hyperthyroidism: Without antithyroid drug pretreatment

    Science.gov (United States)

    Xing, Jialiu; Fang, Yi; Wang, Yong; Zhang, Youren; Long, Yahong

    2015-01-01

    The aim of this study is to evaluate the safety and long-term results of 131I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment. From January 2002 to December 2012, 408 patients with refractory severe hyperthyroidism were treated with 131I alone. Among them, 345 were followed up for 1 to 10 years for physical examination, thyroid function, and thyroid ultrasound. Complete Blood Count (CBC) liver function, electrocardiogram, echocardiogram, and Emission Computed Tomography (ECT) thyroid imaging were performed as indicated. The 345 patients had concomitant conditions including thyrotoxic heart disease, severe liver dysfunction, enlarged thyroid weighing 80 to 400 g, severe cytopenia, and vasculitis. One to two weeks prior to 131I therapy, all patients were given low-iodine diet. The dose of 131I therapy was 2.59 to 6.66 MBq (70 to180 µCi) per gram of thyroid with an average of 3.83 ± 0.6 MBq (103.6 ± 16.4 µCi); and the total 131I activity administrated for the individuals was 111 to 3507.6 MBq (3.0 to 94.8 mCi, mean 444 ± 336.7 MBq (12.0 ± 9.1 mCi)). Out of the 408 patients, 283 were cured, 15 with complete remission, and 47 with incomplete remission. No treatment failure or significant clinical worsening was noted in these patients. Our data indicated that 131I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment is safe and effective. PMID:26341470

  16. Therapy of hepatocellular carcinoma with iodine-131-lipiodol. Results in a large German cohort.

    Science.gov (United States)

    Risse, J H; Rabe, C; Pauleit, D; Reichmann, K; Menzel, C; Grünwald, F; Strunk, H; Biersack, H-J; Palmedo, H

    2006-01-01

    To evaluate the efficacy and tolerance of iodine-131-lipiodol ((131)I-lipiodol) for hepatocellular carcinoma (HCC) in German long term patients and comparison with medically treated controls. 38 courses of intra-arterial (131)I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC (6 with portal vein thrombosis). Liver and tumour volume and lipiodol deposition were measured by computed tomography and (131)I activity by scintigraphy. Therapeutic efficacy was determined by tumour volume change and matched-pairs analysis in comparison to medically (i.e. tamoxifen or medical support) treated patients. Tumour volume decreased in 20/32 index nodules (63%) after the first course. Repeated therapy frequently resulted in further tumour reduction. Overall response to treatment was partial in 11 nodules, minor response in 4 nodules, and disease was stable in 12 and progressive in 5. Significant response was associated with pretherapeutic nodule volume up to 150 ml (diameter of 6.6 cm). Survival rate after 3, 6, 9, 12, 24 and 36 months was 78, 61, 50, 39, 17, and 6%. Matched-pairs analysis of survival revealed (131)I-lipiodol to be superior to medical treatment. The most important side effect was a pancreatitis-like syndrome whereas overall tolerance was good. The long term results confirm that HCC therapy with (131)I-lipiodol is effective and probably superior to medical treatment. Tumour nodules of up to 6 cm diameter are well suited for this therapy even in the presence of portal vein thrombosis.

  17. Preparation and preclinical evaluation of 131 I-trastuzumab for breast cancer.

    Science.gov (United States)

    Kameswaran, Mythili; Gota, Vikram; Ambade, Rajwardhan; Gupta, Sudeep; Dash, Ashutosh

    2017-01-01

    Trastuzumab that targets the human epidermal growth factor receptor type 2 (HER2) is known to benefit patients with HER2+ metastatic breast cancer. The objective was to explore the potential of 131 I-trastuzumab for treatment of breast cancers. Radioiodination of trastuzumab was carried out by chloramine-T method, purified by using PD-10 column, and characterized by size exclusion high-performance liquid chromatography on a gel column. In vitro studies were carried out in HER2+ cells to determine the specificity of the radioimmunoconjugate. Uptake and retention of 131 I-trastuzumab were determined by biodistribution studies in tumor-bearing non-obese diabetic/severe combined immunodeficiency and normal severe combined immunodeficiency mice. The radiochemical purity (RCP) of 131 I-trastuzumab was 98 ± 0.4% with retention time of 17 minutes by high-performance liquid chromatography. In vitro stability studies exhibited RCP of more than 90% in serum at 37°C after 120 hours of radioiodination. In vitro cell binding with 131 I-trastuzumab in HER2+ cells showed binding of 28% to 35% which was inhibited significantly, with unlabeled trastuzumab confirming its specificity. Kd value of 131 I-trastuzumab was 0.5 nM, while its immunoreactivity was more than 80%. Uptake of more than 12% and retention were observed in the tumors up to 120 hours p.i. 131 I-trastuzumab prepared in-house-exhibited RCP of more than 98%, excellent immunoreactivity, affinity to HER2+ cell lines and good tumor uptake thereby indicating its potential for further evaluation in HER2+ breast cancers. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Anatomical location of cervical uptake areas after total thyroidectomy with {sup 131}Iodine - SPECT-CT

    Energy Technology Data Exchange (ETDEWEB)

    Torres, Ivone do Carmo Goncalves; Lima, Eduardo Nobrega Pereira; Carvalho, Andre Lopes; Cavicchioli, Marcelo; Martinez, Iris do Carmo da Costa; Bitencourt, Almir Galvao Vieira [Hospital A.C. Camargo, Sao Paulo, SP (Brazil)

    2012-07-01

    Objective: The purpose of this study was to evaluate the use of SPECT-CT for the determination of the anatomical locations of the cervical {sup 131}Iodine uptake areas during {sup 131}Iodine-whole body ({sup 131}I-WB) scans. Methods: One hundred fifty-four patients who had undergone total thyroidectomy for differentiated thyroid carcinoma (DTC) and had {sup 13I}-WB scan with cervical uptake images were studied with SPECT-CT, from March 2003 to October 2006. Results: From the 154 patients included, 124 were women (80.5%) and the mean age of 46.09 {+-} 14.77 years. {sup 131}I-WB was performed 1-2 months after surgery in 137 patients (89.0%). The percentage of cervical uptake found varied between 0.1 and 15.0% and its mean was 1.42 {+-} 2.05%. Using SPECT-CT, 223 foci of cervical {sup 131}Iodine uptake (CIU) were identified in 154 patients. CIU foci were localized to the thyroid bed in 17 patients, while 29 patients presented with CIU in the thyroid bed and the extra thyroid tissue and in both the thyroid bed and extra thyroid tissues in another 29 patients. In the remaining 108 subjects, the CIU were located outside of the thyroid bed, of which the most common locations were the sternothyroid muscle and the thyroid cartilage. Conclusions: The use of SPECT-CT demonstrated significant diversity in the anatomical locations of CIU foci observed during {sup 131}I-WB scans after thyroidectomy for DTC. (author)

