WorldWideScience

Sample records for eukaryotic pathogen databases

  1. The Eukaryotic Pathogen Databases: a functional genomic resource integrating data from human and veterinary parasites.

    Science.gov (United States)

    Harb, Omar S; Roos, David S

    2015-01-01

    Over the past 20 years, advances in high-throughput biological techniques and the availability of computational resources including fast Internet access have resulted in an explosion of large genome-scale data sets "big data." While such data are readily available for download and personal use and analysis from a variety of repositories, often such analysis requires access to seldom-available computational skills. As a result a number of databases have emerged to provide scientists with online tools enabling the interrogation of data without the need for sophisticated computational skills beyond basic knowledge of Internet browser utility. This chapter focuses on the Eukaryotic Pathogen Databases (EuPathDB: http://eupathdb.org) Bioinformatic Resource Center (BRC) and illustrates some of the available tools and methods.

  2. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    NARCIS (Netherlands)

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles

  3. Convergent use of RhoGAP toxins by eukaryotic parasites and bacterial pathogens.

    Directory of Open Access Journals (Sweden)

    Dominique Colinet

    2007-12-01

    Full Text Available Inactivation of host Rho GTPases is a widespread strategy employed by bacterial pathogens to manipulate mammalian cellular functions and avoid immune defenses. Some bacterial toxins mimic eukaryotic Rho GTPase-activating proteins (GAPs to inactivate mammalian GTPases, probably as a result of evolutionary convergence. An intriguing question remains whether eukaryotic pathogens or parasites may use endogenous GAPs as immune-suppressive toxins to target the same key genes as bacterial pathogens. Interestingly, a RhoGAP domain-containing protein, LbGAP, was recently characterized from the parasitoid wasp Leptopilina boulardi, and shown to protect parasitoid eggs from the immune response of Drosophila host larvae. We demonstrate here that LbGAP has structural characteristics of eukaryotic RhoGAPs but that it acts similarly to bacterial RhoGAP toxins in mammals. First, we show by immunocytochemistry that LbGAP enters Drosophila immune cells, plasmatocytes and lamellocytes, and that morphological changes in lamellocytes are correlated with the quantity of LbGAP they contain. Demonstration that LbGAP displays a GAP activity and specifically interacts with the active, GTP-bound form of the two Drosophila Rho GTPases Rac1 and Rac2, both required for successful encapsulation of Leptopilina eggs, was then achieved using biochemical tests, yeast two-hybrid analysis, and GST pull-down assays. In addition, we show that the overall structure of LbGAP is similar to that of eukaryotic RhoGAP domains, and we identify distinct residues involved in its interaction with Rac GTPases. Altogether, these results show that eukaryotic parasites can use endogenous RhoGAPs as virulence factors and that despite their differences in sequence and structure, eukaryotic and bacterial RhoGAP toxins are similarly used to target the same immune pathways in insects and mammals.

  4. GenColors-based comparative genome databases for small eukaryotic genomes.

    Science.gov (United States)

    Felder, Marius; Romualdi, Alessandro; Petzold, Andreas; Platzer, Matthias; Sühnel, Jürgen; Glöckner, Gernot

    2013-01-01

    Many sequence data repositories can give a quick and easily accessible overview on genomes and their annotations. Less widespread is the possibility to compare related genomes with each other in a common database environment. We have previously described the GenColors database system (http://gencolors.fli-leibniz.de) and its applications to a number of bacterial genomes such as Borrelia, Legionella, Leptospira and Treponema. This system has an emphasis on genome comparison. It combines data from related genomes and provides the user with an extensive set of visualization and analysis tools. Eukaryote genomes are normally larger than prokaryote genomes and thus pose additional challenges for such a system. We have, therefore, adapted GenColors to also handle larger datasets of small eukaryotic genomes and to display eukaryotic gene structures. Further recent developments include whole genome views, genome list options and, for bacterial genome browsers, the display of horizontal gene transfer predictions. Two new GenColors-based databases for two fungal species (http://fgb.fli-leibniz.de) and for four social amoebas (http://sacgb.fli-leibniz.de) were set up. Both new resources open up a single entry point for related genomes for the amoebozoa and fungal research communities and other interested users. Comparative genomics approaches are greatly facilitated by these resources.

  5. EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

    Directory of Open Access Journals (Sweden)

    Grover Atul

    2007-07-01

    Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

  6. EKPD: a hierarchical database of eukaryotic protein kinases and protein phosphatases.

    Science.gov (United States)

    Wang, Yongbo; Liu, Zexian; Cheng, Han; Gao, Tianshun; Pan, Zhicheng; Yang, Qing; Guo, Anyuan; Xue, Yu

    2014-01-01

    We present here EKPD (http://ekpd.biocuckoo.org), a hierarchical database of eukaryotic protein kinases (PKs) and protein phosphatases (PPs), the key molecules responsible for the reversible phosphorylation of proteins that are involved in almost all aspects of biological processes. As extensive experimental and computational efforts have been carried out to identify PKs and PPs, an integrative resource with detailed classification and annotation information would be of great value for both experimentalists and computational biologists. In this work, we first collected 1855 PKs and 347 PPs from the scientific literature and various public databases. Based on previously established rationales, we classified all of the known PKs and PPs into a hierarchical structure with three levels, i.e. group, family and individual PK/PP. There are 10 groups with 149 families for the PKs and 10 groups with 33 families for the PPs. We constructed 139 and 27 Hidden Markov Model profiles for PK and PP families, respectively. Then we systematically characterized ∼50,000 PKs and >10,000 PPs in eukaryotes. In addition, >500 PKs and >400 PPs were computationally identified by ortholog search. Finally, the online service of the EKPD database was implemented in PHP + MySQL + JavaScript.

  7. PhytoREF: a reference database of the plastidial 16S rRNA gene of photosynthetic eukaryotes with curated taxonomy.

    Science.gov (United States)

    Decelle, Johan; Romac, Sarah; Stern, Rowena F; Bendif, El Mahdi; Zingone, Adriana; Audic, Stéphane; Guiry, Michael D; Guillou, Laure; Tessier, Désiré; Le Gall, Florence; Gourvil, Priscillia; Dos Santos, Adriana L; Probert, Ian; Vaulot, Daniel; de Vargas, Colomban; Christen, Richard

    2015-11-01

    Photosynthetic eukaryotes have a critical role as the main producers in most ecosystems of the biosphere. The ongoing environmental metabarcoding revolution opens the perspective for holistic ecosystems biological studies of these organisms, in particular the unicellular microalgae that often lack distinctive morphological characters and have complex life cycles. To interpret environmental sequences, metabarcoding necessarily relies on taxonomically curated databases containing reference sequences of the targeted gene (or barcode) from identified organisms. To date, no such reference framework exists for photosynthetic eukaryotes. In this study, we built the PhytoREF database that contains 6490 plastidial 16S rDNA reference sequences that originate from a large diversity of eukaryotes representing all known major photosynthetic lineages. We compiled 3333 amplicon sequences available from public databases and 879 sequences extracted from plastidial genomes, and generated 411 novel sequences from cultured marine microalgal strains belonging to different eukaryotic lineages. A total of 1867 environmental Sanger 16S rDNA sequences were also included in the database. Stringent quality filtering and a phylogeny-based taxonomic classification were applied for each 16S rDNA sequence. The database mainly focuses on marine microalgae, but sequences from land plants (representing half of the PhytoREF sequences) and freshwater taxa were also included to broaden the applicability of PhytoREF to different aquatic and terrestrial habitats. PhytoREF, accessible via a web interface (http://phytoref.fr), is a new resource in molecular ecology to foster the discovery, assessment and monitoring of the diversity of photosynthetic eukaryotes using high-throughput sequencing. © 2015 John Wiley & Sons Ltd.

