Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

International Nuclear Information System (INIS)

Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

2011-01-01

Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2002-01-01

Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

2016-01-01

Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

International Nuclear Information System (INIS)

Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

2012-01-01

Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

Energy Technology Data Exchange (ETDEWEB)

Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

2012-05-15

Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

2002-01-01

Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

Directory of Open Access Journals (Sweden)

JOSE MIGUEL CAMPO GAVIRIA

2017-12-01

Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

OpenAIRE

Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

2011-01-01

A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Seyma Ozcirak Ergun

2017-06-01

Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Kátia Maria Gomes Machado

2006-12-01

Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

International Nuclear Information System (INIS)

Khalaf, M.A.; Atia, A.I.

2009-01-01

Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

Science.gov (United States)

Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

2016-08-01

This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

International Nuclear Information System (INIS)

Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

2002-01-01

This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rossana Liguori

2015-01-01

Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

OpenAIRE

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

O. M. Alekseenko

2010-07-01

Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

Science.gov (United States)

Jayakumar, T; Ramesh, E; Geraldine, P

2006-12-01

This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

New lipases by mining of Pleurotus ostreatus genome.

Directory of Open Access Journals (Sweden)

Alessandra Piscitelli

Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

Evaluation of the Synergistic Effect of Mixed Cultures of White-Rot Fungus Pleurotus ostreatus and Biosurfactant-Producing Bacteria on DDT Biodegradation.

Science.gov (United States)

Purnomo, Adi Setyo; Ashari, Khoirul; Hermansyah, Farizha Triyogi

2017-07-28

DDT (1,1,1-trichloro-2,2- bis (4-chlorophenyl) ethane) is one of the organic synthetic pesticides that has many negative effects for human health and the environment. The purpose of this study was to investigate the synergistic effect of mixed cutures of white-rot fungus, Pleurotus ostreatus , and biosurfactant-producing bacteria, Pseudomonas aeruginosa and Bacillus subtilis , on DDT biodegradation. Bacteria were added into the P. ostreatus culture (mycelial wet weight on average by 8.53 g) in concentrations of 1, 3, 5, and 10 ml (1 ml ≈ 1.25 × 10 9 bacteria cells/ml culture). DDT was degraded to approximately 19% by P. ostreatus during the 7-day incubation period. The principal result of this study was that the addition of 3 ml of P. aeruginosa into P. ostreatus culture gave the highest DDT degradation rate (approximately 86%) during the 7-day incubation period. This mixed culture combination of the fungus and bacteria also gave the best ratio of optimization of 1.91. DDD (1,1-dichloro-2,2- bis (4-chlorophenyl) ethane), DDE (1,1-dichloro-2,2- bis (4-chlorophenyl) ethylene), and DDMU (1-chloro-2,2- bis (4-chlorophenyl) ethylene) were detected as metabolic products from the DDT degradation by P. ostreatus and P. aeruginosa . The results of this study indicate that P. aeruginosa has a synergistic relationship with P. ostreatus and can be used to optimize the degradation of DDT by P. ostreatus .

Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

Directory of Open Access Journals (Sweden)

Ahmed I. El-Batal

2015-03-01

Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

2000-01-01

Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

International Nuclear Information System (INIS)

Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

2013-01-01

The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

Science.gov (United States)

Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

2018-05-30

Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

2012-12-01

Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

Science.gov (United States)

Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

2009-04-01

The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

Science.gov (United States)

2014-01-01

Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

OpenAIRE

Naila, Ishmatun; Purnomo, Adi Setyo

2016-01-01

Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

OpenAIRE

Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

2009-01-01

The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

Science.gov (United States)

Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

2014-01-01

Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

Science.gov (United States)

Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

2015-01-01

The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Directory of Open Access Journals (Sweden)

Čeněk Novotný

2016-07-01

Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

Science.gov (United States)

Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

2018-07-25

The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

Science.gov (United States)

Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

2015-01-01

The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

Science.gov (United States)

Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

2018-03-01

As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

Science.gov (United States)

Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

2018-03-01

Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rosa María Espinosa-Valdemar

2015-05-01

Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

Science.gov (United States)

Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

2012-10-01

Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

Biological transformation of anthracene in soil by Pleurotus ostreatus under solid-state fermentation conditions using wheat bran and compost

International Nuclear Information System (INIS)

Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N

2001-01-01

Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil

USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

Directory of Open Access Journals (Sweden)

NATALIA LIZETTE CASTAÑO

2012-12-01

Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

Science.gov (United States)

Slavens, Shelyn Gehle

Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

High-Temperature Induced Changes of Extracellular Metabolites in Pleurotus ostreatus and Their Positive Effects on the Growth of Trichoderma asperellum.

Science.gov (United States)

Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

2018-01-01

Pleurotus ostreatus is a widely cultivated edible fungus in China. Green mold disease of P. ostreatus which can seriously affect yield is a common disease during cultivation. It occurs mostly after P. ostreatus mycelia have been subjected to high temperatures. However, little information is available on the relationship between high temperature and green mold disease. The aim of this study is to prove that extracellular metabolites of P. ostreatus affected by high temperature can promote the growth of Trichoderma asperellum . After P. ostreatus mycelia was subjected to high temperature, the extracellular fluid of P. ostreatus showed a higher promoting effect on mycelial growth and conidial germination of T. asperellum . The thiobarbituric acid reactive substance (TBARS) content reached the maximum after 48 h at 36°C. A comprehensive metabolite profiling strategy involving gas chromatography-mass spectrometry (GC/MS) combined with liquid chromatography-mass spectrometry (LC/MS) was used to analyze the changes of extracellular metabolites in response to high temperature. A total of 141 differential metabolites were identified, including 84.4% up-regulated and 15.6% down-regulated. Exogenous metabolites whose concentrations were increased after high temperature were randomly selected, and nearly all of them were able to promote the mycelial growth and conidial germination of T. asperellum . The combination of all selected exogenous metabolites also has the promotion effects on the mycelial growth and conidial germination of T. asperellum in a given concentration range in vitro . Overall, these results provide a first view that high temperature affects the extracellular metabolites of P. ostreatus , and the extensive change in metabolites promotes T. asperellum growth.

Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Juliana Silveira do Valle

2012-10-01

Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

[The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

Science.gov (United States)

Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

2009-01-01

The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

Directory of Open Access Journals (Sweden)

Juliet B. Akinyele

2012-09-01

Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

Directory of Open Access Journals (Sweden)

Ayşenur Yılmaz

2017-01-01

Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

Directory of Open Access Journals (Sweden)

PILAR SUDIANY VARGAS

2012-06-01

Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

OpenAIRE

Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

2014-01-01

Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2009-12-01

Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

Science.gov (United States)

Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

2015-01-01

Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

Science.gov (United States)

Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

2017-01-01

Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

International Nuclear Information System (INIS)

Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

2013-01-01

It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

Laccase Enzymes in Inocula Pleurotus spp

Directory of Open Access Journals (Sweden)

Nora García-Oduardo

2017-01-01

Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

Directory of Open Access Journals (Sweden)

Patrick Schmidt

2003-12-01

Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

Directory of Open Access Journals (Sweden)

I MADE SUDARMA

2015-09-01

Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

Directory of Open Access Journals (Sweden)

Emanuel Vamanu

2012-03-01

Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

Science.gov (United States)

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

Science.gov (United States)

Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

2016-03-01

Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

Science.gov (United States)

Thongsook, T; Kongbangkerd, T

2011-08-01

Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

Science.gov (United States)

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

Science.gov (United States)

Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

2014-12-01

Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

Science.gov (United States)

Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

2015-03-01

In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

Anti-Fungal activity of essential oil from Baeckea frutescens L against Pleuratus ostreatus

Science.gov (United States)

Jemi, Renhart; Barus, Ade Irma; Nuwa, Sarinah, Luhan, Gimson

2017-11-01

Ujung Atap is an herb that have distinctive odor on its leaves. The plant's essential oil contains bioactive compounds but has not been investigated its anti-fungal activity against Pleurotus ostreatus. Essential oil from Ujung Atap leaves is one environmentally friendly natural preservative. This study consisted of distillation Ujung Atap leaves with boiled method, determining the number of acid, essential oil ester, and anti-fungal activity against Pleurotus ostreatus. Analysis of the data to calculate anti-fungal activity used probit analysis method to determine the IC50. Results for the distillation of leaves Ujung Atap produce essential oil yield of 0.071% and the average yield of the acid number and the ester of essential oils Ujung Atap leaves are 5.24 and 12.15. Anti-fungal activity Pleurotus ostreatus at a concentration of 1000 µg/mL, 100 µg/mL, 75 µg/mL, 50 µg/mL and 100 µg/mL BA defunct or fungi was declared dead, while at a concentration of 25 µg/mL, 10 µg/mL and 5 µg/mL still occur inhibitory processes. Results obtained probit analysis method IC50 of 35.48 mg/mL; means the essential oil of Ujung Atap leaf can inhibit fungal growth by 50 percent to 35.48 µg/mL concentration.

The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

Science.gov (United States)

Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

2015-12-01

Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

Science.gov (United States)

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

Directory of Open Access Journals (Sweden)

Claudia M Rivera-Hoyos

Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

Science.gov (United States)

Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

2018-03-01

Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

Directory of Open Access Journals (Sweden)

Rodolfo WingChing-Jones

2009-01-01

Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

Directory of Open Access Journals (Sweden)

Wei-Jie Wu

Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Ummu Kalsum

2011-09-01

Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

Directory of Open Access Journals (Sweden)

Jorge Alberto Luna Fontalvo

2013-05-01

Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

Science.gov (United States)

Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

2018-04-01

Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

Directory of Open Access Journals (Sweden)

Savić Milena D.

2009-01-01

Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

Directory of Open Access Journals (Sweden)

M. Abu Sayeed

2014-01-01

Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

Science.gov (United States)

Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

2018-04-20

Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

PRODUKTIVITAS JAMUR TIRAM PUTIH (Pleurotus ostreatus PADA MEDIA LIMBAH SEKAM PADI DAN DAUN PISANG KERING SEBAGAI MEDIA ALTERNATIF

Directory of Open Access Journals (Sweden)

Suparti Suparti

2015-08-01

Full Text Available Jamur tiram putih (Pleurotus ostreatus merupakan jenis jamur pangan yang banyak dikonsumsi mengandung protein 27%. Kandungan protein pada jamur tiram putih dapat dipengaruhi oleh komposisi media tanam seperti selulosa, hemiselulosa, lignin dan nutrisi tambahan. Sekam padi dan daun pisang kering merupakan salah satu limbah organik yang dapat digunakan sebagai media alternatif untuk meningkatkan produktivitas jamur tiram putih.Tujuan penelitian ini adalah untuk mengetahui produktivitas jamur tiram putih yang ditumbuhkan pada media  limbah sekam padi dan daun pisang kering sebagai media alternatif. Jenis penelitian eksperimen dengan metode rancangan acak lengkap (RAL dua faktor yaitu faktor 1 penambahan sekam padi dan faktor 2 daun pisang kering (0%, 5%, 10%, 15%, masing-masing  dengan empat perlakuan dan dua kali ulangan.  Hasil analisis data menunjukkan bahwa penambahan sekam padi dan daun pisang kering  15% (S3T3 memberikan pengaruh nyata terhadap lama penyebaran miselium, jumlah badan buah dan berat segar jamur tiram putih.Perlakuan yang paling baik untuk pertumbuhan jamur pada perlakuan S3T3, dengan rata-rata lama penyebaran miselium 25,5 hari, jumlah badan buah 64,5 buah dan berat segar yang dihasilkan 402,5. Hasil data tersebut lebih tinggi dibandingkan dengan perlakuan yang lain.

Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Abena O. Adjapong

2015-01-01

Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

Directory of Open Access Journals (Sweden)

Carol Daniela Coello-Loor

2017-12-01

Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

Science.gov (United States)

Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

2014-01-15

This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

Directory of Open Access Journals (Sweden)

Eduardo Bernardi

2009-01-01

Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

Directory of Open Access Journals (Sweden)

Ricardo Sposina S. Teixeira

2010-01-01

Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Idrus Kadir

2010-01-01

Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

Science.gov (United States)

Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

2014-10-15

Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

Science.gov (United States)

Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

2017-06-01

Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Nam Wai Lun

2017-01-01

Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

Science.gov (United States)

Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

2017-11-01

Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

Evaluación de la capacidad productiva de Pleurotus ostreatus utilizando hoja de plátano deshidratada (Musa paradisiaca L., en relación con otros sustratos agrícolas

Directory of Open Access Journals (Sweden)

Omar Romero

2010-01-01

Full Text Available El objetivo de este estudio fue evaluar la producción de la cepa CP-50 de P. ostreatus en residuos de hoja de plátano deshidratada en contraste con otros sustratos agrícolas de desecho del Municipio de Tetela de Ocampo-Puebla. Las hojas de plátano (M. paradisiaca fueron colectadas en la zona de Martínez de la Torre, Veracruz- México y los demás sustratos agrícolas como paja de trigo (T. aestivum, paja de cebada (H. vulgare, pajilla de frijol (P. vulgaris y rastrojo de maíz (Z. mays se adquirieron en la región de Tetela de Ocampo, Puebla, México, para la obtención de fructificaciones en condiciones rurales. La cepa CP-50 demostró un adecuado crecimiento de aéreas miceliales sobre la hoja de plátano deshidratada con una tasa de producción de 1,5±0,1%. La mayor eficiencia biológica (EB se obtuvo en el sustrato paja de trigo, con 129,34±9,1%, la hoja de plátano deshidratada con 123,30±0,7%, y la pajilla de frijol obtuvo la EB más baja de 82,91±0,4%. Los resultados demostraron la factibilidad de cultivar la cepa CP-50 de Pleurotus ostreatus bajo condiciones rústicas en la sierra norte del estado de Puebla, al aprovechar los residuos de la cosecha de plátano de las regiones aledañas del municipio.

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

Science.gov (United States)

Regula, Julita; Suliburska, Joanna; Siwulski, Marek

2016-01-01

There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

Czech Academy of Sciences Publication Activity Database

Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

2009-01-01

Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

Directory of Open Access Journals (Sweden)

Purbowati Purbowati

2016-06-01

Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

Directory of Open Access Journals (Sweden)

Yueting Dai

2017-11-01

Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

Science.gov (United States)

Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

2017-01-01

Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

Electrochemistry Combined with LC-HRMS: Elucidating Transformation Products of the Recalcitrant Pharmaceutical Compound Carbamazepine Generated by the White-Rot Fungus Pleurotus ostreatus.

Science.gov (United States)

Seiwert, Bettina; Golan-Rozen, Naama; Weidauer, Cindy; Riemenschneider, Christina; Chefetz, Benny; Hadar, Yitzhak; Reemtsma, Thorsten

2015-10-20

Transformation products (TPs) of environmental pollutants must be identified to understand biodegradation processes and reaction mechanisms and to assess the efficiency of treatment processes. The combination of oxidation by an electrochemical cell (EC) with analysis by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is a rapid approach for the determination and identification of TPs generated by natural microbial processes. Electrochemically generated TPs of the recalcitrant pharmaceutical carbamazepine (CBZ) were used for a target screening for TPs formed by the white-rot fungus Pleurotus ostreatus. EC with LC-HRMS facilitates detection and identification of TPs because the product spectrum is not superimposed with biogenic metabolites and elevated substrate concentrations can be used. A group of 10 TPs formed in the microbial process were detected by target screening for molecular ions, and another 4 were detected by screening on the basis of characteristic fragment ions. Three of these TPs have never been reported before. For CBZ, EC with LC-HRMS was found to be more effective than software tools in defining targets for the screening and faster than nontarget screening alone in TP identification. EC with LC-HRMS may be used to feed MS databases with spectra of possible TPs of larger numbers of environmental contaminants for an efficient target screening.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

Directory of Open Access Journals (Sweden)

Milovanović Ivan

2014-01-01

Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

Directory of Open Access Journals (Sweden)

E. N. Vlasenko

2017-08-01

Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

DESIGN OF OYSTER (PLEUROTUS OSTREATUS PRODUCTION UNIT TAKING INTO ACCOUNT ITS AGROTECHNIC OF GROWIGN AND QUALITY AND QUANTITY OF ITS PRODUCTION

Directory of Open Access Journals (Sweden)

Marcel Golian

2015-02-01

Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.

Pleurotus ostreatus Yetiştiriciliğinde Katkı Maddesi Olarak Mısır Silajının Kullanımı

Directory of Open Access Journals (Sweden)

Beyhan Kibar

2016-05-01

Full Text Available Bu çalışma Pleurotus ostreatus mantarı yetiştiriciliğinde mısır silajının katkı maddesi olarak kullanım durumunu belirlemek amacıyla yapılmıştır. Çalışmada buğday samanına farklı oranlarda (%5, 10, 15 ve 20 mısır silajı ilave edilerek hazırlanan yetiştirme ortamları, verim ve morfolojik özellikler bakımından kontrol ile (%95 buğday samanı+%5 buğday kepeği karşılaştırılmıştır. Yetiştirme ortamlarının hazırlanmasında kullanılan materyallerin her birinin başlangıçtaki ve hazırlanan yetiştirme ortamlarının sterilizasyondan sonraki pH, karbon (C ve azot (N miktarı, C:N oranı ve mineral madde (K, P, Mg, Zn, Fe ve Mn içerikleri tespit edilmiştir. Verim bakımından kontrol ve farklı oranlarda mısır silajı ilave edilerek hazırlanan yetiştirme ortamları arasındaki farklılık istatistiki olarak önemli (P<0.05, morfolojik özellikler (şapka uzunluğu, sap uzunluğu ve sap kalınlığı bakımından ise önemsiz bulunmuştur. En yüksek verim (220.13 g kg-1 ortam buğday samanına %10 oranında mısır silajının ilave edilmesiyle hazırlanan yetiştirme ortamından, en düşük verim (153.75 g kg-1 ortam ise kontrol ortamından elde edilmiştir. Mısır silajının P. ostreatus yetiştiriciliğinde buğday kepeğine alternatif iyi ve ucuz bir katkı maddesi olarak kullanılabileceği sonucuna varılmıştır.

Intelligent use of knowledge in the EUM system

International Nuclear Information System (INIS)

Starynkevitch, B.

1987-05-01

A system accepting truely descriptive knowledge should receive (on build) meta-knowledge for using knowledge. The EUM system, in development, described in this paper, accepts such a knowledge. On the bottom level, it is a programming language (or a virtual machine) designed to be able to self-improve by introspection. Upper levels use meta-knowledge. EUM can access all objects its uses, it executes orders by using explicit methods. These can be meta-expertises. Hence, EUM can reason about its own operation, and cleverly use its knowledge and methods. Interaction with user is done by orders; thus it can be expertly driven. The initial inference engine is made of modules which can be replaced or completed by meta-expertises, of which some partial examples are given. Hence, it is possible to extend the knowledge langage, and the inference mechanism, by meta-expertises. In the same way, knowledge bases can be expertly compiled into orders [fr

Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

Science.gov (United States)

Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

2016-11-01

In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

Antiproliferative and apoptotic effect of Pleurotus ostreatus on human mammary carcinoma cell line (michigan cancer foundation-7

Directory of Open Access Journals (Sweden)

Krishnamoorthy Deepalakshmi

2016-01-01

Conclusion: The study demonstrates a potent anticancer property of P. ostreatus against human mammary carcinoma cells which might be of value in nutraceutical industry. Further investigations are essential to establish it as a treatment against breast cancer.

Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

Directory of Open Access Journals (Sweden)

Simone Parola

2017-10-01

Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey

Directory of Open Access Journals (Sweden)

Esra Altıntığ

2017-06-01

Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.

Decolourization and degradation of azo Dye, Synozol Red HF6BN ...

African Journals Online (AJOL)

Decolourization and degradation of azo Dye, Synozol Red HF6BN, by Pleurotus ostreatus. Sidra Ilyas, Skinder Sultan Sultan, Abdul Rehman. Abstract. The present paper focuses on the use of fungus, Pleurotus ostreatus, to decolorize and degrade azo dye, Synazol Red HF6BN. Decolorization study showed that P.

Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

Directory of Open Access Journals (Sweden)

Nelson Menolli Junior

2010-04-01

Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

Institute of Scientific and Technical Information of China (English)

Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

2004-01-01

@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Gómez Carabalí Arnulfo

2010-03-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y ‘estopa’ de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

The potential of Pleurotus-treated olive mill solid waste as cattle feed.

Science.gov (United States)

Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

2009-12-01

The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

Science.gov (United States)

Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

Bioconversion of apple pomace into a nutritionally enriched substrate by Candida utilis and Pleurotus ostreatus

DEFF Research Database (Denmark)

Villas-Bôas, Silas Granato; Esposito, E.; de Mendonca, M.M.

2003-01-01

, into an enriched substrate with increased digestibility for use as ruminant feed. After C. utilis fermentation, the protein level increased 100% and the mineral content 60%, accompanied by 8.2% of increase in the digestibility. The level of free sugars decreased 97% after substrate supplementation with ammonium...... the fermentation with P. ostreatus alone due to pectin and hemicellulose degradation. Considering the time required for fermentation, the C. utilis treatment was the most efficient treatment to convert apple pomace into a more nutritive substrate for ruminant feed....

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus.

Science.gov (United States)

Kholif, A E; Khattab, H M; El-Shewy, A A; Salem, A Z M; Kholif, A M; El-Sayed, M M; Gado, H M; Mariezcurrena, M D

2014-03-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health.

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus

Science.gov (United States)

Kholif, A. E.; Khattab, H. M.; El-Shewy, A. A.; Salem, A. Z. M.; Kholif, A. M.; El-Sayed, M. M.; Gado, H. M.; Mariezcurrena, M. D.

2014-01-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health. PMID:25049962

Effect of substrate on the growth, nutritional and bioactive ...

African Journals Online (AJOL)

rosemary

2016-07-06

Jul 6, 2016 ... growth, determining nutritional and bioactive components of two oyster mushroom, Pleurotus ostreatus and. Pleurotus ... and the method of cultivation are of major importance ..... rendered alkaline with a few drops of ammonia solution. 5 ..... production and non-enzymatic antioxidant activity of Pleurotus.

Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

Directory of Open Access Journals (Sweden)

Cristina Ramos

2011-01-01

Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

Pleurotus ostreatus

African Journals Online (AJOL)

badr

2011-11-07

Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

Phenol oxidation of petrol refinery wastewater catalyzed by Laccase

International Nuclear Information System (INIS)

Vargas, Maria Carolina; Ramirez, Nubia E.

2002-01-01

Laccase has been obtained through two different production systems, the first using Pleurotus ostreatus in solid-state fermentation, the second one using Trametes versicolor in submerged culture. Different substrates (by products from yeast, flour and beverage industries) have been evaluated in both systems. Maximum laccase yield with Pleurotus ostreatus (25 u/ml) was obtained in a wheat bran medium. The maximum enzyme concentration level using Trametes versicolor (25 u/ml) was achieved in a submerged system, containing 10% vinasse, 4,5% wheat bran and 0,2% molasses per liter of waste. Culture filtrate extracted from Pleurotus ostreatus was used to remove phenol from wastewater. The enzymatic treatment is effective over a wide pH and temperature range. The Laccase treatment has been successfully used to dephenolize industrial petrol refinery wastewater. The advantage of Laccase dephenolization is that this enzyme uses molecular oxygen as an oxidant

Use of medicinal plants in different composts for yield improvement of various strains of oyster mushroom

International Nuclear Information System (INIS)

Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.

2010-01-01

Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human

Content of Chemical Elements in Wood-Destroying Fungi

Directory of Open Access Journals (Sweden)

Strapáč I.

2016-12-01

Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Pleurotus ostreatus and Pleurotus pulmonarius

African Journals Online (AJOL)

STORAGESEVER

2010-03-15

Mar 15, 2010 ... was maintained on plate of potato dextrose agar (PDA). Degradation of ... 40% concentrate feed (40% corn, 10% wheat offal, 10% palm kernel cake, 20% ... meal) and 60% Pannicum maximum at 5% body weight. The rumen.

Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

Science.gov (United States)

Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

2014-01-01

The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

Fungal treatment of lignocellulosic biomass: Importance of fungal species, colonization and time on chemical composition and in vitro rumen degradability

NARCIS (Netherlands)

Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2015-01-01

The aim of this study is to evaluate fungal treatments to improve in vitro rumen degradability of lignocellulosic biomass. In this study four selective lignin degrading fungi, Ganoderma lucidum, Lentinula edodes, Pleurotus eryngii and Pleurotus ostreatus, were used to pre-treat lignocellulosic

African Journal of Biotechnology - Vol 14, No 8 (2015)

African Journals Online (AJOL)

Biodegradation of polycyclic aromatic hydrocarbons (PAHs) in spent and fresh cutting fluids contaminated soils by Pleurotus pulmonarius (Fries). Quelet and Pleurotus ostreatus (Jacq.) Fr. P. Kumm · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. CO Adenipekun, AR ...

Güney Kore’de Mantar Yetiştiriciliği

Directory of Open Access Journals (Sweden)

Mustafa Kemal Soylu

2016-03-01

Full Text Available Güney Kore’de son yıllarda mantar üretimi çok hızlı bir şekilde artmaktadır. Güney Kore mantar üretimi 173577 ton olup, bu üretimden yıllık 800 milyon dolar gelir elde edilmektedir. Farklı mantar türlerinin üretimi yapılmakta olup, üretim miktarının %31’ni kış mantarı (Flammulina velutipes, %26’sını kulacık mantarı (Pleurotus eryngii, %26’sını kayın mantarı (Pleurotus ostreatus, %13’ünü beyaz şapkalı kültür mantar (Agaricus bisporus, kalan %4’ünü ise Lentinula edodes, Ganoderma lucidum ve Phellinus vb. mantarlar oluşturmaktadır. 764ha’lık bir alanda mantar üretimi yapılmaktadır. Üretim alanının %31’inde kayın mantarı (Pleurotus ostreatus, %14’ünde kulacık mantarı (Pleurotus eryngii, %6’sında kış mantarı (Flummulina velutipes, %16’sında beyaz şapkalı kültür mantarı (Agaricus bisporus, %3’ünde Phellinus, %3’ünde ölümsüzlük mantarı (Ganoderma lucidum, %27’sı ise diğer mantar türlerinden oluşmaktadır. Kore’de mantar sıkça tüketilen bir gıda olup, kişi başına mantar tüketimi 4.2 kg’dır. Kütüklerde (meşe mantarı, ölümsüzlük mantarı ve Phellinus yetiştiricilik, ranzalarda yetiştiricilik (Agaricus bisporus ve Pleurotus ostreatus ve şişe kültürü (Flummulina velutipes, Pleurotus ostreatus, Pleurotus eryngii yaygın olarak yapılan yetiştirme sistemleridir.

High protein complementation with high fiber substrates for oyster ...

African Journals Online (AJOL)

Agricultural residues have been world widely accepted for oyster mushroom culture. In this study, we used wheat straw, barley straw, maize stem residue, and lawn residue as substrates coupled with wheat bran, rice bran and soybean powder as complements for the growth of Pleurotus florida and Pleurotus ostreatus as ...

Effect of fungal treatments of fibrous agricultural by-products on chemical composition and in vitro rumen fermentation and methane production

NARCIS (Netherlands)

Tuyen, D.V.; Phuong, H.N.; Cone, J.W.; Baars, J.J.P.; Sonnenberg, A.S.M.; Hendriks, W.H.

2013-01-01

Maize stover, rice straw, oil palm fronds and sugarcane bagasse were treated with the white-rot fungi Ceriporiopsis subvermispora, Lentinula edodes, Pleurotus eryngii, or Pleurotus ostreatus at 24 °C for 0–6 weeks. The fungi increased total gas production from oil palm fronds by 68–132%, but none of

Tae-Eum Type as an Independent Risk Factor for Obstructive Sleep Apnea

Directory of Open Access Journals (Sweden)

Seung Ku Lee

2013-01-01

Full Text Available Obstructive sleep apnea (OSA is prevalent and associated with several kinds of chronic diseases. There has been evidence that a specific type of Sasang constitution is a risk factor for metabolic and cardiovascular diseases that can be found in patients with OSA, but there are no studies that address the association between the Sasang constitution type (SCT and OSA. The purpose of this study was to investigate the association between the SCT and OSA. A total of 652 participants were included. All participants were examined for demographic information, medical history, and completed an interviewer-administered questionnaire on life style and sleep-related variables. Biochemical analyses were performed to determine the glucose and lipid profiles. An objective recording of OSA was done with an unattended home PSG using an Embla portable device. The apnea-hypopnea index (AHI and oxygen desaturation index (ODI were significantly higher in the Tae-eum (TE type as compared to the So-eum (SE and the So-yang (SY types. Even after adjusting for confounding variables, the TE type still had a 2.34-fold (95% CI, 1.11–4.94; P=0.0262 increased risk for OSA. This population-based cohort study found that the TE constitutional type is an independent risk factor for the development of OSA.

Usage of Edible Mushrooms in Various Food Products

Directory of Open Access Journals (Sweden)

Özge Süfer

2016-03-01

Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.

Heavy metal and proximate composition associated with the ...

African Journals Online (AJOL)

Changes in the heavy metal content and proximate composition during the 28 day composting of cassava peels used in the cultivation of the oyster mushrooms Pleurotus ostreatus strain EM-1 was studied. Significant dry weight variations of cellulose, hemicellulose and fat contents were observed from day 0 to 12.

Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

International Nuclear Information System (INIS)

Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

Interaction of uranium with Pleurotus sp

International Nuclear Information System (INIS)

Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

2002-01-01

Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

Aprovechamiento hidroeléctrico del río Eume

Directory of Open Access Journals (Sweden)

Yordi de Carricarte, Luciano

1960-02-01

Full Text Available En la provincia de La Coruña, junto a la desembocadura del río Eume, y en las proximidades del pueblo de Puentedeume, se ha realizado el aprovechamiento hidroeléctrico de dicho río, formado, en cuestión, por tres elementos básicos: una presa de embalse de doble curvatura, de 103 m de altura; una conducción forzada, integrada por un túnel de 2.839 m de longitud y dos tuberías de 310; y una central, equipada con dos grupos de 75.000 CV.

Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

International Nuclear Information System (INIS)

Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

2006-01-01

This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

Author Details

African Journals Online (AJOL)

Osafo, E L. Vol 47, No 1 (2014) - Articles Some blood indices in finisher broiler chickens fed cocoa pod husk (Theobroma cacao L.) fermented with Pleurotus ostreatus or treated with enzymes as ingredients in their diets. Abstract. ISSN: 0855-0042. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for ...

The effect of polythene colour container and three spawn rates on ...

African Journals Online (AJOL)

Pleurotus ostreatus), experiment was carried out to investigate the cultivation on barely straws substrate. This cultivation system can improve the economic status of the farmer. Field experiment was conducted at College of Agriculture, ...

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Antonella Amore | NREL

Science.gov (United States)

Pleurotus ostreatus," Biotechnol. Appl. Biochem. (2014) "Enzymes for Food and Beverage Industries and beverage processing fermentations," in Fermentation Processes Engineering in the Food : Current Situation, Challenges and Perspectives" in Advances in Food Biotechnology (2013) "

SUPPLEMENTATION OF COFFEE HUSK FERMENTED WITH Pleurotus ostreatus: EFFECT ON PERFORMANCE AND BLOOD PROFILE OF GASTROINTESTINAL NEMATODES INFECTED GOAT

Directory of Open Access Journals (Sweden)

I. Badarina

2016-03-01

Full Text Available The aim of this study was to investigate the potency of coffee husk fermented with P.ostreatus as a natural anthelmintic supplement by measuring the performance and blood profile of goat suffered gastrointestinal nematodes infection. Eighteen local male goats of Kacang goat with body weight of 9.23 ± 1.71 kg and aged at ± 10 months were arranged into three treatments in completely randomized design. The treatments were T0 (group without chemical anthelmintic treatment and no supplementation of fermented coffee husk, T1 (without chemical anthelmintic treatment, but supplied with fermented coffee husk and T2 (group with chemical anthelmintic and no supplementation of fermented coffee husk. All goats were offered a basal diet in the ratio of 60% natural grasses along with 40% concentrate. Fermented coffee husk was added in the diet as much as 6% from the dry matter need. The result showed that there were no significant effect to dry matter intake, daily weight gain, PCV value and eosinophil counts (P>0.05. The supplementation of fermented coffee husk (T1 enhanced Hb and red blood cell (RBC value (P<0.05 while no significant difference to T2. There were no nematodes infection in T1 and T2 with the eggs count were zero while the animals in T0 were still infected. This result indicated that fermented coffee husk can be used as a promising natural anthelmintic supplement with the improvement of Hb value, RBC, egg counts and daily weight gain.

Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

Directory of Open Access Journals (Sweden)

javad janpoor

2018-03-01

. eryngii. Materials and Methods: Sawdust was utilized as the main substrate obtained from beech and populous trees (1:1. After being rinsed off in water and supplemented with calcium sulfate (3% and calcium carbonate (3%, the substrate was filled in 20 × 40 cm polyethylene bags weighted to 800 grams. Sterilization was performed at 121 °C under pressure of 1.5 bars for two hours. A cultivated P. eryngii strain was then inoculated in the cooled material at a rate of 3% of dry/fresh substrate. The experiments were conducted based on a completely randomized design with five treatments and four replications, measuring mycelial growth (MG, number of fruiting bodies (NFB, mushroom weight, and biological efficiency (BE. AMG was measured in both test tubes and in petri plates in different pH levels (5.5, 7, and 8.5. Data were analyzed by JAMP 4.0, while graphs were drawn by Microsoft Excel 2007 and SigmaPlot 12.0 software. Results and Discussion: The pH of 7 was found to be the best for obtaining maximal MG under all treatments after seven days. The highest amount of MG was obtained with substrate No. 1, while the least was observed in the culture of substrate No. 5. The substrates No. 1 and No. 5 generated the highest and lowest NFBs (p≤0.05. However, there was no significant difference (p≥0.05 in NFB between substrates No. 1 and 3 or between substrates No. 2, 4 and 5. The BE percentages obtained from experimental treatments No. 1, 2, 3, 4, and 5 were 64.81, 49.74, 59.22, 28.72, and 19.8, respectively. The comparison of means of different growth characteristics revealed that there was no significant difference between substrates No. 1 and 3 or between substrates No. 4 and 5 (p≥0.05. Conclusion: In this time, only two species (Agaricus bisporus and P. ostreatus are producing in Iran, whereas at least 10 species of edible mushrooms are cultivating in the world. King oyster mushroom has low cost of production and distinguishable characteristics. Therefore, this mushroom can

Simultaneously upgrading biogas and purifying biogas slurry using cocultivation of Chlorella vulgaris and three different fungi under various mixed light wavelength and photoperiods.

Science.gov (United States)

Cao, Weixing; Wang, Xue; Sun, Shiqing; Hu, Changwei; Zhao, Yongjun

2017-10-01

In order to purify biogas slurry and biogas simultaneously, three different fungi, Pleurotus geesteranus (P. geesteranus), Ganoderma lucidum (G. lucidum), and Pleurotus ostreatus (P. ostreatus) were pelletized with Chlorella vulgaris (C. vulgaris). The results showed that the optimal light wavelength ratio for red:blue was 5:5 for these three different fungi-assisted C. vulgaris, resulting in higher specific growth rate as well as nutrient and CO 2 removal efficiency compared with other ratios. G. lucidum/C. vulgaris was screened as the best fungi-mialgae for biogas slurry purification and biogas upgrading with light/dark ratio of 14h:10h, which was also confirmed by the economic efficiency analysis of the energy consumptions. These results will provide a theoretical foundation for large-scale biogas slurry purifying and biogas upgrading using microalgae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Books received by the Rijksherbarium library

NARCIS (Netherlands)

NN,

1993-01-01

Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

Directory of Open Access Journals (Sweden)

Hanan Aref Hasan

2018-04-01

Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

Growth of colonies and hyphal ultrastructure of filamentous fungi grown on dibutyl phthalate and di(2-ethylhexyl)phthalate

OpenAIRE

Suárez-Segundo, J.L.; Vázquez-López, D.; Torres-García, J.L.; Ahuactzin-Perez, M.; Montiel-Martínez, N.; Tlecuitl-Beristain, S.; Sánchez, C.

2013-01-01

Phthalates are compounds that give fl exnbíüty to the plastics and are considered mutagens and teratogens. Mycelial growth rate, biomass production and hyphal diameter of the young and mature zones of colonies of Fusarium oxysporum, Mortierella alpina, Pleurotuspulmonarius, two strains of Pleurotus ostreatus (Po 37 and Po 83) and one strain of Pleurotus florida grown on glucose, di(2-ethylhexyl) phthalate (DEHP) and dibutyl phthalate were studied. F oxysporum had the highest mycelial growth r...

Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

DEFF Research Database (Denmark)

Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

2017-01-01

In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

African Journal of Biotechnology - Vol 11, No 88 (2012)

African Journals Online (AJOL)

Decolourization and degradation of azo Dye, Synozol Red HF6BN, by Pleurotus ostreatus · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Sidra Ilyas, Skinder Sultan Sultan, Abdul Rehman, 15422-15429 ...

Evaluation on the effects of P. ostreatus spent mushroom compost ...

African Journals Online (AJOL)

Realization in minimizing production cost for in vitro culture had brought to a study on application of P. ostreatus spent mushroom compost (SMC). Sterile nodal explants was inoculated on different treatments with 15 replicates each. Treatments were MS medium supplemented with different concentrations of SMC (1 and 2 ...

Radiopasteurization of sawdust media used in propagation of mushrooms

International Nuclear Information System (INIS)

Ito, Hitoshi; Sato, Tomotaro

1975-01-01

In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)

Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

Science.gov (United States)

Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

2014-01-01

Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

Biodegradation of hydrocarbons exploiting spent substrate from ...

African Journals Online (AJOL)

SAM

2014-08-13

Aug 13, 2014 ... Key words: Bioremediation, diesel, laccase, veratryl alcohol oxidase, Pleurotus ostreatus. ... Abbreviations: Lac, Laccases; MnP, Manganese peroxidases; VP, versatile peroxidases; VAO, veratryl alcohol oxidases; SMS, ..... Hacia un desarrollo sostenible del sistema de producción-consumo de los hongos ...

Pleurotus sajor caju

African Journals Online (AJOL)

Administrator

The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

Mechanical properties and chemical composition of beech wood exposed for 30 and 120 days to white-rot fungi

Science.gov (United States)

Ehsan Bari; Hamid Reza Taghiyari; Behbood Mohebby; Carol A. Clausen; Olaf Schmidt; Mohammad Ali Tajick Ghanbary; Mohammad Javad Vaseghi

2015-01-01

The effects of exposing specimens of Oriental beech [Fagus sylvatica subsp. orientalis (Lipsky) Greuter and Burdet] to the white-rot fungi Pleurotus ostreatus (Jacq.: Fr.) Kummer and Trametes versicolor (L.: Fr.) Pilát strain 325 have been studied concerning the mechanical properties and...

SACCHARIFICATION WITH Phanerochaete chrysosporium and ...

African Journals Online (AJOL)

cantocanche

2011-05-09

May 9, 2011 ... and Pleurotus ostreatus enzymatic extracts of pretreated banana ... reduction in the cost of production (Hahn-Hägerdal et al., ... economy, the saccharification of these materials is necessary ... To efficiently process lignocellulosic wastes, the lignin ..... industries depend on the success in saccharification.

Decolourization of remazol brilliant blue R by enzymatic extract and ...

African Journals Online (AJOL)

Ezedom Theresa

2013-09-25

Sep 25, 2013 ... extract and submerged cultures of a newly isolated. Pleurotus ostreatus ... stable to light, temperature, and microbial attack, making them recalcitrant ... was also cultivated in media formulated with inducers to increase laccase ... performed by using heat inactivated enzymes after incubation at. 100°C for 10 ...

Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

Directory of Open Access Journals (Sweden)

Jordan Merkuri

2016-03-01

Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

DOI: 10.18697/ajfand.79.16235 12243 PROXIMATE COMPOSITION ...

African Journals Online (AJOL)

Native rice husk (NRH) was fermented with Pleurotus ostreatus for 7, 14 and 21 days to improve the nutritional values. The proximate composition and amino acid profiles were determined. The results showed that crude fibre (CF), nitrogen free extract (NFE), acid detergent fibre (ADF), and neutral detergent fibre (NDF) were ...

Browse Title Index

African Journals Online (AJOL)

Items 101 - 150 of 11090 ... Asma Murtaza, Shazia Shafique, Tehmina Anjum, Sobiya Shafique. Vol 12, No 46 (2013), In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon, Abstract PDF. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, ...

African Journal of Biotechnology - Vol 12, No 46 (2013)

African Journals Online (AJOL)

In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, Meire C. N. Andrade, 6526- ...

Proximate composition and amino acid profile of rice husk ...

African Journals Online (AJOL)

Native rice husk (NRH) was fermented with Pleurotus ostreatus for 7, 14 and 21 days to improve the nutritional values. The proximate composition and amino acid profiles were determined. The results showed that crude fibre (CF), nitrogen free extract (NFE), acid detergent fibre (ADF), and neutral detergent fibre (NDF) were ...

Cultivation Techniques and Medicinal Properties of Pleurotus spp.

Directory of Open Access Journals (Sweden)

Andrej Gregori

2007-01-01

Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

So-Eum Type as an Independent Risk Factor for Irritable Bowel Syndrome: A Population-Based Study in Korea

Science.gov (United States)

Lee, Seung Ku; Yoon, Dae Wui; Yi, Hyeryeon; Lee, Si Woo; Kim, Jong Yeol; Kim, Jin Kwan; Hong, Jeong Hwa

2014-01-01

Abstract Objectives: It has been hypothesized that Sasang constitutional types (SCTs) have a specific hypoactive organ, which can account for vulnerability to related diseases or symptoms. This study examined the relationship between SCTs and irritable bowel syndrome (IBS). Design: Cross-sectional study in a population-based cohort study in Korea. Participants: 1362 individuals (705 men and 657 women) who participated in the Korean Genome and Epidemiology Study. Outcome measures: The participants were classified into SCTs by the integrated diagnostic model and asked about symptoms related to IBS using the Rome II criteria. Results: The prevalence of IBS differed significantly among the SCTs, with 33 (18.3%) of the So-eum (SE) type, 74 (9.9%) of the Tae-eum (TE) type, and 57 (13.2%) of the So-yang (SY) type having IBS. Even after adjustment for possible confounders, the SE type for both sexes continued to show 1.82-fold (95% confidence interval [CI], 1.05–3.16) excess odds of having IBS. Men with SE type had a 2.97 times (95% CI, 1.34–6.58) and a 2.50 times (95% CI, 1.15–5.47) significantly higher odds of having IBS than the TE and SY types, respectively. In analysis for the joint effect of SCT and psychological stress, the multivariate odds ratio of IBS was 3.21 (95% CI, 1.33–7.75) for the SE type and Psychological Well-Being Index-Short Form (PWI-SF) score (<27), and 5.83 (95% CI, 1.80–18.88) for the SE type and PWI-SF (≥27) compared with the TE type and PWI-SF score (<27). Conclusions: The SE type of SCT is an independent risk factor for IBS. The findings support the hypothesis that persons with SE type are vulnerable to gastrointestinal diseases. PMID:25148474

INFLUENCIA DE LA ADICIÓN DE UNA FUENTE DE NITRÓGENO EN LA PRODUCCIÓN DE LIGNINASAS INFLUENÇA DA ADIÇÃO DE UMA FONTE DE NITRÔGENIO NA PRODUÇÃO DE LIGNINASE INFLUENCE THE ADDITION OF NITROGEN SOURCE ON PRODUCTION OF LIGNINASES

Directory of Open Access Journals (Sweden)

LINA MARCELA GIL

2012-06-01

Full Text Available Durante el proceso de extracción de aceite de palma se producen grandes cantidades de residuos ricos en lignina y hemicelulosa denominados 'raquis', los cuales fueron un buen sustrato para el crecimiento del hongo Pleurotus ostreatus en fase solida durante 10 días de fermentación y a una temperatura de 28°C. Este trabajo se enfoco en evaluar la actividad enzimática de la lacasa, manganeso peroxidasa y lignina peroxidasa a partir del cultivo de Pleurotus ostreatus sobre residuos de palma modificando las condiciones de tamaño de partícula del sustrato (2, 3 y 4 cm y la fuente de nitrógeno (NH4Cl y KNO3. La actividad de la lignina peroxidasa fue casi nula en el sustrato sin suplemento. Por otro lado, las mejores condiciones encontradas para la producción de lacasa (7,42 U/L fue en cultivo sin suplemento con tamaño de partícula de 3cm, y para manganeso peroxidasa (20,29 U/L fue en el cultivo suplementado con nitrato de amonio (NH4Cl en una relación de carbono/nitrógeno de 20 y un tamaño de partícula de 3cm.Durante o processo de extração de óleo de palma são produzidas grandes quantidades de resíduos que são ricos em lignina e hemicelulose, os quais foram um bom substrato para o crescimento do fungo Pleurotus ostreatus na fermentação durante 10 dias a uma temperatura de 28 ° C na fase sólida. Este trabalho concentrou-se em avaliar a atividade enzimática da lacase, manganese peroxidase e lignina peroxidase de Pleurotus ostreatus em resíduos de palma de óleo mudando as condições do tamanho das partículas do substrato (2, 3 e 4 cm e fonte de nitrogênio (NH4Cl e KNO3. Os resultados mostraram que a atividade da peroxidase lignina foi quase zero no substrato sem adição de suplemento. Para a produção de lacase (7,42 U/L a melhor condição foi encontrada para um tamanho de partícula de três centímetros sem adição de suplemento, e para manganese peroxidasa (20,29 U/L a melhor condição é para uma cultura com nitrato

(e- Mind Thinking with e-Um

Directory of Open Access Journals (Sweden)

Damjan Kobal

2008-04-01

Full Text Available Modern technology has opened up many new possibilities in learning. Unfortunately, technology's uncritical use can also be damaging. In promoting productive and comprehensive IT learning the essential issue lies within the capability of the teacher and IT material to use computer to promote the basic cognitive aspects of learning and not only to manipulate the learner to remain motivated. Motivation is productive only if used with a focus towards knowledge and understanding. Especially in mathematics the concepts, we try to teach, are simple and logical, but often abstract. Smart use of computers can motivate this abstract concepts through intuitive simulations and animations as well as provide a sophisticated but simple insight into the causality of mathematical thinking. Thus, we argue that preparation of good e-Learning materials requires an almost contemplative focus on what we want to communicate in order not to overwhelm the student with too many effects that the technology offers. The concept and the vision of E-um project has been based on the above premises with a comprehensive system of simple technical, mathematical and didactical guidelines, together with a dynamic and creative system of permanent self evaluation and control. To support those premises new software package based on the Exe open source system has been developed. In order to provide an adequate technical framework for our conceptual ideas new emerging technologies with an emphasis on writing mathematical texts had been used.

PCB in the environment: bio-based processes for soil decontamination and management of waste from the industrial production of Pleurotus ostreatus.

Science.gov (United States)

Siracusa, Giovanna; Becarelli, Simone; Lorenzi, Roberto; Gentini, Alessandro; Di Gregorio, Simona

2017-10-25

Polychlorinated biphenyls (PCBs) are hazardous soil contaminants for which a bio-based technology for their recovery is essential. The objective of this study was to validate the exploitation of spent mushroom substrate (SMS), a low or null cost organic waste derived from the industrial production of P. ostreatus, as bulking agent in a dynamic biopile pilot plant. The SMS shows potential oxidative capacity towards recalcitrant compounds. The aim was consistent with the design of a process of oxidation of highly chlorinated PCBs, which is independent from their reductive dehalogenation. Feasibility was verified at a mesocosm scale and validated at pilot scale in a dynamic biopile pilot plant treating ten tons of a historically contaminated soil (9.28±0.08mg PCB/kg soil dry weight). Mixing of the SMS with the soil was required for the depletion of the contaminants. At the pilot scale, after eight months of incubation, 94.1% depletion was recorded. A positive correlation between Actinobacteria and Firmicutes active metabolism, soil laccase activity and PCB removal was observed. The SMS was found to be exploitable as a versatile low cost organic substrate capable of activating processes for the oxidation of highly chlorinated PCBs. Moreover, its exploitation as bulking agent in biopiles is a valuable management strategy for the re-utilisation of an organic waste deriving from the industrial cultivation of edible mushrooms. Copyright © 2017 Elsevier B.V. All rights reserved.

Using of gamma rays in stimulation and improvement of mushroom spawns plerotus ostreatus

International Nuclear Information System (INIS)

Hussein, O.S.; Atia, A.I.

2009-01-01

The objective of this work was activation and stimulation of plerotus ostreatus growth and increasing their yields by using of gamma rays, in addition to improvement of mushroom quality and shelf life.Exposing plerotus ostreatus to different doses of gamma rays 2.5, 5, 10 and 15 Gy to determine some of the basic composition of mushroom fruits achieved significant increase in yields and basic composition of resulted mushrooms. Also, increase in carbohydrates content, most of amino acids content and fatty acids content, mainly unsaturated fatty acid i.e., (C 16:1) and (C 18:1,2), which are essential for human nutrition as antioxidant. Whereas, there was a significant decrease in the total phenols content of the resulted fruits, which affected the quality and shelf life of mushroom fruits. All gamma rays doses used increased mushroom yield in fresh and dry wt basis. The recommended dose for spawn irradiation was 10 Gy to increase mushroom yields and its chemical components

Author Details - African Journals Online

African Journals Online (AJOL)

Shan, L. Vol 6, No 23 (2007) - Articles Seasonal and spatial root biomass and water use efficiency of four forage legumes in semiarid northwest China Abstract PDF · Vol 10, No 46 (2011) - Articles Extension of the shelf-life of fresh oyster mushrooms (Pleurotus ostreatus) by modified atmosphere packaging with chemical ...

Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

International Nuclear Information System (INIS)

Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

Characteristics of radiocesium concentration by mushrooms and microorganisms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio

2000-01-01

The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)

VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

Directory of Open Access Journals (Sweden)

Jamile Rosa RAMPINELLI

2010-11-01

Full Text Available

Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

Bioremediation of long-term PCB-contaminated soil by white-rot fungi

Czech Academy of Sciences Publication Activity Database

Stella, Tatiana; Covino, Stefano; Čvančarová, Monika; Filipová, Alena; Petruccioli, M.; D´Annibale, A.; Cajthaml, Tomáš

2017-01-01

Roč. 324, FEB 15 PART B (2017), s. 701-710 ISSN 0304-3894 R&D Projects: GA TA ČR TE01020218; GA ČR(CZ) GA15-02328S Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * Ligninolytic fungi * Polychlorinated biphenyls Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 6.065, year: 2016

Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

Science.gov (United States)

Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

2009-07-30

This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

Growth of the mycelium of different basidiomycetes on various media

International Nuclear Information System (INIS)

Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

2008-01-01

Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

Morphological and enzymatic response of the thermotolerant fungus Fomes sp. EUM1 in solid state fermentation under thermal stress.

Science.gov (United States)

Ordaz-Hernández, Armando; Ortega-Sánchez, Eric; Montesinos-Matías, Roberto; Hernández-Martínez, Ricardo; Torres-Martínez, Daniel; Loera, Octavio

2016-08-01

Thermotolerance of the fungus Fomes sp. EUM1 was evaluated in solid state fermentation (SSF). This thermotolerant strain improved both hyphal invasiveness (38%) and length (17%) in adverse thermal conditions exceeding 30°C and to a maximum of 40°C. In contrast, hyphal branching decreased by 46% at 45°C. The production of cellulases over corn stover increased 1.6-fold in 30°C culture conditions, xylanases increased 2.8-fold at 40°C, while laccase production improved 2.7-fold at 35°C. Maximum production of lignocellulolytic enzymes was obtained at elevated temperatures in shorter fermentation times (8-6 days), although the proteases appeared as a thermal stress response associated with a drop in lignocellulolytic activities. Novel and multiple isoenzymes of xylanase (four bands) and cellulase (six bands) were secreted in the range of 20-150 kDa during growth in adverse temperature conditions. However, only a single laccase isoenzyme (46 kDa) was detected. This is the first report describing the advantages of a thermotolerant white-rot fungus in SSF. These results have important implications for large-scale SSF, where effects of metabolic heat are detrimental to growth and enzyme production, which are severely affected by the formation of high temperature gradients. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Radiocesium uptake mechanisms in wild and culture mushrooms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.

1993-01-01

Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)

Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.

Science.gov (United States)

Plagemann, Ina; Krings, Ulrich; Berger, Ralf G

2014-01-01

The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.

Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

Science.gov (United States)

Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

2014-11-01

Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

SERVER

2008-01-04

Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

STORAGESEVER

2009-05-04

May 4, 2009 ... 1Department of Biochemistry and Biotechnology, Kwame Nkrumah University of Science and ... composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot ... as biocatalyst to improve the nutritional status of CPH. ... L.) is an important commodity in Ghana because of the.

New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-06-01

Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

and extracellular laccase isoenzymes from Pleurotus ostreatus

African Journals Online (AJOL)

ZMG

Colonia Vicentina, Delegación Iztapalapa, 09340 México D.F., México. 3Centro de .... mechanic homogenization of the mycelium in physiological solution, with the help of an electric ..... pubescens and regulation of its synthesis by metal ions.

ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

Directory of Open Access Journals (Sweden)

Gabriela Popa

2016-11-01

Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

African Journals Online (AJOL)

Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

Diversity of edible mushrooms in pakistan

International Nuclear Information System (INIS)

Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

2007-01-01

Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

Microbiological decomposition of bagasse after radiation pasteurization

International Nuclear Information System (INIS)

Ito, Hitoshi; Ishigaki, Isao

1987-01-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

Microbiological decomposition of bagasse after radiation pasteurization

Energy Technology Data Exchange (ETDEWEB)

Ito, Hitoshi; Ishigaki, Isao

1987-11-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation.

Science.gov (United States)

Kobayashi, Hiroko; Motoyoshi, Naomi; Itagaki, Tadashi; Suzuki, Mamoru; Inokuchi, Norio

2015-01-01

RNase He1 from Hericium erinaceus, a member of the RNase T1 family, has high identity with RNase Po1 from Pleurotus ostreatus with complete conservation of the catalytic sequence. However, the optimal pH for RNase He1 activity is lower than that of RNase Po1, and the enzyme shows little inhibition of human tumor cell proliferation. Hence, to investigate the potential antitumor activity of recombinant RNase He1 and to possibly enhance its optimum pH, we generated RNase He1 mutants by replacing 12 Asn/Gln residues with Asp/Glu residues; the amino acid sequence of RNase Po1 was taken as reference. These mutants were then expressed in Escherichia coli. Using site-directed mutagenesis, we successfully modified the optimal pH for enzyme activity and generated a recombinant RNase He1 that inhibited the proliferation of cells in the human leukemia cell line. These properties are extremely important in the production of anticancer biologics that are based on RNase activity.

QUANTIFICATION AND BIOREMEDIATION OF ENVIRONMENTAL SAMPLES BY DEVELOPING A NOVEL AND EFFICIENT METHOD

Directory of Open Access Journals (Sweden)

Mohammad Osama

2014-06-01

Full Text Available Pleurotus ostreatus, a white rot fungus, is capable of bioremediating a wide range of organic contaminants including Polycyclic Aromatic Hydrocarbons (PAHs. Ergosterol is produced by living fungal biomass and used as a measure of fungal biomass. The first part of this work deals with the extraction and quantification of PAHs from contaminated sediments by Lipid Extraction Method (LEM. The second part consists of the development of a novel extraction method (Ergosterol Extraction Method (EEM, quantification and bioremediation. The novelty of this method is the simultaneously extraction and quantification of two different types of compounds, sterol (ergosterol and PAHs and is more efficient than LEM. EEM has been successful in extracting ergosterol from the fungus grown on barley in the concentrations of 17.5-39.94 µg g-1 ergosterol and the PAHs are much more quantified in numbers and amounts as compared to LEM. In addition, cholesterol usually found in animals, has also been detected in the fungus, P. ostreatus at easily detectable levels.

[Cellulose acetate membrane electrophoresis CAE and Raman spectroscopy as a method identification of beta-glucans, used as biologically and therapeutically active biomaterials].

Science.gov (United States)

Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga

2012-01-01

The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

Directory of Open Access Journals (Sweden)

Marli Camassola

2013-01-01

Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

Treatment of micropollutants in municipal wastewater: study of a sequential batch biofilter

OpenAIRE

Contijoch Culleré, Andreu

2014-01-01

All the experimental part of this final project was done at Laboratoire de Biotechnologie Environnementale (LBE) from the École Polytechnique Fédérale de Lausanne (EPFL), Switzerland, during 6 months (November 2013- May 2014). A fungal biofilter composed of woodchips was designed in order to remove micropollutants from the effluents of waste water treatment plants. Two fungi were tested: Pleurotus ostreatus and Trametes versicolor in order to evaluate their efficiency for the r...

Vitamin D2 Stability During the Refrigerated Storage of Ultraviolet B-Treated Cultivated Culinary-Medicinal Mushrooms.

Science.gov (United States)

Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa

2017-01-01

The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.

nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

African Journals Online (AJOL)

DJFLEX

The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

Lignocellulose degradation by Pleurotus ostreatus in the presence of cadmium

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2003-01-01

Roč. 220, - (2003), s. 235-240 ISSN 0378-1097 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : cadmium * cellulose * hemicellulose Subject RIV: EE - Microbiology, Virology Impact factor: 1.932, year: 2003

Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

Science.gov (United States)

Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

2012-01-01

Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

Directory of Open Access Journals (Sweden)

Maura Téllez-Téllez

2016-03-01

Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

International Nuclear Information System (INIS)

Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

2017-01-01

The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

African Journals Online (AJOL)

The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

Papel de la vitamina C y los β-glucanos sobre el sistema inmunitario: revisión

OpenAIRE

Ismael San Mauro-Martín; Elena Garicano Vilar

2016-01-01

Existe un creciente interés en conocer herramientas nutricionales al alcance de profesionales para el manejo de la modulación del sistema inmunitario del humano. Esta revisión bibliográfica se centra en los potenciales efectos beneficiosos sobre el sistema inmune atribuidos a productos alimenticios compuestos por β-glucanos de Pleurotus ostreatus, y/o Vitamina C. Este trabajo muestra el resultado obtenido en diferentes estudios con la ingesta de estos componentes sobre el sistema inmunitario,...

Papel de la vitamina C y los β-glucanos sobre el sistema inmunitario: revisión

OpenAIRE

San Mauro-Martín, Ismael; Garicano-Vilar, Elena

2015-01-01

Existe un creciente interés en conocer herramientas nutricionales al alcance de profesionales para el manejo de la modulación del sistema inmunitario del humano. Esta revisión bibliográfica se centra en los potenciales efectos beneficiosos sobre el sistema inmune atribuidos a productos alimenticios compuestos por β-glucanos de Pleurotus ostreatus, y/o Vitamina C. Este trabajo muestra el resultado obtenido en diferentes estudios con la ingesta de estos componentes sobre el sistema inmunitario,...

Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

2010-01-01

Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

Science.gov (United States)

Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

2015-10-01

Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

Diseases and pests noxious to Pleurotus spp. mushroom crops.

Science.gov (United States)

Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.

Science.gov (United States)

Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana

2016-05-01

A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.

Performance of oyster mushroom (Pleurotus ostreatus) in different ...