  19. Use of I-131- CRTX for targeting malignant adenocarcinoma in mice: biodistribution and radiation dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Raquel Gouvea dos; Soares, Marcella Araugio; Andrade, Henrique Martins de, E-mail: santosr@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Santos, Marcos Antonio da Cunha [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Estatistica

    2008-07-01

    Snake venoms molecules have been shown to play a role not only in the survival and proliferation of tumour cells but also in the processes of tumour cell adhesion, migration and angiogenesis. We have shown that {sup 125}I-Crtx, a radiolabeled version of a protein derived from Crotalus durissus terrificus snake venom (Cdt), specifically binds to tumor and triggers apoptotic death. This study reports the biokinetic profile of {sup 99m}Tc-Cdt and {sup 125/131}I-Crtx in Swiss mice bearing Ehrlich solid tumor and MIRD formulation was applied to calculate the absorbed radiation doses for various organs and tumor site. Biokinetic evaluations were performed up to 24 h after intravenous (i.v) or intratumor (i.tu.) injection of {sup 99m}Tc-Cdt or {sup 125/131}I-Crtx. Time-activity curves were generated for the main organs by fitting the organ specific mass mean counts. The radiation dose from {sup 131}I-Crtx was calculated based on non penetrating radiation in the mouse model. Biokinetics data from {sup 99m}Tc-Cdt after i.v. injection in mice tumor model showed rapid blood clearance (T{sub 1/2}= 36.1 ± 2.4 min.), slow tumor clearance (T{sub 1/2}: 108.3 ± 19.5 min.) and indicated the kidneys as the main excretion pathway. Interaction studies in vitro demonstrated that {sup 125}I-Crtx recognize specific sites on Erlich tumor cell membrane. Upon intravenous and intratumor administration of {sup 131}I-Crtx in mice bearing Erlich tumor, it was observed high uptake in tumor site in vivo (Ã =72kBq x h/g) resulting in a high absorbed dose radiation to tumor site. Distributions of {sup 125/131}I-Crtx i.v. were only significant in tumor, stomach, liver and kidneys, reflecting non-specific uptake of Crtx in normal excretion tissues in vivo. Intratumoral administration reduced significantly the radiation dose to the kidneys (42-fold lower) and increased the uptake by the tumor site (128- fold higher). {sup 131}I control was run in a parallel experiment and showed no significant tumor

  20. Internal dosimetry of nuclear medicine workers through the analysis of {sup 131}I in aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Gomes C, L.; Lucena, E. A.; Da Silva S, C.; Almeida D, A. L.; Oliveira S, W.; Souza S, M.; Maranhao D, B., E-mail: carneiro@ird.gov.br [Instituto de Radioprotecao e Dosimetria - CNEN, Av. Salvador Allende s/n, 22783-127 Rio de Janeiro (Brazil)

    2014-08-15

    {sup 131}I is widely used in nuclear medicine for diagnostic and therapy of thyroid diseases. Depending of workplace safety conditions, routine handling of this radionuclide may result in a significant risk of exposure of the workers subject to chronic intake by inhalation of aerosols. A previous study including in vivo and in vitro measurements performed recently among nuclear medicine personnel in Brazil showed the occurrence of {sup 131}I incorporation by workers involved in the handling of solutions used for radioiodine therapy. The present work describes the development, optimization and application of a methodology to collect and analyze aerosol samples aiming to assess internal doses based on the activity of {sup 131}I present in a radiopharmacy laboratory. Portable samplers were positioned at one meter distant from the place where non-sealed liquid sources of {sup 131}I are handled. Samples were collected over one hour using high-efficiency filters containing activated carbon and analyzed by gamma spectrometry with a high purity germanium detection system. Results have shown that, although a fume hood is available in the laboratory, {sup 131}I in the form of vapor was detected in the workplace. The average activity concentration was found to be of 7.4 Bq /m{sup 3}. This value is about three orders of magnitude below the Derived Air Concentration (Dac) of 8.4 kBq/m{sup 3}. Assuming that the worker is exposed by inhalation of iodine vapor during one hour, {sup 131}I concentration detected corresponds to an intake of 3.6 Bq which results in a committed effective dose of 7.13 x 10{sup -5} mSv. These results show that the radiopharmacy laboratory evaluated is safe in terms of internal exposure of the workers. However it is recommended that the presence of {sup 131}I should be periodically re-assessed since it may increase individual effective doses. It should also be pointed out that the results obtained so far reflect a survey carried out in a specific

  1. Internal dosimetry of nuclear medicine workers through the analysis of (131)I in aerosols.

    Science.gov (United States)

    Carneiro, Luana Gomes; de Lucena, Eder Augusto; Sampaio, Camilla da Silva; Dantas, Ana Letícia Almeida; Sousa, Wanderson Oliveira; Santos, Maristela Souza; Dantas, Bernardo Maranhão

    2015-06-01

    (131)I is widely used in nuclear medicine for diagnostic and therapy of thyroid diseases. Depending of workplace safety conditions, routine handling of this radionuclide may result in a significant risk of exposure of the workers subject to chronic intake by inhalation of aerosols. A previous study including in vivo and in vitro measurements performed recently among nuclear medicine personnel in Brazil showed the occurrence of (131)I incorporation by workers involved in the handling of solutions used for radioiodine therapy. The present work describes the development, optimization and application of a methodology to collect and analyze aerosol samples aiming to assess internal doses based on the activity of (131)I present in a radiopharmacy laboratory. Portable samplers were positioned at one meter distant from the place where non-sealed liquid sources of (131)I are handled. Samples were collected over 1h using high-efficiency filters containing activated carbon and analyzed by gamma spectrometry with a high-purity germanium detection system. Results have shown that, although a fume hood is available in the laboratory, (131)I in the form of vapor was detected in the workplace. The average activity concentration was found to be of 7.4Bq/m(3). This value is about three orders of magnitude below the Derived Air Concentration (DAC) of 8.4kBq/m(3). Assuming that the worker is exposed by inhalation of iodine vapor during 1h, (131)I concentration detected corresponds to an intake of 3.6Bq which results in a committed effective dose of 7.13×10(-5)mSv. These results show that the radiopharmacy laboratory evaluated is safe in terms of internal exposure of the workers. However it is recommended that the presence of (131)I should be periodically re-assessed since it may increase individual effective doses. It should also be pointed out that the results obtained so far reflect a survey carried out in a specific workplace. Thus, it is suggested to apply the methodology

  2. Die Psalms: soorte, funksie, aard en die omdigting van Psalm 131

    Directory of Open Access Journals (Sweden)

    C.J.A. Vos

    2002-08-01

    Full Text Available Psalms: types, function, character and the versification of Psalm 131 The publishing of Liedboek van die kerk (2001 has emphasised the importance of the Psalms for the liturgy and the hymnology. This article considers the following aspects: the bridge function of the psalms; the significance and function of the psalms as an open hymnbook and as an anthology; and the literary types found in the psalms. The structure and form of Psalm 131 are analysed in greater detail. This analysis leads in conclusion to a literary evaluation of its versification by T.T. Cloete.