  8. The COG database: an updated version includes eukaryotes

    Directory of Open Access Journals (Sweden)

    Sverdlov Alexander V

    2003-09-01

    Full Text Available Abstract Background The availability of multiple, essentially complete genome sequences of prokaryotes and eukaryotes spurred both the demand and the opportunity for the construction of an evolutionary classification of genes from these genomes. Such a classification system based on orthologous relationships between genes appears to be a natural framework for comparative genomics and should facilitate both functional annotation of genomes and large-scale evolutionary studies. Results We describe here a major update of the previously developed system for delineation of Clusters of Orthologous Groups of proteins (COGs from the sequenced genomes of prokaryotes and unicellular eukaryotes and the construction of clusters of predicted orthologs for 7 eukaryotic genomes, which we named KOGs after eukaryotic orthologous groups. The COG collection currently consists of 138,458 proteins, which form 4873 COGs and comprise 75% of the 185,505 (predicted proteins encoded in 66 genomes of unicellular organisms. The eukaryotic orthologous groups (KOGs include proteins from 7 eukaryotic genomes: three animals (the nematode Caenorhabditis elegans, the fruit fly Drosophila melanogaster and Homo sapiens, one plant, Arabidopsis thaliana, two fungi (Saccharomyces cerevisiae and Schizosaccharomyces pombe, and the intracellular microsporidian parasite Encephalitozoon cuniculi. The current KOG set consists of 4852 clusters of orthologs, which include 59,838 proteins, or ~54% of the analyzed eukaryotic 110,655 gene products. Compared to the coverage of the prokaryotic genomes with COGs, a considerably smaller fraction of eukaryotic genes could be included into the KOGs; addition of new eukaryotic genomes is expected to result in substantial increase in the coverage of eukaryotic genomes with KOGs. Examination of the phyletic patterns of KOGs reveals a conserved core represented in all analyzed species and consisting of ~20% of the KOG set. This conserved portion of the

  9. Comparative and functional genomics of Legionella identified eukaryotic like proteins as key players in host-pathogen interactions

    Directory of Open Access Journals (Sweden)

    Laura eGomez-Valero

    2011-10-01

    Full Text Available Although best known for its ability to cause severe pneumonia in people whose immune defenses are weakened, Legionella pneumophila and Legionella longbeachae are two species of a large genus of bacteria that are ubiquitous in nature, where they parasitize protozoa. Adaptation to the host environment and exploitation of host cell functions are critical for the success of these intracellular pathogens. The establishment and publication of the complete genome sequences of L. pneumophila and L. longbeachae isolates paved the way for major breakthroughs in understanding the biology of these organisms. In this review we present the knowledge gained from the analyses and comparison of the complete genome sequences of different L. pneumophila and L. longbeachae strains. Emphasis is given on putative virulence and Legionella life cycle related functions, such as the identification of an extended array of eukaryotic-like proteins, many of which have been shown to modulate host cell functions to the pathogen's advantage. Surprisingly, many of the eukaryotic domain proteins identified in L. pneumophila as well as many substrates of the Dot/Icm type IV secretion system essential for intracellular replication are different between these two species, although they cause the same disease. Finally, evolutionary aspects regarding the eukaryotic like proteins in Legionella are discussed.

  10. PHI-base: a new interface and further additions for the multi-species pathogen-host interactions database.

    Science.gov (United States)

    Urban, Martin; Cuzick, Alayne; Rutherford, Kim; Irvine, Alistair; Pedro, Helder; Pant, Rashmi; Sadanadan, Vidyendra; Khamari, Lokanath; Billal, Santoshkumar; Mohanty, Sagar; Hammond-Kosack, Kim E

    2017-01-04

    The pathogen-host interactions database (PHI-base) is available at www.phi-base.org PHI-base contains expertly curated molecular and biological information on genes proven to affect the outcome of pathogen-host interactions reported in peer reviewed research articles. In addition, literature that indicates specific gene alterations that did not affect the disease interaction phenotype are curated to provide complete datasets for comparative purposes. Viruses are not included. Here we describe a revised PHI-base Version 4 data platform with improved search, filtering and extended data display functions. A PHIB-BLAST search function is provided and a link to PHI-Canto, a tool for authors to directly curate their own published data into PHI-base. The new release of PHI-base Version 4.2 (October 2016) has an increased data content containing information from 2219 manually curated references. The data provide information on 4460 genes from 264 pathogens tested on 176 hosts in 8046 interactions. Prokaryotic and eukaryotic pathogens are represented in almost equal numbers. Host species belong ∼70% to plants and 30% to other species of medical and/or environmental importance. Additional data types included into PHI-base 4 are the direct targets of pathogen effector proteins in experimental and natural host organisms. The curation problems encountered and the future directions of the PHI-base project are briefly discussed. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Soil eukaryotic microorganism succession as affected by continuous cropping of peanut--pathogenic and beneficial fungi were selected.

    Directory of Open Access Journals (Sweden)

    Mingna Chen

    Full Text Available Peanut is an important oil crop worldwide and shows considerable adaptability but growth and yield are negatively affected by continuous cropping. Soil micro-organisms are efficient bio-indicators of soil quality and plant health and are critical to the sustainability of soil-based ecosystem function and to successful plant growth. In this study, 18S rRNA gene clone library analyses were employed to study the succession progress of soil eukaryotic micro-organisms under continuous peanut cultivation. Eight libraries were constructed for peanut over three continuous cropping cycles and its representative growth stages. Cluster analyses indicated that soil micro-eukaryotic assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. Six eukaryotic groups were found and fungi predominated in all libraries. The fungal populations showed significant dynamic change and overall diversity increased over time under continuous peanut cropping. The abundance and/or diversity of clones affiliated with Eurotiales, Hypocreales, Glomerales, Orbiliales, Mucorales and Tremellales showed an increasing trend with continuous cropping but clones affiliated with Agaricales, Cantharellales, Pezizales and Pyxidiophorales decreased in abundance and/or diversity over time. The current data, along with data from previous studies, demonstrated that the soil microbial community was affected by continuous cropping, in particular, the pathogenic and beneficial fungi that were positively selected over time, which is commonplace in agro-ecosystems. The trend towards an increase in fungal pathogens and simplification of the beneficial fungal community could be important factors contributing to the decline in peanut growth and yield over many years of continuous cropping.

  12. Using the Pathogen-Host Interactions database (PHI-base to investigate plant pathogen genomes and genes implicated in virulence

    Directory of Open Access Journals (Sweden)

    Martin eUrban

    2015-08-01

    Full Text Available New pathogen-host interaction mechanisms can be revealed by integrating mutant phenotype data with genetic information. PHI-base is a multi-species manually curated database combining peer-reviewed published phenotype data from plant and animal pathogens and gene/protein information in a single database.

  13. FishPathogens.eu a new database in the research of aquatic animal diseases

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, T.; Olesen, Niels Jørgen

    Virus (KHV). The database design is based on freeware and could easily be implemented to include pathogens relevant for other species than fish. We present the database using the data on the different fish pathogens as example. However if some are interested in the platform we are happy to cooperate...... and share the database structure with other Epizone members....

  14. FishPathogens.eu/vhsv: a user-friendly viral haemorrhagic septicaemia virus isolate and sequence database

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren

    2009-01-01

    A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the Eu......A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part...... of the European Community Reference Laboratory for Fish Diseases function. This concept has been initially developed for viral haemorrhagic septicaemia virus and will be extended in future to include information on other significant aquaculture pathogens. Information included for each isolate comprises sequence...... to obtain data from any selected part of the genome of interest. The output of the sequence search can be readily retrieved as a FASTA file ready to be imported into a sequence alignment tool of choice, facilitating further molecular epidemiological study....

  15. Towards New Antifolates Targeting Eukaryotic Opportunistic Infections

    Energy Technology Data Exchange (ETDEWEB)

    Liu, J.; Bolstad, D; Bolstad, E; Wright, D; Anderson, A

    2009-01-01

    Trimethoprim, an antifolate commonly prescribed in combination with sulfamethoxazole, potently inhibits several prokaryotic species of dihydrofolate reductase (DHFR). However, several eukaryotic pathogenic organisms are resistant to trimethoprim, preventing its effective use as a therapeutic for those infections. We have been building a program to reengineer trimethoprim to more potently and selectively inhibit eukaryotic species of DHFR as a viable strategy for new drug discovery targeting several opportunistic pathogens. We have developed a series of compounds that exhibit potent and selective inhibition of DHFR from the parasitic protozoa Cryptosporidium and Toxoplasma as well as the fungus Candida glabrata. A comparison of the structures of DHFR from the fungal species Candida glabrata and Pneumocystis suggests that the compounds may also potently inhibit Pneumocystis DHFR.

  16. Structure and Mechanism of a Eukaryotic FMN Adenylyltransferase

    OpenAIRE

    Huerta, Carlos; Borek, Dominika; Machius, Mischa; Grishin, Nick V.; Zhang, Hong

    2009-01-01

    Flavin mononucleotide adenylyltransferase (FMNAT) catalyzes the formation of the essential flavocoenzyme FAD and plays an important role in flavocoenzyme homeostasis regulation. By sequence comparison, bacterial and eukaryotic FMNAT enzymes belong to two different protein superfamilies and apparently utilize different set of active site residues to accomplish the same chemistry. Here we report the first structural characterization of a eukaryotic FMNAT from a pathogenic yeast Candida glabrata...