African Journals Online (AJOL)

USER

2012-05-08

May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

screening of pleurotus ostreatus and gleophylum sepiarium strains ...

African Journals Online (AJOL)

USER

sawdust dump-site were screened for protease enzyme production. High yields of protease ... glass spreader, sterilized by dipping in 95% ethanol and flaming. .... because higher temperatures led to a sharp decrease in activity. The result is ...

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention.

Science.gov (United States)

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-07-20

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

A two-dimensional protein map of Pleurotus ostreatus microsomes-proteome dynamics

Czech Academy of Sciences Publication Activity Database

Petráčková, Denisa; Halada, Petr; Bezoušková, Silvia; Křesinová, Zdena; Svobodová, Kateřina

2016-01-01

Roč. 61, č. 1 (2016), s. 63-71 ISSN 0015-5632 R&D Projects: GA ČR(CZ) GA15-02328S Institutional support: RVO:61388971 Keywords : FUNGUS * EXPRESSION * BIODEGRADATION Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides Impact factor: 1.521, year: 2016

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-05-01

One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

Directory of Open Access Journals (Sweden)

Paccola Edneia A. de Souza

2001-01-01

Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

Directory of Open Access Journals (Sweden)

Miriam HAIDUKOWSKI

2017-05-01

Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

International Nuclear Information System (INIS)

Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

2007-01-01

The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

Preliminary investigation into the use of Pleurotus tuber-regium ...

African Journals Online (AJOL)

The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

Directory of Open Access Journals (Sweden)

Evânia Geralda Silva

2007-03-01

Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

Antioxidant properties of mushroom mycelia obtained by batch cultivation and tocopherol content affected by extraction procedures.

Science.gov (United States)

Vamanu, Emanuel

2014-01-01

The determination of the antioxidant potential of lyophilized mushroom mycelia from 5 strains of the species Pleurotus ostreatus and Coprinus comatus (obtained by submerged cultivation in batch system) was analyzed as ethanolic extracts by evaluating ABTS and the hydroxyl scavenging activity, FRAP method, the chelating capacity, the inhibition of human erythrocyte hemolysis, and the inhibition of xanthine oxidase activity. The main compounds present in all extracts were determined by HPLC chromatography. Overall, results demonstrated that the biologically active substances content is modulated by the extraction method used. The most beneficial extract, characterized by determining the EC50 value, was that of C. comatus M8102, followed by P. ostreatus PQMZ91109. Significant amount of α-tocopherol (179.51 ± 1.51 mg/100 g extract) was determined as well as flavones such as rutin and apigenin. In the P. ostreatus PQMZ91109 extract, 4.8 ± 0.05 mg/100 g extract of tocopherol acetate known to play a significant role as an antioxidant in skin protection against oxidative stress generated by UV rays was determined. The various correlations (r (2) = 0.7665-0.9426 for tocopherol content) assessed and the composition of extracts in fluidized bed from the mycelia of the tested species depicted a significant pharmacological potential as well as the possibility of usage in the development of new functional products.

Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

OpenAIRE

Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

2007-01-01

Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

Science.gov (United States)

Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

2011-01-01

Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

African Journals Online (AJOL)

Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

OpenAIRE

Albuquerque, Margeli Pereira de

2010-01-01

As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

Using natural and synthetic growth regulators of plants in industrial mycology and malting

Directory of Open Access Journals (Sweden)

O. V. Kuznetcova

2010-07-01

Full Text Available Data on the expansion of the use the plants growth regulators in different areas are presented. The positive impact of the growth stimulators on the development of the Pleurotus ostreatus mycelium’s on agar nutrient media during surface cultivation is shown. The results for growth regulators stimulating effect on the fungus biosynthetic activity in submerged cultures are obtained. The possibility of using fumar and heteroauxin for malting is considered. The decline of malting time and increase of amylolytic activity of the malt are recorded.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Energy Technology Data Exchange (ETDEWEB)

Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)

2010-12-15

The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Science.gov (United States)

Bercu, V.; Negut, C. D.; Duliu, O. G.

2010-12-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

International Nuclear Information System (INIS)

Bercu, V.; Negut, C.D.; Duliu, O.G.

2010-01-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

Produção enzimática de biodiesel a partir de resíduos agro-industriais usando a lipase imobilizada de origem microbiana

OpenAIRE

Almeida, Marta Neves Rebelo de

2016-01-01

Trabalho Final de Mestrado para obtenção do grau de Mestre em Engenharia Química e Biológica O presente trabalho teve como objectivo a optimização do cultivo de várias estirpes mutantes bacterianas Pseudomonas aeruginosa da estirpe AI3(P. aeruginosa AI3), estirpe Ph3B (P. aeruginosa Ph3B) e estirpe L10 (P. aeruginosa L10) e fúngicas (Phlebia rufa (PM), Ganoderma lucidum violeta(GV), Pleurotus ostreatus (PO) e Ganoderma carnosum (G)), para a produ...

Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

Directory of Open Access Journals (Sweden)

E.P. Vetchinkina

2017-05-01

Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.

Science.gov (United States)

Morales, Viviana; Sánchez, Jose E

2017-01-01

The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.

Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2016-09-01

Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

Biomass production of pleurotus sajor-caju by submerged culture fermentation

International Nuclear Information System (INIS)

Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

2006-01-01

The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

The effects of composting on the nutritional composition of fibrous bio-regenerative life support systems (BLSS) plant waste residues and its impact on the growth of Nile tilapia ( Oreochromis niloticus)

Science.gov (United States)

Gonzales, John M.; Lowry, Brett A.; Brown, Paul B.; Beyl, Caula A.; Nyochemberg, Leopold

2009-04-01

Utilization of bio-regenerative life support systems (BLSS) plant waste residues as a nutritional source by Nile tilapia ( Oreochromis niloticus) has proven problematic as a result of high concentrations of fibrous compounds in the plant waste residues. Nutritional improvement of plant waste residues by composting with the oyster mushroom ( Pleurotus ostreatus), and the effects on growth and nutrient utilization of Nile tilapia fed such residues were evaluated. Five Nile tilapia (mean weight = 70.9 ± 3.1 g) were stocked in triplicate aquaria and fed one of two experimental diets, cowpea (CP) and composted cowpea (CCP), twice daily for a period of 8 weeks. Composting of cowpea residue resulted in reduced concentrations of nitrogen-free extract, hemi-cellulose and trypsin inhibitor activity, though trypsin inhibitor activity remained high. Composting did not reduce crude fiber, lignin, or cellulose concentrations in the diet. No significant differences ( P tilapia fed CP and CCP. These results suggest that P. ostreatus is not a suitable candidate for culture in conjunction with the culture of Nile tilapia. Additional work is needed to determine what, if any, benefit can be obtained from incorporating composted residue as feed for Nile tilapia.

Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

International Nuclear Information System (INIS)

Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook

2003-01-01

A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

Biotechnological modification of lignin

Energy Technology Data Exchange (ETDEWEB)

1989-01-01

A literature search of organisms capable of degrading lignin was conducted. Four fungi were selected for study and these were Phanerochaete chrysosporium, Chrysosporium pruinosum, Phlebia tremellosus and Trametes versicolor. Other organisms, Pleurotus ostreatus, Pleurotus florida and Lentinus edodes were also tested in preliminary experiments. All cultures were screened for their ability to degrade the lignin component of aspen sawdust and also lignin extracted from steam-exploded wood. This type of screen was followed by analysis of culture filtrates for the presence of ligninase, the marker enzyme for lignin degradation. Phanerochaete chrysosporium and consequently chosen for further studies in fermentors. Considerable efforts were directed to production of ligninase in fermentors. Only when Chrysosporium pruinosum was pre-cultured in a shake flask for 4 days and then transferred to a fermentor could ligninase activity be detected. The enzyme from shake flasks has been concentrated ready for use in bench-scale studies on cell-free depolymerization of lignin. 13 refs., 8 tabs.

ORF Alignment: NC_004337 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_000913 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_004741 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_002655 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_002695 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_004431 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

Studies on Possible Activation of Microbial Laccase Production Using Gamma Irradiation

International Nuclear Information System (INIS)

ElKenawy, N.M.A.

2013-01-01

Enzyme production is an essential discipline in biotechnology. Laccase enzyme is an oxidoreductase that catalyzes the oxidation of various aromatic compounds, with the simultaneous reduction of oxygen into water. Although the enzyme is present in plants, insects and bacteria, the most important source is fungi and particularly the Basidiomycetes. In fungi, the enzyme plays a role in the removal of potentially toxic phenols arising during fungal morphogenesis, sporulation, phytopathogensis and virulence. In this work, the production of fungal laccase was optimized from a local isolate of Pleurotus ostreatus using solid state fermentation. Factorial design was used to study the effect of several nutrients and inducer on enzyme activity. Purification, characterization of the enzyme, the effect of temperature and ph were studied. The effect of gamma radiation on fungal growth and enzyme production was investigated. The optimization of the production conditions yielded an enzyme with activity over 32,054 IU/gram of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds and consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80 % reduction in color in case of methyl orange and trypan blue. The decolorisation of dyes is a simple method to assess the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications, which opens a door towards using of fungal laccase in further biotechnological processes.

Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

NARCIS (Netherlands)

Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

2006-01-01

When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

Concentration of radiocesium in cultivated mushrooms and substrates

International Nuclear Information System (INIS)

Miyake, Sadaaki; Higasa, Mamoru; Urabe, Ken-ichi; Haraguchi, Masato; Omura, Toshitaka

2008-01-01

Concentrations of 134 Cs, 137 Cs and 40 K in mushrooms cultivated in Saitama prefecture and those substrates were measured by gamma-ray spectrometry. In all mushrooms and substrates, 134 Cs was not detected. Concentrations of 137 Cs in mushrooms were in the range of 0.012 - 2.1 Bq/kg·fresh, and those in substrates were in the range of 0.080 - 1.8 Bq/kg·dry. Concentrations of 137 Cs in mushrooms varied widely with mushroom species, and the average concentration of 137 Cs in Lentinus edodes (Shiitake) was over 30 times higher than that in Pleurotus ostreatus (Hiratake). Mushroom-to-substrate concentration ratios of 137 Cs (fresh/dry) were 0.11-0.53. They were higher than the reported transfer factors for common agricultural plants. (author)

Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

Science.gov (United States)

Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

2010-10-01

Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

Science.gov (United States)

Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

2014-01-01

Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

Usability and Workflow Evaluation of “RhEumAtic Disease Activity” (READY)

Science.gov (United States)

Yen, Po-Yin; Lara, Barbara; Lopetegui, Marcelo; Bharat, Aseem; Ardoin, Stacy; Johnson, Bernadette; Mathur, Puneet; Embi, Peter J.

2016-01-01

Summary Background RhEumAtic Disease activitY (READY) is a mobile health (mHealth) application that aims to create a shared platform integrating data from both patients and physicians, with a particular emphasis on arthritis disease activity. Methods We made READY available on an iPad and pilot implemented it at a rheumatology out-patient clinic. We conducted 1) a usability evaluation study to explore patients’ and physicians’ interactions with READY, and 2) a time motion study (TMS) to observe the clinical workflow before and after the implementation. Results A total of 33 patients and 15 physicians participated in the usability evaluation. We found usability problems in navigation, data entry, pain assessment, documentation, and instructions along with error messages. Despite these issues, 25 (75,76%) patients reported they liked READY. Physicians provided mixed feedback because they were concerned about the impact of READY on clinical workflow. Six physicians participated in the TMS. We observed 47 patient visits (44.72 hours) in the pre-implementation phase, and 42 patient visits (37.82 hours) in the post-implementation phase. We found that patients spent more time on READY than paper (4.39mins vs. 2.26mins), but overall, READY did not delay the workflow (pre = 52.08 mins vs. post = 45.46 mins). This time difference may be compensated with READY eliminating a workflow step for the staff. Conclusion Patients preferred READY to paper documents. Many found it easier to input information because of the larger font size and the ease of ‘tapping’ rather than writing-out or circling answers. Even though patients spent more time on READY than using paper documents, the longer usage of READY was mainly due to when troubleshooting was needed. Most patients did not have problems after receiving initial support from the staff. This study not only enabled improvements to the software but also serves as good reference for other researchers or institutional decision

Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

Directory of Open Access Journals (Sweden)

Maria Teresa Branà

Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

Comparative effect of steam and gamma irradiation sterilization of sawdust compost on the yield, nutrient and shelf-life of Pleurotus ostreatus (Jacq. Ex.Fr) Kummer stored in two different packaging materials

International Nuclear Information System (INIS)

Kortei, J. N. K.

2015-06-01

influence of radiation on drying rate of oyster mushrooms were determined by five non- linear regression models (Lewis, Page, Henderson and Pabis, Diffussion and Wang and Singh by the estimation of R 2 , X 2 and RMSE). The total phenolic contents, flavonoids and free radical scavenging activity DPPH (2, 2' - diphenyl- 1- picrylhydrazyl) as sources of natural antioxidant of stored mushroom in polypropylene and polythene packs were determined using aqueous, ethanol and methanol extracts by Folin- Ciocalteau method. Finally, the influence of gamma irradiation on the colour characteristics were determined by the Hunter L * a* b* and Browning Index (BI) method while textural characteristics were determined mechanically by measuring Texture Hardness (kgf), Fracturability (N), Cohesiveness, Chewiness (N), Springiness (mm), Gumminess, Adhesiveness (kgf.s) and Resilience of fresh, dry and rehydrated mushrooms. The mechanical estimation to textural characters obtained were compared mean scores on 9-point Hedonic scale of sensory acceptability attributes (appearance, colour, aroma, taste, mouthfeel and overall acceptability of coded samples in two packaging containers. The survey demonstrated the popularity of drum (moist heat) technique of sterilization in Ghana. Majority (64%) of the respondents were dissatisfied with the method of sterilization of compost and spawn substrate with 36% indicated the method was alright by them. Majority (82%) of the respondents have never heard of sterilization of food or mushroom by gamma irradiation technique. Because of the high contamination rate of the steam sterilized compost and spawn substrate, the farmers indicated the need to achieve better sterilization for these starting material for mushroom cultivation. Drying was selected as the most popular preservation method as the fresh fruiting bodies have short shelf-life and P. ostreatus was found to be the most preferred mushroom followed by the termite mushroom (Termitomyces sp.). The

Nutriceutical potential of Pleurotus tuber-regium sclerotium

Directory of Open Access Journals (Sweden)

R. C. Ohiri

2018-04-01

Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

Electrical stimulation in white oyster mushroom (Pleurotus florida) production

Science.gov (United States)

Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

2017-09-01

White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

Science.gov (United States)

This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

Fungi-based treatment of brewery wastewater-biomass production and nutrient reduction.

Science.gov (United States)

Hultberg, M; Bodin, H

2017-06-01

The beer-brewing process produces high amounts of nutrient-rich wastewater, and the increasing number of microbreweries worldwide has created a need for innovative solutions to deal with this waste. In the present study, fungal biomass production and the removal of organic carbon, phosphorus and nitrogen from synthetic brewery wastewater were studied. Different filamentous fungi with a record of safe use were screened for growth, and Trametes versicolor, Pleurotus ostreatus and Trichoderma harzianum were selected for further work. The highest biomass production, 1.78 ± 0.31 g L -1 of dry weight, was observed when P. ostreatus was used for the treatment, while T. harzianum demonstrated the best capability for removing nutrients. The maximum reduction of chemical oxygen demand, 89% of the initial value, was observed with this species. In the removal of total nitrogen and phosphorus, no significant difference was observed between the species, while removal of ammonium varied between the strains. The maximum reduction of ammonium, 66.1% of the initial value, was also found in the T. harzianum treatment. It can be concluded that all treatments provided significant reductions in all water-quality parameters after 3 days of growth and that the utilisation of filamentous fungi to treat brewery wastewater, linked to a deliberate strategy to use the biomass produced, has future potential in a bio-based society.

Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

Directory of Open Access Journals (Sweden)

Eustáquio Souza Dias

2003-12-01

Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

The comparative study on screening of pleurotus polysaccharide high-yield strains by use of ion beam implantation and composite mutagenesis

International Nuclear Information System (INIS)

Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian

2009-01-01

In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)

Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments

Directory of Open Access Journals (Sweden)

S.M. Badalyan

2004-04-01

Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.

Effects of oriental medicine music therapy in an ovarian cancer patient with So-Eum-type constitution: a case report

Directory of Open Access Journals (Sweden)

Seung-Hyun Lee

2015-03-01

Full Text Available The cancer incidence in Korea has been increasing, although there is a serious lack of supportive care for the treatment and management of the rapidly increasing number of cancer patients, and there is an immense need for therapeutic interventions to support cancer patients. A 47-year-old So-Eum-type Korean female patient, who was diagnosed with ovarian cancer, had been receiving chemotherapies. She was experiencing pain due to swelling of her hands and feet, and under extreme stress due to hardships of life. During the patient's fourth chemotherapy treatment, she received oriental medicine music therapy twice per week for 2 weeks, for 1 hour each time (4 sessions in total. A self-administered questionnaire and the visual analog scale were used to assess and determine the level of negative and positive feelings. After receiving the oriental medicine music therapy, her negative and positive feelings as well as the visual analog scale score that reflects subjective health conditions have improved and stabilized. This case report suggests the potential of oriental medicine music therapy as a complementary and alternative medical treatment method to promote and enhance quality of life and health conditions of cancer patients in postsurgical care and chemotherapy treatment.

Effects of oriental medicine music therapy in an ovarian cancer patient with So-Eum-type constitution: a case report.

Science.gov (United States)

Lee, Seung-Hyun; Song, Eunhye; Kim, Seul-Ki

2015-03-01

The cancer incidence in Korea has been increasing, although there is a serious lack of supportive care for the treatment and management of the rapidly increasing number of cancer patients, and there is an immense need for therapeutic interventions to support cancer patients. A 47-year-old So-Eum -type Korean female patient, who was diagnosed with ovarian cancer, had been receiving chemotherapies. She was experiencing pain due to swelling of her hands and feet, and under extreme stress due to hardships of life. During the patient's fourth chemotherapy treatment, she received oriental medicine music therapy twice per week for 2 weeks, for 1 hour each time (4 sessions in total). A self-administered questionnaire and the visual analog scale were used to assess and determine the level of negative and positive feelings. After receiving the oriental medicine music therapy, her negative and positive feelings as well as the visual analog scale score that reflects subjective health conditions have improved and stabilized. This case report suggests the potential of oriental medicine music therapy as a complementary and alternative medical treatment method to promote and enhance quality of life and health conditions of cancer patients in postsurgical care and chemotherapy treatment.

Effect of bacteria on the degradation ability of Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Válková, H.; Novotný, Čeněk; Malachová, K.; Šlosarčíková, P.; Fojtík, J.

2017-01-01

Roč. 584, APR 15 (2017), s. 1114-1120 ISSN 0048-9697 Institutional support: RVO:61388971 Keywords : Fungal biofilms * Biodegradation * Anthraquinone dye Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.900, year: 2016

Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.; Matel, L.

2007-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2015-12-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

A. K. Veligodska

2015-11-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

Improving the yield and quality of DNA isolated from white-rot fungi.

Science.gov (United States)

Kuhad, R C; Kapoor, R K; Lal, R

2004-01-01

A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

Influence of growing conditions on heavy metals content in cultivated mushrooms

International Nuclear Information System (INIS)

Kmitene, L.

1997-01-01

The aim of the research was to investigate the influence of growing terms, microclimate conditions and growing medium on the mushroom harvest and quality. Champignons were grown according to the Polish technology. Pleurotus ostreatus was grown in perforate sacks using chopped wheat straw. Mycelium was sowed in different terms. It was established that the harvest of mushrooms, especially their quality, depends not only on growing conditions, but also on the kind of mushrooms, composte quality, mushroom size (diameter of cap), picking of mushrooms, storage time and other conditions. The technology of mushroom growing will be developed after studying all the factors determining the content of heavy metals and radiation in mushrooms

Inmovilización de hongos ligninolíticos para la remoción del colorante negro reactivo 5

Directory of Open Access Journals (Sweden)

Jorge Andrés Fernández

2009-01-01

Full Text Available La presencia de colorantes azoicos en aguas residuales de la industria textil es un problema ambiental y sanitario, porque muchos de estos compuestos son cancerígenos. Los tratamientos biológicos son una alternativa para la remoción de ese tipo de colorantes. En el presente trabajo se evaluó el efecto de tres hongos de podredumbre blanca, Trametes versicolor, Pleurotus ostreatus y Phanerochaete chrysosporium sobre la decoloración de un agua que contiene colorante negro reactivo 5 (NR5, ampliamente usado en la industria textil. Se estudió la inmovilización de estos hongos en dos soportes, espuma de poliuretano y estropajo (L. cylíndrica para seleccionar el mejor soporte y el hongo con mayor capacidad para la decoloración. Ambos soportes fueron igualmente efectivos, pero se seleccionó estropajo por ser un producto natural. El hongo que generó los mayores porcentajes de decoloración en 4 días fue Trametes versicolor, con 96%, 98% y 98% para agua con concentración de NR5 300 ppm, 150 ppm y 75 ppm, respectivamente. La actividad lacasa para cada concentración de NR5 fue 8 U L-1, 7 U L-1 y 5 U L-1. Waste water from the textile industry represents a major environmental and health problem because it contains azo dyes whose carcirogenic effect has been tested in research. Biological treatment represents a valuable alternative for removing these dyes. The effect of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium rot fungi on decoloration of water containing reactive black five (NR5 textile dye was evaluated in this work. Immobilising the fungi on polyurethane foam and luffa sponge (Luffa cylindrica supports was studied in order to select the best support and the fungi having the best decolorisation. Both supports were equally effective; however, the luffa sponge was selected as being a natural product. Trametes versicolor produced the highest decolorisation percentages in four days (96%, 98% and 98% for 300 ppm, 150

Adsorption characteristics of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ) by four kinds of immobilized fungi residues.

Science.gov (United States)

Li, Xia; Zhang, Dan; Sheng, Fei; Qing, Hui

2018-01-01

This study investigated the adsorption characteristics of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ) by immobilized Flammulina velutipes, Auricularia polytricha, Pleurotus eryngii and Pleurotus ostreatus residues. Lagergren model, elovich and intraparticle diffusion model were used to present the adsorption kinetics, and it was proved that Langmuir isotherm model and pseudo-second order kinetics are the best suitable model with high correlation coefficient to characterize the adsorption process of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ). The results showed that adsorption process finished in 120min at pH 6.0. The adsorption rate of Cu 2+ , Zn 2+ and Hg 2+ were reached to 53.8-84.1% of total in the initial 60min, and finished in 120min. Ion exchange and complexation of F. velutipes were the main mechanisms for adsorption of metal ions by characterizations of Scanning electron microscopy (SEM) and Fourier transform infrared (FTIR). In addition the functional group of cell walls such as hydroxyl, amide, carbonyl, phosphoric played a critical role in ions adsorption of edible mushroom residues. Cu 2+ , Zn 2+ and Hg 2+ in wastewater could be efficiently removed by F. velutipes residue with removal ratio of 73.11%, 66.67% and 69.35%, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

Directory of Open Access Journals (Sweden)

S. N. FASEHAH

2017-04-01

Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media

Science.gov (United States)

Utami, Christine Pamardining; Susilawati, Puspita Ratna

2017-08-01

Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.

Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme

International Nuclear Information System (INIS)

Hassan Hamdani Mutaat; Mat Rasol Awang

2004-01-01

The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)

The use of residual geothermal energy in an edible mushroom production plant, Los Humeros geothermal fields (Mexico): Achievements and alternatives; El uso de la energia geotermica residual en la planta productora de hongos comestibles del campo geotermico Los Humeros (Mexico): Logros y alternativas

Energy Technology Data Exchange (ETDEWEB)

Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)

2000-12-01

A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.

The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

Directory of Open Access Journals (Sweden)

Paula Fernanda Bomfim Oliveira Cogorni

2014-06-01

Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

The amphiphilic hydrophobin Vmh2 plays a key role in one step synthesis of hybrid protein-gold nanoparticles.

Science.gov (United States)

Politi, Jane; De Stefano, Luca; Longobardi, Sara; Giardina, Paola; Rea, Ilaria; Methivier, Christophe; Pradier, Claire-Marie; Casale, Sandra; Spadavecchia, Jolanda

2015-12-01

We report a simple and original method to synthesize gold nanoparticles in which a fungal protein, the hydrophobin Vmh2 from Pleurotus ostreatus and dicarboxylic acid-terminated polyethylene-glycol (PEG) has been used as additional components in a one step process, leading to hybrid protein-metal nanoparticles (NPs). The nanoparticles have been characterized by ultra-violet/visible, infrared and X-ray photoelectron spectroscopies, dynamic light scattering and also by electron microscopy imaging. The results of these analytical techniques highlight nanometric sized, stable, hybrid complexes of about 12 nm, with outer surface rich in functional chemical groups. Interaction with protein and antibodies has also been exploited. Copyright © 2015 Elsevier B.V. All rights reserved.

Use of Swine Wastewater as Alternative Substrate for Mycelial Bioconversion of White Rot Fungi.

Science.gov (United States)

Lee, Jangwoo; Shin, Seung Gu; Ahn, Jinmo; Han, Gyuseong; Hwang, Kwanghyun; Kim, Woong; Hwang, Seokhwan

2017-02-01

Seven white rot fungal species were tested for growth as mycelia using swine wastewater (SW), an agro-waste with tremendous environmental footprint, as the sole nutrient source. The SW contained high concentrations of carbon and nitrogen components, which could support nutritional requirements for mycelial growth. Out of the seven species, Pleurotus ostreatus and Hericium erinaceus were successfully cultivated on the SW medium using solid-state fermentation. Response surface methodology was employed to determine the combination of pH, temperature (T), and substrate concentration (C) that maximizes mycelial growth rate (Kr) for the two species. The optimum condition was estimated as pH = 5.8, T = 28.8 °C, and C = 11.2 g chemical oxygen demand (COD)/L for P. ostreatus to yield Kr of 11.0 mm/day, whereas the greatest Kr (3.1 mm/day) was anticipated at pH = 4.6, T = 25.5 °C, and C = 11.9 g COD/L for H. erinaceus. These Kr values were comparable to growth rates obtained using other substrates in the literature. These results demonstrate that SW can be used as an effective substrate for mycelial cultivation of the two white rot fungal species, suggesting an alternative method to manage SW with the production of potentially valuable biomass.

Activity of the fungus Pleurotus ostreatus and of its proteases on ...

African Journals Online (AJOL)

Avell G1511

more studies from biological models under laboratory conditions. Extracellular proteases produced by nematophagous fungi are directly involved in the stages of the infection. They act in the digestion of nematode's protection barrier, rich in protein (Braga et al., 2010). However, there is a lack of studies aimed at elucidating ...

[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

Science.gov (United States)

Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Mutual interactions of Pleurotus ostreatus with bacteria of activated sludge in solid-bed bioreactors

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Petráčková, Denisa; Kozická, Barbora; Halada, Petr; Novotný, Čeněk

2016-01-01

Roč. 32, č. 6 (2016), s. 94 ISSN 0959-3993 R&D Projects: GA ČR(CZ) GA15-02328S; GA MŠk LO1509 Institutional support: RVO:61388971 Keywords : TRAMETES-VERSICOLOR * WASTE-WATER * BIOFILM FORMATION Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.658, year: 2016

Comparative assessment of fungal augmentation treatments of a fine-textured and historically oil-contaminated soil.

Science.gov (United States)

Covino, Stefano; Stella, Tatiana; D'Annibale, Alessandro; Lladó, Salvador; Baldrian, Petr; Čvančarová, Monika; Cajthaml, Tomas; Petruccioli, Maurizio

2016-10-01

The removal of aged hydrophobic contaminants from fine-textured soils is a challenging issue in remediation. The objective of this study was to compare the efficacy of augmentation treatments to that of biostimulation in terms of total aliphatic hydrocarbon (TAH) and toxicity removal from a historically contaminated clay soil and to assess their impact on the resident microbial community. To this aim, Pleurotus ostreatus, Botryosphaeria rhodina and a combination of both were used as the inoculants while the addition of a sterilized lignocellulose mixture to soil (1:5, w/w) was used as a biostimulation approach. As opposed to the non-amended control soil, where no changes in TAH concentration and residual toxicity were observed after 60days, the activation of specialized bacteria was found in the biostimulated microcosms resulting in significant TAH removal (79.8%). The bacterial community structure in B. rhodina-augmented microcosms did not differ from the biostimulated microcosms due to the inability of the fungus to be retained within the resident microbiota. Best TAH removals were observed in microcosms inoculated with P. ostreatus alone (Po) and in binary consortium with B. rhodina (BC) (86.8 and 88.2%, respectively). In these microcosms, contaminant degradation exceeded their bioavailability thresholds determined by sequential supercritical CO2 extraction. Illumina metabarcoding of 16S rRNA gene showed that the augmentation with Po and BC led to lower relative abundances of Gram(+) taxa, Actinobacteria in particular, than those in biostimulated microcosms. Best detoxification, with respect to the non-amended incubation control, was found in Po microcosms where a drop in collembola mortality (from 90 to 22%) occurred. At the end of incubation, in both Po and BC, the relative abundances of P. ostreatus sequences were higher than 60% thus showing the suitability of this fungus in bioaugmentation-based remediation applications. Copyright © 2016 Elsevier B.V. All

Potential for bioremediation of agro-industrial effluents with high loads of pesticides by selected fungi.