  3. Measurement of the thyroid's iodine absorption utilizing minimal /sup 131/I dose

    Energy Technology Data Exchange (ETDEWEB)

    Paz A, B.; Villegas A, J.; Delgado B, C. (Universidad Nacional San Agustin de Arequipa (Peru). Departamento de Bioquimica)

    1981-03-01

    We utilize a minimal dose of /sup 131/I thus limiting the contact of the thyroid tissues with the isotopic materials to determine the absorption of /sup 131/I by the thyroid from 6 to 24 hours in 90 pupils of the locality of Arequipa. The average rate of absorption in 6 and 24 hours in the case considered are of 24.15% and 35.42% respectively, with a standard deviation of 6.93% and 9.61%. No significant differences were reported from the results of those of adults and our own results in all the probes which were undertaken.

  4. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives.

    Science.gov (United States)

    Dasari, Srikanth; Patra, Ashis K

    2015-12-14

    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  5. Application of a room temperature ionic liquid for nuclear spent fuel reprocessing: speciation of trivalent europium and solvatation effects; Application d'un liquide ionique basse temperature pour les procedes de separation: speciation de l'europium trivalent et effets solvatation

    Energy Technology Data Exchange (ETDEWEB)

    Moutiers, G.; Mekki, S. [CEA Saclay, Dept. de Physico-Chimie, Service de Chimie Physique, 91 - Gif sur Yvette (France); Billard, I. [IN2P3/CNRS, 69 - Villeurbanne (France)

    2007-07-01

    One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf{sub 2}N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf{sub 2}N for the whole thesis and start with

  6. Stimulation with 0.3-mg recombinant human thyrotropin prior to iodine 131 therapy to improve the size reduction of benign nontoxic nodular goiter

    DEFF Research Database (Denmark)

    Nielsen, Viveque Egsgaard; Bonnema, Steen Joop; Boel-Jørgensen, Henrik

    2006-01-01

    ) were randomized to receive either 0.3 mg of recombinant human thyrotropin (n = 28) or placebo (n = 29) 24 hours before (131)I therapy. The (131)I dose was calculated based on thyroid size (measured by ultrasound), thyroid (131)I uptake, and (131)I half-life. The follow-up period was 1 year and included......BACKGROUND: Use of recombinant human thyrotropin increases the thyroid radioiodine (iodine 131 [(131)I]) uptake and may have a role in the context of (131)I therapy of benign goiter. METHODS: In a double-blind, placebo-controlled trial, 57 patients with nodular nontoxic goiter (51 women and 6 men......: Stimulation with recombinant human thyrotropin prior to (131)I therapy improves thyroid size reduction by 35%, with a 5-fold higher rate of hypothyroidism. These effects are, at least partially, mediated through mechanisms other than an increase in retained (131)I thyroid dose. Further recombinant human...

  7. Extraction, radiolabeling and in vivo biological evaluation of {sup 131}I labeled egonol glycosides extract

    Energy Technology Data Exchange (ETDEWEB)

    Akguel, Yurdanur; Pazar, Erdinc [Ege Univ., Izmir (Turkey). Chemistry Dept.; Yilmaz, Habibe; Sanlier, Senay Hamarat [Ege Univ., Izmir (Turkey). Biochemistry Dept.; Lambrecht, Fatma Yurt [Ege Univ., Izmir (Turkey). Dept. of Nuclear Applications; Yilmaz, Osman [Dokuz Eyluel Univ., Izmir (Turkey). Dept. of Lab. Animal Science

    2015-09-01

    Crude extract of S. officinalis L. was found to have suspending agent, hemolytic, antitumor, antioxidant and antimicrobial activities. Its major components benzofurans and benzofuran glycosides have antifungal, anticancer, antibacterial and anticomplement activities and display acetylcholinesterase-cyclooxygenase inhibitory and cytotoxic properties. Recently, it has been reported that egonolgentiobioside is a valuable target for structural modification and warrants further investigation for its potential as a novel pharmaceutical tool for the prevention of estrogen deficiency induced diseases. The aim of the current study is to perform in vivo biological evaluation of a glycosides extract, which was isolated from the fruits endocarp of Styrax officinalis L, identified as egonolgentiobioside and homoegonolgentiobioside and labeled with {sup 131}I. The radiolabeled glycosides extract was labeled with {sup 131}I with high yield. The labeled obtained radiolabeled compound was found to be quite stable and lipophilic. In order to determine its tissue distribution, an in vivo study was performed using healthy female Albino Wistar rats injected by {sup 131}I-glycosides. The biodistribution results showed that clearance of the radiolabeled compound is through the hepatobiliary pathway. The experimental study indicated that the radiolabeled glycosides extract accumulated in the large intestine. Therefore, the potential of {sup 131}I-glycosides might be evaluated in colon cancer cell lines and this might be a promising of tumor-imaging agent.

  8. Hyper-reactive PMNs in Fc gamma RIIa 131 H/H genotype periodontitis patients

    NARCIS (Netherlands)

    Nicu, E A; Van der Velden, U; Everts, V; Van Winkelhoff, A J; Roos, D; Loos, B G

    2007-01-01

    Background: Receptors for the Fc part of IgG (Fc gamma RIIa) on polymorphonuclear leukocytes (PMN) mediate phagocytosis and cell activation. Previous results show that one of the genetic variants of the Fc gamma RIIa, the 131 H/H, is associated with more periodontal breakdown than the R/R. This may

  9. Differences in the dry deposition of gaseous elemental I-131 to several leafy vegetable species

    Energy Technology Data Exchange (ETDEWEB)

    Shinonaga, T.; Heuberger, H.; Tschiersch, J. [GSF-National Research Center for Environment and Health, Institute of Radiation Protection, Neuherberg, Germany, IAEA Laboratories, Seibersdorf (Austria)

    2004-07-01

    The height of the dry deposition of gaseous elemental {sup 131}I to leafy vegetable is quite uncertain because of the different habit, surface texture and leaf uptake of the different plant species. There is no comparative data on the deposition to various species, but leafy vegetables are taken as reference plants for the estimation of the height of contamination of vegetable foods after a nuclear accident. Therefore new chamber experiments were performed to determine under homogeneous and controlled conditions the dry deposition of gaseous elemental {sup 131}I on mature leafy vegetable. The simultaneous exposition of endive, head lettuce, red oak leaf lettuce and spinach (spring leafy vegetable) rsp. curly kale, white cabbage and spinach (summer leafy vegetable) was arranged. The sample collective of each species was such large that for the expected variation of the results a statistically firm analysis was possible. Significant differences were observed for the {sup 131}I deposition on spring vegetable: the deposition on spinach was roughly 3 times that on leaf lettuce, 4 times that on endive and 9 times that on head lettuce. All summer vegetables showed differences in deposition. For Iodine, the deposition on spinach was roughly 3 times (6 times) that on curly kale and 35 times (100 times) that on white cabbage in the 2 experiments. Washing by deionised water could reduce the contamination only by about 10% for {sup 131}I. (author)

  10. 40 CFR 131.21 - EPA review and approval of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.21 EPA review and approval of water quality standards. (a) After the State submits its... analysis. (b) The Regional Administrator's approval or disapproval of a State water quality standard shall...