  17. TiPs: a database of therapeutic targets in pathogens and associated tools.

    KAUST Repository

    Lepore, Rosalba

    2013-05-21

    MOTIVATION: The need for new drugs and new targets is particularly compelling in an era that is witnessing an alarming increase of drug resistance in human pathogens. The identification of new targets of known drugs is a promising approach, which has proven successful in several cases. Here, we describe a database that includes information on 5153 putative drug-target pairs for 150 human pathogens derived from available drug-target crystallographic complexes. AVAILABILITY AND IMPLEMENTATION: The TiPs database is freely available at http://biocomputing.it/tips. CONTACT: anna.tramontano@uniroma1.it or allegra.via@uniroma1.it.

  18. FishPathogens.eu/vhsv: A user-friendly Viral Haemorrhagic Septicaemia Virus (VHSV) isolate and sequence database

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren

    A database has been created, www.FishPathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the European...

  19. Transfer of DNA from Bacteria to Eukaryotes

    Directory of Open Access Journals (Sweden)

    Benoît Lacroix

    2016-07-01

    Full Text Available Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen, Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium, or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs, the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer.

  20. Eukaryotic Pathogen Database Resources (EuPathDB)

    Data.gov (United States)

    U.S. Department of Health & Human Services — EuPathDB Bioinformatics Resource Center for Biodefense and Emerging/Re-emerging Infectious Diseases is a portal for accessing genomic-scale datasets associated with...

  1. Defensins: antifungal lessons from eukaryotes

    Directory of Open Access Journals (Sweden)

    Patrícia M. Silva

    2014-03-01

    Full Text Available Over the last years, antimicrobial peptides (AMPs have been the focus of intense research towards the finding of a viable alternative to current antifungal drugs. Defensins are one of the major families of AMPs and the most represented among all eukaryotic groups, providing an important first line of host defense against pathogenic microorganisms. Several of these cysteine-stabilized peptides present a relevant effect against fungi. Defensins are the AMPs with the broader distribution across all eukaryotic kingdoms, namely, Fungi, Plantæ and Animalia, and were recently shown to have an ancestor in a bacterial organism. As a part of the host defense, defensins act as an important vehicle of information between innate and adaptive immune system and have a role in immunomodulation. This multidimensionality represents a powerful host shield, hard for microorganisms to overcome using single approach resistance strategies. Pathogenic fungi resistance to conventional antimycotic drugs is becoming a major problem. Defensins, as other AMPs, have shown to be an effective alternative to the current antimycotic therapies, demonstrating potential as novel therapeutic agents or drug leads. In this review, we summarize the current knowledge on some eukaryotic defensins with antifungal action. An overview of the main targets in the fungal cell and the mechanism of action of these AMPs (namely, the selectivity for some fungal membrane components are presented. Additionally, recent works on antifungal defensins structure, activity and citotoxicity are also reviewed.

  2. Communities of microbial eukaryotes in the mammalian gut within the context of environmental eukaryotic diversity

    Energy Technology Data Exchange (ETDEWEB)

    Parfrey, Laura Wegener; Walters, William A.; Lauber, Christian L.; Clemente, Jose C.; Berg-Lyons, Donna; Teiling, Clotilde; Kodira, Chinnappa; Mohiuddin, Mohammed; Brunelle, Julie; Driscoll, Mark; Fierer, Noah; Gilbert, Jack A.; Knight, Rob

    2014-06-19

    Eukaryotic microbes (protists) residing in the vertebrate gut influence host health and disease, but their diversity and distribution in healthy hosts is poorly understood. Protists found in the gut are typically considered parasites, but many are commensal and some are beneficial. Further, the hygiene hypothesis predicts that association with our co-evolved microbial symbionts may be important to overall health. It is therefore imperative that we understand the normal diversity of our eukaryotic gut microbiota to test for such effects and avoid eliminating commensal organisms. We assembled a dataset of healthy individuals from two populations, one with traditional, agrarian lifestyles and a second with modern, westernized lifestyles, and characterized the human eukaryotic microbiota via high-throughput sequencing. To place the human gut microbiota within a broader context our dataset also includes gut samples from diverse mammals and samples from other aquatic and terrestrial environments. We curated the SILVA ribosomal database to reflect current knowledge of eukaryotic taxonomy and employ it as a phylogenetic framework to compare eukaryotic diversity across environment. We show that adults from the non-western population harbor a diverse community of protists, and diversity in the human gut is comparable to that in other mammals. However, the eukaryotic microbiota of the western population appears depauperate. The distribution of symbionts found in mammals reflects both host phylogeny and diet. Eukaryotic microbiota in the gut are less diverse and more patchily distributed than bacteria. More broadly, we show that eukaryotic communities in the gut are less diverse than in aquatic and terrestrial habitats, and few taxa are shared across habitat types, and diversity patterns of eukaryotes are correlated with those observed for bacteria. These results outline the distribution and diversity of microbial eukaryotic communities in the mammalian gut and across

  3. Sexual Reproduction of Human Fungal Pathogens

    Science.gov (United States)

    Heitman, Joseph; Carter, Dee A.; Dyer, Paul S.; Soll, David R.

    2014-01-01

    We review here recent advances in our understanding of sexual reproduction in fungal pathogens that commonly infect humans, including Candida albicans, Cryptococcus neoformans/gattii, and Aspergillus fumigatus. Where appropriate or relevant, we introduce findings on other species associated with human infections. In particular, we focus on rapid advances involving genetic, genomic, and population genetic approaches that have reshaped our view of how fungal pathogens evolve. Rather than being asexual, mitotic, and largely clonal, as was thought to be prevalent as recently as a decade ago, we now appreciate that the vast majority of pathogenic fungi have retained extant sexual, or parasexual, cycles. In some examples, sexual and parasexual unions of pathogenic fungi involve closely related individuals, generating diversity in the population but with more restricted recombination than expected from fertile, sexual, outcrossing and recombining populations. In other cases, species and isolates participate in global outcrossing populations with the capacity for considerable levels of gene flow. These findings illustrate general principles of eukaryotic pathogen emergence with relevance for other fungi, parasitic eukaryotic pathogens, and both unicellular and multicellular eukaryotic organisms. PMID:25085958

  4. Gram-Negative Bacterial Sensors for Eukaryotic Signal Molecules

    Directory of Open Access Journals (Sweden)

    Olivier Lesouhaitier

    2009-09-01

    Full Text Available Ample evidence exists showing that eukaryotic signal molecules synthesized and released by the host can activate the virulence of opportunistic pathogens. The sensitivity of prokaryotes to host signal molecules requires the presence of bacterial sensors. These prokaryotic sensors, or receptors, have a double function: stereospecific recognition in a complex environment and transduction of the message in order to initiate bacterial physiological modifications. As messengers are generally unable to freely cross the bacterial membrane, they require either the presence of sensors anchored in the membrane or transporters allowing direct recognition inside the bacterial cytoplasm. Since the discovery of quorum sensing, it was established that the production of virulence factors by bacteria is tightly growth-phase regulated. It is now obvious that expression of bacterial virulence is also controlled by detection of the eukaryotic messengers released in the micro-environment as endocrine or neuro-endocrine modulators. In the presence of host physiological stress many eukaryotic factors are released and detected by Gram-negative bacteria which in return rapidly adapt their physiology. For instance, Pseudomonas aeruginosa can bind elements of the host immune system such as interferon-γ and dynorphin and then through quorum sensing circuitry enhance its virulence. Escherichia coli sensitivity to the neurohormones of the catecholamines family appears relayed by a recently identified bacterial adrenergic receptor. In the present review, we will describe the mechanisms by which various eukaryotic signal molecules produced by host may activate Gram-negative bacteria virulence. Particular attention will be paid to Pseudomonas, a genus whose representative species, P. aeruginosa, is a common opportunistic pathogen. The discussion will be particularly focused on the pivotal role played by these new types of pathogen sensors from the sensing to the transduction

  5. CRN13 candidate effectors from plant and animal eukaryotic pathogens are DNA-binding proteins which trigger host DNA damage response.