Science.gov (United States)

Karas, Panagiotis A; Perruchon, Chiara; Exarhou, Katerina; Ehaliotis, Constantinos; Karpouzas, Dimitrios G

2011-02-01

Wastewaters from the fruit packaging industry contain a high pesticide load and require treatment before their environmental discharge. We provide first evidence for the potential bioremediation of these wastewaters. Three white rot fungi (WRF) (Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus) and an Aspergillus niger strain were tested in straw extract medium (StEM) and soil extract medium (SEM) for degrading the pesticides thiabendazole (TBZ), imazalil (IMZ), thiophanate methyl (TM), ortho-phenylphenol (OPP), diphenylamine (DPA) and chlorpyrifos (CHL). Peroxidase (LiP, MnP) and laccase (Lac) activity was also determined to investigate their involvement in pesticide degradation. T. versicolor and P. ostreatus were the most efficient degraders and degraded all pesticides (10 mg l⁻¹) except TBZ, with maximum efficiency in StEM. The phenolic pesticides OPP and DPA were rapidly degraded by these two fungi with a concurrent increase in MnP and Lac activity. In contrast, these enzymes were not associated with the degradation of CHL, IMZ and TM implying the involvement of other enzymes. T. versicolor degraded spillage-level pesticide concentrations (50 mg l⁻¹) either fully (DPA, OPP) or partially (TBZ, IMZ). The fungus was also able to rapidly degrade a mixture of TM/DPA (50 mg l⁻¹), whereas it failed to degrade IMZ and TBZ when supplied in a mixture with OPP. Overall, T. versicolor and P. ostreatus showed great potential for the bioremediation of wastewaters from the fruit packaging industry. However, degradation of TBZ should be also achieved before further scaling up.

Development of a protocol and catalogue for existing end-use metered data from Canadian utilities

International Nuclear Information System (INIS)

Robillard, P.; Lopes, J.

1994-12-01

Reasons for collection of end-use metering (EUM) data by electrical utilities were cited as: (1) demand-side management (DSM); (2) class end-use load research; (3) technology assessment; and (4) marketing and customer support. The emergence of DSM evaluation has served to focus on EUM as a strategic tool. The combination of DSM- related load research and other load data requirements has resulted in diverse means of end-use data collection, most of them involving frequent data collection. EUM technology was considered costly, and time consuming to implement. Also, the intrusive character of EUM can sometimes strain customer relations. Electric utilities were found to be interested in pursuing options for sharing of EUM data. An expert service function should be developed to provide EUM study design, implementation, and data analysis services to participating utilities. A planning process for coordinating projects among utilities was recommended to reduce single party costs. Organizational mechanisms for providing EUM services were identified. A number of recommendations were made directed toward the CEA for the realization of an EUM service

Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.

Science.gov (United States)

Upadhyay, R C; Hofrichter, M

1993-01-01

Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

Decolorization and detoxification of reactive industrial dyes by immobilized fungi Trametes pubescens and Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Caiseri, L.; Varese, G.C.; Anastasi, A.; Prigione, V.; Svobodová, Kateřina; Marchisio, V.F.; Novotný, Čeněk

2008-01-01

Roč. 53, č. 1 (2008), s. 44-52 ISSN 0015-5632 R&D Projects: GA AV ČR IAA6020411 Institutional research plan: CEZ:AV0Z50200510 Keywords : decolorization * detoxification * trametes pubescens Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

Directory of Open Access Journals (Sweden)

Hamid Akbarirad

2013-06-01

Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

Fatty Acid Compositions of Six Wild Edible Mushroom Species

Science.gov (United States)

Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

2013-01-01

The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

Fatty Acid Compositions of Six Wild Edible Mushroom Species

Directory of Open Access Journals (Sweden)

Pelin Günç Ergönül

2013-01-01

Full Text Available The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2. Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids.

Avaliação do cultivo de Pleurotus sajor-caju (fries sing. sobre o resíduo de algodão da industria têxtil para a produção de cogumelos e para alimentação animal Evaluation of the cultivation of Pleurotus sajor-caju (fries sing. on cotton textile mill waste for mushroom production and animal feeding

Directory of Open Access Journals (Sweden)

Clenderson Corradi de Mattos Gonçalves

2010-02-01

Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste

Antioxidative Effects of Phenolic Compounds of Mushroom Mycelia in Simulated Regions of the Human Colon, In Vitro Study

Directory of Open Access Journals (Sweden)

Vamanu Emanuel

2018-03-01

Full Text Available Many compounds in mushrooms are biologically active; however, the in vivo actions of their metabolites are poorly understood. An in vitro system, GIS1, was used to simulate the fermentation action of microbiota in each colon region. We used MycoPo, a natural product obtained from the lyophilized mycelia of different Pleurotus ostreatus species to determine the biological effects in human-colon regions. Controls (Lentinula edodes mycelia; dried basidia of Agaricus brunnescens were chosen to confirm the biological activity of P. ostreatus mycelia in vitro. We measured total antioxidant capacity and ferric ion-reducing antioxidant power (FRAP in simulated colon regions to identify antioxidant compounds, and undertook in vitro gastrointestinal simulation and microbiological analyses. The highest FRAP was found for the ascending colon, and the antioxidant effect was higher when MycoPo was administered. A. brunnescens consumption resulted in low total antioxidant capacity. Polyphenol content was correlated with the antioxidant status and microbial composition of microbiota. Total polyphenolic content was higher after A. brunnescens consumption, and four types of polyphenols were identified by high-performance liquid chromatography. Major phenolic acids were gentisic acid, homogentisic acid, and small amounts of caffeic acid. The Enterobacteriaceae species populations varied greatly across the three parts of the colon. We noted a significant (p0.85. These data suggest a direct relationship between favorable bacterial strains and availability of bioactive compounds, with specificity for each colon region.

Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

Directory of Open Access Journals (Sweden)

Akpaja EO

2012-02-01

Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

Bojesodok-eum, a Herbal Prescription, Ameliorates Acute Inflammation in Association with the Inhibition of NF-κB-Mediated Nitric Oxide and ProInflammatory Cytokine Production

Directory of Open Access Journals (Sweden)

Kook Ho Sohn

2012-01-01

Full Text Available Bojesodok-eum (BSE is a herbal prescription consisting of Coptidis Rhizoma and Scutellariae Radix as main components. This paper investigated the effects of BSE on the induction of nitric oxide (NO, prostaglandin E2 (PGE2, and proinflammatory cytokines that are caused by lipopolysaccharide (LPS in murine macrophage cell line and on the paw edema formation in animals. Administration of BSE (0.3 g/kg and 1 g/kg in rats significantly inhibited carrageenan-induced paw edema formation, as did dexamethasone, an anti-inflammatory positive control drug. In cell model, treatment of BSE decreased the production of NO and PGE2 in RAW264.7 cells stimulated by LPS. BSE also inhibited the expression of iNOS and COX-2 protein as well as COX activity in a concentration-dependent manner. Consistently, BSE suppressed the ability of LPS to produce TNF-α, interleukin-1β, and interleukin-6. LPS treatment induced nuclear NF-κB level and I-κBα phosphorylation, which were inhibited subsequent treatment of BSE, suggesting its repression of LPS-inducible NF-κB activation. BSE abrogated the induction of NO, PGE2, and proinflammatory cytokines, as well as iNOS and COX-2 protein expression in RAW264.7 cells stimulated by LPS as mediated with NF-κB inhibition.

Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

International Nuclear Information System (INIS)

Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

2005-01-01

A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

Fungal treatment of humic-rich industrial wastewater: application of white rot fungi in remediation of food-processing wastewater.

Science.gov (United States)

Zahmatkesh, Mostafa; Spanjers, Henri; van Lier, Jules B

2017-11-01

This paper presents the results of fungal treatment of a real industrial wastewater (WW), providing insight into the main mechanisms involved and clarifying some ambiguities and uncertainties in the previous reports. In this regard, the mycoremediation potentials of four strains of white rot fungi (WRF): Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus and Pleurotus pulmonarius were tested to remove humic acids (HA) from a real humic-rich industrial treated WW of a food-processing plant. The HA removal was assessed by color measurement and size-exclusion chromatography (SEC) analysis. T. versicolor showed the best decolorization efficiency of 90% and yielded more than 45% degradation of HA, which was the highest among the tested fungal strains. The nitrogen limitation was studied and results showed that it affected the fungal extracellular laccase and manganese peroxidase (MnP) activities. The results of the SEC analysis revealed that the mechanism of HA removal by WRF involves degradation of large HA molecules to smaller molecules, conversion of HA to fulvic acid-like molecules and also biosorption of HA by fungal mycelia. The effect of HS on the growth of WRF was investigated and results showed that the inhibition or stimulation of growth differs among the fungal strains.

Chemical Composition and Bioactive Compounds of Some Wild Edible Mushrooms

Directory of Open Access Journals (Sweden)

Melinda NAGY

2017-05-01

Full Text Available Over the last decades, the consumption of mushrooms has significantly increased due to the scientific evidence of their ability to help the organism in the combat and prevention of several diseases (Kalac, 2009. Fruiting bodies of mushrooms are consumed as a delicacy for their texture and flavour, but also for their nutritional properties that makes them even more attractable (Heleno S. 2015. In this paper data were collected from several scientific studies with the aim to characterize the chemical composition and content of bioactive compounds of various mushrooms species: Agaricus bisporus, Boletus edulis, Cantharellus cibarius, Pleurotus ostreatus, Lactarius piperatus. The chemical composition of 5 wild edible studied mushrooms, including moisture, ash, total carbohydrates, total sugars, crude fat, crude protein and energy were determined according to AOAC procedures.

Enrichment of mushrooms: an interesting strategy for the acquisition of lithium.

Science.gov (United States)

de Assunção, Laélia Soares; da Luz, José Maria Rodrigues; da Silva, Marliane de Cássia Soares; Vieira, Patrícia Aparecida Fontes; Bazzolli, Denise Mara Soares; Vanetti, Maria Cristina Dantas; Kasuya, Maria Catarina Megumi

2012-09-15

The capability of Pleurotus ostreatus mushroom to accumulate lithium (Li) and the accessibility of this Li compared with lithium carbonate (Li(2)CO(3)), often used as psychiatric medicine, were investigated. Mushrooms were produced on a substrate-based on coffee husk, with different added concentrations of lithium chloride (LiCl). Biological efficiency (BE), the crude protein content, the concentration of Li and other elements present in mushrooms were determined. The sequential extraction and in vitro test were used to verify the accessibility and the degree of solubility of this element. Li concentration in mushrooms was directly influenced by increasing LiCl concentration in the substrate (Plithium can be an alternative source of Li, as well as being a food with high nutritional value. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

Directory of Open Access Journals (Sweden)

Alfonso Soto-Sánchez

2015-09-01

Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

IL LIBRO D’ORO DI ARISTOMACHE: UNA NOTIZIA ANTIQUARIA IN PLUTARCO (MOR. 675 B E UN FRAMMENTO DI EPOS CORINTIO (EUM. FR. 8 BERNABÉ

Directory of Open Access Journals (Sweden)

Roberto Capel Badino

2014-09-01

Full Text Available Discutendo un problema cronologico in merito all’inclusione di gare poetiche nel contesto dei festival panellenici, Plutarco (mor. 675 b riferisce – sull’autorità di Polemone, scrittore antiquario (fr. 27 Preller – informazioni circa un libro d’oro offerto come ex voto nel tesoro dei Sicionii a Delfi dalla sconosciuta figura di Aristomache, vincitrice all’Istmo.Lo studio discute alcuni problemi riguardo al testo di Plutarco – pubblicato con un nuovo apparato critico, la natura dell’ex voto e l’identità di Aristomache. Poiché non c’è notizia di agoni poetici a Corinto prima della fine del IV sec. a.C., con maggiore coerenza rispetto al ragionamento di Plutarco, Aristomache può essere considerata una figura leggendaria assimilabile a una Sibilla. Il frammento di Polemone può essere confrontato con Eum. fr. 8 Bernabé (Favor. Corinth. 13, p. 305.8 Barigazzi, un frammento di un’opera epica, dove una Sibilla, parlando in prima persona, fornisce una tradizione corintia circa l’origine delle Istmie.

Utilização do composto exaurido de Pleurotus sajor caju em rações de frangos de corte e seus efeitos no desempenho dessas aves - DOI: 10.4025/actascianimsci.v31i2.4811 Utilization of the spent substrate of Pleurotus sajor caju mushroom in broiler chicks ration and the effect on broiler chicken performance - DOI: 10.4025/actascianimsci.v31i2.4811

Directory of Open Access Journals (Sweden)

Antônio Gilberto Bertechini

2009-08-01

Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and

UTILIZATION OF AREN (Arenga pinnata Merr. SAWMILLING WASTE FOR EDIBLE MUSHROOM CULTIVATION MEDIA

Directory of Open Access Journals (Sweden)

Djarwanto

2016-04-01

Full Text Available Aren (Arenga pinnata Merr. is a multipurpose tree that can be utilized for palm sugar, alcoholic drinks, beverages and construction wood. The use of aren sawdust has not been studied intensively. This study examines the utilization of aren sawdust as cultivation media for edible mushrooms. Aren sawdust was mixed with rice bran, CaCO3, gypsum, fertilizers and distilled water before sterilization in 30 minutes pressurized autoclave at 1210C and 1.5atm. The mixed media was inoculated with pure cultures containing four mushrooms species (Pleurotus flabellatus, P. ostreatus, P. sajor-caju and Lentinula edodes and incubated for five weeks to allow mycelium growth producing fruit bodies. The fruit bodies were harvested everyday within four months and examined for its gained mushroom-weight and biological conversion efficiency/BE. The core part of aren trunk was cut into smaller pieces of 10 cm (width by 5 cm (thickness, by 120 cm (length. Each core sample was bored from the surface inward, creating holes with a particular distance apart. Each hole was inoculated with pure cultures containing 6 mushroom species (four species above, P. cystidiosus and Auricularia polytricha. The inoculated samples were slanted on bamboo support, and placed in a bamboo hut. Harvesting was carried out everyday after the fruiting body became mature and examined for its gained mushroom weight. Results show that the use of sawdust supplemented with nutritious material is more likely to improve the mushroom yield than that of aren sawn-timber core. In this case, the BE values with aren-sawdust media were 21.97-89.45% (P. flabellatus, 15.36-105.36% (P. ostreatus, 63.88-76.86% (P. sajor-caju, and up to 62.88% (L. edodes. Meanwhile, the yields (gained mushroom weight with aren sawn-timber media were 210g (P. ostreatus, 368g (P. flabellatus, 331g (P. sajor-caju and 48g (A. polytricha; however, P. cystidiosus and L. edodes inoculated on aren stem core failed to grow.

Evaluation of umami taste in mushroom extracts by chemical analysis, sensory evaluation, and an electronic tongue system.

Science.gov (United States)

Phat, Chanvorleak; Moon, BoKyung; Lee, Chan

2016-02-01

Seventeen edible mushrooms commercially available in Korea were analysed for their umami taste compounds (5'-nucleotides: AMP, GMP, IMP, UMP, XMP; free amino acids: aspartic, glutamic acid) and subjected to human sensory evaluation and electronic tongue measurements. Amanita virgineoides featured the highest total 5'-nucleotide content (36.9 ± 1.50 mg/g), while monosodium glutamate-like components (42.4 ± 6.90 mg/g) were highest in Agaricus bisporus. The equivalent umami concentration (EUC) ranged from 1.51 ± 0.42 to 3890 ± 833 mg MSG/g dry weight; most mushrooms exhibited a high umami taste. Pleurotus ostreatus scored the highest in the human sensory evaluation, while Flammulina velutipes obtained the maximum score in the electronic tongue measurement. The EUC and the sensory score from the electronic tongue test were highly correlated, and also showed significant correlation with the human sensory evaluation score. These results suggest that the electronic tongue is suitable to determine the characteristic umami taste of mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

Directory of Open Access Journals (Sweden)

Sunil S. More

2011-01-01

Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax⁡ values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

1 INTRODUÇÃO

African Journals Online (AJOL)

Ceci Sales

2013-11-13

Nov 13, 2013 ... Revista Saúde e Ambiente, 1:60-63. Gonçalves CR (2002). ... processamento de madeira nas indústrias madeireiras de Manaus,. Amazonas ... ostreatus in culture media based on formulated straw or grass. Afri. J. Agric. Res ...

Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

Directory of Open Access Journals (Sweden)

Evelise Moncaio Moda

2005-04-01

Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com �

Risk of alpha radionuclides presence in cultivating substrate of oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.

2006-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)

The immobilization of filamentous fungi by cellular adherence and surface film growth on radiopolymerized hydrogels

International Nuclear Information System (INIS)

Petre, M.; Zarnea, G.; Adrian, P.; Gheorghiu, E.; Gheordunescu, V.

1998-01-01

The continuous biodegradation processes of cellulose wastes, from wine-producing industry and canned food processing were performed using immobilized fungal cells on complex polyhydrogels such as: collagen-polyacrylamide (CPAA), elastin-polyacrylamide (EPAA), gelatin-polyacrylamide (GPAA) and poly-hydroxy-ethyl-methyl-methacrylate (PHEMA) which were prepared by experimental radiopolymerization methods using a 60 Co radioactive source. The experiments were performed using cellulolytic micro- and macrofungal species and the immobilization methods were applied in connection with morphogenetic characteristics of each one of these species that were used as inoculum. A flow-cascade bioreactor was achieved as a research laboratory tool in order to control the cellulose waste biodegradation in continuous processes using immobilized fungal cells on complex polyhydrogels. In this way the continuous control was possible for fungal metabolic activity during the cellulose biodegradation processes by microscopical hyphal growth measurements inside the polyhydrogels and, also, by mycelial protein content analysis. The tested fungal species were Pleurotus ostreatus and Pleurotus florida from macromycetes and Trichoderma viride from micromycetes. There were noticed significant differences in biodegradation rate of cellulose wastes between 'in vitro' immobilized fungal cultures and free fungal cells cultures used as control samples to be compared with cellulose biodegradation processes in natural conditions of polluted ecosystems. The fungal growth displayed by soluble mycelial protein were compared with cellulose biodegradation rates which were expressed by cellulose weight loss in the culture medium. (authors)

An analysis of employee exposure to organic dust at large-scale composting facilities

Science.gov (United States)

Sykes, P.; Allen, J. A.; Wildsmith, J. D.; Jones, K. P.

2009-02-01

The occupational health implications from exposure to dust, endotoxin and 1-3 β Glucan at commercial composting sites are uncertain. This study aims to establish employee exposure levels to inhalable and respirable dust, endotoxin and 1-3 β Glucan during various operational practices in the composting process. Personal samples were collected and the inhalable and respirable dust fractions were determined by gravimetric analysis. Endotoxin concentrations were determined using a Limulus Amebocyte Lysate assay (LAL). 1-3 β Glucan levels were estimated using a specific blocking agent to establish the contribution that these compounds gave to the original endotoxin assay. Employees' exposure to dust was found to be generally lower than the levels stipulated in the Control of Substances Hazardous to Health Regulations (COSHH) 2002 (as amended), (median inhalable fraction 1.08 mg/m3, min 0.25 mg/m3 max 10.80 mg/m3, median respirable fraction 0.05 mg/m3, min 0.02 mg/m3, max 1.49 mg/m3). Determination of the biological component of the dust showed that employees' exposures to endotoxin were elevated (median 31.5 EU/m3, min 2.00 EU/m3, max 1741.78 EU/m3), particularly when waste was agitated (median 175.0 EU/m3, min 2.03 EU/m3, max 1741.78 EU/m3). Eight out of 32 (25%) of the personal exposure data for endotoxin exceeded the 200 EU/m3 temporary legal limit adopted in the Netherlands and thirteen out of 32 (40.6%) exceeded the suggested 50 EU/m3 guidance level suggested to protect workers from respiratory health effects. A significant correlation was observed between employee inhalable dust exposure and personal endotoxin concentration (r = 0.728, phealth risks associated with endotoxin exposure at composting sites. Employee exposure levels and dose-response disease mechanisms are not well understood at this present time. Consequently, in light of this uncertainty, it is recommended that a precautionary approach be adopted in managing the potential health risks associated

Extracellular polysaccharide production by a strain of Pleurotus djamor isolated in the south of Brazil and antitumor activity on Sarcoma 180

Directory of Open Access Journals (Sweden)

Gisele Martini Borges

2013-12-01

Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.

Mutation induction of pleurotus ferulae by low-energy N+ ion implantation and characters of the selected mutant

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian

2008-01-01

In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)

Evaluation of the physicochemical properties of coffee chaff when subjected to a biological treatment and its potential impact as a raw material in subsequent biological processes or thermochemical

International Nuclear Information System (INIS)

Valverde Camacho, Edgar

2014-01-01

An investigation is carried out using white rot fungi in coffee pulp to study the impact on the physicochemical properties. The use of brushwood in thermochemical processes, biochemists is evaluated for later use and production of energy or any product with added value. The strain is selected by growth in Petri dishes and fresh pulp is then inoculated with a strain of Trametes versicolor and Pleurotus ostreatus one. Each treatment was maintained in growth for seven weeks . The measurement of each of the response variables used were subsequently performed to characterize the fresh pulp, including: concentration of cellulose, hemicellulose, lignin, extractables total polyphenols, total ash, moisture, combustion heat and thermal gravimetric analysis. Measurements in the fresh pulp and brushwood-fungal matrix is performed at the end of treatment. An impact on the concentration of extractable total polyphenols is obtained with an apparent reduction of 87.7% in the treated Pult with Trametes versicolor and 80.5% in the treated with Pleurotus ostreatus, with regard to the fresh brushwood. Lignin concentration was affected; however, errors were found in the analytical method associated with the presence of the fungus in the analysis, leading to erroneous readings in the measurement parameter. Thermogravimetric analysis have allowed to observe a change in the whole matrix microorganism-brushwood. The biological treatment has generated a positive impact on the region pyrolysis at temperatures in the range of 150 to 400 degrees centigrade, improving processes of decomposition. Both treatments have shown a stabilization of the thermolysis in the region of temperatures above 400 degrees centigrade. The impact on a larger scale of the pre-treatment is evaluated on the gasification process, specifically on the production of tars has been necessary for field tests in a pilot team and in the same way for the case of enzymatic fermentation. Tests of ergosterol concentration and

Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

Science.gov (United States)

Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

2016-12-01

Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

Effect of gamma irradiation on the structure of corn stalks and their subsequent bioconversion into protein-rich mycelial biomass of pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Awafo, V [Quebec Univ., Montreal, PQ (Canada)

1994-12-31

Lignocellulosic biomass like corn stalk is an abundant and renewable resource from which food, feed and chemicals may be derived. Enzymatic hydrolysis of native lignocellulosic material is prohibitively slow due to their compositional heterogeneity and structural complexity. In this work, ground corn stalks (20 mesh) were subjected to gamma irradiation (10-170 Mrads) as pretreatments to make them more susceptible for bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757. The irradiation was carried out in air in a {sup 60}Co Underwater Calibrator (UC-15, Nordion International) at a dose rate of 2.5 Mrads/h as measured by Fricke dosimetry. No apparent structural differences were observed under the light microscope. However, the protein synthesis and the proportion of mycelial biomass increased with the increase in both the dose of irradiation and time of fermentation during the bioconversion of 1% corn stalk into mycelial biomass of Pleurotus sajor-caju. Gamma irradiation at the dose of 50 Mrads or lower did not produce any appreciable increase in the amount of protein synthesised. At 170 Mrads, the final product contained 28% protein representing a 2-fold increase from non-irradiated corn stalk and an efficiency of 36% conversion of total utilizable polysaccharides of corn stalks into mycelial biomass. The lag phase during mycelial biomass production was much more prolonged at very high doses indicating possible production of some toxic substances during irradiation. (author). 2 tabs., 6 figs.

The Removal of Turbidity and TSS of the Domestic Wastewater by Coagulation-Flocculation Process Involving Oyster Mushroom as Biocoagulant

Science.gov (United States)

Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono

2018-02-01

Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.

Solubilization of Australian lignites by fungi and other microorganisms

Energy Technology Data Exchange (ETDEWEB)

Catcheside, D.E.A.; Mallett, K.J. (Flinders University, Bedford Park, SA (Australia). School of Biological Sciences)

Lignites (brown coals) from the Latrobe Valley in Victoria are solubilized by {ital Coriolus versicolor}, {ital Phanerochaete chrysosporium}, and five other species known to be active on Leonardite and various acid-treated North America lignites. Run-of-mine coal from Morwell and Loy Yang is refractory but is soluble after pretreatment with acid. A weathered deposit at Loy Yang, like Leonardite, is susceptible to biosolubilization without pretreatment. The white rot fungi {ital Ganoderma applanatum}, {ital Perenniporia tephropora} ({ital Fomes lividus}), {ital Pleurotus ostreatus}, {ital Pycnoporus cinnabarinus}, {ital Rigidoporus ulmarius}, and {ital Xylaria hypoxylon} were found to be capable of solubilizing lignite. In contrast, brown rot fungi were weakly active or inactive under the same test conditions. Lignite-degrading fungi, actinomycetes, and other bacteria, including some active on untreated run-of-mine coal, were isolated from natural lignite exposures and mining sites. 15 refs., 5 tabs.

Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

2017-10-01

Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

Differential proteomic analysis of the secretome of Irpex lacteus and other white-rot fungi during wheat straw pretreatment.

Science.gov (United States)

Salvachúa, Davinia; Martínez, Angel T; Tien, Ming; López-Lucendo, María F; García, Francisco; de Los Ríos, Vivian; Martínez, María Jesús; Prieto, Alicia

2013-08-10

Identifying new high-performance enzymes or enzyme complexes to enhance biomass degradation is the key for the development of cost-effective processes for ethanol production. Irpex lacteus is an efficient microorganism for wheat straw pretreatment, yielding easily hydrolysable products with high sugar content. Thus, this fungus was selected to investigate the enzymatic system involved in lignocellulose decay, and its secretome was compared to those from Phanerochaete chrysosporium and Pleurotus ostreatus which produced different degradation patterns when growing on wheat straw. Extracellular enzymes were analyzed through 2D-PAGE, nanoLC/MS-MS, and homology searches against public databases. In wheat straw, I. lacteus secreted proteases, dye-decolorizing and manganese-oxidizing peroxidases, and H2O2 producing-enzymes but also a battery of cellulases and xylanases, excluding those implicated in cellulose and hemicellulose degradation to their monosaccharides, making these sugars poorly available for fungal consumption. In contrast, a significant increase of β-glucosidase production was observed when I. lacteus grew in liquid cultures. P. chrysosporium secreted more enzymes implicated in the total hydrolysis of the polysaccharides and P. ostreatus produced, in proportion, more oxidoreductases. The protein pattern secreted during I. lacteus growth in wheat straw plus the differences observed among the different secretomes, justify the fitness of I. lacteus for biopretreatment processes in 2G-ethanol production. Furthermore, all these data give insight into the biological degradation of lignocellulose and suggest new enzyme mixtures interesting for its efficient hydrolysis.

Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

Directory of Open Access Journals (Sweden)

Xianghe Yuan

2016-02-01

Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

Science.gov (United States)

Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

2014-01-01

Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

Usability and Workflow Evaluation of "RhEumAtic Disease activitY" (READY). A Mobile Application for Rheumatology Patients and Providers.

Science.gov (United States)

Yen, Po-Yin; Lara, Barbara; Lopetegui, Marcelo; Bharat, Aseem; Ardoin, Stacy; Johnson, Bernadette; Mathur, Puneet; Embi, Peter J; Curtis, Jeffrey R

2016-11-02

RhEumAtic Disease activitY (READY) is a mobile health (mHealth) application that aims to create a shared platform integrating data from both patients and physicians, with a particular emphasis on arthritis disease activity. We made READY available on an iPad and pilot implemented it at a rheumatology outpatient clinic. We conducted 1) a usability evaluation study to explore patients' and physicians' interactions with READY, and 2) a time motion study (TMS) to observe the clinical workflow before and after the implementation. A total of 33 patients and 15 physicians participated in the usability evaluation. We found usability problems in navigation, data entry, pain assessment, documentation, and instructions along with error messages. Despite these issues, 25 (75,76%) patients reported they liked READY. Physicians provided mixed feedback because they were concerned about the impact of READY on clinical workflow. Six physicians participated in the TMS. We observed 47 patient visits (44.72 hours) in the pre-implementation phase, and 42 patient visits (37.82 hours) in the post-implementation phase. We found that patients spent more time on READY than paper (4.39mins vs. 2.26mins), but overall, READY did not delay the workflow (pre = 52.08 mins vs. post = 45.46 mins). This time difference may be compensated with READY eliminating a workflow step for the staff. Patients preferred READY to paper documents. Many found it easier to input information because of the larger font size and the ease of 'tapping' rather than writing-out or circling answers. Even though patients spent more time on READY than using paper documents, the longer usage of READY was mainly due to when troubleshooting was needed. Most patients did not have problems after receiving initial support from the staff. This study not only enabled improvements to the software but also serves as good reference for other researchers or institutional decision makers who are interested in implementing such a

Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

Directory of Open Access Journals (Sweden)

Petcharat, V. and

2004-09-01

Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

KAJIAN MACAM LIMBAH DAN PENAMBAHAN TEPUNG TONGKOL JAGUNG TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Agung Setyarini

2016-12-01

Full Text Available One limiting for factor the production of oyster mushrooms was difficult to obtain the raw material of sengon wood sawdust, meanwhile, the production of oyster mushroom necessary need the nutrients in the form of bran or cornmeal. The purpose of this study was to study planting medium, the concentration of corn cob flour, and to find the effective interaction of these two factors on growth and yield of oyster mushroom. This study used a completely randomized design (CRD with two factors, concentration of media and corn cob flour. The media used in this study are sengon sawdust, glugu sawdust, acacia wood sawdust, rice straw and bagasse, while the concentration of corn cob flour was 0% per baglog, 1% per baglog, 2% per baglog, 3% per baglog and 4% per baglog. Data analysis was using F test level 5% and continued with Duncan test. The results of this study showed that sawdvst sengon media generally give better effect to the growth and yield of oyster mushroom, while corn cob flour treatment concentration was not known exactly in enhancing the growth and yield of oyster mushroom. Treatment of media accelerate the deployment of mycelium old, when appearing pin head, increasing the number of fruiting bodies in a single clump and increasing the mushroom fruit body weight. Extra flour treatment corncob accelerate as emerging pin head, increasing the number of fruiting bodies in a clump and increase total body weight of mushrooms.

Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.

Science.gov (United States)

Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G

2012-03-01

Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.

Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

Directory of Open Access Journals (Sweden)

Ira Djajanegara

2012-02-01

Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

Removal of Neutral Red from aqueous solution by adsorption on spent cottonseed hull substrate

International Nuclear Information System (INIS)

Zhou Qi; Gong Wenqi; Xie Chuanxin; Yang Dongjiang; Ling Xiaoqing; Yuan Xiao; Chen Shaohua; Liu Xiaofang

2011-01-01

Cottonseed hull, a low-cost widely available agricultural waste in China, after used as substrate for the white rot fungus Pleurotus ostreatus cultivation, was tested for the removal of Neutral Red (NR), a cationic dye, from aqueous solution. A batch adsorption study was carried out with varied solution pH, adsorbent dosage, reaction time and initial NR concentration. The results show that the kinetics of dye removal by the spent cottonseed hull substrate (SCHS) is prompt in the first 5 min and the adsorption equilibrium can be attained after 240 min. The biosorption kinetics and equilibrium follow typical pseudo-second-order and Langmuir adsorption models. Thermodynamic parameters of ΔG o , ΔH o and ΔS o show that the adsorption is a spontaneous and endothermic process. Fourier transform infrared (FTIR) spectroscopy was used for the characterization of possible dye-biosorbent interaction. This study provides a facile method to produce low-cost biosorbent for the purification of dye contaminated water.

Dose of Biocoagulant-Mixing Rate Combinations for Optimum Reduction of COD in Wastewater

Science.gov (United States)

Patricia, Maria Faustina; Purwono; Budihardjo, Mochamad Arief

2018-02-01

Chemical oxygen demand (COD) in domestic wastewater can be treated using flocculation-coagulation process with addition of Oyster mushroom (Pleurotus ostreatus) in powder form as biocoagulant. The fungal cell wall of Oyster mushroom comprises of chitin that is high polyelectrolyte and can be function as an absorbent of heavy metals in wastewater. The effectiveness of flocculation-coagulation process in treating wastewater depends on dose of coagulant and mixing rate. Therefore, this study aims to determine the best combination of three variation of dose of biocoagulant which are 600 mg/l, 1000 mg/l, and 2000 mg/l and mixing rate which are 100 rpm, 125 rpm, and 150 rpm that give the most reduction of COD in the wastewater. The result indicates that the combination of 1000 mg/l of biocoagulant and 100 rpm of mixing rate were found to be the most optimum combination to treat COD in the wastewater with COD reduction of 47.7%.

Olive mill wastewater biodegradation potential of white-rot fungi--Mode of action of fungal culture extracts and effects of ligninolytic enzymes.

Science.gov (United States)

Ntougias, Spyridon; Baldrian, Petr; Ehaliotis, Constantinos; Nerud, Frantisek; Merhautová, Věra; Zervakis, Georgios I

2015-01-01

Forty-nine white-rot strains belonging to 38 species of Basidiomycota were evaluated for olive-mill wastewater (OMW) degradation. Almost all fungi caused high total phenolics (>60%) and color (⩽ 70%) reduction, while COD and phytotoxicity decreased to a lesser extent. Culture extracts from selected Agrocybe cylindracea, Inonotus andersonii, Pleurotus ostreatus and Trametes versicolor strains showed non-altered physicochemical and enzymatic activity profiles when applied to raw OMW in the presence or absence of commercial catalase, indicating no interaction of the latter with fungal enzymes and no competition for H2O2. Hydrogen peroxide's addition resulted in drastic OMW's decolorization, with no effect on phenolic content, suggesting that oxidation affects colored components, but not necessarily phenolics. When fungal extracts were heat-treated, no phenolics decrease was observed demonstrating thus their enzymatic rather than physicochemical oxidation. Laccases added to OMW were reversibly inhibited by the effluent's high phenolic load, while peroxidases were stable and active during the entire process. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dose of Biocoagulant-Mixing Rate Combinations for Optimum Reduction of COD in Wastewater

Directory of Open Access Journals (Sweden)

Faustina Patricia Maria

2018-01-01

Full Text Available Chemical oxygen demand (COD in domestic wastewater can be treated using flocculation-coagulation process with addition of Oyster mushroom (Pleurotus ostreatus in powder form as biocoagulant. The fungal cell wall of Oyster mushroom comprises of chitin that is high polyelectrolyte and can be function as an absorbent of heavy metals in wastewater. The effectiveness of flocculation-coagulation process in treating wastewater depends on dose of coagulant and mixing rate. Therefore, this study aims to determine the best combination of three variation of dose of biocoagulant which are 600 mg/l, 1000 mg/l, and 2000 mg/l and mixing rate which are 100 rpm, 125 rpm, and 150 rpm that give the most reduction of COD in the wastewater. The result indicates that the combination of 1000 mg/l of biocoagulant and 100 rpm of mixing rate were found to be the most optimum combination to treat COD in the wastewater with COD reduction of 47.7%.

Effect of gamma and electron beam irradiation on the physico-chemical and nutritional properties of mushrooms: a review.

Science.gov (United States)

Fernandes, Ângela; Antonio, Amilcar L; Oliveira, M Beatriz P P; Martins, Anabela; Ferreira, Isabel C F R

2012-11-15

The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers. There has been extensive research on finding the most appropriate technology for mushrooms preservation. Gamma, electron-beam and UV irradiation have been shown to be potential tools in extending the postharvest shelf-life of fresh mushrooms. Studies evaluating the effects of ionizing radiation are available mainly in cultivated species such as Agaricus bisporus, Lentinus edodes and Pleurotus ostreatus. This review comprises a comprehensive study of the effects of irradiation on physico-chemical parameters (weight, colour, texture and pH), chemical compounds including nutrients (proteins, sugars and vitamins) and non-nutrients (phenolics, flavonoids and flavour compounds), and on biochemical parameters such as enzymatic activity of mushrooms for different species and from different regions of the world. Copyright © 2012 Elsevier Ltd. All rights reserved.

Enzymatic extract containing lignin peroxidase immobilized on carbon nanotubes: Potential biocatalyst in dye decolourization

Directory of Open Access Journals (Sweden)

Sabrina Feliciano Oliveira

2018-05-01

Full Text Available The majority of the textile dyes are harmful to the environment and potentially carcinogenic. Among strategies for their exclusion, the treatment of dye contaminated wastewater with fungal extract, containing lignin peroxidase (LiP, may be useful. Two fungi isolates, Pleurotus ostreatus (PLO9 and Ganoderma lucidum (GRM117, produced the enzymatic extract by fermentation in the lignocellulosic residue, Jatropha curcas seed cake. The extracts from PLO9 and GRM117 were immobilized on carbon nanotubes and showed an increase of 18 and 27-fold of LiP specific activity compared to the free enzyme. Also, LiP from both fungi extracts showed higher Vmax and lower Km values. Only the immobilized extracts could be efficiently reused in the dye decolourization, contrary, the carbon nanotubes became saturated and they should be discarded over time. This device may offer a final biocatalyst with higher catalytic efficiency and capability to be reused in the dye decolourization process. Keywords: Lignocellulosic residue, Solid state fermentation, Immobilization, Fungi

Enzymatic extract containing lignin peroxidase immobilized on carbon nanotubes: Potential biocatalyst in dye decolourization.

Science.gov (United States)

Oliveira, Sabrina Feliciano; da Luz, José Maria Rodrigues; Kasuya, Maria Catarina Megumi; Ladeira, Luiz Orlando; Correa Junior, Ary

2018-05-01

The majority of the textile dyes are harmful to the environment and potentially carcinogenic. Among strategies for their exclusion, the treatment of dye contaminated wastewater with fungal extract, containing lignin peroxidase (LiP), may be useful. Two fungi isolates, Pleurotus ostreatus (PLO9) and Ganoderma lucidum (GRM117), produced the enzymatic extract by fermentation in the lignocellulosic residue, Jatropha curcas seed cake. The extracts from PLO9 and GRM117 were immobilized on carbon nanotubes and showed an increase of 18 and 27-fold of LiP specific activity compared to the free enzyme. Also, LiP from both fungi extracts showed higher Vmax and lower Km values. Only the immobilized extracts could be efficiently reused in the dye decolourization, contrary, the carbon nanotubes became saturated and they should be discarded over time. This device may offer a final biocatalyst with higher catalytic efficiency and capability to be reused in the dye decolourization process.

Papel de la vitamina C y los β-glucanos sobre el sistema inmunitario: revisión

Directory of Open Access Journals (Sweden)

Ismael San Mauro-Martín

2016-01-01

Full Text Available Existe un creciente interés en conocer herramientas nutricionales al alcance de profesionales para el manejo de la modulación del sistema inmunitario del humano. Esta revisión bibliográfica se centra en los potenciales efectos beneficiosos sobre el sistema inmune atribuidos a productos alimenticios compuestos por β-glucanos de Pleurotus ostreatus, y/o Vitamina C. Este trabajo muestra el resultado obtenido en diferentes estudios con la ingesta de estos componentes sobre el sistema inmunitario, así como el efecto específico sobre marcadores inmunitarios como las interleuquinas, los linfocitos, células Natural Killer y los leucocitos, no sólo atendiendo a los mecanismos, sino a las experiencias en modelos in vitro e in vivo (animal y humano. Tanto la vitamina C como los β-glucanos parecen mostrar eficacia sobre el sistema inmune en diversos estudios, especialmente de forma conjunta, pero son necesarios más estudios.

SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Fedotov О. V.

2014-02-01

Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

Science.gov (United States)

Akpinar, Merve; Urek, Raziye Ozturk

2012-01-01

Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

Crescimento e capacidade de biosorção de metais por Pleurotus sajor-caju, em cultivo líquido e em cultivo sólido

OpenAIRE

Silva, Stela Maris da

2007-01-01

Neste trabalho, avaliaram-se o crescimento e a capacidade de biosorção de metais de Pleurotus sajor-caju PS 2001, em meios de cultivo líquido e sólido, contendo sulfatos de cobre II, de ferro II, de alumínio, de zinco, de cromo II e de níquel II, em concentrações de 30 ou 60mg.100mL-1 . O crescimento e a massa micelial foram avaliados aos 7, 14 e 21 dias de desenvolvimento para cultivo líquido sendo que para cada etapa de desenvolvimento foram retiradas amostras que foram submetidas a metodol...

Prevalence of Metabolic Syndrome according to Sasang Constitutional Medicine in Korean Subjects.

Science.gov (United States)

Song, Kwang Hoon; Yu, Sung-Gon; Kim, Jong Yeol

2012-01-01

Metabolic syndrome (MS) is a complex disorder defined by a cluster of abdominal obesity, atherogenic dyslipidemia, hyperglycemia, and hypertension; the condition is recognized as a risk factor for diabetes and cardiovascular disease. This study assessed the effects of the Sasang constitution group (SCG) on the risk of MS in Korean subjects. We have analyzed 1,617 outpatients of Korean oriental medicine hospitals who were classified into three SCGs, So-Yang, So-Eum, and Tae-Eum. Significant differences were noted in the prevalence of MS and the frequencies of all MS risk factors among the three SCGs. The odds ratios for MS as determined via multiple logistic regression analysis were 2.004 for So-Yang and 4.521 for Tae-Eum compared with So-Eum. These results indicate that SCG may function as a significant risk factor of MS; comprehensive knowledge of Sasang constitutional medicine may prove helpful in predicting susceptibility and developing preventive care techniques for MS.

Prevalence of Metabolic Syndrome according to Sasang Constitutional Medicine in Korean Subjects

Directory of Open Access Journals (Sweden)

Kwang Hoon Song

2012-01-01

Full Text Available Metabolic syndrome (MS is a complex disorder defined by a cluster of abdominal obesity, atherogenic dyslipidemia, hyperglycemia, and hypertension; the condition is recognized as a risk factor for diabetes and cardiovascular disease. This study assessed the effects of the Sasang constitution group (SCG on the risk of MS in Korean subjects. We have analyzed 1,617 outpatients of Korean oriental medicine hospitals who were classified into three SCGs, So-Yang, So-Eum, and Tae-Eum. Significant differences were noted in the prevalence of MS and the frequencies of all MS risk factors among the three SCGs. The odds ratios for MS as determined via multiple logistic regression analysis were 2.004 for So-Yang and 4.521 for Tae-Eum compared with So-Eum. These results indicate that SCG may function as a significant risk factor of MS; comprehensive knowledge of Sasang constitutional medicine may prove helpful in predicting susceptibility and developing preventive care techniques for MS.

Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation

Science.gov (United States)

Petre, Marian; Teodorescu, Alexandru

2011-01-01

Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.

EFFECTS OF LIGHT WAVELENGTHS AND COHERENCE ON BASIDIOSPORES GERMINATION

Directory of Open Access Journals (Sweden)

Natalia Poyedinok

2015-02-01

Full Text Available The effects of light wavelengths and coherence on basidiospore germination of Agaricus bisporus, Flammulina velutipes, Ganoderma applanatum, Ganoderma lucidum, Hericium erinaceus, Lentinus edodes and Pleurotus ostreatus have been studied. Short-term low-intensity irradiation by coherent (laser light wavelength 488.0 nm and 632.8 nm at doses 45 and 230 mJ/cm2 has significantly increased the number of germinated basidiospores. It has established that there are differences in the photosensitivity not only between species but also between strains. Spores irradiation by 514.5 nm light has been either neutral or inhibitory. A comparative analysis of basidiospores sensitivity to laser and LED light has also been conducted. To stimulate germination of basidiospores and growth of monokaryons the most suitable solution was to use red coherent and incoherent light of 632.8 nm and 660,0 nm for A. bisporus, G. applanatum and P. ostreatus, red and blue coherent light of 632.8 nm and 488,0 nm for F. velutipes, and both red and blue laser and LED light G. lucidum and H. erinaceus and for L. edodes. No essential difference of a continuous wave mode and intermittent mode light effect at the same doses and wavelength on spore germination were revealed. Light influence has reduced germination time and formation of aerial mycelium on agar medium as compared to the original value and increased the growth rate of monosporous isolates. Characterization of basidiospores photosensitivity and development of environmentally friendly stimulating methods of their germination is important for creating highly effective technologies of mushrooms selection and cultivation.

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

2014-09-03

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

Optimizing bio-physical conditions and pre-treatment options for breaking lignin barrier of maize stover feed using white rot fungi

Directory of Open Access Journals (Sweden)

Andrew M. Atuhaire

2016-12-01

Full Text Available The greatest limitation to utilization of maize stover by ruminants as a feed is the high concentration of lignin, which limits fibre digestibility. However, ruminants can effectively utilize maize stover if its nutritive value is improved using white rot fungal species. This study was designed to determine optimal bio-physical conditions for mycelial growth and select the most ideal fungal species and pre-treatment options for improving nutritive value of maize stover. Four popular edible Pleurotus fungal species (viz. Pleurotus florida, Pleurotus ostreatus, Pleurotus sajor caju and Pleurotus pulmonarius were subjected to varying temperatures, pH levels, hydrogen peroxide (H2O2 concentration and illumination to establish the extent of mycelial growth rate. Inclusion of H2O2 was used to determine optimal levels for preservation and prevention of contamination from other indigenous microbiota. Effects of pre-treatment options on chemical composition and nutritive value of maize stover were also examined. Mycelial growth rate of Pleurotus species on potato dextrose agar (PDA varied (P < 0.05 with temperature, pH level and H2O2 concentration following a quadratic trend. Optimal temperature, pH and H2O2 concentration for mycelial growth on PDA were 25 °C, 5 and 0.01 mL/L, respectively. Under the different bio-physical conditions, P. sajor caju had the highest mycelia density and growth rate. Chemical composition of solid-state fermented maize stover differed (P < 0.05 among the Pleurotus species. Maize stover fermented with P. sajor caju had the highest crude protein (CP of 86.6 g/kg DM, in-vitro dry matter digestibility (IVDMD of 731 g/kg DM, in-vitro organic matter digestibility (IVOMD of 670.4 g/kg DM and metabolizable energy (ME of 10.0 MJ/kg DM but with the lowest lignin (sa of 50 g/kg DM. At 25 °C, P. sajor caju had the highest mycelial growth rate on PDA and highest lignin (sa breakdown in the maize stover substrate. It was

Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

Science.gov (United States)

Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

2016-11-01

Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

Directory of Open Access Journals (Sweden)

Gian Luigi Rana

2013-03-01

Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

Effect of inclusion of oyster mushroom substrate on the in vitro fermentation kinetics of Brachiaria brizantha hay

Directory of Open Access Journals (Sweden)

Ricardo da Silva Oliveira

2015-07-01

Full Text Available The objective of this study was to evaluate the effect of inclusion of exhausted substrate of Pleurotus ostreatus on the in vitro fermentation of Brachiaria brizantha hay-based diets. The experiment was conducted using the semi-automated gas production technique. The ruminal inoculum was collected from three fistulated cattle kept on Brachiaria brizantha pasture. Brachiaria brizantha hay and exhausted substrate of Pleurotus production were used for composition of the diets: ES (100% exhausted substrate, BH (100% Brachiaria brizantha hay, ES5 (5% ES + 95% BH, ES20 (20% ES + 80% BH, and ES30 (30% ES + 70% BH. The experimental design was a 5x3 factorial scheme consisting of five treatments and three ruminal inocula. The degradation kinetics of dry matter (DM was determined after 96 hours of fermentation [D (96h]. No significant differences in the cumulative volume of gas (A were observed between BH (262.6 mL/g DM, ES5 (284.3 mL/g MS, ES20 (256.6 mL/g MS and ES30 (261.7 mL/g MS, indicating that inclusion of the substrate did not affect hay fermentation. A lower gas volume (165.9 mL and lower degradability (52% were observed for the ES diet, showing a lower nutritional value of this substrate compared to Brachiaria brizantha hay, probably due to the action of enzymes that degrade structural carbohydrates found in the mycelia of Pleurotus. The ES diet exhibited a shorter colonization time (L=2.6 h; P<0.05, a finding that may be attributed to the interaction between the mycelium and substrate, facilitating initial colonization. The inclusion of exhausted substrate did not increase microbial growth or degradation compared to the BH diet, but seems to have favored initial colonization of this substrate. The use of ES does not negatively affect colonization and may be used as an ingredient of ruminant diets.

Incidencia del medio y de las condiciones de cultivo en el potencial como nutriceútico de tres especies del genero Pleurotus

OpenAIRE

Chegwin Angarita, Carolina

2014-01-01

El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...

Efficacy of fungal decolorization of a mixture of dyes belonging to different classes

Directory of Open Access Journals (Sweden)

Wioletta Przystas

2015-06-01

Full Text Available Dyes are the most difficult constituents to remove by conventional biological wastewater treatment. Colored wastewater is mainly eliminated by physical and chemical procedures, which are very expensive and have drawbacks. Therefore, the advantage of using biological processes, such as the biotransformation of dyes, is that they may lead to complete mineralization or formation of less toxic products. To prove the possibility of using fungal processes for decolorization and other applications, the analysis of the toxicity of the processes' products is required. The decolorization of the mixture of two dyes from different classes - triphenylmethane brilliant green and azo Evans blue (GB - total concentration 0.08 g/L, proportion 1:1 w/w - by Pleurotus ostreatus (BWPH and MB, Gloeophyllum odoratum (DCa, RWP17 (Polyporus picipes and Fusarium oxysporum (G1 was studied. Zootoxicity (Daphnia magna and phytotoxicity (Lemna minor changes were estimated at the end of the experiment. The mixture of dyes was significantly removed by all the strains that were tested with 96 h of experimental time. However, differences among strains from the same species (P. ostreatus were noted. Shaking improved the efficacy and rate of the dye removal. In static samples, the removal of the mixture reached more than 51.9% and in shaken samples, more than 79.2%. Tests using the dead biomass of the fungi only adsorbed up to 37% of the dye mixture (strain BWPH, which suggests that the process with the living biomass involves the biotransformation of the dyes. The best results were reached for the MB strain, which removed 90% of the tested mixture under shaking conditions. Regardless of the efficacy of the dye removal, toxicity decreased from class V to class III in tests with D. magna. Tests with L. minor control samples were classified as class IV, and samples with certain strains were non-toxic. The highest phytotoxicity decrease was noted in shaken samples where the

Exopolysaccharides from Pleurotus pulmonarius: Fermentation Optimization, Characterization and Antioxidant Activity

Directory of Open Access Journals (Sweden)

Jin-Wen Shen

2013-01-01

Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.

[Effect of cultivation in zinc media on the growth of and the degree of zinc in organic form in transgenic metallothionein mushroom].

Science.gov (United States)

Sheng, Ji-Ping; Shen, Lin; Ru, Bing-Gen

2009-03-01

Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich and metal-binding functional proteins. Transgenic MT mushroom can be used as functional food additives, but its zinc-enriching ability has not been studied systemically until now. The zinc contents in mycelia of transgenic MT mushroom (Pleurotus ostreatus) and wild type mushroom mycelia cultivated in different zinc concentration media were analyzed by ICP-OES. The growth status, zinc-enriching ability and degree of zinc in organic form (DZOF) were also analyzed. Results showed that MT mushroom mycelia grew rapidly, but the growth was inhibited when the zinc content in solid media was higher than 1.6 mmol x L(-1). MT mushroom mycelia could enrich more zinc than that of wild type, and the zinc content in MT mushroom mycelia could be 2.56-27.49 mg x kg(-1) when it was cultivated in a liquid media with 0.6-1.2 mmol x L(-1) zinc. DZOF of MT mushroom mycelia in a liquid media with 0.6 mmol x L(-1) zinc at 7 d was significantly higher (88.7%) than that in the wild type (82.1%, alpha = 0.05), but there was no significant difference in DZOF when the MT mushroom mycelia was cultivated in a liquid media with different zinc content at 7 d.

Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

Science.gov (United States)

Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

2013-01-01

With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

The effect of temperature on the nutritional quality of feed from biological treated oil palm empty fruit bunch by Pleurotus sajor caju

International Nuclear Information System (INIS)

Mat Rasol Awang; Hassan Hamdani Mutaat; Yusri Atan; Tamikazu Kume; Shoji Hashimoto; Shinpei Matsuhashi

1998-01-01

In solid state fermentation, Pleurotus sajor caju degrades oil palm Empty Fruit Bunch (EFB) fibre to give a useful feed material (1). Its chemical composition, dry matter digestibility both in vitro and in vivo have been characterised and described previously (2). However, the performance of this microorganism in degradation activity has not been described. Since CO sub 2 is the most important metabolic product of this fermentation, the microbial degradation activity is directly related to the rate and total CO sub 2 evolved in the fermentation. In this work a range of temperature were selected for fermentation, aiming to suit its practical application for countries of tropical climate in general, particularly Malaysia. The nutritional quality of fermented products obtained from the fermentation at different temperature were analysed and discussed

Composted versus Raw Olive Mill Waste as Substrates for the Production of Medicinal Mushrooms: An Assessment of Selected Cultivation and Quality Parameters

Directory of Open Access Journals (Sweden)

Georgios I. Zervakis

2013-01-01

Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

Composted versus raw olive mill waste as substrates for the production of medicinal mushrooms: an assessment of selected cultivation and quality parameters.

Science.gov (United States)

Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis

2013-01-01

Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

Digestibility, Milk Production, and Udder Health of Etawah Goats Fed with Fermented Coffee Husk

Directory of Open Access Journals (Sweden)

I. Badarina

2015-04-01

Full Text Available This study was carried out to assess the utilization of coffee husk fermented by Pleurotus ostreatus as feed supplement by measuring the digestibility, milk production and udder health of Etawah goats suffered from subclinical mastitis (+1. There were three experimental diets consisted of T0 (control diet/basal diet without fermented coffee husk, T1 (basal diet with 6% fermented coffee husk and T2 (basal diet with 6% fermented coffee husk soaked in crude palm oil for an hour before using. Basal diet consisted of napier grass (60% and concentrate (40%. The results showed that supplementation of lactating Etawah does with fermented coffee husk did not affect the palatability of the diets, but increased the protein and crude fiber consumption (P<0.05. There was no significant effect on nutrient digestibility and milk production while milk composition (protein, fat, total solid increased in supplemented groups (P<0.05. The persistency of milk production and the somatic cells count were not different. There was an improvement of somatic cells count on supplemented groups. In conclusion, fermented coffee husk could be used as feed supplement without any negative effects on digestibility and milk production. The positive effects to udder health could be expected from including fermented coffee husk in diets.

Exploitation of Trametes versicolor for bioremediation of endocrine disrupting chemicals in bioreactors.

Directory of Open Access Journals (Sweden)

Cinzia Pezzella

Full Text Available Endocrine disrupting chemicals (EDCs are environmental contaminants causing increasing concerns due to their toxicity, persistence and ubiquity. In the present study, degradative capabilities of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium to act on five EDCs, which represent different classes of chemicals (phenols, parabens and phthalate and were first applied as single compounds, were assessed. T. versicolor was selected due to its efficiency against target EDCs and its potentialities were exploited against a mixture of EDCs in a cost-effective bioremediation process. A fed-batch approach as well as a starvation strategy were applied in order to reduce the need for input of 'fresh' biomass, and avoid the requirement for external nutrients. The fungus was successfully operated in two different bioreactors over one week. Semi-batch cultures were carried out by daily adding a mixture of EDCs to the bioreactors in a total of five consecutive degradation cycles. T. versicolor was able to efficiently remove all compounds during each cycle converting up to 21 mg L-1 day-1 of the tested EDCs. The maintained ability of T. versicolor to remove EDCs without any additional nutrients represents the main outcome of this study, which enables to forecast its application in a water treatment process.

Systematic review of type-specific pathophysiological symptoms of Sasang typology

Directory of Open Access Journals (Sweden)

Yoo Ri Han

2016-06-01

Full Text Available Previous studies on the Sasang typology have focused on the differential diagnosis of each Sasang type with type-specific pathophysiological symptoms (TSPS. The purpose of this study was to elucidate the latent physiological mechanism related to these clinical indicators. We searched six electronic databases for articles published from 1990 to 2015 using the Sasang typology-related keywords, and found and analyzed 35 such articles. The results were summarized into six TSPS categories: perspiration, temperature preference, sleep, defecation, urination, and susceptibility to stress. The Tae-Eum and So-Eum types showed contrasting features with TSPS, and the So-Yang type was in the middle. The Tae-Eum type has good digestive function, regular bowel movement and defecation, high sleep quality, and low susceptibility to stress and cold. The Tae-Eum type has relatively large volumes of sweat and feels fresh after sweating; however, the urine is highly concentrated. These clinical features might be related to the biopsychological traits of the Tae-Eum type, including a low trait anxiety level and high ponderal and body mass indices. This study used the autonomic reactivity hypothesis for explaining the pathophysiological predispositions in the Sasang typology. The Tae-Eum and So-Eum Sasang types have a low threshold in parasympathetic and sympathetic activation, respectively. This study provides a foundation for integrating traditional Korean personalized medicine and Western biomedicine.

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

Science.gov (United States)

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-12-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

OpenAIRE

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-01-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

Iron bioavailability from cereal products enriched with Pleurotus ostreatus mushrooms in rats with induced anaemia

Directory of Open Access Journals (Sweden)

Julita Reguła

2016-06-01

Product may be a valuable source of iron in the nutrition of individuals with a deficiency of this element, first of all patients with absorption and metabolism disorders, but also may add variety to the traditional daily diet.

A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

Science.gov (United States)

Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

2010-01-01

A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

Science.gov (United States)

Chang, Bea-Ven; Chang, Yi-Ming

2016-04-01

The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

Avaliação de resíduos lignocelulósicos para a produção de Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes

OpenAIRE

Claudia Paganelli Lacerda de Azevedo

2000-01-01

Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...

Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

Directory of Open Access Journals (Sweden)

Chia-Wei Phan

2014-01-01

Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

Science.gov (United States)

Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

2017-11-01

Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

A step forward in laccase exploitation: Recombinant production and evaluation of techno-economic feasibility of the process.

Science.gov (United States)

Pezzella, Cinzia; Giacobelli, Valerio Guido; Lettera, Vincenzo; Olivieri, Giuseppe; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

2017-10-10

Protein heterologous production offers viable opportunities to tailor laccase properties to specific industrial needs. The high redox potential laccase POXA1b from Pleurotus ostreatus was chosen as case study of marketable enzyme, due to its desirable properties in terms of activity/stability profile, and already assessed applicability. POXA1b was heterologously produced in Pichia pastoris by investigating the effect of inducible and constitutive expression systems on both the yield and the cost of its production. System performances were first assessed in shaken-flasks and then scaled-up in bioreactor. The production level obtained in the inducible system is 42U/mL, while the activity value achieved with the constitutive one is 60U/mL, the highest obtained in constitutive systems so far. The economic feasibility of recombinant laccase production was simulated, describing the case of an Italian small-medium enterprise. Two scenarios were evaluated: Scenario (I) production based on methanol inducible system; Scenario (II) production based on the constitutive system, fed with glycerol. At all the scales the glycerol-based fermentation is more economic than the methanol-based one. The price forecast for rPOXA1b production is 0.34€kU -1 for glycerol-based process, and is very competitive with the current price of commercial laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

Science.gov (United States)

Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

2016-11-01

This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-11-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-12-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

The first report on mushroom green mould disease in Croatia.