  11. 40 CFR 131.22 - EPA promulgation of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false EPA promulgation of water quality... PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.22 EPA promulgation of water quality standards. (a) If the State does not adopt the changes specified by the Regional...

  12. 40 CFR 131.20 - State review and revision of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.20 State review and revision of water quality standards. (a) State review. The State shall... reviewing applicable water quality standards and, as appropriate, modifying and adopting standards. Any...

  13. [Evaluation of Reproductive Health of Chickens and Their Progeny at a Chronic Effect of 131I].

    Science.gov (United States)

    Boudarkov, V A

    2015-01-01

    A reproductive health of hens exposed to 131I in a 30-day period with daily quantities ranging from 0.11 to 4.6 MBq/kg and 6 progenies of their offspring was evaluated. We determined that 131I did not change significantly the reproductive potential of hens if administered at a dose of 0.11 MBq, while it raised at 1.1 MBq, progressively decreased after a short-time increase at 2.1 MBq and was inhabited up to its irreversible extinction at 4.6 MBq. Irrespective of the isotope quantity administered, a decline occurred in the birth rate of the progeny where hens dominated in the sex composition. The reproductive potential (i.e., laying capacity) of the offspring of three chicken progenies that had been administered 131I at 0.11 MBq/kg, progenies 3 and 5 that had been administered 1.1 MBq/kg and progeny 1 affected with 2.1 MBq/kg increased, while for chicken progenies 1, 2, 4 and 6 that had been given 131I at 1.1. MBq/kg the reproductive capacity was within the normal range or decreased.

  14. Long-term radiobiological effects in rats after exposure of 131I in utero

    Directory of Open Access Journals (Sweden)

    V. V. Talko

    2017-12-01

    Full Text Available Remote radiobiological effects in male rats prenatally exposed by 131I in different periods of gestation were studied. It was established that the negative effects of irradiation of 131I in utero in the distant period are manifested by disorders of the functioning of the pituitary-thyroid link of endocrine regulation, pro-antioxidant equilibrium, changes in the lipid-lipoprotein spectrum of blood serum. As a result of irradiation of 131I in utero throughout the period of gestation, discoordination in the functioning of the pituitary-thyroid link of endocrine regulation, a violation of the pro-antioxidant balance by increasing the intensity of lipoperoxidation processes and the activity reducing of enzymes of antioxidant defense, the atherogenic orientation of changes in the lipid-lipoprotein spectrum was established. As a result of irradiation by 131I in utero during the third trimester of gestation, the development of hypothyroidism, changes in pro-antioxidant balance due to the activation of antioxidant defense, and the reduction of the concentration of the main classes of lipids have been established.

  15. Deciphering the measured ratios of Iodine-131 to Cesium-137 at the Fukushima reactors

    OpenAIRE

    Matsui, T.

    2011-01-01

    We calculate the relative abundance of the radioactive isotopes Iodine-131 and Cesium-137 produced by nuclear fission in reactors and compare it with data taken at the troubled Fukushima Dai-ichi nuclear power plant. The ratio of radioactivities of these two isotopes can be used to obtain information about when the nuclear reactions terminated.

  16. 25 CFR 39.131 - What is a Language Development Program?

    Science.gov (United States)

    2010-04-01

    ....131 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL...) Are not proficient in spoken or written English; (b) Are not proficient in any language; (c) Are learning their Native language for the purpose of maintenance or language restoration and enhancement; (d...

  17. Structure of negative parity yrast bands in odd mass 125− 131Ce ...

    Indian Academy of Sciences (India)

    The negative parity yrast bands of neutron-deficient 125-131Ce nuclei are studied by using the projected shell model approach. Energy levels, transition energies and (1)/(2) ratios are calculated and compared with the available experimental data. The calculations reproduce the band-head spins of negative parity ...

  18. Structure of negative parity yrast bands in odd mass 125−131Ce ...

    Indian Academy of Sciences (India)

    Abstract. The negative parity yrast bands of neutron-deficient 125−131Ce nuclei are studied by using the projected shell model approach. Energy levels, transition energies and B(M1)/B(E2) ratios are calculated and compared with the available experimental data. The calculations reproduce the band-head spins of negative ...

  19. 21 CFR 131.127 - Nonfat dry milk fortified with vitamins A and D.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nonfat dry milk fortified with vitamins A and D... and Cream § 131.127 Nonfat dry milk fortified with vitamins A and D. (a) Description. Nonfat dry milk fortified with vitamins A and D conforms to the standard of identity for nonfat dry milk, except that...

  20. 17 CFR 1.31 - Books and records; keeping and inspection.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Books and records; keeping and... REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Recordkeeping § 1.31 Books and records; keeping and inspection. (a)(1) All books and records required to be kept by the Act or by these regulations shall be kept for...

  1. Renal I-131-hippurate clearance overestimates true renal blood flow in the instrumented conscious dog

    NARCIS (Netherlands)

    Visscher, CA; DeZeeuw, D; Navis, G; VanZanten, AK; DeJong, PE; Huisman, RM

    We evaluated renal I-131-hippurate clearance (ERPF(hip)) as a measure of renal blood flow (RBF) in chronically instrumented conscious dogs. When adjusted for renal hippurate extraction (E(hip), 0.77 +/- 0.01) and hematocrit (Hct, 39.7 +/- 1%), calculated RBF(hip) (656 +/- 37 ml/min) markedly

  2. Tissue to plasma capillary permeability of 131I-albumin in the perfused rabbit ear

    DEFF Research Database (Denmark)

    Bent-Hansen, Lasse; Svendsen, J H

    1991-01-01

    The tissue to plasma transfer of 131I-albumin was recorded in perfused rabbit ears (n = 6) following equilibration for 24 hr. 125I-fibrinogen served as the plasma marker, and was introduced intravenously 15 min before clamping. The ears were rollerpump perfused with isotonic diluted plasma...