    Science.gov (United States)

    Ramirez-Garcés, Diana; Camborde, Laurent; Pel, Michiel J C; Jauneau, Alain; Martinez, Yves; Néant, Isabelle; Leclerc, Catherine; Moreau, Marc; Dumas, Bernard; Gaulin, Elodie

    2016-04-01

    To successfully colonize their host, pathogens produce effectors that can interfere with host cellular processes. Here we investigated the function of CRN13 candidate effectors produced by plant pathogenic oomycetes and detected in the genome of the amphibian pathogenic chytrid fungus Batrachochytrium dendrobatidis (BdCRN13). When expressed in Nicotiana, AeCRN13, from the legume root pathogen Aphanomyces euteiches, increases the susceptibility of the leaves to the oomycete Phytophthora capsici. When transiently expressed in amphibians or plant cells, AeCRN13 and BdCRN13 localize to the cell nuclei, triggering aberrant cell development and eventually causing cell death. Using Förster resonance energy transfer experiments in plant cells, we showed that both CRN13s interact with nuclear DNA and trigger plant DNA damage response (DDR). Mutating key amino acid residues in a predicted HNH-like endonuclease motif abolished the interaction of AeCRN13 with DNA, the induction of DDR and the enhancement of Nicotiana susceptibility to P. capsici. Finally, H2AX phosphorylation, a marker of DNA damage, and enhanced expression of genes involved in the DDR were observed in A. euteiches-infected Medicago truncatula roots. These results show that CRN13 from plant and animal eukaryotic pathogens promotes host susceptibility by targeting nuclear DNA and inducing DDR. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Beyond Agrobacterium-Mediated Transformation: Horizontal Gene Transfer from Bacteria to Eukaryotes.

    Science.gov (United States)

    Lacroix, Benoît; Citovsky, Vitaly

    2018-03-03

    Besides the massive gene transfer from organelles to the nuclear genomes, which occurred during the early evolution of eukaryote lineages, the importance of horizontal gene transfer (HGT) in eukaryotes remains controversial. Yet, increasing amounts of genomic data reveal many cases of bacterium-to-eukaryote HGT that likely represent a significant force in adaptive evolution of eukaryotic species. However, DNA transfer involved in genetic transformation of plants by Agrobacterium species has traditionally been considered as the unique example of natural DNA transfer and integration into eukaryotic genomes. Recent discoveries indicate that the repertoire of donor bacterial species and of recipient eukaryotic hosts potentially are much wider than previously thought, including donor bacterial species, such as plant symbiotic nitrogen-fixing bacteria (e.g., Rhizobium etli) and animal bacterial pathogens (e.g., Bartonella henselae, Helicobacter pylori), and recipient species from virtually all eukaryotic clades. Here, we review the molecular pathways and potential mechanisms of these trans-kingdom HGT events and discuss their utilization in biotechnology and research.

  7. TiPs: a database of therapeutic targets in pathogens and associated tools.

    KAUST Repository

    Lepore, Rosalba; Tramontano, Anna; Via, Allegra

    2013-01-01

    has proven successful in several cases. Here, we describe a database that includes information on 5153 putative drug-target pairs for 150 human pathogens derived from available drug-target crystallographic complexes. AVAILABILITY AND IMPLEMENTATION

  8. QuartetS-DB: a large-scale orthology database for prokaryotes and eukaryotes inferred by evolutionary evidence

    Directory of Open Access Journals (Sweden)

    Yu Chenggang

    2012-06-01

    Full Text Available Abstract Background The concept of orthology is key to decoding evolutionary relationships among genes across different species using comparative genomics. QuartetS is a recently reported algorithm for large-scale orthology detection. Based on the well-established evolutionary principle that gene duplication events discriminate paralogous from orthologous genes, QuartetS has been shown to improve orthology detection accuracy while maintaining computational efficiency. Description QuartetS-DB is a new orthology database constructed using the QuartetS algorithm. The database provides orthology predictions among 1621 complete genomes (1365 bacterial, 92 archaeal, and 164 eukaryotic, covering more than seven million proteins and four million pairwise orthologs. It is a major source of orthologous groups, containing more than 300,000 groups of orthologous proteins and 236,000 corresponding gene trees. The database also provides over 500,000 groups of inparalogs. In addition to its size, a distinguishing feature of QuartetS-DB is the ability to allow users to select a cutoff value that modulates the balance between prediction accuracy and coverage of the retrieved pairwise orthologs. The database is accessible at https://applications.bioanalysis.org/quartetsdb. Conclusions QuartetS-DB is one of the largest orthology resources available to date. Because its orthology predictions are underpinned by evolutionary evidence obtained from sequenced genomes, we expect its accuracy to continue to increase in future releases as the genomes of additional species are sequenced.

  9. The Pathogen-Host Interactions database (PHI-base): additions and future developments.

    Science.gov (United States)

    Urban, Martin; Pant, Rashmi; Raghunath, Arathi; Irvine, Alistair G; Pedro, Helder; Hammond-Kosack, Kim E

    2015-01-01

    Rapidly evolving pathogens cause a diverse array of diseases and epidemics that threaten crop yield, food security as well as human, animal and ecosystem health. To combat infection greater comparative knowledge is required on the pathogenic process in multiple species. The Pathogen-Host Interactions database (PHI-base) catalogues experimentally verified pathogenicity, virulence and effector genes from bacterial, fungal and protist pathogens. Mutant phenotypes are associated with gene information. The included pathogens infect a wide range of hosts including humans, animals, plants, insects, fish and other fungi. The current version, PHI-base 3.6, available at http://www.phi-base.org, stores information on 2875 genes, 4102 interactions, 110 host species, 160 pathogenic species (103 plant, 3 fungal and 54 animal infecting species) and 181 diseases drawn from 1243 references. Phenotypic and gene function information has been obtained by manual curation of the peer-reviewed literature. A controlled vocabulary consisting of nine high-level phenotype terms permits comparisons and data analysis across the taxonomic space. PHI-base phenotypes were mapped via their associated gene information to reference genomes available in Ensembl Genomes. Virulence genes and hotspots can be visualized directly in genome browsers. Future plans for PHI-base include development of tools facilitating community-led curation and inclusion of the corresponding host target(s). © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Hijacking of the host SCF ubiquitin ligase machinery by plant pathogens

    Directory of Open Access Journals (Sweden)

    Shimpei eMagori

    2011-11-01

    Full Text Available The SCF (SKP1-CUL1-F-box protein ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. Although this ubiquitination machinery is found and functional only in eukaryotes, many non-eukaryotic pathogens also encode F-box proteins, the critical subunits of the SCF complex. Increasing evidence indicates that such non-eukaryotic F-box proteins play an essential role in subverting or exploiting the host ubiquitin/proteasome system for efficient pathogen infection. A recent bioinformatic analysis has identified more than 70 F-box proteins in 22 different bacterial species, suggesting that use of pathogen-encoded F-box effectors in the host cell may be a widespread infection strategy. In this review, we focus on plant pathogen-encoded F-box effectors, such as VirF of Agrobacterium tumefaciens, GALAs of Ralstonia solanacearum, and P0 of Poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.

  11. Eukaryotic systematics: a user's guide for cell biologists and parasitologists.

    Science.gov (United States)

    Walker, Giselle; Dorrell, Richard G; Schlacht, Alexander; Dacks, Joel B

    2011-11-01

    Single-celled parasites like Entamoeba, Trypanosoma, Phytophthora and Plasmodium wreak untold havoc on human habitat and health. Understanding the position of the various protistan pathogens in the larger context of eukaryotic diversity informs our study of how these parasites operate on a cellular level, as well as how they have evolved. Here, we review the literature that has brought our understanding of eukaryotic relationships from an idea of parasites as primitive cells to a crystallized view of diversity that encompasses 6 major divisions, or supergroups, of eukaryotes. We provide an updated taxonomic scheme (for 2011), based on extensive genomic, ultrastructural and phylogenetic evidence, with three differing levels of taxonomic detail for ease of referencing and accessibility (see supplementary material at Cambridge Journals On-line). Two of the most pressing issues in cellular evolution, the root of the eukaryotic tree and the evolution of photosynthesis in complex algae, are also discussed along with ideas about what the new generation of genome sequencing technologies may contribute to the field of eukaryotic systematics. We hope that, armed with this user's guide, cell biologists and parasitologists will be encouraged about taking an increasingly evolutionary point of view in the battle against parasites representing real dangers to our livelihoods and lives.

  12. The quantitative basis of the Arabidopsis innate immune system to endemic pathogens depends on pathogen genetics

    DEFF Research Database (Denmark)

    Corwin, Jason A; Copeland, Daniel; Feusier, Julie

    2016-01-01

    The most established model of the eukaryotic innate immune system is derived from examples of large effect monogenic quantitative resistance to pathogens. However, many host-pathogen interactions involve many genes of small to medium effect and exhibit quantitative resistance. We used the Arabido......The most established model of the eukaryotic innate immune system is derived from examples of large effect monogenic quantitative resistance to pathogens. However, many host-pathogen interactions involve many genes of small to medium effect and exhibit quantitative resistance. We used....... cinerea, we identified a total of 2,982 genes associated with quantitative resistance using lesion area and 3,354 genes associated with camalexin production as measures of the interaction. Most genes were associated with resistance to a specific Botrytis isolate, which demonstrates the influence...... genes associated with quantitative resistance. Using publically available co-expression data, we condensed the quantitative resistance associated genes into co-expressed gene networks. GO analysis of these networks implicated several biological processes commonly connected to disease resistance...