Science.gov (United States)

Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

2012-12-01

Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

Biodegradation of naphthalenesulphonate polymers: the potential of a combined application of fungi and bacteria.

Science.gov (United States)

Gullotto, Antonella; Lubello, Claudio; Mannucci, Alberto; Gori, Riccardo; Munz, Giulio; Briganti, Fabrizio

2015-01-01

The potential of several fungi and their synergy with bacterial biomasses were evaluated as a solution for the removal of 2-naphthalensulphonic acid polymers (2-NSAPs) from petrochemical wastewater, characterized by a chemical oxygen demand (COD) greater than 9000 mg/L. The ability of fungi to grow on 2-NSAP mixtures was preliminarily investigated using a solid medium, and then the action of the selected strains, both in suspended and immobilized form, was evaluated in terms of degradation, depolymerization, sorption and an increase in biodegradability of 2-NSAP. Among the 25 fungi evaluated two, in particular, Bjerkandera adusta and Pleurotus ostreatus, have been found to significantly depolymerize 2-NSAP yielding to the corresponding monomer (2-naphthalenesulphonic acid, 2-NSA), which has been further degraded by a bacterial consortia selected in a wastewater treatment plant (WWTP). The fungal treatment alone was able to reduce the COD value up to 44%, while activated sludge removed only 9% of the initial COD. In addition, the combined treatment (fungi and bacteria) allowed an increase in the COD removal up to 62%.

Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

Science.gov (United States)

Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

2018-01-01

Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

[Oil degradation by basidiomycetes in soil and peat at low temperatures].

Science.gov (United States)

Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

2016-01-01

A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

Directory of Open Access Journals (Sweden)

Nutsuda Banlangsawan

2016-02-01

Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

Directory of Open Access Journals (Sweden)

Simon James

2011-05-01

Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

Science.gov (United States)

Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

2012-11-07

Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

Directory of Open Access Journals (Sweden)

Tariqul Islam

2017-03-01

Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

Development and evaluation of Pleurotus tuber-regium-cornstarch composite as a direct compression multifunctional excipient.

Science.gov (United States)

Okoye, Ebere I; Onyekweli, Anthony O

2016-01-01

The aim was to develop a novel excipient from Pleurotus tuber-regium (PT)-cornstarch (CS) mixture and evaluate its multifunctional characteristics in tablet formulation. Composites were generated from dephytochemicalized PT and CS combined at 1:1 to 4:1 ratios and pregelatinized in a hot water bath at 65°C ± 2°C for 5 min. The paste was dried, pulverized, and screened through 150-μm sieve. PT-CS physical mixtures were prepared and their characteristics/functionalities in tableting chloroquine were compared to those of composites and microcrystalline cellulose (Avicel(®)). PT ash value was 0.40 ± 0.09% and heavy metal contents were below official limits. PT's differential scanning calorimetric (DSC) thermogram depicted broad melting peak at 329.5°C; this peak was attenuated by the presence of CS. Fourier transform infrared (FTIR) spectra predicted compatibility between PT and CS. Composites consolidated better and also flowed better than physical mixtures and Avicel(®). Increasing PT content enhanced the excipients' swellabilities, and composites possessed significantly (P plastic deformation with yield pressures significantly (P plastic deformation. The mechanical properties of chloroquine tablets were acceptable, with the 1:4 (PT:CS) imparting the best properties. Mean disintegration times for the commercial comparator and Avicel(®) -containing tablets were significantly higher (P < 0.05) than those of composites. Drug release from tablets formulated with composites were similar to the commercial comparator, but significantly higher (P < 0.05) than those of Avicel(®). The novel composites are excellent multifunctional excipients, the best (PT:CS 1:4) one showcasing potentially better mechanical functionality than Avicel(®), a popular multifunctional excipient.

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

Science.gov (United States)

Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

2017-10-01

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

Directory of Open Access Journals (Sweden)

Félix G de Siqueira

2011-06-01

Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

A comparison between electrical uterine monitor, tocodynamometer and intra uterine pressure catheter for uterine activity in labor.

Science.gov (United States)

Hadar, Eran; Biron-Shental, Tal; Gavish, Oz; Raban, Oded; Yogev, Yariv

2015-08-01

We aimed to evaluate the performance of a non-invasive EMG electrical uterine monitor (EUM) versus tocodynamometry (TOCO) by comparing both to internal uterine pressure catheter (IUPC). Prospective observational trial. Uterine activity was recorded continuously and simultaneously, in women during active term labor, with TOCO, EUM and IUPC. Uterine activity tracings were analyzed by three blinded physicians. Overall, 385 tracings from 43 women were analyzed. A similar rate of interpretable tracings between physicians was demonstrated for EUM (87%; 95% CI 80.9-92.7%) and IUPC (94.8%; 95% CI 83.4-96.3%), with a significantly lower rate for TOCO (67.5%; 95% CI 59.4-76.8%, p TOCO versus IUPC (-3.34 ± 4.97). There is a high variability between the timing of TOCO contractions as compared to IUPC (4.74 ± 10.03 seconds), while a gap of 8.46 ± 4.24 seconds was detected for EUM. The sensitivity, positive predictive value and false positive rate for individual contraction identification by TOCO and EUM are 54.0%, 84.4%, 15.6% and 94.2%, 87.6%, 12.4%, respectively. EUM is efficient as IUPC for uterine activity assessment and both techniques are superior in comparison to external tocodynamometry. Our results support the use of non-invasive EMG technology to monitor uterine activity.

PROSES PENGELOLAHAN MENINGKATKAN AKTIVITAS HIPOLIPIDEMIK JAMUR TIRAM (PLEUROTUS OSTREATUS PADA TIKUS (RATTUS NORVEGICUS SPRGUE-DAWLEY HIPERKOLESTEROL

Directory of Open Access Journals (Sweden)

Eni Harmayani, Deera Army Pramana, Sri Anggrahini dan Sutikarini

2012-12-01

Full Text Available Oyster mushroom is considered to have hypocholesterolemic and hypolipidemic activities. Therefore, it is classifiedas functional food. Prior to serving and consumption, oyster mushroom can be processed in various ways. Thisresearch studied the effect of three kinds of processing commonly used in cooking oyster mushroom; boiling,frying, and roasting. Thirty Sprague-Dawley male rats, 8 weeks old, were acclimated to laboratory condition,and then induced with high lipid diet. The rats were divided into five experiment groups; high-lipid diet (K,high-lipid diet + raw oyster mushroom (M, high-lipid diet + fried oyster mushroom (G, high-lipid diet + roastedoyster mushroom (P, and high-lipid diet + boiled oyster mushroom (R. Blood samples were obtained from orbitalplexus after acclimation, hypercholesterolemic induction, and 21 days of feeding. The blood serum was examinedfor total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-c, dan high-densitylipoprotein cholesterol (HDL-c. The result showed that cooked oyster mushroom had better hypocholesterolemicand hypolipidemic activity than raw oyster mushroom. Among the three, the roasted oyster mushroom reduced thetotal cholesterol the most, while boiled oyster mushroom reduced triglyceride the most.

Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

Science.gov (United States)

Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

2016-01-01

An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

Kinetics, equilibrium and thermodynamic studies on biosorption of Ag(I) from aqueous solution by macrofungus Pleurotus platypus.

Science.gov (United States)

Das, Devlina; Das, Nilanjana; Mathew, Lazar

2010-12-15

Reports are available on silver binding capacity of some microorganisms. However, reports on the equilibrium studies on biosorption of silver by macrofungi are seldom known. The present study was carried out in a batch system using dead biomass of macrofungus Pleurotus platypus for the sorption of Ag(I). P. platypus exhibited the highest silver uptake of 46.7 mg g(-1) of biomass at pH 6.0 in the presence of 200 mg L(-1) Ag(I) at 20°C. Kinetic studies based on fractional power, zero order, first order, pseudo-first order, Elovich, second order and pseudo-second order rate expressions have been carried out. The results showed a very good compliance with the pseudo-first order model. The experimental data were analyzed using two parameter isotherms (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Halsey), three parameter isotherms (Redlich-Peterson, Sips, Khan, Koble-Corrigan, Hill, Toth, Radke-Prausmitz, Jossens, Langmuir-Freundlich), four parameter isotherms (Weber-van Vliet, Fritz-Schlunder, Baudu) and five parameter isotherm (Fritz-Schlunder). Thermodynamic parameters of the biosorption (ΔG, ΔH and ΔS) were also determined. The present study confirmed that macrofungus P. platypus may be used as a cost effective efficient biosorbent for the removal of Ag(I) ions from aqueous solution. Copyright © 2010 Elsevier B.V. All rights reserved.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2017-01-01

Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

ISOLASI DAN KARAKTERISASI JAMUR PENDEGRADASI ZAT PEWARNA TEKSTIL (Isolation and Characterization of dye-degrading Fungi

Directory of Open Access Journals (Sweden)

Erni Martani

2011-07-01

. ABSTRACT The aim of this study was to isolate textile dye degrading fungi from many kinds of sample. Isolation was done using surface plating method on Potato Dextrose Agar medium. Degradation ability was measured based on dye decolorization of agar medium. The selection of isolates was based on ability to decolorize some types of dye, rate of decolorization, and tolerance to dye concentration, respectively. Six kinds dye, namely Basic fuchsin, Crystal violet, Direct blue, Methylene blue, Rhodamine B, and Safranine were used in this study. Six species of lignin degrading white rot fungi were used as positive controls. More than 100 fungal strains could be isolated from waste water and solid wastes of textile and pulp & paper industries, peat soils from Central Kalimantan and Riau, and forest soil. Examination on dye decolorization resulted in 6 selected isolates (coded as JKNT-1, JKSC-1, KRMS 5, TPA-4, TPA-10, and JYGC-1; and 2 species of lignin degrading white rot fungi, namely Phanerochaete chrysosporium and Pleurotus ostreatus. Decolorization of dye was depended on the fungal species and type of dye, i.e. one species decolorized some dyes but not the others. Methylene Blue was decolorized more readily than other dyes. In general, dye decolorization activity of fungal isolates was lower than the lignin degrading fungi. Microscopic examination indicated that the isolates of JKNT 1 and KRMS-5 were come from the genus Penicillium, the genus of JKSC-1 was Stachybotrys, the TPA-4 and JYGC-1 were Cladosporium, and TPA-10 isolate was included in genus of Aspergillus.

The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

Directory of Open Access Journals (Sweden)

Islam Md. Tariqul

2017-01-01

Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

Decontamination of a municipal landfill leachate from endocrine disruptors using a combined sorption/bioremoval approach.

Science.gov (United States)

Loffredo, Elisabetta; Castellana, Giancarlo; Senesi, Nicola

2014-02-01

Sorption and biodegradation are the main mechanisms for the removal of endocrine disruptor compounds (EDs) from both solid and liquid matrices. There are recent evidences about the capacity of white-rot fungi to decontaminate water systems from phenolic EDs by means of their ligninolytic enzymes. Most of the available studies report the removal of EDs by biodegradation or adsorption separately. This study assessed the simultaneous removal of five EDs—the xenoestrogens bisphenol A (BPA), ethynilestradiol (EE2), and 4-n-nonylphenol (NP), and the herbicide linuron and the insecticide dimethoate—from a municipal landfill leachate (MLL) using a combined sorption/bioremoval approach. The adsorption matrices used were potato dextrose agar alone or added with each of the following adsorbent materials: ground almond shells, a coffee compost, a coconut fiber, and a river sediment. These matrices were either not inoculated or inoculated with the fungus Pleurotus ostreatus and superimposed on the MLL. The residual amount of each ED in the MLL was quantified after 4, 7, 12, and 20 days by HPLC analysis and UV detection. Preliminary experiments showed that (1) all EDs did not degrade significantly in the untreatedMLL for at least 28 days, (2) the mycelial growth of P. ostreatus was largely stimulated by components of the MLL, and (3) the enrichment of potato dextrose agar with any adsorbent material favored the fungal growth for 8 days after inoculation. A prompt relevant disappearance of EDs in the MLL occurred both without and, especially, with fungal activity, with the only exception of the very water soluble dimethoate that was poorly adsorbed and possibly degraded only during the first few days of experiments. An almost complete removal of phenolic EDs, especially EE2 and NP, occurred after 20 days or much earlier and was generally enhanced by the adsorbent materials used. Data obtained indicated that both adsorption and biodegradation mechanisms contribute

Production of versatile peroxidase from Pleurotus eryngii by solid-state fermentation using agricultural residues and evaluation of its catalytic properties.

Science.gov (United States)

Palma, C; Lloret, L; Sepúlveda, L; Contreras, E

2016-01-01

Interest in production of ligninolytic enzymes has been growing over recent years for their use in various applications such as recalcitrant pollutants bioremediation; specifically, versatile peroxidase (VP) presents a great potential due to its catalytic versatility. The proper selection of the fermentation mode and the culture medium should be an imperative to ensure a successful production by an economic and available medium that favors the process viability. VP was produced by solid-state fermentation (SSF) of Pleurotus eryngii, using the agricultural residue banana peel as growth medium; an enzymatic activity of 10,800 U L(-1) (36 U g(-1) of substrate) was detected after 18 days, whereas only 1800 U L(-1) was reached by conventional submerged fermentation (SF) with glucose-based medium. The kinetic parameters were determined by evaluating the H2O2 and Mn(2+) concentration effects on the Mn(3+)-tartrate complex formation. The results indicated that although the H2O2 inhibitory effect was observed for the enzyme produced by both media, the reaction rates for VP obtained by SSF were less impacted. This outcome suggests the presence of substances released from banana peel during the fermentation, which might exhibit a protective effect resulting in an improved kinetic behavior of the enzyme.

Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

International Nuclear Information System (INIS)

Awafo, V.A.; Chahal, D.S.; Charbonneau, R.

1995-01-01

Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mild alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and γ-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. The highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P. sajor-caju was recorded. (author)

Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

International Nuclear Information System (INIS)

Awafo, V.A.; Chahal, D.S.; Charbonneau, R.

1995-01-01

Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mied alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and γ-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. This highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P.sajor-caju was recorded. (author)

Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Awafo, V.A.; Chahal, D.S.; Charbonneau, R. [Universite du Quebec (Canada). Applied Microbiology Research Center

1995-10-01

Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mild alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and {gamma}-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. The highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P. sajor-caju was recorded. (author).

Comparative analysis of diabetes self-management education programs in the European Union Member States.

Science.gov (United States)

Saha, Sarama; Riemenschneider, Henna; Müller, Gabriele; Levin-Zamir, Diane; Van den Broucke, Stephan; Schwarz, Peter E H

2017-12-01

Diabetes self-management education (DSME) is generally considered as an integral part of diabetes care. The availability of different types of self-management in the European Union Member States (EUMS) remains uncertain. The aim of this study is to perform a comparative analysis of existing DSME programs (DSMEP) implemented in EUMS. Unpublished data regarding DSME in the EUMS was assessed with Diabetes Literacy Survey using wiki tool (WT) targeting patients and different stakeholders. An additional literature review (LR) was performed in PubMed to identify published studies regarding DSMEP in the EUMS from 2004 to 2014. A total of 102 DSMEP implemented in EUMS were reported in the WT and 154 programs were identified from the LR. Comparative analysis of the data indicated that a majority of programs are aimed at adults and only a minority at children and elderly. Only a small percentage of the programs utilize information technology for teaching and learning, and only one out of five programs pay attention to depression. The identified DSMEP aimed primarily to empower patients through increasing knowledge and changing attitudes and beliefs towards diabetes. This study provides an overview of the present state-of-the-art on diabetes self-management education programs in the 28 EUMS. To increase participation, existing DSMEP should be made more accessible to the patients as well as tailored to specific patient groups. Copyright © 2017 Primary Care Diabetes Europe. Published by Elsevier Ltd. All rights reserved.

Additive effects of CuSO4 and aromatic compounds on laccase production by Pleurotus sajor-caju PS-2001 using sucrose as a carbon source

Directory of Open Access Journals (Sweden)

F. Bettin

2014-06-01

Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.

Influence of gaseous phase, light and substrate pretreatment on fruit-body formation, lignin degradation and in vitro digestibility of wheat straw fermented with Pleurotus spp

Energy Technology Data Exchange (ETDEWEB)

Kamra, D.N.; Zadrazil, F.

1986-01-01

Wheat straw was fermented in the solid state with Pleurotus sajor-caju and P. eryngii at 25 degrees C under different concentrations of oxygen and carbon dioxide. Lower than 20% oxygen in the gaseous phase adversely affected the loss of organic matter, the lignin degradation and the change in straw digestibility with both species of Pleurotus. Higher concentrations (10%-30%) of carbon dioxide, with 20% oxygen in the atmospshere, slightly decreased the loss of lignin and organic matter when compared with the losses under oxygen or air. In spite of better lignin degradation by P. sajor-caju, the process efficiency with P. eryngii was higher, because of lower loss of organic matter during the fermentation. Fruit-bodies were not formed by P. eryngii during the period of experiment in any of the treatments. In P. sajor-caju, fruit-bodies were only formed either in flasks closed with cotton plugs or supplied with a continuous flow of sterile air. Carbon dioxide inhibited the process of primordia initiation and fruit-body development. A short exposure (20 minutes per day) to light was essential for primordia and fruit-body formation. The substrate changes and process efficiency with respect to increase in digestibility were much higher in darkness than in light. Light leads to intensive fruit-body production and a different pattern of substrate degradation. The indigenous microflora of wheat straw inhibited fruit-body formation and caused a higher organic matter loss, accompanied by a decrease in digestibility of the fermented wheat straw. 33 references.

Antagonistic evaluation of Trichodermaviride and Aspergillusflavus against wood-decay fungus Pleurotusostreatus

Science.gov (United States)

Erwin; Iskandar, E.; Husien, N.

2018-04-01

Pleurotusostreatus cultivation is often limited by the presence of antagonistic microorganisms that can also grow together on a variety of substrates that are used as growth media of P. ostreatus. As a preliminary study, this research aims to evaluate the antagonism of Trichodermaviride and Aspergillusflavus in interacting with the P.ostreatus fungus by in-vitro. An antagonism test using a dual culture method of these fungi with 1 month incubation time on Poteto Dextrose Agar (PDA) media was performed. Evaluation of the antagonistic properties of these fungi is conducted through macroscopic and microscopic observations. Macroscopically, the growth of T. viride and A. flavus mycelium showed that both colonies were more dominant than P. ostreatus colonies. Microscopically, hyphae of T. viride and A. flavus indicate the presence of very strong micoparasitic properties that characterized by attachment and convolution of both hyphae to P. ostreatus hyphae. It was concluded thatthe growth of T. viride and A. flavus fungi was more dominant and had potential as an inhibiting agent of P. ostreatus fungal growth, respectively, in dual culture on PDA media.

Manejo biológico de nematodos fitoparásitos con hongos y bacterias

Directory of Open Access Journals (Sweden)

Ricardo Piedra Naranjo

2013-05-01

Full Text Available La agricultura actual demanda la reducción de plaguicidas químicos y la introducción de sistemas sostenibles con el uso de agentes de manejo biológico.  La alternativa de usar hongos y bacterias para el manejo de nematodos fitoparásitos puede ser una opción biológica muy importante de actualidad. El manejo biológico de nematodos fitoparásitos es posible si se logra fomentar e investigar la utilización de hongos y bacterias que pueden estar en el suelo o, de lo contrario, reproducirse en laboratorios para uso comercial. En revisión de literatura se encontró varios organismos (hongos y bacterias que pueden ser utilizados por agricultores, y en algunos casos, ya están siendo aplicados. Entre los organismos encontrados, tenemos las bacterias Pasteuria penetrans, Pseudomonas (Burlkoldelia cepacia tipo Wisconsin.  Algunos hongos como: Verticillium chlamydosporium. Arthtrobotrys y Monacrosporium, Catenaria spp, Drechmeria coniospora, Pleurotus ostreatus, Pleurotus spp. Fusarium solani, Cylindrocarpon cylindroides y Paecilomyces lilacinus, Verticillium lecanii, Arthrobotrys conoides, A. musiformis, A.  robusta, Monoacrosporium ellipsosporum, Dactylaria thaumasia, Cylindrocarpon sp., Trichoderma harzianum, Dactylella brochophaga, Arthrobotrys oligospora y Arthrobotrys botryospora y Myrothecium verrucaria. Con este tipo de información, planteada desde el punto de vista en investigaciones agropecuarias, se podría tener posibilidades de utilizar nematicidas biológicos en el manejo de nematodos fitoparásitos, desarrollando un manejo integrado de plagas, donde se tendría la posibilidad de no usar de nematicidas químicos en un futuro, o por lo menos reducir sustancialmente su uso en nuestra agricultura y así mejorar la relación con el medio ambiente y el ser humano.

Mechanistic Study of 17 alpha-Ethinylestradiol Biodegradation by Pleurotus ostreatus: Tracking of Extracelullar and Intracelullar Degradation Mechanisms

Czech Academy of Sciences Publication Activity Database

Křesinová, Zdena; Moeder, M.; Ezechiáš, Martin; Svobodová, Kateřina; Cajthaml, Tomáš

2012-01-01

Roč. 46, č. 24 (2012), s. 13377-13385 ISSN 0013-936X R&D Projects: GA TA ČR TA01020804; GA ČR GAP503/10/0408 Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGI * ENDOCRINE-DISRUPTING CHEMICALS * PERSONAL CARE PRODUCTS Subject RIV: EE - Microbiology, Virology Impact factor: 5.257, year: 2012

Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

Science.gov (United States)

Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

2017-02-01

The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

Evaluation of the Cytotoxic Effects of CAM Therapies: An In Vitro Study in Normal Kidney Cell Lines

Directory of Open Access Journals (Sweden)

Shagun Arora

2014-01-01

Full Text Available The purpose of this current study was to justify the incorporation of complementary and alternate medicine (CAM in current cancer treatments. The major drawback of anticancer drugs is their nonselective killing, which ultimately leads to attrition of normal cells. Keeping this as the foundation of our study, we made an effort to compare the cytotoxicity associated with a known chemotherapeutic drug 5-Fluorouracil (5-FU, with certain CAM therapies previously reported to have anticancer activity. The parameters chosen for the study were based on antiproliferative and cytotoxic effects on normal, kidney epithelial cells (NRK-52E. The MTT assay, colony formation assay, DNA fragmentation, and differential staining using AO/EB, following treatment with either 5-FU or CAM therapies, were performed. The CAM therapies under study were various extracts of wheatgrass, roots of Achyranthes aspera (AA, mushroom extracts (Pleurotus ostreatus, Macrolepiota procera, and Auricularia polytricha, and a homeopathic drug, Ruta graveolens (Ruta. The results showed that treatment of normal cells with the CAM therapies led to minimum cell damage in comparison to 5-FU. This evidence-based study will lead to greater acceptance of alternative therapies against cancer.

EVALUATION OF ENDOGLUCANASE, EXOGLUCANASE, LACCASE, AND LIGNIN PEROXIDASE ACTIVITIES ON TEN WHITE-ROT FUNGI

Directory of Open Access Journals (Sweden)

Sandra Montoya B

2014-12-01

Full Text Available This paper presents a way of tracking the production of lignocellulolytic enzymes in ten species of white rot fungi: Lentinula edodes, Schizophyllum commune, Trametes trogii, Coriolus versicolor, Pycnoporus sanguineus, Ganoderma applanatum, Ganoderma lucidum, Grifola frondosa, Pleurotus ostreatus and Auricularia delicata. These species were first screened on solid culture media containing carboxymethyl cellulose, crystalline cellulose, ABTS (2,2´-azino-bis(3-ethylbenzothiazoline-6-sulphonate and azure B, which showed the production of endoglucanase, exoglucanase, laccase and lignin peroxidase (LiP enzymes. Cellulolytic activities were detected after five days of incubation with congo red indicator, forming a clear-white halo in areas where cellulose was degraded. For ligninases, the tracking consisted of the monitoring in the formation of green halos due to ABTS oxidation for laccase, and decolorization halos on azure B for LiP during 14 days of incubation. From this qualitative screening, four strains were selected (G. lucidum, L. edodes, C. versicolor and T. trogii as the best producers of cellulolytic and ligninolytic enzymes. These four species were inoculated on a substrate of sawdust oak, yielding 51,8% of lignin degraded by L. edodes and 22% of cellulose degraded by C. versicolor.

Bioremediation of soil contaminated crude oil by Agaricomycetes.

Science.gov (United States)

Mohammadi-Sichani, M Maryam; Assadi, M Mazaheri; Farazmand, A; Kianirad, M; Ahadi, A M; Ghahderijani, H Hadian

2017-01-01

One of the most important environmental problems is the decontamination of petroleum hydrocarbons polluted soil, particularly in the oil-rich country. Bioremediation is the most effective way to remove these pollutants in the soil. Spent mushroom compost has great ability to decompose lignin-like pollution. The purpose of this study was the bioremediation of soil contaminated with crude oil by an Agaricomycetes . Soil sample amended with spent mushroom compost into 3%, 5% and 10% (w/w) with or without fertilizer. Ecotoxicity germination test was conducted with Lipidium sativa . The amplified fragment (18 s rDNA) sequence of this mushroom confirmed that the strain belonged to Pleurotus ostreatus species with complete homology (100% identity). All tests experiment sets were effective at supporting the degradation of petroleum hydrocarbons contaminated soil after three months. Petroleum contaminated soil amended with Spent mushroom compost 10% and fertilizer removed 64.7% of total petroleum hydrocarbons compared control. The germination index (%) in ecotoxicity tests ranged from 60.4 to 93.8%. This showed that the petroleum hydrocarbons contaminated soil amended with 10% Spent mushroom compost had higher bioremediation ability and reduced soil toxicity in less than three months.

On the reaction of some bacteria and fungi on coal tar creosote. Zur Verhalten einiger Bakterien und Pilze gegenueber Steinkohlenteeroel

Energy Technology Data Exchange (ETDEWEB)

Schmidt, O.; Dittberner, D.; Faix, O. (Universitaet Hamburg, Hamburg (Germany). Ordinariat fuer Holzbiologie)

1991-01-01

To contribute to the waste management of wood preservatives, the biodegradability of coal tar creosote by bacteria and fungi has been investigated. Microorganisms comprised 24 bacterial strains and 31 fungi from different systematic and ecological groups as well as isolates from contaminated soils. Based on countings of viable cells, the experiments with various nutrient media, methods of cultivation, preservative concentrations, and organic solvents yielded some bacteria which could grow in the presence of creosote: {ital Aeromonas hydrophila}, {ital Flavobacterium} sp., {ital Pseudomonas arvilla}, {ital P. fluorescens}, and {ital P. putida}. The white-rot fungi {ital Bjerkandera adusta}, {ital Heterobasidion annosum}, {ital Hirschioporus abietinus}, {ital Lentinula edodes}, {ital Peniophora gigantea}, {ital Pleurotus ostreatus}, {ital Schizophyllum commune}, and {ital Trametes versicolor}, the brown-rot fungus {ital Lentinus lepideus}, the staining fungi {ital Ceratocystis piceae} and {ital Stereum sanguinolentum}, and the moulds {ital Paecilomyces variotii} and {ital Trichoderma viride} also grew with creosote. To prepare samples for IR-measurements, continuous extraction of creosote from the nutrient liquid by percolation with methylene chloride was suitable. However, the IR-spectra of creosote did not show any measurable changes after incubation with 16 bacterial strains and 6 fungi. 42 refs., 2 figs., 4 tabs.

Fungal biodegradation of anthracene-polluted cork: A comparative study.

Science.gov (United States)

Jové, Patrícia; Olivella, Maria À; Camarero, Susana; Caixach, Josep; Planas, Carles; Cano, Laura; De Las Heras, Francesc X

2016-01-01

The efficiency of cork waste in adsorbing aqueous polycyclic aromatic hydrocarbons (PAHs) has been previously reported. Biodegradation of contaminated cork using filamentous fungi could be a good alternative for detoxifying cork to facilitate its final processing. For this purpose, the degradation efficiency of anthracene by three ligninolytic white-rot fungi (Phanerochaete chrysosporium, Irpex lacteus and Pleurotus ostreatus) and three non-ligninolytic fungi which are found in the cork itself (Aspergillus niger, Penicillium simplicissimum and Mucor racemosus) are compared. Anthracene degradation by all fungi was examined in solid-phase cultures after 0, 16, 30 and 61 days. The degradation products of anthracene by P. simplicissimum and I. lacteus were also identified by GC-MS and a metabolic pathway was proposed for P. simplicissimum. Results show that all the fungi tested degraded anthracene. After 61 days of incubation, approximately 86%, 40%, and 38% of the initial concentration of anthracene (i.e., 100 µM) was degraded by P. simplicissimum, P. chrysosporium and I. lacteus, respectively. The rest of the fungi degraded anthracene to a lesser extent (cork itself, could be used as an efficient degrader of PAH-contaminated cork.

Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

Directory of Open Access Journals (Sweden)

Silva Sueli Oliveira

2002-01-01

Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

Science.gov (United States)

Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

2014-01-01

Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

Study of new ways of supplementary and combinatory therapy of rheumatoid arthritis with immunomodulators. Glucomannan and Imunoglukán in adjuvant arthritis.