  3. Radiation protection procedures in 131I treatments for thyroid cancer in patients requiring hemodialysis.

    Science.gov (United States)

    Fioroni, Federica; Sghedoni, Roberto; Grassi, Elisa; Piccagli, Vando; Sollini, Martina; Filice, Angelina; Versari, Annibale; Iori, Mauro

    2014-06-01

    Hemodialysis is essential for patients with renal failure, and iodine-131 ((131)I) administration is the standard of care in thyroid carcinoma treatment. Although the need for hemodialysis during (131)I treatment is very rare, it raises some concerns due to the involvement of personnel not exposed to radiation and to the contamination of devices used for other patients. In this paper, a radioprotection protocol to perform hemodialysis safely on patients during (131)I treatment has been presented. The exposure of personnel who assisted 13 patients over the course of 10 years was monitored: external exposure was measured through electronic dosimeters, and internal contamination was checked by thyroid uptake and urine sample gamma spectrometry. Over this period, room layout was optimized to allow an improvement of radioprotection procedures.Two nurses were involved in patient assistance. After hemodialysis, measurements of internal contamination were below the minimum detectable activity and external exposure was in the range of 1-82 μSv in terms of H(p)(10). A reduction in personnel exposure was observed after hospitalization room renovation: H(p)(10) normalized to the activity administered to the patient was about halved. The data show that hemodialysis can be performed safely during I treatments when appropriate radioprotection actions are implemented.

  4. Doubled haploid inbred lines USVL048 and USVL131 of heading broccoli

    Science.gov (United States)

    Two inbred lines of heading broccoli (Brassica oleracea L. var. italica), designated USVL048 and USVL131, were released by the Agricultural Research Service of the U.S. Department of Agriculture in 2012. Both of the released lines are doubled haploids originally derived from another culture. As do...

  5. [Management of iodine-131 ablation therapy for thyroid carcinoma in a patient on chronic hemodialysis].

    Science.gov (United States)

    Zenasni, Nadia; Elkhayat, Salma; Taleb, Sara; Zamd, Mohammed; Medkouri, Ghizlaine; Benghanem Gharbi, Mohammed; Ramdani, Benyounes; Aschawa, Hind; Guensi, Amal

    2015-04-01

    Iodine-131 ablation therapy for thyroid cancer in the patient on chronic hemodialysis represents a real problem since the main route of elimination of radioiodine is urinary. There is no recommendation on the management of this treatment in the patient on hemodialysis. We report our experience of management of this treatment in a patient aged 38 years, undergoing hemodialysis for chronic renal failure, and who have been indicated the treatment with iodine-131 for papillary thyroid carcinoma high risk. After multidisciplinary discussions (nephrologists and specialists in nuclear medicine and radiation safety), it has been decided to treat the patient with continuous ambulatory peritoneal dialysis therapy (CAPD). Because of the low but continuous elimination of iodine in the case of CAPD, the patient received a reduced ablative (131)I dose of 1850 MBq, which is 30% of the usual dose delivered in subjects with normal renal function. The patient was hospitalized for four days in nuclear medicine unit and the (131)I radioactivity emitted from him was 2.5 μSv/h at one meter at his hospital discharge. In conclusion, CAPD in relay of hemodialysis is a technique of renal replacement therapy that can be suggested to minimize exposure to radioactivity to the patient, his family and the medical staff. Copyright © 2015 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

  6. Development of gamma-photon/Cerenkov-light hybrid system for simultaneous imaging of I-131 radionuclide

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Seiichi; Suzuki, Mayumi; Kato, Katsuhiko [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine (Japan); Watabe, Tadashi; Ikeda, Hayato; Kanai, Yasukazu [Department of Molecular Imaging in Medicine, Osaka University Graduate School of Medicine (Japan); Ogata, Yoshimune [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine (Japan); Hatazawa, Jun [Department of Molecular Imaging in Medicine, Osaka University Graduate School of Medicine (Japan)

    2016-09-11

    Although iodine 131 (I-131) is used for radionuclide therapy, high resolution images are difficult to obtain with conventional gamma cameras because of the high energy of I-131 gamma photons (364 keV). Cerenkov-light imaging is a possible method for beta emitting radionuclides, and I-131 (606 MeV maximum beta energy) is a candidate to obtain high resolution images. We developed a high energy gamma camera system for I-131 radionuclide and combined it with a Cerenkov-light imaging system to form a gamma-photon/Cerenkov-light hybrid imaging system to compare the simultaneously measured images of these two modalities. The high energy gamma imaging detector used 0.85-mm×0.85-mm×10-mm thick GAGG scintillator pixels arranged in a 44×44 matrix with a 0.1-mm thick reflector and optical coupled to a Hamamatsu 2 in. square position sensitive photomultiplier tube (PSPMT: H12700 MOD). The gamma imaging detector was encased in a 2 cm thick tungsten shield, and a pinhole collimator was mounted on its top to form a gamma camera system. The Cerenkov-light imaging system was made of a high sensitivity cooled CCD camera. The Cerenkov-light imaging system was combined with the gamma camera using optical mirrors to image the same area of the subject. With this configuration, we simultaneously imaged the gamma photons and the Cerenkov-light from I-131 in the subjects. The spatial resolution and sensitivity of the gamma camera system for I-131 were respectively ~3 mm FWHM and ~10 cps/MBq for the high sensitivity collimator at 10 cm from the collimator surface. The spatial resolution of the Cerenkov-light imaging system was 0.64 mm FWHM at 10 cm from the system surface. Thyroid phantom and rat images were successfully obtained with the developed gamma-photon/Cerenkov-light hybrid imaging system, allowing direct comparison of these two modalities. Our developed gamma-photon/Cerenkov-light hybrid imaging system will be useful to evaluate the advantages and disadvantages of these two

  7. 18 CFR 131.80 - FERC Form No. 556, Certification of qualifying facility status for an existing or a proposed...

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false FERC Form No. 556... facility. 131.80 Section 131.80 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... annual hourly energy input in terms of Btu for the following fossil fuel energy inputs, and provide the...

  8. 12 CFR 204.131 - Participation by a depository institution in the secondary market for its own time deposits.

    Science.gov (United States)

    2010-01-01

    ... the secondary market for its own time deposits. 204.131 Section 204.131 Banks and Banking FEDERAL... secondary market for its own time deposits. (a) Background. In 1982, the Board issued an interpretation concerning the effect of a member bank's purchase of its own time deposits in the secondary market in order...

  9. Diagnostic I-131 scintigraphy in patients with differentiated thyroid cancer : no additional value of higher scan dose

    NARCIS (Netherlands)

    Phan, TTH; van Tol, KM; Links, TP; Piers, DA; de Vries, EGE; Dullaart, RPF; Jager, PL

    2004-01-01

    Objective: After initial treatment with total thyroidectomy and radioiodine ablation, most follow-up protocols for patients with differentiated thyroid carcinoma contain cyclic diagnostic I-131 imaging and serum thyroglobulin measurements. The applied diagnostic I-131 doses vary between 37 and 370

  10. Genomic analysis of Bacillus subtilis OH 131.1 and coculturing with Cryptococcus flavescens for control of fusarium head blight

    Science.gov (United States)

    Bacillus subtilis OH131.1 is a bacterial antagonist of Fusarium graminearum, a plant pathogen which causes Fusarium head blight in wheat. The genome of B. subtilis OH131.1 was sequenced, annotated and analyzed to understand its potential to produce bioactive metabolites. The analysis identified 6 sy...