  13. diArk – a resource for eukaryotic genome research

    Directory of Open Access Journals (Sweden)

    Kollmar Martin

    2007-04-01

    Full Text Available Abstract Background The number of completed eukaryotic genome sequences and cDNA projects has increased exponentially in the past few years although most of them have not been published yet. In addition, many microarray analyses yielded thousands of sequenced EST and cDNA clones. For the researcher interested in single gene analyses (from a phylogenetic, a structural biology or other perspective it is therefore important to have up-to-date knowledge about the various resources providing primary data. Description The database is built around 3 central tables: species, sequencing projects and publications. The species table contains commonly and alternatively used scientific names, common names and the complete taxonomic information. For projects the sequence type and links to species project web-sites and species homepages are stored. All publications are linked to projects. The web-interface provides comprehensive search modules with detailed options and three different views of the selected data. We have especially focused on developing an elaborate taxonomic tree search tool that allows the user to instantaneously identify e.g. the closest relative to the organism of interest. Conclusion We have developed a database, called diArk, to store, organize, and present the most relevant information about completed genome projects and EST/cDNA data from eukaryotes. Currently, diArk provides information about 415 eukaryotes, 823 sequencing projects, and 248 publications.

  14. TrSDB: a proteome database of transcription factors

    Science.gov (United States)

    Hermoso, Antoni; Aguilar, Daniel; Aviles, Francesc X.; Querol, Enrique

    2004-01-01

    TrSDB—TranScout Database—(http://ibb.uab.es/trsdb) is a proteome database of eukaryotic transcription factors based upon predicted motifs by TranScout and data sources such as InterPro and Gene Ontology Annotation. Nine eukaryotic proteomes are included in the current version. Extensive and diverse information for each database entry, different analyses considering TranScout classification and similarity relationships are offered for research on transcription factors or gene expression. PMID:14681387

  15. AMPK in Pathogens.

    Science.gov (United States)

    Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

    2016-01-01

    During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

  16. Heterogeneous Family of Cyclomodulins: Smart Weapons That Allow Bacteria to Hijack the Eukaryotic Cell Cycle and Promote Infections

    Directory of Open Access Journals (Sweden)

    Rachid A. El-Aouar Filho

    2017-05-01

    Full Text Available Some bacterial pathogens modulate signaling pathways of eukaryotic cells in order to subvert the host response for their own benefit, leading to successful colonization and invasion. Pathogenic bacteria produce multiple compounds that generate favorable conditions to their survival and growth during infection in eukaryotic hosts. Many bacterial toxins can alter the cell cycle progression of host cells, impairing essential cellular functions and impeding host cell division. This review summarizes current knowledge regarding cyclomodulins, a heterogeneous family of bacterial effectors that induce eukaryotic cell cycle alterations. We discuss the mechanisms of actions of cyclomodulins according to their biochemical properties, providing examples of various cyclomodulins such as cycle inhibiting factor, γ-glutamyltranspeptidase, cytolethal distending toxins, shiga toxin, subtilase toxin, anthrax toxin, cholera toxin, adenylate cyclase toxins, vacuolating cytotoxin, cytotoxic necrotizing factor, Panton-Valentine leukocidin, phenol soluble modulins, and mycolactone. Special attention is paid to the benefit provided by cyclomodulins to bacteria during colonization of the host.

  17. Composition of Micro-eukaryotes on the Skin of the Cascades Frog (Rana cascadae and Patterns of Correlation between Skin Microbes and Batrachochytrium dendrobatidis

    Directory of Open Access Journals (Sweden)

    Jordan G. Kueneman

    2017-12-01

    Full Text Available Global amphibian decline linked to fungal pathogens has galvanized research on applied amphibian conservation. Skin-associated bacterial communities of amphibians have been shown to mediate fungal skin infections and the development of probiotic treatments with antifungal bacteria has become an emergent area of research. While exploring the role of protective bacteria has been a primary focus for amphibian conservation, we aim to expand and study the other microbes present in amphibian skin communities including fungi and other micro-eukaryotes. Here, we characterize skin-associated bacteria and micro-eukaryotic diversity found across life stages of Cascades frog (Rana cascadae and their associated aquatic environments using culture independent 16S and 18S rRNA marker-gene sequencing. Individuals of various life stages of Cascades frogs were sampled from a population located in the Trinity Alps in Northern California during an epidemic of the chytrid fungus, Batrachochytrium dendrobatidis. We filtered the bacterial sequences against a published database of bacteria known to inhibit B. dendrobatidis in co-culture to estimate the proportion of the skin bacterial community that is likely to provide defense against B. dendrobatidis. Tadpoles had a significantly higher proportion of B. dendrobatidis-inhibitory bacterial sequence matches relative to subadult and adult Cascades frogs. We applied a network analysis to examine patterns of correlation between bacterial taxa and B. dendrobatidis, as well as micro-eukaryotic taxa and B. dendrobatidis. Combined with the published database of bacteria known to inhibit B. dendrobatidis, we used the network analysis to identify bacteria that negatively correlated with B. dendrobatidis and thus could be good probiotic candidates in the Cascades frog system.

  18. A Helicobacter pylori Homolog of Eukaryotic Flotillin Is Involved in Cholesterol Accumulation, Epithelial Cell Responses and Host Colonization

    Directory of Open Access Journals (Sweden)

    Melanie L. Hutton

    2017-06-01

    Full Text Available The human pathogen Helicobacter pylori acquires cholesterol from membrane raft domains in eukaryotic cells, commonly known as “lipid rafts.” Incorporation of this cholesterol into the H. pylori cell membrane allows the bacterium to avoid clearance by the host immune system and to resist the effects of antibiotics and antimicrobial peptides. The presence of cholesterol in H. pylori bacteria suggested that this pathogen may have cholesterol-enriched domains within its membrane. Consistent with this suggestion, we identified a hypothetical H. pylori protein (HP0248 with homology to the flotillin proteins normally found in the cholesterol-enriched domains of eukaryotic cells. As shown for eukaryotic flotillin proteins, HP0248 was detected in detergent-resistant membrane fractions of H. pylori. Importantly, H. pylori HP0248 mutants contained lower levels of cholesterol than wild-type bacteria (P < 0.01. HP0248 mutant bacteria also exhibited defects in type IV secretion functions, as indicated by reduced IL-8 responses and CagA translocation in epithelial cells (P < 0.05, and were less able to establish a chronic infection in mice than wild-type bacteria (P < 0.05. Thus, we have identified an H. pylori flotillin protein and shown its importance for bacterial virulence. Taken together, the data demonstrate important roles for H. pylori flotillin in host-pathogen interactions. We propose that H. pylori flotillin may be required for the organization of virulence proteins into membrane raft-like structures in this pathogen.

  19. Custom database development and biomarker discovery methods for MALDI-TOF mass spectrometry-based identification of high-consequence bacterial pathogens.

    Science.gov (United States)

    Tracz, Dobryan M; Tyler, Andrea D; Cunningham, Ian; Antonation, Kym S; Corbett, Cindi R

    2017-03-01

    A high-quality custom database of MALDI-TOF mass spectral profiles was developed with the goal of improving clinical diagnostic identification of high-consequence bacterial pathogens. A biomarker discovery method is presented for identifying and evaluating MALDI-TOF MS spectra to potentially differentiate biothreat bacteria from less-pathogenic near-neighbour species. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  20. EuGI: a novel resource for studying genomic islands to facilitate horizontal gene transfer detection in eukaryotes.

    Science.gov (United States)

    Clasen, Frederick Johannes; Pierneef, Rian Ewald; Slippers, Bernard; Reva, Oleg

    2018-05-03

    Genomic islands (GIs) are inserts of foreign DNA that have potentially arisen through horizontal gene transfer (HGT). There are evidences that GIs can contribute significantly to the evolution of prokaryotes. The acquisition of GIs through HGT in eukaryotes has, however, been largely unexplored. In this study, the previously developed GI prediction tool, SeqWord Gene Island Sniffer (SWGIS), is modified to predict GIs in eukaryotic chromosomes. Artificial simulations are used to estimate ratios of predicting false positive and false negative GIs by inserting GIs into different test chromosomes and performing the SWGIS v2.0 algorithm. Using SWGIS v2.0, GIs are then identified in 36 fungal, 22 protozoan and 8 invertebrate genomes. SWGIS v2.0 predicts GIs in large eukaryotic chromosomes based on the atypical nucleotide composition of these regions. Averages for predicting false negative and false positive GIs were 20.1% and 11.01% respectively. A total of 10,550 GIs were identified in 66 eukaryotic species with 5299 of these GIs coding for at least one functional protein. The EuGI web-resource, freely accessible at http://eugi.bi.up.ac.za , was developed that allows browsing the database created from identified GIs and genes within GIs through an interactive and visual interface. SWGIS v2.0 along with the EuGI database, which houses GIs identified in 66 different eukaryotic species, and the EuGI web-resource, provide the first comprehensive resource for studying HGT in eukaryotes.