Science.gov (United States)

Bauerová, K; Paulovicová, E; Mihalová, D; Svík, K; Ponist, S

2009-01-01

We studied the anti-arthritic activity of glucomannan (GM) isolated from Candida utilis and of Imunoglukán, a beta-(1,3/1,6)-D-glucan (IMG) isolated from Pleurotus ostreatus. Adjuvant arthritis (AA) was induced intradermally by the injection of Mycobacterium butyricum in incomplete Freund's adjuvant to Lewis rats. Blood for biochemical and immunological analysis was collected on experimental days 1, 14, 21, and 28. A clinical parameter--hind paw volume (HPV)--was also measured. The detection of IL-1 alpha, IL-4, TNF alpha, and MCP-1 was done by immunoflowcytometry. On day 28--the end of the experiment--we determined spectrophotometrically: the total anti-oxidant status (TAS) of plasma samples along with thiobarbituric acid-reacting substances (TBARS) levels in plasma and we assessed the activity of gamma-glutamyl transferase (GGT) in hind paw joint homogenate. The experiments included healthy animals, arthritic animals without treatment, and arthritic animals with administration of glucomannan (GM-AA) in the oral daily dose of 15 mg/kg b.w. and of IMG (IMG-AA) in the oral daily dose of 2 mg/kg b.w. The progress of AA was manifested by all parameters monitored. Both substances had beneficial effects on HPV, TBARS levels, GGT activity, and TAS levels. For cytokine assessment, only IMG-AA samples were selected, considering the significant HPV improvement accompanied with the observed anti-oxidant action. IMG administration had a positive immunomodulating effect on all cytokine plasma levels measured, changed markedly due to arthritis progression. Thus, IMG may be considered as a candidate for combinatorial therapy of rheumatoid arthritis.

Synthesis and characterization of nanocomplexes of Eu(III) and Er(III) coordinate with 2(4-clorophenil)-3-phenyl-1,3,4-thiadiazoleo-5-tiolate mesoionic

International Nuclear Information System (INIS)

Taveira Rocha do Nascimento, Railda Shelsea; Rodrigues da Silva Morais, Crislene; Lucena Lira, Helio de; Alves de Morais, Soraya; Filgueiras de Athayde Filho, Petronio; Figueiredo Lopes Lucena, Luciana de; Gouveia de Souza, Antonio; Brasileiro Campos, Gabriela

2010-01-01

The solids achieved in nanometric scale have been demanding scientific and technological interest due to the significant alterations in physical and chemical properties observed in such kind of materials, potentializing their technological applications. The nanocomplexes produced by lanthanide ions with the mesoionic compounds 2(4-clorophenil)-3-phenyl-1,3,4-thiadiazole-5-tiolate (M-1) were achieved in a powdered yellowed way. These compounds were characterized through X-ray diffraction, infrared (IR) spectroscopy and differential scanning calorimetry (DSC). The X-ray diffractograms of the M-1 compound and of Er(M-1) 3 .3H 2 O, Eu(M-1) 3 .3H 2 O complexes, presented more than one phase and a crystalline structure. The disappearance and appearance of new peaks, as well as the variation on the intensity of the M-1 majoritary peaks as compared to the complexes' peaks can also be observed. The IR spectra indicate that the coordination of M-1 with the cations Eu +3 e Er +3 probably happens due to the sulfur exocyclic atom, where a considerable displacement in the carbon-sulfur (C-S)-ligation can be perceived. Comparing the DSC curves of the M-1, Er(M-1) 3 .3H 2 O and Eu(M-1) 3 .3H 2 O, a displacement of the complexes peaks in relation to M-1 can be observed, suggesting the achievement of new specimens. Thus, it can be concluded that the formation of two new organic nanocomplexes with crystalline characteristics which may be used as a pharmacy, is quite evident.

Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

International Nuclear Information System (INIS)

Awang, M.R.; Mutaat, H.H.; Mahmud, M.S.

1993-01-01

In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28 o C, relative pH 6-8, moisture 60-70% and medium composition of CaCO 3 : were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO 2 released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author)

Elucidation of the regio- and chemoselectivity of enzymatic allylic oxidations with Pleurotus sapidus – conversion of selected spirocyclic terpenoids and computational analysis

Directory of Open Access Journals (Sweden)

Verena Weidmann

2013-10-01

Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.

Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

Science.gov (United States)

Suseem, S R; Saral, Mary

2015-07-01

To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

Endotoxin levels and contribution factors of endotoxins in resident, school, and office environments - A review

Science.gov (United States)

Salonen, Heidi; Duchaine, Caroline; Létourneau, Valérie; Mazaheri, Mandana; Laitinen, Sirpa; Clifford, Sam; Mikkola, Raimo; Lappalainen, Sanna; Reijula, Kari; Morawska, Lidia

2016-10-01

As endotoxin exposure has known effects on human health, it is important to know the generally existing levels of endotoxins as well as their contributing factors. This work reviews current knowledge on the endotoxin loads in settled floor dust, concentrations of endotoxins in indoor air, and different environmental factors potentially affecting endotoxin levels. The literature review consists of peer-reviewed manuscripts located using Google and PubMed, with search terms based on individual words and combinations. References from relevant articles have also been searched. Analysis of the data showed that in residential, school, and office environments, the mean endotoxin loads in settled floor dust varied between 660 and 107,000 EU/m2, 2180 and 48,000 EU/m2, and 2700 and 12,890 EU/m2, respectively. Correspondingly, the mean endotoxin concentrations in indoor air varied between 0.04 and 1610 EU/m3 in residences, and 0.07 and 9.30 EU/m3 in schools and offices. There is strong scientific evidence indicating that age of houses (or housing unit year category), cleaning, farm or rural living, flooring materials (the presence of carpets), number of occupants, the presence of dogs or cats indoors, and relative humidity affect endotoxin loads in settled floor dust. The presence of pets (especially dogs) was extremely strongly associated with endotoxin concentrations in indoor air. However, as reviewed articles show inconsistency, additional studies on these and other possible predicting factors are needed.

Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

Science.gov (United States)

Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

2016-04-01

The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

Biochemical and microstructural Ccharacteristics of insoluble and soluble dietary fiber prepared from mushroom sclerotia of Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos.

Science.gov (United States)

Wong, Ka-Hing; Cheung, Peter C K; Wu, Jin-Zhong

2003-11-19

The proximate composition of sclerotia of Pleurotus tuber-regium, Polyporus rhinoceros, and Wolfiporia cocos, together with the yield, purity, monosaccharide profile, and microstructure of their insoluble dietary fiber (IDF) and soluble dietary fiber (SDF) fractions prepared from AOAC enzymatic-gravimetric methods were investigated and compared. All three sclerotia were typical carbohydrate rich sclerotia [ranging from 90.5 to 98.1% dry matter (DM)] with an exceptionally low amount of crude lipid content (ranging from 0.02 to 0.14% DM). Besides, all three sclerotia possessed substantial amounts of IDF (ranging from 77.4 to 94.6% DM) with notably high levels of nonstarch polysaccharides (NSP) (89.9-92.2% DM) in which glucose was the predominant sugar residue (90.6-97.2% of NSP DM). On the contrary, both the yield (only ranging from 1.45 to 2.50% DM) and the amount of NSP (ranging from 22.4 to 29.6% DM) of the three sclerotial SDF fractions were very low. Scanning electron micrographs showed fragments of interwoven hyphae and insoluble materials in the three sclerotial IDF fractions, but only an amorphous structure of soluble materials was observed in the SDF fractions. The potential use of these fiber preparations was discussed.

Analisis Faktor-Faktor yang Mempengaruhi Pendapatan Usahatani Jamur Tiram (Pleurotus ostreatus) di Kota Medan dan Kabupaten Deli Serdang

OpenAIRE

Ginting, Nina Maksimiliana

2015-01-01

Oyster mushroom is a horticultural crop which is very good for health and has high economic value. Therefore, how big the economic value that can be gained is needs to be studied. The purpose of this study was to analyze the factors influencing the income of oyster mushroom farming in the City of Medan and Deli Serdang District. The data used in this study conducted in 2012 were primary and secondary data. The data obtained were analyzed through multiple linear regression tests using SPSS ...

An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

Science.gov (United States)

Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

2009-02-01

Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

Occupational hygiene in terms of volatile organic compounds (VOCs) and bioaerosols at two solid waste management plants in Finland

International Nuclear Information System (INIS)

Lehtinen, Jenni; Tolvanen, Outi; Nivukoski, Ulla; Veijanen, Anja; Hänninen, Kari

2013-01-01

Highlights: ► Odorous VOCs: acetic acid, 2,3-butanedione, ethyl acetate, alpha-pinene and limonene. ► VOC concentrations did not exceed occupational exposure limit concentrations. ► 2,3-Butanedione as the health effecting compound is discussed. ► Endotoxin concentrations may cause health problems in waste treatment. - Abstract: Factors affecting occupational hygiene were measured at the solid waste transferring plant at Hyvinkää and at the optic separation plant in Hämeenlinna. Measurements consisted of volatile organic compounds (VOCs) and bioaerosols including microbes, dust and endotoxins. The most abundant compounds in both of the plants were aliphatic and aromatic hydrocarbons, esters of carboxylic acids, ketones and terpenes. In terms of odour generation, the most important emissions were acetic acid, 2,3-butanedione, ethyl acetate, alpha-pinene and limonene due to their low threshold odour concentrations. At the optic waste separation plant, limonene occurred at the highest concentration of all single compounds of identified VOCs. The concentration of any single volatile organic compound did not exceed the occupational exposure limit (OEL) concentration. However, 2,3-butanedione as a health risk compound is discussed based on recent scientific findings linking it to lung disease. Microbe and dust concentrations were low at the waste transferring plant. Only endotoxin concentrations may cause health problems; the average concentration inside the plant was 425 EU/m 3 which clearly exceeded the threshold value of 90 EU/m 3 . In the wheel loader cabin the endotoxin concentrations were below 1 EU/m 3 . High microbial and endotoxin concentrations were measured in the processing hall at the optic waste separation plant. The average concentration of endotoxins was found to be 10,980 EU/m 3 , a concentration which may cause health risks. Concentrations of viable fungi were quite high in few measurements in the control room. The most problematic factor was

Obtención in vitro de micelio de hongos comestibles, shiitake (Lentinula edodes) y orellanas (Pleurotus ostreatus y Pleurotus pulmonarius) a partir de aislamientos de cuerpos fructíferos, para la producción de semilla / In vitro micelia isolation of edible mushrooms, shiitake (Lentinula edodes) and oyster mushrooms (Pleurotus ostreatus and Pleurotus pulmonarius) from fruiting bodies, for spawn production

OpenAIRE

Suárez Arango, Carolina

2010-01-01

Los macromicetos han sido parte de la cultura humana desde hace miles de años y han sido reportados como alimento humano en las más importantes civilizaciones de la historia. Se han descrito muchísimas propiedades nutricéuticas de los macromicetos, como lo son sus propiedades anticancerígenas y antitumorales, hipocolesterolémicas, antivirales, antibacterianas, inmunomoduladoras, entre otras. Igualmente, han sido descritas sus propiedades nutricionales, tienen un elevado contenido de proteína,...

The fungistatic activity of organic selenium and its application to the production of cultivated mushrooms Agaricus bisporus and Pleurotus spp.

Directory of Open Access Journals (Sweden)

Savic Milena

2012-01-01

Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001

Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

Energy Technology Data Exchange (ETDEWEB)

Awang, M.R.; Mutaat, H.H.; Mahmud, M.S. (Ministry of Science, Technology and the Environment (Malaysia). Nuclear Energy Unit) (and others)

In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28[sup o]C, relative pH 6-8, moisture 60-70% and medium composition of CaCO[sub 3]: were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO[sub 2] released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author).

Study on Chinese model of low carbon economy-energy-electricity-environment

Energy Technology Data Exchange (ETDEWEB)

Hu, Zhaoguang

2010-09-15

With the successful experience on energy efficiency in the past 30 years in China, it can be summarized as Energy Usage Management(EUM) and Integrated Resource Strategic Planning(IRSP). They will play essential role in Low Carbon Economy. The model of Low Carbon Economy-Energy-Electricity-Environment and an outlook of Chinese economic growth, energy-electricity demand, and renewable energy generation have been studied in this paper. It has been shown that China would save energy 4.38 billion toe and reduce CO2 emission 16.55 billion ton by EUM, and would save energy 1.5 billion toe and reduce CO2 emission 5.7 Btons by IRSP during 2010-2030.

Perbandingan Pertumbuhan Jamur Tiram Putih di Kumbung Ciseeng dan Universitas Al-Azhar Indonesia

Directory of Open Access Journals (Sweden)

Putri Kenanga

2016-03-01

Full Text Available White oyster mushroom (Pleurotus ostreatus is one of wood fungi which easy to grow at rotting wood and organic waste. White oyster mushroom is rich in protein, carbohydrates, minerals, and vitamins. Environmental factors affecting the growth of white oyster mushrooms is temperature and humidity. The study aims to compare the growth and production of white oyster mushroom in different location, Ciseeng and University of Al-Azhar Indonesia (UAI. Cultivation in UAI done in a controlled situation using autoclave sterilization, inoculation using enkas and the treatment is watering on gunny sack in the mushroom house regularly. Whereas, cultivation in Ciseeng less controlled by traditional cultivation using steam sterilization and inoculation process at open space. Wet weight, dry weight, and biological efficiency results is higher in UAI than Ciseeng at 7.95%, 14.5%, and 7.34% higher, respectively. Morphological parameter such as number of fruiting body, mushroom cap diameters, and stem lenght also show better in UAI than Ciseeng at 23.67%, 8.75%, 54.96% higher, respectively. Better result of mushroom cultivation at UAI supported by 28.3oC average temperature and 93.95% humidity, meanwhile in Ciseeng average temperature and humidity was 29.25oC and 82.15%.

Modification of growth conditions by mm-waves of wood-decaying mushrooms cultures

International Nuclear Information System (INIS)

Avagyan, I.A.

2016-01-01

Basidial macromycetes are not only value food, but can be used as source of such biological active compounds as the genistein, β -glucans, glioxal-oxidase et al. In this work we used different frequencies of extremely high frequency of electromagnetic irradiation (EHF EMI) with the aim of obtaining mushroom cultures with increased fermentative activity by the modulation of its growth conditions during growth on the peptone media. We investigated the influence of the non-thermal extremely high frequency electromagnetic waves in the interval of 45-53 GHz on β-glucosidase activities of two species of wood-decaying mushroom. In this study we examined the most popular edible wood-decaying mushroom Pleurotus ostreatus, which is wide-spread in the forests and commercial mushroom Lentinula edodes, under influence of such an abiotic factor as the extremely high frequency waves in the interval of 45 GHz - 53 GHz during 20 and 40 min on the 7th day of mycelial culture's growth. After the treatment of cultures we continued their growth and on the 3th day we examined the influence of these waves on fermentative activity of mycelial extracts. The some conditions of such treatment led to significant rising of β-glucosidase activities in the extracts of mycelial cultures

β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.

Science.gov (United States)

Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang

2017-01-01

Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.

Treatment of petroleum drill cuttings using bioaugmentation and biostimulation supplemented with phytoremediation.

Science.gov (United States)

Kogbara, Reginald B; Ogar, Innocent; Okparanma, Reuben N; Ayotamuno, Josiah M

2016-07-28

This study sought to compare the effectiveness of bioaugmentation and biostimulation, as well as the combination of both techniques, supplemented with phytoremediation, in the decontamination of petroleum drill cuttings. Drill cuttings with relatively low concentration of total petroleum hydrocarbons (TPH) and metals were mixed with soil in the ratio 5:1 and treated with three different combinations of the bioremediation options. Option A entailed bioaugmentation supplemented with phytoremediation. Option B had the combination of biostimulation and bioaugmentation supplemented with phytoremediation. While biostimulation supplemented with phytoremediation was deployed in option C. Option O containing the drill cuttings-soil mixture without treatment served as untreated control. Fertilizer application, tillage and watering were used for biostimulation treatment, while spent mushroom substrate (Pleurotus ostreatus) and elephant grass (Pennisetum purpureum) were employed for bioaugmentation and phytoremediation treatment, respectively. The drill cuttings-soil mixtures were monitored for TPH, organic carbon, total nitrogen, pH, metal concentrations, and fungal counts, over time. After 56 days of treatment, there was a decline in the initial TPH concentration of 4,114 mg kg(-1) by 5.5%, 68.3%, 75.6% and 48% in options O, A, B and C, respectively. Generally, higher TPH loss resulted from the phytoremediation treatment stage. The treated options also showed slight reductions in metal concentrations ranging from 0% to 16% of the initial low concentrations. The results highlight the effectiveness of bioaugmentation supplemented with phytoremediation. The combination of bioaugmentation and biostimulation supplemented with phytoremediation, however, may prove better in decontaminating petroleum drill cuttings to environmentally benign levels.

Oil palm empty fruit bunch as media for mushroom cultivation

International Nuclear Information System (INIS)

Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

1998-01-01

The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

EVALUATION OF GIN WASTE AS A GROWING SUBSTRATE, ENRICHED WITH DIFFERENT VOLUME PERCENTAGE OF THE WHEAT BRAN FOR CULTIVATION OF OYSTER MUSHROOM (PLEUROTUS OSTREATUS

Directory of Open Access Journals (Sweden)

M. M. Akhtar

2016-08-01

Full Text Available Pleurotusostreatus mushroom was cultivated on cotton gin waste amended with wheat bran in order to judge its growth potential. Two substrates (cotton gin waste and wheat bran were employed alone and with different combinations. Experiment consisted of four treatments T0 (100 % cotton gin waste, T1(97% cotton gin waste + 3% wheat bran, T2(94% cotton gin waste + 6% wheat bran and T3(91% cotton gin waste + 9% wheat bran. Data about time needed for commencement of spawn run, time needed for completion of mycelial growth, time needed for initiation of pinheads, time needed for harvesting of 1st, 2nd and 3rd flush, fresh weight of 1st, 2nd and 3rd flush harvested, total yield, pH of mushroom, total soluble solids of mushroom, acidity and ascorbic acid contents, reducing sugars, non-reducing sugars and total sugars of mushroom, total nitrogen, phosphorus and potassium contents of mushroom was recorded. T0 (100 % cotton gin waste performed better as compared to other treatments.

Oyster mycelium on the liquid medium

Directory of Open Access Journals (Sweden)

Mariusz Gapiński

2013-12-01

Full Text Available The research presents the results of oyster mycelium growth on the liquid medium. The growth of 4-mycelium genius: Pleurotus citrinopileatus Singer, Pleurotus djamor Fries, Boedjin, Pleurotus erynii Fr. Kumm. and Pleurotus precoce Fr. Quel was tested. The quality and quantity of mycelium was assumed.

Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

Directory of Open Access Journals (Sweden)

Nualsri, C.

2005-01-01

Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

Characterization of Anatomical, Chemical, and Biodegradable Properties of Fibers from Corn, Wheat, and Rice Residues Caracterización de Propiedades Anatómicas, Químicas y de Biodegradación de Fibras Provenientes de Residuos de Maíz, Trigo y Arroz

Directory of Open Access Journals (Sweden)

Rose Marie Garay M

2009-09-01

Full Text Available Anatomical, chemical, and biodegradation properties of fibers from wheat (Triticum aestivum L., rice (Oryza sativa L., and corn (Zea mays L. plant residues and from rice hull were characterized to generate scientific and technical knowledge to support decision making regarding their use. The anatomical and chemical properties were determined following standard procedures. The degree of biodeterioration was analyzed from growth of white rot fungus Pleurotus ostreatus (Jaq. Quél. in 30 d under favorable conditions. Afterwards, weight loss was evaluated for each residue. Three replicates were used, plus a control of radiata pine (Pinus radiata D. Don woodchips. The greatest proportion of a-cellulose was found in residues of rice plants (45.1%, with a high amount of extractable (non-structural components, that confer organoleptic characteristics, followed by rice hull (22.78%, which is explained by the presence of silica in their cells. Ash content was higher in wheat residues, reaching up to 18.34%. Anatomical characteristics were studied to corroborate potential use in industrial processes. Fiber length and wall thickness were similar to those of latifoliate wood fibers, although possibly less resistant because of lower lignification. The largest weight loss was from rice plant (32%, followed by rice hull (27%, and corn plants (26.6%. The most resistant was wheat plant (15.8%. All these materials had greater weight losses than the control sample (3.8%. Thus, given their anatomical and chemical properties, the use of plant residue fibers in industrial processes is technically possible, though with concern about their biodegradability.Se caracterizaron las propiedades anatómicas, químicas y biodegradación de fibras de residuos de plantas de trigo (Triticum aestivum L., plantas de arroz (Oryza sativa L., plantas de maíz (Zea mays L., y cáscara de arroz, con el objetivo de generar información y tomar decisiones de uso con bases científicas y

An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

Science.gov (United States)

Panjikkaran, Seeja Thomachan; Mathew, Deepu

2013-03-15

The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

Science.gov (United States)

Awang, Mat Rasol; Mutaat, Hassan Hamdani; Mahmud, Mohd. Shukri; Wan Husain, Wan Badrin; Osman, Tajuddin; Bakar, Khomsaton Abu; Kassim, Asmahwati; Wan Mahmud, Zal U'yun; Manaf, Ishak; Kume, Tamikazu; Hashimoto, Shoji

1993-10-01

In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm empty Fruit Bunch (EFB) fibre leaving 70 % useful materials. Conditions under which fermentation carried out were investigated. It was found that, in the temperature range between 25- 28 °C, relative ph between 6-8, moisture between 60-70 % and medium composition of CaCO 3: rice bran 2 %: 5 % were the optimum conditions. The results showed in fermented products that, there were substantial reduction in cellulosic component such as Crude Fiber (CF, 18 %); Acid Detergent Fibre (ADF, 45 %), Neutral Detergent Fibre (NDF, 61 %) and Acid Detergent Lignin (ADL, 14 %). However, Crude Protein (CP, 10%) increased resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in fermentation process corresponds to the CO 2 released during fermentation. Hence, attributable to the decreased in content of CF, ADF, NDF, and ADL. The digestibility study has also been carried out to determine the useful level of this product to ruminant. Aflatoxin content was detected low in both the initial substrates and products. Based on nutritional value and low content of aflatoxin, the product is useful as a source of roughage to ruminant.

Antihyperlipidemic activities of Pleurotus ferulae on biochemical and histological function in hypercholesterolemic rats

Directory of Open Access Journals (Sweden)

Nuhu Alam

2011-01-01

Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.

Levels of platinum group elements and rare-earth elements in wild mushroom species growing in Poland.

Science.gov (United States)

Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika

2016-01-01

Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

Science.gov (United States)

Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

2011-01-01

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

Science.gov (United States)

Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

2014-01-01

Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

Science.gov (United States)

Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

2016-10-01

This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

Personal computer wallpaper user segmentation based on Sasang typology.

Science.gov (United States)

Lee, Joung-Youn

2015-03-01

As human-computer interaction (HCI) is becoming a significant part of all human life, the user's emotional satisfaction is an important factor to consider. These changes have been pointed out by several researchers who claim that a user's personality may become the most important factor in the design. The objective of this study is to examine Sasang typology as a user segmentation method in the area of HCI design. To test HCI usage patterns in terms of the user's personality and temperament, this study focuses on personal computer (PC) or lap-top wallpaper settings. One hundred and four Facebook friends completed a QSCC II survey assessing Sasang typology type and sent a captured image of their personal PC or lap-top wallpaper. To classify the computer usage pattern, folder organization and wallpaper setting were investigated. The research showed that So-Yang type organized folders and icons in an orderly manner, whereas So-Eum type did not organize folders and icons at all. With regard to wallpaper settings, So-Yang type used the default wallpaper provided by the PC but So-Eum type used landscape images. Because So-Yang type was reported to be emotionally stable and extrovert, they tended to be highly concerned with online privacy compared with So-Eum type. So-Eum type use a lot of images of landscapes as the background image, which demonstrates So-Eum's low emotional stability, anxiety, and the desire to obtain analogy throughout the computer screen. Also, So-Yang's wallpapers display family or peripheral figures and this is due to the sociability that extrovert So-Yang types possess. By proposing the Sasang typology as a factor in influencing an HCI usage pattern in this study, it can be used to predict the user's HCI experience, or suggest a native design methodology that can actively cope with the user's psychological environment.

Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

Science.gov (United States)

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2015-01-01

The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

Energy Technology Data Exchange (ETDEWEB)

Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

2008-07-15

Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

Gamma radiation in increasing productivity of Agaricus bisporus and Pleurotus sajor-caju and enhancing storage life of P. sajor-caju

International Nuclear Information System (INIS)

Roy, M.K.; Chatterjee, S.R.; Bahukhandi, D.; Sharma, R.; Philips, A.S.

2000-01-01

Gamma radiation of spawn of Agaricus bisporus and pleurotus sajor-caju at doses of 0.1 to 0.3 kGy and 0.1 to 0.25 kGy respectively, reduced the mycelial spawn run time and exerted a stimulatory effect on the growth of these two mushrooms. Irradiation also increased yield of these mushrooms. In all cases of the former, the highest yield of 2.57g was recorded from spawn irradiated at 0.3 kGy, while with the latter, best yield of 1119 g was recorded from spawn treated with 0.25 kGy. The control (non-irradiated) spawns of A. bisporus and P. sajor-caju gave yields of 2.03 g and 565 g respectively. Thus, a major boost in yields could be achieved using this technology. The shelf life of P. sajor-caju could be extended up to 9 days by 0.5 kGy of radiation, when the treated fruit bodies were held at 15 deg C as against the un-irradiated ones which had a shelf-life of 6 days. This dose neither adversely affected the browning of the fruit bodies at 45 deg C, nor lowered their protein (protein + free amino acids) and carbohydrate contents. Irradiation, however, at all the doses from 0.1 to 0.75 kGy enhanced the rehydration ratio and total free amino acid contents. The rehydration ratio of 0.62 was the maximum, reached with a dose of 0.25 kGy as against the control, which showed a value of 5.0. Dehydration along with gamma radiation treatment could play an important role for long term storage of mushrooms. Weight loss of un-dehydrated fruit bodies also decreased as a result of irradiation. (author)

Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

International Nuclear Information System (INIS)

Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

2013-01-01

Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

Steps toward a shared governance response for achieving Good Environmental Status in the Mediterranean Sea

Directory of Open Access Journals (Sweden)

Sergio Cinnirella

2014-12-01

Full Text Available The Mediterranean region is of fundamental importance to Europe given its strategic position. The responsibility for its overall ecosystem integrity is shared by European Union Member States (EU-MS and other Mediterranean countries. A juxtaposition of overlapping governance instruments occurred recently in the region, with the implementation of both the Marine Strategy Framework Directive (MSFD for EU-MS and the Ecosystem Approach Strategy (ECAP for all Mediterranean countries, including EU-MS. Both MSFD and ECAP are structured around vision-driven processes to achieve Good Environmental Status and a Healthy Environment, respectively. These processes have clear ecosystem-based, integrated policy objectives to guarantee the preservation and integrity of Mediterranean marine ecosystem goods and services. However, adoption of these instruments, especially those related to the new EU-MS directives on marine policy, could result in a governance gap in addition to the well-known economic gap between the EU and the non-EU political blocs. We identify two complementary requirements for effective implementation of both MSFD and ECAP that could work together to reduce this gap, to ensure a better alignment between MSFD and ECAP and better planning for stakeholder engagement. These are key issues for the future success of these instruments in a Mediterranean region where discrepancies between societal and ecological objectives may pose a challenge to these processes.

Separation of active laccases from Pleurotus sapidus culture supernatant using aqueous two-phase systems in centrifugal partition chromatography.

Science.gov (United States)

Schwienheer, C; Prinz, A; Zeiner, T; Merz, J

2015-10-01

For the production of bio active compounds, e.g., active enzymes or antibodies, a conserved purification process with a minimum loss of active compounds is necessary. In centrifugal partition chromatography (CPC), the separation effect is based on the different distribution of the components to be separated between two immiscible liquid phases. Thereby, one liquid phase is kept stationary in chambers by a centrifugal field and the mobile phase is pumped through via connecting ducts. Aqueous two phase systems (ATPS) are known to provide benign conditions for biochemical products and seem to be promising when used in CPC for purification tasks. However, it is not known if active biochemical compounds can "survive" the conditions in a CPC where strong shear forces can occur due to the two-phasic flow under centrifugal forces. Therefore, this aspect has been faced within this study by the separation of active laccases from a fermentation broth of Pleurotus sapidus. After selecting a suitable ATPS and operating conditions, the activity yield was calculated and the preservation of the active enzymes could be observed. Therefore, CPC could be shown as potentially suitable for the purification of bio-active compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation;Aumento da vida util de cogumelos Pleurotus sajor-caju in natura com aplicacao de radiacao gama

Energy Technology Data Exchange (ETDEWEB)

Moda, Evelise Moncaio

2008-07-01

The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage

The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

Science.gov (United States)

Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

2013-12-01

The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0

Características de Trichoderma harzianum, como agente limitante en el cultivo de hongos comestibles

Directory of Open Access Journals (Sweden)

Omar Romero Arenas

2009-07-01

Full Text Available El incremento dramático de incidencia y severidad de los “mohos verdes” en la producción de hongos comestibles se refleja en la aparición de formas altamente agresivas de éstos patógenos, como es el caso de los biotipos de Trichoderma harzianum (Th1, Th2., Th3 y Th4, que han sido encontrados en Europa y Norte América, donde la importancia de la patogenicidad de dicho “moho” se comprobó en 1995 con las pérdidas del 30-100% en las plantas de hongos comestibles en Chester, Pennsylvania. En México se han identificado diversos “mohos contaminantes”, entre los cuales Trichoderma spp., se encuentra frecuentemente en la producción de hongos comestibles (Agaricus bisporus, Pleurotus ostreatus y Lentinula edodes, en el 2004, un grupo de investigación detectó la presencia de cepas altamente agresivas de T. aggressivum f. aggressivum, identificadas con técnicas clásicas y moleculares, en muestras de substrato (compost contaminado, proporcionado por la principal planta de hongos de México. Actualmente se desconoce la situación sobre la distribución de Trichoderma harzianum y los problemas de contaminación en la producción de hongos comestibles, tanto de zonas rurales, como de zonas industrializadas en México, puede causar serias disminuciones en la producción de hongos comestibles y presentar pérdidas económicas para los productores de la región.