  11. Gamma camera based method for 131I capsule counting: an alternate method to Uptake probe method.

    Science.gov (United States)

    Menon, Biju K; Uday, Awasare S; Singh, Baghel N

    2017-11-10

    The main objective of this study was to check the validity of using gamma camera as an alternate method to thyroid uptake probe, for counting 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules before administration to thyroid patients. Methods: - 10 sets each of 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules received from Board Of Radiation and Isotope Technology, Department Of Atomic Energy, India (BRIT, DAE) have been counted individually using thyroid uptake probe for 10 seconds following institutional protocol and also by keeping individual capsule of a set with 8cm gap between each of them .These capsules were also scanned by Scintillation gamma camera for 100 seconds. Capsules having counts within the range of mean ±2 Standard Deviation (SD) were accepted for patient administration. After analysing both the data, correlation coefficient between these two methods has been evaluated. Results: Scanned images were analysed by drawing Identical ROI around each set of 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules. Capsules with counts within 2 Standard Deviation from mean were accepted for patient administration. Good correlation coefficient (r >0.95) was observed between these two counts set. Conclusion: Gamma camera based 131I -capsule counting method is an easy and time saving method compared to probe based capsule counting method as we can scan a set of capsules in a single acquisition. It can provide uniformity information for a batch of 131I -capsules and avoid the time consuming method of individual capsule counting with the thyroid uptake probe. Copyright © 2017 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  12. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: a systematic review and meta-analysis.

    Science.gov (United States)

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-03-17

    Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient populations. Hyperendemicity could result from increased transmissibility, longer duration of infectiousness, and/or higher pathogenic potential as compared with other lineages of the same species. The aim of our research is to quantitatively estimate these critical parameters for E. coli ST131 and K. pneumoniae ST258, in order to investigate whether E. coli ST131 and K. pneumoniae ST258 are truly hyperendemic clones. A systematic literature search was performed to assess the evidence of transmissibility, duration of infectiousness, and pathogenicity for E. coli ST131 and K. pneumoniae ST258. Meta-regression was performed to quantify these characteristics. The systematic literature search yielded 639 articles, of which 19 data sources provided information on transmissibility (E. coli ST131 n=9; K. pneumoniae ST258 n=10)), 2 on duration of infectiousness (E. coli ST131 n=2), and 324 on pathogenicity (E. coli ST131 n=285; K. pneumoniae ST258 n=39). Available data on duration of carriage and on transmissibility were insufficient for quantitative assessment. In multivariable meta-regression E. coli isolates causing infection were associated with ST131, compared to isolates only causing colonisation, suggesting that E. coli ST131 can be considered more pathogenic than non-ST131 isolates. Date of isolation, location and resistance mechanism also influenced the prevalence of ST131. E. coli ST131 was 3.2 (95% CI 2.0 to 5.0) times more pathogenic than non-ST131. For K. pneumoniae ST258 there were not enough data for meta-regression assessing the influence of colonisation versus infection on ST258 prevalence. With the currently available data, it cannot be confirmed nor rejected, that E. coli ST131

  13. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: a systematic review and meta-analysis

    Science.gov (United States)

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-01-01

    Objectives Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient populations. Hyperendemicity could result from increased transmissibility, longer duration of infectiousness, and/or higher pathogenic potential as compared with other lineages of the same species. The aim of our research is to quantitatively estimate these critical parameters for E. coli ST131 and K. pneumoniae ST258, in order to investigate whether E. coli ST131 and K. pneumoniae ST258 are truly hyperendemic clones. Primary outcome measures A systematic literature search was performed to assess the evidence of transmissibility, duration of infectiousness, and pathogenicity for E. coli ST131 and K. pneumoniae ST258. Meta-regression was performed to quantify these characteristics. Results The systematic literature search yielded 639 articles, of which 19 data sources provided information on transmissibility (E. coli ST131 n=9; K. pneumoniae ST258 n=10)), 2 on duration of infectiousness (E. coli ST131 n=2), and 324 on pathogenicity (E. coli ST131 n=285; K. pneumoniae ST258 n=39). Available data on duration of carriage and on transmissibility were insufficient for quantitative assessment. In multivariable meta-regression E. coli isolates causing infection were associated with ST131, compared to isolates only causing colonisation, suggesting that E. coli ST131 can be considered more pathogenic than non-ST131 isolates. Date of isolation, location and resistance mechanism also influenced the prevalence of ST131. E. coli ST131 was 3.2 (95% CI 2.0 to 5.0) times more pathogenic than non-ST131. For K. pneumoniae ST258 there were not enough data for meta-regression assessing the influence of colonisation versus infection on ST258 prevalence. Conclusions With the currently available data

  14. In Vitro Activities of Moxifloxacin, 127I-Moxifloxacin and 131I-Moxifloxacin Against Staphylococcus Aureus Biofilms

    Directory of Open Access Journals (Sweden)

    Hasan Demiroğlu

    2015-02-01

    Full Text Available Objective: The aim of the study was to investigate the antimicrobial effect of Moxifloxacin (MXF, radio (Na131I and cold (K127I iodinated MXF on methicillin susceptible Staphylococcus aureus ATCC 35556 (MSSA biofilms. Methods: MXF was labeled with Na131I using the iodogen method. The optimum radiodination conditions for 131I-MXF was determined by thin-layer radio chromatography studies. Thin-layer radio chromatography (TLRC chromatograms were obtained by using Cyclone Plus Storage Phosphor System. The MICs of MXF, 127I-MXF and 131I-MXF were determined using the microdilution broth method according to CLSI criteria. Time kill curves were performed over 24 h using an inoculum of 2×105 (CFU/mL. Biofilms were grown in microtitre plates, dyed with crystal violet and the mean optical density (OD630 was used for quantification. Biofilms were incubated MXF, 127I-MXF and 131I-MXF at various concentration (0.03 to 64 µg/mL. Results: MXF was labeled with 131I iodogen method. 131I-MXF was obtained with high a yield 95±3%. The MIC values for MXF, 127I-MXF and 131I-MXF was 0.06 µg/mL. Bactericidal activity was demonstrated at 0.25 µg/mL 4 hour for MXF, 127I-MXF and 131I-MXF. At MIC levels, MXF, 127I-MXF and 131I-MXF was not showed a marked reduction of metabolic activity in the S. aureus biofilm. The ODs of biofilm after incubation with an increasing antibiotic concentration were significantly lower than the ODs of biofilms without antibiotic p≤005. The radiolabeled MXF was most effective than MXF, 127I-MXF in reducing the number of bacteria in biofilm. After 24 h incubation Log10 CFU/mL values for 32 µg/mL antibiotic concentration: Control, MXF, 127I-MXF and 131I-MXF were 9.5, 4.3, 4.8 and 3.1, respectively. Conclusion: 131I and 127I were used alone there was no penetration of the S. aureus biofilm and no damage. In contrast our results demonstrate that the radiolabeled Moxifloxacin (131I-MXF have potent anti-biofilm activity against S. aureus