  1. Meiosis and haploid gametes in the pathogen Trypanosoma brucei.

    Science.gov (United States)

    Peacock, Lori; Bailey, Mick; Carrington, Mark; Gibson, Wendy

    2014-01-20

    In eukaryote pathogens, sex is an important driving force in spreading genes for drug resistance, pathogenicity, and virulence. For the parasitic trypanosomes that cause African sleeping sickness, mating occurs during transmission by the tsetse vector and involves meiosis, but haploid gametes have not yet been identified. Here, we show that meiosis is a normal part of development in the insect salivary glands for all subspecies of Trypanosoma brucei, including the human pathogens. By observing insect-derived trypanosomes during the window of peak expression of meiosis-specific genes, we identified promastigote-like (PL) cells that interacted with each other via their flagella and underwent fusion, as visualized by the mixing of cytoplasmic red and green fluorescent proteins. PL cells had a short, wide body, a very long anterior flagellum, and either one or two kinetoplasts, but only the anterior kinetoplast was associated with the flagellum. Measurement of nuclear DNA contents showed that PL cells were haploid relative to diploid metacyclics. Trypanosomes are among the earliest diverging eukaryotes, and our results support the hypothesis that meiosis and sexual reproduction are ubiquitous in eukaryotes and likely to have been early innovations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  2. UMD-USHbases: a comprehensive set of databases to record and analyse pathogenic mutations and unclassified variants in seven Usher syndrome causing genes.

    Science.gov (United States)

    Baux, David; Faugère, Valérie; Larrieu, Lise; Le Guédard-Méreuze, Sandie; Hamroun, Dalil; Béroud, Christophe; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

    2008-08-01

    Using the Universal Mutation Database (UMD) software, we have constructed "UMD-USHbases", a set of relational databases of nucleotide variations for seven genes involved in Usher syndrome (MYO7A, CDH23, PCDH15, USH1C, USH1G, USH3A and USH2A). Mutations in the Usher syndrome type I causing genes are also recorded in non-syndromic hearing loss cases and mutations in USH2A in non-syndromic retinitis pigmentosa. Usher syndrome provides a particular challenge for molecular diagnostics because of the clinical and molecular heterogeneity. As many mutations are missense changes, and all the genes also contain apparently non-pathogenic polymorphisms, well-curated databases are crucial for accurate interpretation of pathogenicity. Tools are provided to assess the pathogenicity of mutations, including conservation of amino acids and analysis of splice-sites. Reference amino acid alignments are provided. Apparently non-pathogenic variants in patients with Usher syndrome, at both the nucleotide and amino acid level, are included. The UMD-USHbases currently contain more than 2,830 entries including disease causing mutations, unclassified variants or non-pathogenic polymorphisms identified in over 938 patients. In addition to data collected from 89 publications, 15 novel mutations identified in our laboratory are recorded in MYO7A (6), CDH23 (8), or PCDH15 (1) genes. Information is given on the relative involvement of the seven genes, the number and distribution of variants in each gene. UMD-USHbases give access to a software package that provides specific routines and optimized multicriteria research and sorting tools. These databases should assist clinicians and geneticists seeking information about mutations responsible for Usher syndrome.

  3. High Throughput Sequencing for Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Camilla Sekse

    2017-10-01

    Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.

  4. How often do they have sex? A comparative analysis of the population structure of seven eukaryotic microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Nicolás Tomasini

    Full Text Available The model of predominant clonal evolution (PCE proposed for micropathogens does not state that genetic exchange is totally absent, but rather, that it is too rare to break the prevalent PCE pattern. However, the actual impact of this "residual" genetic exchange should be evaluated. Multilocus Sequence Typing (MLST is an excellent tool to explore the problem. Here, we compared online available MLST datasets for seven eukaryotic microbial pathogens: Trypanosoma cruzi, the Fusarium solani complex, Aspergillus fumigatus, Blastocystis subtype 3, the Leishmania donovani complex, Candida albicans and Candida glabrata. We first analyzed phylogenetic relationships among genotypes within each dataset. Then, we examined different measures of branch support and incongruence among loci as signs of genetic structure and levels of past recombination. The analyses allow us to identify three types of genetic structure. The first was characterized by trees with well-supported branches and low levels of incongruence suggesting well-structured populations and PCE. This was the case for the T. cruzi and F. solani datasets. The second genetic structure, represented by Blastocystis spp., A. fumigatus and the L. donovani complex datasets, showed trees with weakly-supported branches but low levels of incongruence among loci, whereby genetic structuration was not clearly defined by MLST. Finally, trees showing weakly-supported branches and high levels of incongruence among loci were observed for Candida species, suggesting that genetic exchange has a higher evolutionary impact in these mainly clonal yeast species. Furthermore, simulations showed that MLST may fail to show right clustering in population datasets even in the absence of genetic exchange. In conclusion, these results make it possible to infer variable impacts of genetic exchange in populations of predominantly clonal micro-pathogens. Moreover, our results reveal different problems of MLST to determine the

  5. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi.

    Science.gov (United States)

    Meireles, D A; Domingos, R M; Gaiarsa, J W; Ragnoni, E G; Bannitz-Fernandes, R; da Silva Neto, J F; de Souza, R F; Netto, L E S

    2017-08-01

    Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species). Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr), the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i) the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols), but not by β-mercaptoethanol or GSH (monothiols), even in large excess; (ii) MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH) over hydrogen peroxide; (iii) MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13)×10 8 M -1 s -1 ). Both Cys 87 and Cys 154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pK a value of the Cys p residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Copyright © 2017. Published by Elsevier B.V.

  6. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi

    Directory of Open Access Journals (Sweden)

    D.A. Meireles

    2017-08-01

    Full Text Available Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species. Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr, the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols, but not by β-mercaptoethanol or GSH (monothiols, even in large excess; (ii MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH over hydrogen peroxide; (iii MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13×108 M−1 s−1. Both Cys87 and Cys154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pKa value of the Cysp residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Keywords: Ohr/OsmC, Thiol-dependent peroxidases, Phylogeny

  7. IntPath--an integrated pathway gene relationship database for model organisms and important pathogens.

    Science.gov (United States)

    Zhou, Hufeng; Jin, Jingjing; Zhang, Haojun; Yi, Bo; Wozniak, Michal; Wong, Limsoon

    2012-01-01

    Pathway data are important for understanding the relationship between genes, proteins and many other molecules in living organisms. Pathway gene relationships are crucial information for guidance, prediction, reference and assessment in biochemistry, computational biology, and medicine. Many well-established databases--e.g., KEGG, WikiPathways, and BioCyc--are dedicated to collecting pathway data for public access. However, the effectiveness of these databases is hindered by issues such as incompatible data formats, inconsistent molecular representations, inconsistent molecular relationship representations, inconsistent referrals to pathway names, and incomprehensive data from different databases. In this paper, we overcome these issues through extraction, normalization and integration of pathway data from several major public databases (KEGG, WikiPathways, BioCyc, etc). We build a database that not only hosts our integrated pathway gene relationship data for public access but also maintains the necessary updates in the long run. This public repository is named IntPath (Integrated Pathway gene relationship database for model organisms and important pathogens). Four organisms--S. cerevisiae, M. tuberculosis H37Rv, H. Sapiens and M. musculus--are included in this version (V2.0) of IntPath. IntPath uses the "full unification" approach to ensure no deletion and no introduced noise in this process. Therefore, IntPath contains much richer pathway-gene and pathway-gene pair relationships and much larger number of non-redundant genes and gene pairs than any of the single-source databases. The gene relationships of each gene (measured by average node degree) per pathway are significantly richer. The gene relationships in each pathway (measured by average number of gene pairs per pathway) are also considerably richer in the integrated pathways. Moderate manual curation are involved to get rid of errors and noises from source data (e.g., the gene ID errors in WikiPathways and