ATR FT-IR spectroscopy on Vmh2 hydrophobin self-assembled layers for Teflon membrane bio-functionalization

International Nuclear Information System (INIS)

Portaccio, M.; Gravagnuolo, A.M.; Longobardi, S.; Giardina, P.; Rea, I.; De Stefano, L.; Cammarota, M.; Lepore, M.

2015-01-01

Graphical abstract: - Highlights: • Hydrophobin self-assembled layers on Teflon in different preparation conditions were investigated. • ATR collection data geometry allowed samples examination without any particular preparation. • Amide content, lipid/amide and carbohydrate/amide ratios of the protein layer were estimated. • Secondary structure of protein was determined for the examined samples. • FT-IR demonstrated to be of extreme relevance in monitoring hydrophobin self-assembled layers preparation. - Abstract: Surface functionalization by layers of hydrophobins, amphiphilic proteins produced by fungi offers a promising and green strategy for fabrication of biomedical and bioanalytical devices. The layering process of the Vmh2 hydrophobin from Pleurotus ostreatus on Teflon membrane has been investigated by Attenuated Total Reflection Fourier Transform Infrared (ATR FT-IR) spectroscopy. In particular, protein layers obtained with hydrophobin purified with two different procedures and in various coating conditions have been examined. The layers have been characterized by quantifying the amide I and amide II band area together with the lipid/amide ratio and carbohydrate/amide ratio. This characterization can be very useful in evaluating the best purification strategy and coating conditions. Moreover the analysis of the secondary structure of the layered protein using the deconvolution procedure of amide I band indicate the prevalent contribution from β-sheet state. The results inferred by infrared spectroscopy have been also confirmed by scanning electron microscopy imaging

ATR FT-IR spectroscopy on Vmh2 hydrophobin self-assembled layers for Teflon membrane bio-functionalization

Energy Technology Data Exchange (ETDEWEB)

Portaccio, M., E-mail: marianna.portaccio@unina2.it [Dipartimento di Medicina Sperimentale – Seconda Università di Napoli, Via S.M. di Costantinopoli, 16-80134 Napoli (Italy); Gravagnuolo, A.M., E-mail: alfredomaria.gravagnuolo@unina.it [Dipartimento di Scienze Chimiche, Università “Federico II”, Via Cintia, 21- 80126 Napoli (Italy); Longobardi, S., E-mail: sara.longobardi@unina.it [Dipartimento di Scienze Chimiche, Università “Federico II”, Via Cintia, 21- 80126 Napoli (Italy); Giardina, P., E-mail: paola.giardina@unina.it [Dipartimento di Scienze Chimiche, Università “Federico II”, Via Cintia, 21- 80126 Napoli (Italy); Rea, I., E-mail: ilaria.rea@na.imm.cnr.it [Institute for Microelectronics and Microsystems, CNR, Via P. Castellino, 111-80131 Napoli (Italy); De Stefano, L., E-mail: luca.destefano@na.imm.cnr.it [Institute for Microelectronics and Microsystems, CNR, Via P. Castellino, 111-80131 Napoli (Italy); Cammarota, M., E-mail: marcella.cammarota@unina2.it [Dipartimento di Medicina Sperimentale – Seconda Università di Napoli, Via S.M. di Costantinopoli, 16-80134 Napoli (Italy); Lepore, M., E-mail: maria.lepore@unina2.it [Dipartimento di Medicina Sperimentale – Seconda Università di Napoli, Via S.M. di Costantinopoli, 16-80134 Napoli (Italy)

2015-10-01

Graphical abstract: - Highlights: • Hydrophobin self-assembled layers on Teflon in different preparation conditions were investigated. • ATR collection data geometry allowed samples examination without any particular preparation. • Amide content, lipid/amide and carbohydrate/amide ratios of the protein layer were estimated. • Secondary structure of protein was determined for the examined samples. • FT-IR demonstrated to be of extreme relevance in monitoring hydrophobin self-assembled layers preparation. - Abstract: Surface functionalization by layers of hydrophobins, amphiphilic proteins produced by fungi offers a promising and green strategy for fabrication of biomedical and bioanalytical devices. The layering process of the Vmh2 hydrophobin from Pleurotus ostreatus on Teflon membrane has been investigated by Attenuated Total Reflection Fourier Transform Infrared (ATR FT-IR) spectroscopy. In particular, protein layers obtained with hydrophobin purified with two different procedures and in various coating conditions have been examined. The layers have been characterized by quantifying the amide I and amide II band area together with the lipid/amide ratio and carbohydrate/amide ratio. This characterization can be very useful in evaluating the best purification strategy and coating conditions. Moreover the analysis of the secondary structure of the layered protein using the deconvolution procedure of amide I band indicate the prevalent contribution from β-sheet state. The results inferred by infrared spectroscopy have been also confirmed by scanning electron microscopy imaging.

棉籽壳基质在P.ostreatus生长过程中组份与 微结构的变化及其对菌糠饲用价值的影响%Compositional and Micro-structural Changes of Cottonseed Hull Substrate During P. ostreatus Growth and the Effects on Feed Value of the Spent Substrate

Institute of Scientific and Technical Information of China (English)

李秀金; 庞云芝; 张瑞红

2001-01-01

The dry matters and contents of major compositions of cottons e ed hull substrate for P. ostreatus cultivation were tested at different grow ing stages. The micro-structures of the substrate were observed under scanning electronic microscopy(SEM). Their effects on the feed nutritional values of the spent substrate were investigated. During the whole P. ostreatus growing per iod, the content of protein, cellulose, hemicellulose, lignin, and the micro-st ructures of the substrate were changed considerably. These contributed to the raising of the dr y matter digestibility of the spent substrate, making it possibly acceptable to be used as ruminant feed with improved feed value.%对棉籽基质在栽培P.ostreatus过程中不同时期的干物质及主要组 份含量进行了测定。对其微观结构的变化进行了显微观察。分析了组份与微观结构的变化对 菌糠饲用价值的影响。结果表明：与初始料相比，菌糠具有较高的干物质消化率，因而有可 能用作反刍动物的饲料。

Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

International Nuclear Information System (INIS)

Moda, Evelise Moncaio

2008-01-01

The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period

Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Min Keun Kim

2017-06-01

Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

Science.gov (United States)

Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

2015-01-01

Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

Use of Edible and Medicinal Oyster Mushroom (Pleurotus ostreatus(Jacq.: Fr.) Kumm.) Spent Compost in Remediation of Chemically Polluted Soils

Czech Academy of Sciences Publication Activity Database

Eggen, T.; Šašek, Václav

2002-01-01

Roč. 4, č. 3 (2002), s. 255-261 ISSN 1521-9437 Grant - others:GA of the Center for Molecular and Gene Biotechnology(XC) LN00B030; Norwegian Research Founding grant(NO) 113788/720 Program:LN Institutional research plan: CEZ:AV0Z5020903 Keywords : biodegradation * bioremediation * contaminated soil Subject RIV: EE - Microbiology, Virology

Determination of polysaccharide yield from the fruiting bodies and mycelium of selected mushroom species

International Nuclear Information System (INIS)

Shaiful Azuar Mohamad; Mat Rasol Awang

2006-01-01

Numerous polysaccharides and polysaccharides-protein complexes have been isolated from mushrooms and used as a source of therapeutic agents. The mycelium of Pleurotus sajor caju, Pleurotus tuber-regium, black ganoderma, and the fruiting bodies of Pleurotus sajor caju and Pleurotus florida were used to determine the percentage of polysaccharides obtained from the mushroom raw material. Hot water extraction method was used followed by refrigerated centrifuge and lyophilization. The yield from the various species will be compared. (Author)

Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

Science.gov (United States)

Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

2013-01-01

Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

Optimization of cultural conditions for biosurfactant production by Pleurotus djamor in solid state fermentation.

Science.gov (United States)

Velioglu, Zulfiye; Ozturk Urek, Raziye

2015-11-01

Being eco-friendly, less toxic, more biodegradable and biocompatible, biological surfactants have higher activity and stability compared to synthetic ones. In spite of the fact that there are abundant benefits of biosurfactants over the synthetic congeners, the problem related with the economical and large scale production proceeds. The utilization of several industrial wastes in the production media as substrates reduces the production cost. This current study aims optimization of biosurfactant production conditions by Pleurotus djamor, grown on sunflower seed shell, grape wastes or potato peels as renewable cheap substrates in solid state fermentation. After determination of the best substrate for biosurfactant production, we indicate optimum size and amount of solid substrate, volume of medium, temperature, pH and Fe(2+) concentrations on biosurfactant production. In optimum conditions, by reducing water surface tension to 28.82 ± 0.3 mN/m and having oil displacement diameter of 3.9 ± 0.3 cm, 10.205 ± 0.5 g/l biosurfactant was produced. Moreover, chemical composition of biosurfactant produced in optimum condition was determined by FTIR. Lastly, laboratory's large-scale production was carried out in optimum conditions in a tray bioreactor designed by us and 8.9 ± 0.5 g/l biosurfactant was produced with a significant surface activity (37.74 ± 0.3 mN/m). With its economical suggestions and applicability of laboratory's large-scale production, this work indicates the possibility of using low cost agro-industrial wastes as renewable substrates for biosurfactant production. Therefore, using economically produced biosurfactant will reduce cost in several applications such as bioremediation, oil recovery and biodegradation of toxic chemicals. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Determinación de la actividad lignocelulolítica en sustrato natural de aislamientos fúngicos obtenidos de sabana de pastoreo y de bosque secundario de sabana inundable tropical Determination of lignocellulolytic activity in a natural substrate of native fungi strains obtained from savanna and of secondary forest from a tropical flooded savanna

Directory of Open Access Journals (Sweden)

Martha Lucía Ortiz Moreno

2010-12-01

Full Text Available El objetivo de este trabajo fue identificar aislamientos de hongos ligninolíticos y celulolíticos que pudieran degradar desechos de cosecha y mejorar las características del suelo en los Llanos Orientales, se realizó un muestreo siguiendo la metodología de transepto y muestras integradas. Se obtuvo una cepa ligninolítica (005L Verticillium spp. y 72 cepas celulolíticas. La comparación de los usos del suelo (sabana de pastoreo y bosque secundario mostró que no existía una relación entre el número de géneros obtenidos y las características del suelo. Posteriormente, se realizó la cuantificación de la actividad celulolítica y ligninolítica de los aislamientos para identificar las cepas que posteriormente serían evaluadas en el sustrato natural pasto seco (Brachiaria spp.. Se encontraron dos cepas con alta actividad exoglucanasa (055C y 061C Penicillium spp. y una cepa con alta actividad endoglucanasa (019C Trichoderma spp. respecto al control Trichoderma viride. En el sustrato natural se evaluaron los consorcios de las cepas seleccionadas formados por pares: una ligninolítica y una celulolítica. Las pruebas mostraron que los aislamientos promisorios aumentaron su actividad enzimática en el sustrato pasto superando a los controles positivos (Pleurotus ostreatus para lignina y T. viride para celulosa y que los consorcios no afectaron la capacidad enzimática de las cepas que los formaban. Por lo tanto, se recomienda utilizar estos consorcios para el desarrollo de biofertilizantes acondicionadores del suelo, empleando especialmente el consorcio formado por las cepas 005L (Verticillium spp. y 055C (Penicillium spp., que mostró alta actividad ligninolítica y celulolítica.The aim of this work was to identify lignolytic and cellulolytic fungal strains capable of degrading harvest waste and thereby improving the soil characteristics of the eastern Llanos of Colombia. Sampling was carried out using the transept methodology and

Bioconcentration of artificial radionuclides in edible mushrooms: in situ and in vitro studies

Energy Technology Data Exchange (ETDEWEB)

Dementyev, Dmitry V.; Manukovsky, Nikolai S.; Bolsunovsky, Alexander Ya.; Alexandrova, Yuliyana V. [Institute of Biophysics, Siberian Branch of the Russian Academy of Sciences, 660036, Krasnoyarsk (Russian Federation)

2014-07-01

grown on the soil-like substrate showed that accumulation of Am-241 from solution by mycelium of Pleurotus ostreatus and Neonothopanus nimbi reached 97%. Hence, these mushroom species can be used for bioremediation of solutions contaminated by radionuclides. The substrates prepared from Yenisei flood plain soils and bottom sediments, which contained Co-60, Cs-137, and Eu-152 and were also supplemented with Am-241, were used to grow fruiting bodies of P. ostreatus. The analysis showed that the fruiting bodies accumulated only Cs-137 and Am-241. The highest CF of Cs-137 by P. ostreatus grown on the sediment-based substrate was an order of magnitude higher than the CF of Cs-137 by the mushrooms grown on the soil-based substrate (0.1 vs. 0.008), due to differences in Cs-137 bioavailability in soil and sediment. Also, the CF of Am-241 was twice higher in the fruiting bodies grown on the sediment-based substrate than in those grown on the soil-based substrate (0.005 vs. 0.0026). Analysis of the CFs showed that under natural conditions, accumulation rates of Cs-137 by mushrooms were an order of magnitude higher than those of U-238. Under laboratory conditions, accumulation of Cs-137 in fruiting bodies was an order of magnitude greater than accumulation of Am-241, a transuranium radionuclide. The ability of mushrooms to accumulate artificial radionuclides makes them good candidates for bioremediation of contaminated solutions and soils. (authors)

Use of Pleurotus sajor-caju in upgrading green jute plants and jute sticks as ruminant feed

Directory of Open Access Journals (Sweden)

Zinat Mahal

2013-01-01

Full Text Available In this study, superfluous jute plants and jute stick were converted into upgraded animal feed by solid state fermentation (SSF using a cellulolytic fungus, Pleurotus sajor-caju. Prior to fermentation, substrates were subjected to several pretreatments such as soaking with water overnight and alkali or lime pretreatment. SSF was carried out with 20 g of substrate in 100 ml conical flask and was incubated at 30C for 8 weeks. In all treatments, the highest amount of reducing sugar, soluble protein as well as the cellulolytic activities of three enzymes viz. cellobiase, carboxymethyl cellulase and avicelase were obtained at 6th week of fermentation. Compared to raw, unsoaked substrates, soaking treatment alone could produce 10% more soluble protein in both substrates whereas reducing sugar increment was 5% and 6% in jute sticks and jute plants, respectively. From all treatments, combination of soaking and lime treatment in green jute plants yielded higher value than jute sticks in terms of reducing sugar, soluble protein and enzymatic activity. The radiation doses at 20, 30 and 40 kGy appeared to have no effect on sugar and protein accretion. During eight weeks of fermentation, relatively higher cellobiase activity was found compared to that of carboxymethyl cellulase and avicelase. The present investigation indicates that fungal conversion with pretreatment can turn these lignocellulosic agro-wastes to a nutritionally enriched animal feed by increasing the crude protein and reducing sugar content. However, further research is necessary to develop strategies for industrial scale production to overcome the crisis of nutritionally improved animal feed.

Effects of Cooking and In Vitro Digestion on Antioxidant Properties and Cytotoxicity of the Culinary-Medicinal Mushroom Pleurotus ostreatoroseus (Agaricomycetes).

Science.gov (United States)

Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

2018-01-01

In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.

The lipid peroxidation intensity of fungi strains from the orders Agaricales and Polyporales

Directory of Open Access Journals (Sweden)

O. V. Fedotov

2016-07-01

Full Text Available This article is devoted to investigation of the dynamics of growth and level of spontaneous and induced lipid peroxidation intensity of Basidiomycetes strains grown by surface cultivation on a glucose-peptone medium. The materials of the research are mycelium and culture filtrates (CF of 57 strains (5 belong to 5 species from the order Polyporales s.l., and 52 belong to 7 species of the order Agaricales s.l.. To study the dynamics of growth we used a weighing method for determining the accumulation of absolutely dry biomass. Intensity of lipid peroxidation was determined by a modified spectrophotometric method for content of active to thiobarbituric acid products. It was found that the most productive in absolutely dry biomass accumulation were the strains Flammulina velutipes (Curt.: Fr. Sing. F-610 and Pleurotus eryngii (DC.: Fr. Quél. P-er. The level of spontaneous and induced LPO intensity in mycelia of all strains was higher than this figure in the culture filtrate and increased with the duration of cultivation. Dependencies between the content of lipid peroxidation products in the mycelia and CF were not established. The lowest values were recorded for biomass accumulation by the strains Pleurotus ostreatus (Jacq.: Fr. P. Kumm. P-14, P-192 and P. citrinopileatus Singer. Р-сіtr. Groups of basidiomycete cultures with different levels of TBA-AP were identified. Spontaneous and induced intensivity of lipid peroxidation in all studied strains of mycelia was higher than the figure in the culture filtrate. The intensity of lipid peroxidation in both mycelia and culture filtrate constantly increased, which can be explained by the growing shortage of certain nutrients (primarily carbon and increased concentration of metabolic products in the medium. The ratio of spontaneous and induced lipid peroxidation intensity is specific to each strain and is independent of its systematic position. Shifting of prooxidant-antioxidant balance to a

Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat pheochromocytoma cells.

Science.gov (United States)

Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary

2012-07-19

Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be

Insight into the impact of two structural calcium ions on the properties of Pleurotus eryngii versatile ligninolytic peroxidase.

Science.gov (United States)

Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang

2016-12-15

Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.

Microbial liquefaction of peat for the production of synthetic fuels

Energy Technology Data Exchange (ETDEWEB)

Gunasekaran, M.

1988-01-01

Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.

Caracterización de los estudios de utilización de medicamentos publicados en revistas médicas cubanas, 1990-2003 Characterization of the studies of drug use published in Cuban medical journals, 1990-2003

Directory of Open Access Journals (Sweden)

Juan Antonio Furones Mourelle

2006-04-01

Full Text Available Introducción : El análisis de los estudios de utilización de medicamentos (EUM en un determinado país puede ayudar al conocimiento de la investigación realizada en este campo y detectar deficiencias o aspectos de la investigación no abordados, que permitan planificarlos de manera eficiente. Métodos : Se realizó un estudio descriptivo, transversal y retrospectivo según la fuente de información, con el objetivo de cuantificar y caracterizar los EUM publicados en revistas médicas cubanas desde 1990 hasta el 2003. El universo de estudio lo constituyeron todos los EUM publicados en revistas médicas cubanas de la Editorial Ciencias Médicas. Se describieron las principales variables que caracterizan el comportamiento de los EUM como: especialidad del primer autor, provincia y nivel asistencial donde se realizó el estudio, tipo de EUM, grupo farmacológico y fuente de datos empleada. Se utilizaron como medidas de resumen los números y los porcentajes. Resultados : Se revisaron 785 números de revistas, en las cuales se localizaron solo 31 artículos, y se observó un incremento de su publicación a partir del año 2000. Los médicos (80,6 % fueron los principales investigadores y la atención primaria de salud (67,7 % el nivel asistencial más utilizado. Las encuestas (58,1 % constituyeron la fuente de información más empleada. La mayoría de los estudios fueron de prescripción-indicación (48,4 % y el grupo farmacológico antiinfeccioso (29 % el más estudiado. Conclusiones : Resulta insuficiente la publicación de EUM en revistas médicas cubanas, lo que pudiera reflejar una infraproducción de este tipo de investigacionesIntroduction: The analysis of the studies of drug use in a given country may help to know the research carried out in this field and detect deficiencies or untouched research aspects, and allow planning them more efficiently. Methods: a retrospective descriptive and cross-sectional study was conducted to quantify

Estimation of Bound and Free Fractions of Lignocellulose-Degrading Enzymes of Wood-Rotting Fungi Pleurotus ostreatus, Trametes versicolor and Piptoporus betulinus

Czech Academy of Sciences Publication Activity Database

Valášková, Vendula; Baldrian, Petr

2006-01-01

Roč. 157, - (2006), s. 119-124 ISSN 0923-2508 R&D Projects: GA AV ČR KJB600200516 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulase * freeeze-drying * hemicellulase Subject RIV: EE - Microbiology, Virology Impact factor: 2.504, year: 2006

Study of the spectroscopy properties of uranium matrix doped with europium. Energy transfer between UO22+ and Eu3+

International Nuclear Information System (INIS)

Luiz, Jose Eduardo Monteiro de Sa

2007-01-01

Uranyl compounds (UO 2 2+ ) present a great potential as luminescent materials, for instance, applied in technology laser, luminescent probes, cells for conversion of energy, etc. In this work it is studied the efficiency of energy transfer in the compound Eu 3+ doped in UO 2 (MS) 2 .(H 2 O)n matrix and UO 2 2+ in Eu(MS) 3 (H 2 O)n for to be used as efficient Light Conversion Molecular Devices (LCMD) and/or in solar cells for energy conversion. It is also described the synthesis, characterization and spectroscopic study of the matrix Eu(MS) 3 .(H 2 O)n.(x%mol) UO 2 2+ and UO 2 (MS) 2 .(H 2 O)n.(x%mol) Eu 3+ (where x= 1, 3, 5 and 10). The compounds obtained was characterized by elementary analyses for determine the U 6+ concentration, infrared spectra, thermal analyses and luminescence spectra. The IR data suggest that the MS ligand acts as bidentate one. The emission spectra of Eu 3+ doped in UO 2 (MS) 2 .(H 2 O) 2 matrix showed characteristic fluorescence bands of the uranyl ion, attributed to the transition of 3 Π u -> 1 Σ g + of the uranium matrix. For the UO 2 2+ in Eu(MS) 3 (H 2 O) 6 the transitions of D o -> 7 F J (J=0 ->4 ) are predominant in the spectra. The intense europium luminescence associated with uranyl sensitising is registered in emission spectra of Eu 3+ ions in the range of 420-720 nm. The quenching rate constant of UO 2 2+ fluorescence with Eu 3+ is also determined. (author)

Estimating future burned areas under changing climate in the EU-Mediterranean countries.

Science.gov (United States)

Amatulli, Giuseppe; Camia, Andrea; San-Miguel-Ayanz, Jesús

2013-04-15

The impacts of climate change on forest fires have received increased attention in recent years at both continental and local scales. It is widely recognized that weather plays a key role in extreme fire situations. It is therefore of great interest to analyze projected changes in fire danger under climate change scenarios and to assess the consequent impacts of forest fires. In this study we estimated burned areas in the European Mediterranean (EU-Med) countries under past and future climate conditions. Historical (1985-2004) monthly burned areas in EU-Med countries were modeled by using the Canadian Fire Weather Index (CFWI). Monthly averages of the CFWI sub-indices were used as explanatory variables to estimate the monthly burned areas in each of the five most affected countries in Europe using three different modeling approaches (Multiple Linear Regression - MLR, Random Forest - RF, Multivariate Adaptive Regression Splines - MARS). MARS outperformed the other methods. Regression equations and significant coefficients of determination were obtained, although there were noticeable differences from country to country. Climatic conditions at the end of the 21st Century were simulated using results from the runs of the regional climate model HIRHAM in the European project PRUDENCE, considering two IPCC SRES scenarios (A2-B2). The MARS models were applied to both scenarios resulting in projected burned areas in each country and in the EU-Med region. Results showed that significant increases, 66% and 140% of the total burned area, can be expected in the EU-Med region under the A2 and B2 scenarios, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

Co-pyrolysis behaviour and kinetic of two typical solid wastes in China and characterisation of activated carbon prepared from pyrolytic char.

Science.gov (United States)

Ma, Yuhui; Niu, Ruxuan; Wang, Xiaona; Wang, Qunhui; Wang, Xiaoqiang; Sun, Xiaohong

2014-11-01

This is the first study on the co-pyrolysis of spent substrate of Pleurotus ostreatus and coal tar pitch, and the activated carbon prepared from the pyrolytic char. Thermogravimetry (TG) analysis was carried out taking spent substrate, coal tar pitch and spent substrate-coal tar pitch mixture. The activation energies of pyrolysis reactions were obtained via the Flynn-Wall-Ozawa and Kissinger-Akahira-Sunose methods. The kinetic models were determined by the master-plots method. The activated carbons were characterised by N2-adsorption, Fourier transform infrared spectroscopy and X-ray diffraction. Experimental results demonstrated a synergistic effect happened during co-pyrolysis, which was characterised by a decreased maximum decomposition rate and an enhanced char yield. The average activation energies of the pyrolysis reactions of spent substrate, coal tar pitch and the mixture were 115.94, 72.92 and 94.38 kJ mol(-1) for the Flynn-Wall-Ozawa method, and 112.17, 65.62 and 89.91 kJ mol(-1) for the Kissinger-Akahira-Sunose method. The reaction model functions were f(α) = (1-α)(3.42), (1-α)(1.72) and (1-α)(3.07) for spent substrate, coal tar pitch and the mixture, respectively. The mixture char-derived activated carbon had a Brunauer-Emmett-Teller surface area up to 1337 m(2) g(-1) and a total pore volume of 0.680 cm(3) g(-1). Mixing spent substrate with coal tar pitch led to the creation of more micropores and a higher surface area compared with the single spent substrate and coal tar pitch char. Also, the mixture char-derived activated carbon had a higher proportion of aromatic stacking. This study provides a reference for the utilisation of spent substrate and coal tar pitch via co-pyrolysis, and their pyrolytic char as a promising precursor of activated carbon. © The Author(s) 2014.

Implementación de una línea de evaluación para subproductos agroindustriales como sustrato para la producción de bioetanol. Presacarificación-sacarificación/fermentación simultánea

Directory of Open Access Journals (Sweden)

Mary Lopretti

2011-05-01

Full Text Available El estudio de vías alternativas con mayores rendimientos y bajos costos es en estos días el foco de estudio en el tema Bioetanol, por tal motivo, en el presente trabajo se utilizaron dos cepas de hongos filamentosos; Trichoderma harzianum y Pleurotus ostreatus, actuando en diferentes sustratos residuales; orujo de uva, aserrín y torta de girasol provenientes de diferentes industrias nacionales, con el fin de establecer un sistema de evaluación de procesos conjuntos para la producción de alcohol a partir de microorganismos lignocelulósicos. En el diseño de estudio se contemplan la realización de una Presacarificación, con el objetivo de predigerir los sustratos, de forma de homogeneizar los diferentes sustratos acortando de esta forma las etapas posteriores; una Sacarificación enzimática utilizando el extracto de celulasas fúngicas obtenidas por Fermentación semi sólida en el proceso de Presacarificación; y un proceso de Fermentación, el cual involucra un microorganismo termoestable; Kluyveromyces marxianus (NRRL Y-665, de tal forma que permita reunir los procesos de Sacarificación y Fermentación en forma simultánea.De acuerdo a los resultados obtenidos podemos establecer que el sistema empleado de FSS previa presacarificación es un buen sistema para la producción de azúcares fermentables y alcohol. Los estudios comparativos realizados con diferentes sustratos demuestran que cuando el soporte es orujo de uva o torta de girasol, se utiliza un mayor porcentaje de los azúcares fermentables disponibles, aproximadamente un 50%. Los productos de degradación, resultado de la presacarificación, pueden afectar al microorganismo y actuar como potenciales inhibidores de la fermentación, por lo que es crítico realizar estudios que determinen estos productos de degradación y los mecanismos para su reducción. Podemos concluir que el sistema utilizado es efectivo para el almacenamiento de la biomasa en forma estable en el mismo

Genome-Wide Association Study Reveals Four Loci for Lipid Ratios in the Korean Population and the Constitutional Subgroup.

Science.gov (United States)

Kim, Taehyeung; Park, Ah Yeon; Baek, Younghwa; Cha, Seongwon

2017-01-01

Circulating lipid ratios are considered predictors of cardiovascular risks and metabolic syndrome, which cause coronary heart diseases. One constitutional type of Korean medicine prone to weight accumulation, the Tae-Eum type, predisposes the consumers to metabolic syndrome, hypertension, diabetes mellitus, etc. Here, we aimed to identify genetic variants for lipid ratios using a genome-wide association study (GWAS) and followed replication analysis in Koreans and constitutional subgroups. GWASs in 5,292 individuals of the Korean Genome and Epidemiology Study and replication analyses in 2,567 subjects of the Korea medicine Data Center were performed to identify genetic variants associated with triglyceride (TG) to HDL cholesterol (HDLC), LDL cholesterol (LDLC) to HDLC, and non-HDLC to HDLC ratios. For subgroup analysis, a computer-based constitution analysis tool was used to categorize the constitutional types of the subjects. In the discovery stage, seven variants in four loci, three variants in three loci, and two variants in one locus were associated with the ratios of log-transformed TG:HDLC (log[TG]:HDLC), LDLC:HDLC, and non-HDLC:HDLC, respectively. The associations of the GWAS variants with lipid ratios were replicated in the validation stage: for the log[TG]:HDLC ratio, rs6589566 near APOA5 and rs4244457 and rs6586891 near LPL; for the LDLC:HDLC ratio, rs4420638 near APOC1 and rs17445774 near C2orf47; and for the non-HDLC:HDLC ratio, rs6589566 near APOA5. Five of these six variants are known to be associated with TG, LDLC, and/or HDLC, but rs17445774 was newly identified to be involved in lipid level changes in this study. Constitutional subgroup analysis revealed effects of variants associated with log[TG]:HDLC and non-HDLC:HDLC ratios in both the Tae-Eum and non-Tae-Eum types, whereas the effect of the LDLC:HDLC ratio-associated variants remained only in the Tae-Eum type. In conclusion, we identified three log[TG]:HDLC ratio-associated variants, two LDLC