  15. Control system of liquid effluents generated in treatment with I-131; Sistema de control de efluentes liquidos generados en el tratamiento con I-131

    Energy Technology Data Exchange (ETDEWEB)

    Garcia M, T.; Ruiz C, M. A.; Angeles C, A.; Ramirez S, R., E-mail: teodoro.garcia@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

    2015-09-15

    In recent years, nuclear medicine has developed greatly in our country and around the world. Techniques for both medical diagnosis and therapy have increased the use of radiopharmaceuticals, notably the I-131. In Mexico there are around 150 nuclear medicine establishments authorized by the Comision Nacional de Seguridad Nuclear y Salvaguardias. Most of these establishments do not have an appropriate facility for the treatment of radioactive liquid effluents, to ensure compliance with the concentration limits established in the regulations. The Instituto Nacional de Investigaciones Nucleares (ININ) developed and implemented successfully, a control system of radioactive effluents (named SACEL) from a nuclear medicine facility. This system ensures an effective compliance with regulations and also better management and control of these radioactive effluents. Calculations and design of SACEL were made with respect to I-131, because is one of the most commonly used in radiotherapy and medical diagnostics, besides its half-life is greater in relation to other radionuclides. SACEL is comprised of four storage tanks and decay and a fifth tank for measuring the concentration of I-131 and later discharge to the drain; these tanks are connected to an automated system that controls the effluents passage. The calculation to determine the volume of the tanks was carried out according to the demand that has the hospital, to the maximum activity being poured in effluents and time required to decay. In this paper the design and installation of SACEL system, in addition to functioning as a facility that enables the Hospital meet the required standards is presented. Dose calculations performed with MCNPX and the methodology used in the calibration of the detection system is also presented. (Author)

  16. Proton-hole and core-excited states in the semi-magic nucleus 131In82

    Energy Technology Data Exchange (ETDEWEB)

    Taprogge, J.; Jungclaus, A.; Grawe, H.; Borzov, I. N.; Nishimura, S.; Doornenbal, P.; Lorusso, G.; Simpson, G. S.; Söderström, P. -A.; Sumikama, T.; Xu, Z. Y.; Baba, H.; Browne, F.; Fukuda, N.; Gernhäuser, R.; Gey, G.; Inabe, N.; Isobe, T.; Jung, H. S.; Kameda, D.; Kim, G. D.; Kim, Y. -K.; Kojouharov, I.; Kubo, T.; Kurz, N.; Kwon, Y. K.; Li, Z.; Sakurai, H.; Schaffner, H.; Shimizu, Y.; Steiger, K.; Suzuki, H.; Takeda, H.; Vajta, Zs.; Watanabe, H.; Wu, J.; Yagi, A.; Yoshinaga, K.; Benzoni, G.; Bönig, S.; Chae, K. Y.; Coraggio, L.; Daugas, J. -M.; Drouet, F.; Gadea, A.; Gargano, A.; Ilieva, S.; Itaco, N.; Kondev, F. G.; Kröll, T.; Lane, G. J.; Montaner-Pizá, A.; Moschner, K.; Mücher, D.; Naqvi, F.; Niikura, M.; Nishibata, H.; Odahara, A.; Orlandi, R.; Patel, Z.; Podolyák, Zs.; Wendt, A.

    2016-11-01

    The decay of the N = 83 nucleus Cd-131 has been studied at the RIBF facility at the RIKEN Nishina Center. The main purpose of the study was to identify the position of the and proton-hole states and the energies of core-excited configurations in the semi-magic nucleus In-131. From the radiation emitted following the decay, a level scheme of In-131 was established and the feeding to each excited state determined. Similarities between the single-particle transitions observed in the decays of the N = 83 isotones In-132 and Cd-131 are discussed. Finally the excitation energies of several core-excited configurations in In-131 are compared to QRPA and shell-model calculations.

  17. Proton-hole and core-excited states in the semi-magic nucleus {sup 131}In{sub 82}

    Energy Technology Data Exchange (ETDEWEB)

    Taprogge, J. [Instituto de Estructura de la Materia, CSIC, Madrid (Spain); Universidad Autonoma de Madrid, Departamento de Fisica Teorica, Madrid (Spain); RIKEN Nishina Center, RIKEN, Saitama (Japan); Jungclaus, A. [Instituto de Estructura de la Materia, CSIC, Madrid (Spain); Grawe, H. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Borzov, I.N. [Kurchatov Institute, Moscow (Russian Federation); Joint Institute for Nuclear Research, Dubna (Russian Federation); Nishimura, S.; Doornenbal, P.; Soederstroem, P.A.; Baba, H.; Fukuda, N.; Inabe, N.; Isobe, T.; Kameda, D.; Kubo, T.; Shimizu, Y.; Suzuki, H.; Takeda, H.; Watanabe, H. [RIKEN Nishina Center, RIKEN, Saitama (Japan); Lorusso, G. [RIKEN Nishina Center, RIKEN, Saitama (Japan); National Physical Laboratory, NPL, Teddington, Middlesex (United Kingdom); University of Surrey, Department of Physics, Guildford (United Kingdom); Simpson, G.S.; Drouet, F. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble Cedex (France); Sumikama, T. [Tohoku University, Department of Physics, Sendai, Miyagi (Japan); Xu, Z.Y.; Niikura, M. [University of Tokyo, Department of Physics, Tokyo (Japan); Browne, F. [RIKEN Nishina Center, RIKEN, Saitama (Japan); University of Brighton, School of Computing, Engineering and Mathematics, Brighton (United Kingdom); Gernhaeuser, R.; Steiger, K.; Muecher, D. [Technische Universitaet Muenchen, Physik Department E12, Garching (Germany); Gey, G. [RIKEN Nishina Center, RIKEN, Saitama (Japan); LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble Cedex (France); Institut Laue-Langevin, B.P. 156, Grenoble Cedex 9 (France); Jung, H.S. [Chung-Ang University, Department of Physics, Seoul (Korea, Republic of); Kim, G.D.; Kwon, Y.K. [Institute for Basic Science, Rare Isotope Science Project, Daejeon (Korea, Republic of); Kim, Y.K. [Institute for Basic Science, Rare Isotope Science Project, Daejeon (Korea, Republic of); Hanyang University, Department of Nuclear Engineering, Seoul (Korea, Republic of); Kojouharov, I.; Kurz, N.; Schaffner, H. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Li, Z. [Peking University, School of Physics and State key Laboratory of Nuclear Physics and Technology, Beijing (China); Sakurai, H. [RIKEN Nishina Center, RIKEN, Saitama (Japan); University of Tokyo, Department of Physics, Tokyo (Japan); Vajta, Zs. [RIKEN Nishina Center, RIKEN, Saitama (Japan); MTA Atomki, P.O. Box 51, Debrecen (Hungary); Wu, J. [RIKEN Nishina Center, RIKEN, Saitama (Japan); Peking University, School of Physics and State key Laboratory of Nuclear Physics and Technology, Beijing (China); Yagi, A.; Nishibata, H.; Odahara, A. [Osaka University, Department of Physics, Toyonaka (Japan); Yoshinaga, K. [Tokyo University of Science, Department of Physics, Faculty of Science and Technology, Noda, Chiba (Japan); Benzoni, G. [INFN, Sezione di Milano, Milano (Italy); Boenig, S.; Ilieva, S.; Kroell, T. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); Chae, K.Y. [Sungkyunkwan University, Department of Physics, Suwon (Korea, Republic of); Coraggio, L.; Gargano, A. [Complesso Universitario di Monte S. Angelo, Istituto Nazionale di Fisica Nucleare, Napoli (Italy); Daugas, J.M. [CEA, DAM, DIF, Arpajon cedex (France); Gadea, A.; Montaner-Piza, A. [CSIC-Univ. of Valencia, Instituto de Fisica Corpuscular, Paterna (Spain); Itaco, N. [Seconda Universita di Napoli, Dipartimento di Matematica e Fisica, Caserta (Italy); Kondev, F.G. [Argonne National Laboratory, Nuclear Engineering Division, Argonne, IL (United States); Lane, G.J. [Australian National University, Department of Nuclear Physics, Research School of Physical Sciences and Engineering, Canberra (Australia); Moschner, K.; Wendt, A. [University of Cologne, IKP, Cologne (Germany); Naqvi, F. [Yale University, Wright Nuclear Structure Laboratory, New Haven, CT (United States); Orlandi, R. [K.U. Leuven, Instituut voor Kern- en StralingsFysica, Heverlee (Belgium); Japan Atomic Energy Agency, Advanced Science Research Center, Tokai, Ibaraki (Japan); Patel, Z.; Podolyak, Zs. [University of Surrey, Department of Physics, Guildford (United Kingdom)