  8. Structure of the prolyl-tRNA synthetase from the eukaryotic pathogen Giardia lamblia

    Energy Technology Data Exchange (ETDEWEB)

    Larson, Eric T.; Kim, Jessica E.; Napuli, Alberto J.; Verlinde, Christophe L. M. J.; Fan, Erkang; Zucker, Frank H.; Van Voorhis, Wesley C.; Buckner, Frederick S.; Hol, Wim G. J.; Merritt, Ethan A., E-mail: merritt@u.washington.edu [Medical Structural Genomics of Pathogenic Protozoa, (United States); University of Washington, Seattle, WA 98195 (United States)

    2012-09-01

    The structure of Giardia prolyl-tRNA synthetase cocrystallized with proline and ATP shows evidence for half-of-the-sites activity, leading to a corresponding mixture of reaction substrates and product (prolyl-AMP) in the two active sites of the dimer. The genome of the human intestinal parasite Giardia lamblia contains only a single aminoacyl-tRNA synthetase gene for each amino acid. The Giardia prolyl-tRNA synthetase gene product was originally misidentified as a dual-specificity Pro/Cys enzyme, in part owing to its unexpectedly high off-target activation of cysteine, but is now believed to be a normal representative of the class of archaeal/eukaryotic prolyl-tRNA synthetases. The 2.2 Å resolution crystal structure of the G. lamblia enzyme presented here is thus the first structure determination of a prolyl-tRNA synthetase from a eukaryote. The relative occupancies of substrate (proline) and product (prolyl-AMP) in the active site are consistent with half-of-the-sites reactivity, as is the observed biphasic thermal denaturation curve for the protein in the presence of proline and MgATP. However, no corresponding induced asymmetry is evident in the structure of the protein. No thermal stabilization is observed in the presence of cysteine and ATP. The implied low affinity for the off-target activation product cysteinyl-AMP suggests that translational fidelity in Giardia is aided by the rapid release of misactivated cysteine.

  9. GOBASE: an organelle genome database

    OpenAIRE

    O?Brien, Emmet A.; Zhang, Yue; Wang, Eric; Marie, Veronique; Badejoko, Wole; Lang, B. Franz; Burger, Gertraud

    2008-01-01

    The organelle genome database GOBASE, now in its 21st release (June 2008), contains all published mitochondrion-encoded sequences (?913 000) and chloroplast-encoded sequences (?250 000) from a wide range of eukaryotic taxa. For all sequences, information on related genes, exons, introns, gene products and taxonomy is available, as well as selected genome maps and RNA secondary structures. Recent major enhancements to database functionality include: (i) addition of an interface for RNA editing...

  10. Influence of solar radiation and biotic interactions on bacterial and eukaryotic communities associated with sewage decomposition in ambient water

    Science.gov (United States)

    Sewage and ambient water both consist of a highly complex array of bacteria and eukaryotic microbes. When these communities are mixed, the persistence of sewage-derived pathogens in environmental waters can represent a significant public health concern. Solar radiation and biot...

  11. Emerging Pathogens Initiative (EPI)

    Data.gov (United States)

    Department of Veterans Affairs — The Emerging Pathogens Initiative (EPI) database contains emerging pathogens information from the local Veterans Affairs Medical Centers (VAMCs). The EPI software...

  12. Distinct Trajectories of Massive Recent Gene Gains and Losses in Populations of a Microbial Eukaryotic Pathogen.

    Science.gov (United States)

    Hartmann, Fanny E; Croll, Daniel

    2017-11-01

    Differences in gene content are a significant source of variability within species and have an impact on phenotypic traits. However, little is known about the mechanisms responsible for the most recent gene gains and losses. We screened the genomes of 123 worldwide isolates of the major pathogen of wheat Zymoseptoria tritici for robust evidence of gene copy number variation. Based on orthology relationships in three closely related fungi, we identified 599 gene gains and 1,024 gene losses that have not yet reached fixation within the focal species. Our analyses of gene gains and losses segregating in populations showed that gene copy number variation arose preferentially in subtelomeres and in proximity to transposable elements. Recently lost genes were enriched in virulence factors and secondary metabolite gene clusters. In contrast, recently gained genes encoded mostly secreted protein lacking a conserved domain. We analyzed the frequency spectrum at loci segregating a gene presence-absence polymorphism in four worldwide populations. Recent gene losses showed a significant excess in low-frequency variants compared with genome-wide single nucleotide polymorphism, which is indicative of strong negative selection against gene losses. Recent gene gains were either under weak negative selection or neutral. We found evidence for strong divergent selection among populations at individual loci segregating a gene presence-absence polymorphism. Hence, gene gains and losses likely contributed to local adaptation. Our study shows that microbial eukaryotes harbor extensive copy number variation within populations and that functional differences among recently gained and lost genes led to distinct evolutionary trajectories. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Influence of Solar Radiation and Biotic Interactions on Bacterial and Eukaryotic Communities Associated with Sewage Decomposition in Ambient Water - Poster

    Science.gov (United States)

    Sewage and ambient water both consist of a highly complex array of bacteria and eukaryotic microbes. When these communities are mixed, the persistence of sewage-derived pathogens in environmental waters can represent a significant public health concern. Solar radiation and biotic...

  14. Type VI secretion system MIX-effectors carry both antibacterial and anti-eukaryotic activities.

    Science.gov (United States)

    Ray, Ann; Schwartz, Nika; de Souza Santos, Marcela; Zhang, Junmei; Orth, Kim; Salomon, Dor

    2017-11-01

    Most type VI secretion systems (T6SSs) described to date are protein delivery apparatuses that mediate bactericidal activities. Several T6SSs were also reported to mediate virulence activities, although only few anti-eukaryotic effectors have been described. Here, we identify three T6SSs in the marine bacterium Vibrio proteolyticus and show that T6SS1 mediates bactericidal activities under warm marine-like conditions. Using comparative proteomics, we find nine potential T6SS1 effectors, five of which belong to the polymorphic MIX-effector class. Remarkably, in addition to six predicted bactericidal effectors, the T6SS1 secretome includes three putative anti-eukaryotic effectors. One of these is a MIX-effector containing a cytotoxic necrotizing factor 1 domain. We demonstrate that T6SS1 can use this MIX-effector to target phagocytic cells, resulting in morphological changes and actin cytoskeleton rearrangements. In conclusion, the V. proteolyticus T6SS1, a system homologous to one found in pathogenic vibrios, uses a suite of polymorphic effectors that target both bacteria and eukaryotic neighbors. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  15. Threats and opportunities of plant pathogenic bacteria.

    Science.gov (United States)

    Tarkowski, Petr; Vereecke, Danny

    2014-01-01

    Plant pathogenic bacteria can have devastating effects on plant productivity and yield. Nevertheless, because these often soil-dwelling bacteria have evolved to interact with eukaryotes, they generally exhibit a strong adaptivity, a versatile metabolism, and ingenious mechanisms tailored to modify the development of their hosts. Consequently, besides being a threat for agricultural practices, phytopathogens may also represent opportunities for plant production or be useful for specific biotechnological applications. Here, we illustrate this idea by reviewing the pathogenic strategies and the (potential) uses of five very different (hemi)biotrophic plant pathogenic bacteria: Agrobacterium tumefaciens, A. rhizogenes, Rhodococcus fascians, scab-inducing Streptomyces spp., and Pseudomonas syringae. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Meiosis and Haploid Gametes in the Pathogen Trypanosoma brucei

    OpenAIRE

    Peacock, Lori; Bailey, Mick; Carrington, Mark; Gibson, Wendy

    2014-01-01

    Summary In eukaryote pathogens, sex is an important driving force in spreading genes for drug resistance, pathogenicity, and virulence [1]. For the parasitic trypanosomes that cause African sleeping sickness, mating occurs during transmission by the tsetse vector [2, 3] and involves meiosis [4], but haploid gametes have not yet been identified. Here, we show that meiosis is a normal part of development in the insect salivary glands for all subspecies of Trypanosoma brucei, including the human...