    2016-11-15

    The β decay of the N = 83 nucleus {sup 131}Cd has been studied at the RIBF facility at the RIKEN Nishina Center. The main purpose of the study was to identify the position of the 1p{sub 3/2} and 0f{sub 5/2} proton-hole states and the energies of core-excited configurations in the semi-magic nucleus {sup 131}In. From the radiation emitted following the β decay, a level scheme of {sup 131}In was established and the β feeding to each excited state determined. Similarities between the single-particle transitions observed in the β decays of the N = 83 isotones {sup 132}In and {sup 131}Cd are discussed. Finally the excitation energies of several core-excited configurations in {sup 131}In are compared to QRPA and shell-model calculations. (orig.)

  18. Thyroid dose of I-131 absorbed by the internal organs of a pregnant woman; Dosis tiroidea de I-131 absorbida por los organos internos de una embarazada

    Energy Technology Data Exchange (ETDEWEB)

    Arcos P, A.; Manzanares A, E.; Vega C, H.R.; Leon, C.L. de [Cuerpo Academico de Radiobiologia de la Universidad Autonoma de Zacatecas (Mexico)]. e-mail: emanz_44@yahoo.com

    2007-07-01

    The use of nuclear techniques, for diagnosis or treatment, generates stress in the patient and its relatives. During the pregnancy some sufferings related with the thyroid gland can be presented. If the patient is pregnant, OEP or NOEP, the stress comes from the fear to that the product can it turns affected. The dose is calculated that the Iodine 131, captured by the thyroid of a woman with three months of pregnancy, it deposits in the brain, stomach, heart, kidneys, liver, lungs, ovaries, pancreas, thymus, spleen and in the uterus. The thymus is the organ that receives the biggest dose. (Author)

  19. Test of irradiation of tellurium oxide for obtaining iodine-131 by dry distillation; Prueba de irradiacion de dioxido de telurio para obtener yodo-131 por destilacion seca

    Energy Technology Data Exchange (ETDEWEB)

    Alanis M, J. [ININ, Departamento de Materiales Radiactivos, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-15

    With the purpose of optimizing to the maximum independently the work of the reactor of those mathematical calculations of irradiation that are already optimized, now it corresponds to carry out irradiation tests in the different positions with their respective neutron fluxes that it counts the reactor for samples irradiation. Then, it is necessary to carry out the irradiation of the tellurium dioxide through cycles, with the purpose of observing the activity that it goes accumulating in each cycle and this way to obtain an activity of the Iodine-131 obtained when finishing the last cycle. (Author)

  20. The utility of I-123 pretherapy scan in I-131 radioiodine therapy for thyroid cancer.

    Science.gov (United States)

    Chen, Ming-Kai; Yasrebi, Mona; Samii, Jason; Staib, Lawrence H; Doddamane, Indukala; Cheng, David W

    2012-03-01

    There is a growing belief that a pretherapy scan yields little or no additional information that would impact on radioiodine ablation dosing. In addition, there is some concern regarding on the stunning effect of a pretherapy scan, especially when I-131 radioisotope is used for imaging. We hypothesized that a pretherapy scan provides invaluable information on the amount of thyroid remnant, sometimes indicating the need for two-step I-131 ablation. It may also detect unsuspected local lymph node involvement or distant metastases, indicating the requirement for a higher I-131 dose after thyroidectomy. The aim of this study was to evaluate how effective pretherapy scans are for guiding I-131 therapy planning and augmenting information provided in the pathology reports for thyroidectomy specimens. We reviewed 122 patients who underwent I-123 pretherapy scan and I-131 radioablation at Yale New Haven Hospital between January 2006 and August 2007. The percentage of neck uptake and whole-body images were acquired 24 hours following the administration of 51.8 MBq (1.4 mCi) of I-123 NaI. A 24-hour uptake of >3% was used as the cutoff to determine whether there was a greater than desired quantity of thyroid remnant, which would require a two-step treatment protocol. Furthermore, attention was paid to identifying cervical lymph nodes, which may not have presented themselves in the euthyroid state at the time of thyroidectomy. Additional clinical information provided by pretherapy scans was computed as percentages with 95% confidence intervals by using adjusted Wald intervals. Overall, the pretherapy scans provided additional critical information in 25% of the cases (31/122; 95% CI: 18%-34%). For cases demonstrating >3% uptake with midline lymph nodes, the pretherapy scan provided additional information in 50% of the cases (8/16; 95% CI: 28%-72%). Our study demonstrated that I-123 pretherapy scans provide valuable information with regard to unsuspected lymph nodes or