  17. Characterization of an eukaryotic peptide deformylase from Plasmodium falciparum.

    Science.gov (United States)

    Bracchi-Ricard, V; Nguyen, K T; Zhou, Y; Rajagopalan, P T; Chakrabarti, D; Pei, D

    2001-12-15

    Ribosomal protein synthesis in eubacteria and eukaryotic organelles initiates with an N-formylmethionyl-tRNA(i), resulting in N-terminal formylation of all nascent polypeptides. Peptide deformylase (PDF) catalyzes the subsequent removal of the N-terminal formyl group from the majority of bacterial proteins. Until recently, PDF has been thought as an enzyme unique to the bacterial kingdom. Searches of the genomic DNA databases identified several genes that encode proteins of high sequence homology to bacterial PDF from eukaryotic organisms. The cDNA encoding Plasmodium falciparum PDF (PfPDF) has been cloned and overexpressed in Escherichia coli. The recombinant protein is catalytically active in deformylating N-formylated peptides, shares many of the properties of bacterial PDF, and is inhibited by specific PDF inhibitors. Western blot analysis indicated expression of mature PfPDF in trophozoite, schizont, and segmenter stages of intraerythrocytic development. These results provide strong evidence that a functional PDF is present in P. falciparum. In addition, PDF inhibitors inhibited the growth of P. falciparum in the intraerythrocytic culture. (c)2001 Elsevier Science.

  18. Assets of the non-pathogenic microorganism Dictyostelium discoideum as a model for the study of eukaryotic extracellular vesicles [v1; ref status: indexed, http://f1000r.es/pa

    Directory of Open Access Journals (Sweden)

    Irène Tatischeff

    2013-03-01

    Full Text Available Dictyostelium discoideum microvesicles have recently been presented as a valuable model for eukaryotic extracellular vesicles. Here, the advantages of D. discoideum for unraveling important biological functions of extracellular vesicles in general are detailed. D. discoideum, a non-pathogenic eukaryotic microorganism, belongs to a billion-year-old Amoeboza lineage, which diverged from the animal-fungal lineage after the plant animal-split. During growth and early starvation-induced development, it presents analogies with lymphocytes and macrophages with regard to motility and phagocytosis capability, respectively. Its 6-chromosome genome codes for about 12,500 genes, some showing analogies with human genes. The presence of extracellular vesicles during cell growth has been evidenced as a detoxification mechanism of various structurally unrelated drugs. Controls led to the discovery of constitutive extracellular vesicle secretion in this microorganism, which was an important point. It means that the secretion of extracellular vesicles occurs, in the absence of any drug, during both cell growth and early development. This constitutive secretion of D. discoideum cells is very likely to play a role in intercellular communication. The detoxifying secreted vesicles, which can transport drugs outside the cells, can also act as "Trojan horses", capable of transferring these drugs not only into naïve D. discoideum cells, but into human cells as well. Therefore, these extracellular vesicles were proposed as a new biological drug delivery tool. Moreover, Dictyostelium, chosen by the NIH (USA as a new model organism for biomedical research, has already been used for studying some human diseases. These cells, which are much easier to manipulate than human cells, can be easily designed in simple conditioned medium experiments. Owing to the increasing consensus that extracellular vesicles are probably important mediators of intercellular communication, D

  19. An emerging cyberinfrastructure for biodefense pathogen and pathogen-host data.

    Science.gov (United States)

    Zhang, C; Crasta, O; Cammer, S; Will, R; Kenyon, R; Sullivan, D; Yu, Q; Sun, W; Jha, R; Liu, D; Xue, T; Zhang, Y; Moore, M; McGarvey, P; Huang, H; Chen, Y; Zhang, J; Mazumder, R; Wu, C; Sobral, B

    2008-01-01

    The NIAID-funded Biodefense Proteomics Resource Center (RC) provides storage, dissemination, visualization and analysis capabilities for the experimental data deposited by seven Proteomics Research Centers (PRCs). The data and its publication is to support researchers working to discover candidates for the next generation of vaccines, therapeutics and diagnostics against NIAID's Category A, B and C priority pathogens. The data includes transcriptional profiles, protein profiles, protein structural data and host-pathogen protein interactions, in the context of the pathogen life cycle in vivo and in vitro. The database has stored and supported host or pathogen data derived from Bacillus, Brucella, Cryptosporidium, Salmonella, SARS, Toxoplasma, Vibrio and Yersinia, human tissue libraries, and mouse macrophages. These publicly available data cover diverse data types such as mass spectrometry, yeast two-hybrid (Y2H), gene expression profiles, X-ray and NMR determined protein structures and protein expression clones. The growing database covers over 23 000 unique genes/proteins from different experiments and organisms. All of the genes/proteins are annotated and integrated across experiments using UniProt Knowledgebase (UniProtKB) accession numbers. The web-interface for the database enables searching, querying and downloading at the level of experiment, group and individual gene(s)/protein(s) via UniProtKB accession numbers or protein function keywords. The system is accessible at http://www.proteomicsresource.org/.

  20. International Society of Human and Animal Mycology (ISHAM)-ITS reference DNA barcoding database--the quality controlled standard tool for routine identification of human and animal pathogenic fungi.

    Science.gov (United States)

    Irinyi, Laszlo; Serena, Carolina; Garcia-Hermoso, Dea; Arabatzis, Michael; Desnos-Ollivier, Marie; Vu, Duong; Cardinali, Gianluigi; Arthur, Ian; Normand, Anne-Cécile; Giraldo, Alejandra; da Cunha, Keith Cassia; Sandoval-Denis, Marcelo; Hendrickx, Marijke; Nishikaku, Angela Satie; de Azevedo Melo, Analy Salles; Merseguel, Karina Bellinghausen; Khan, Aziza; Parente Rocha, Juliana Alves; Sampaio, Paula; da Silva Briones, Marcelo Ribeiro; e Ferreira, Renata Carmona; de Medeiros Muniz, Mauro; Castañón-Olivares, Laura Rosio; Estrada-Barcenas, Daniel; Cassagne, Carole; Mary, Charles; Duan, Shu Yao; Kong, Fanrong; Sun, Annie Ying; Zeng, Xianyu; Zhao, Zuotao; Gantois, Nausicaa; Botterel, Françoise; Robbertse, Barbara; Schoch, Conrad; Gams, Walter; Ellis, David; Halliday, Catriona; Chen, Sharon; Sorrell, Tania C; Piarroux, Renaud; Colombo, Arnaldo L; Pais, Célia; de Hoog, Sybren; Zancopé-Oliveira, Rosely Maria; Taylor, Maria Lucia; Toriello, Conchita; de Almeida Soares, Célia Maria; Delhaes, Laurence; Stubbe, Dirk; Dromer, Françoise; Ranque, Stéphane; Guarro, Josep; Cano-Lira, Jose F; Robert, Vincent; Velegraki, Aristea; Meyer, Wieland

    2015-05-01

    Human and animal fungal pathogens are a growing threat worldwide leading to emerging infections and creating new risks for established ones. There is a growing need for a rapid and accurate identification of pathogens to enable early diagnosis and targeted antifungal therapy. Morphological and biochemical identification methods are time-consuming and require trained experts. Alternatively, molecular methods, such as DNA barcoding, a powerful and easy tool for rapid monophasic identification, offer a practical approach for species identification and less demanding in terms of taxonomical expertise. However, its wide-spread use is still limited by a lack of quality-controlled reference databases and the evolving recognition and definition of new fungal species/complexes. An international consortium of medical mycology laboratories was formed aiming to establish a quality controlled ITS database under the umbrella of the ISHAM working group on "DNA barcoding of human and animal pathogenic fungi." A new database, containing 2800 ITS sequences representing 421 fungal species, providing the medical community with a freely accessible tool at http://www.isham.org/ and http://its.mycologylab.org/ to rapidly and reliably identify most agents of mycoses, was established. The generated sequences included in the new database were used to evaluate the variation and overall utility of the ITS region for the identification of pathogenic fungi at intra-and interspecies level. The average intraspecies variation ranged from 0 to 2.25%. This highlighted selected pathogenic fungal species, such as the dermatophytes and emerging yeast, for which additional molecular methods/genetic markers are required for their reliable identification from clinical and veterinary specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Distribution and Diversity of Microbial Eukaryotes in Bathypelagic Waters of the South China Sea.

    Science.gov (United States)

    Xu, Dapeng; Jiao, Nianzhi; Ren, Rui; Warren, Alan

    2017-05-01

    Little is known about the biodiversity of microbial eukaryotes in the South China Sea, especially in waters at bathyal depths. Here, we employed SSU rDNA gene sequencing to reveal the diversity and community structure across depth and distance gradients in the South China Sea. Vertically, the highest alpha diversity was found at 75-m depth. The communities of microbial eukaryotes were clustered into shallow-, middle-, and deep-water groups according to the depth from which they were collected, indicating a depth-related diversity and distribution pattern. Rhizaria sequences dominated the microeukaryote community and occurred in all samples except those from less than 50-m deep, being most abundant near the sea floor where they contributed ca. 64-97% and 40-74% of the total sequences and OTUs recovered, respectively. A large portion of rhizarian OTUs has neither a nearest named neighbor nor a nearest neighbor in the GenBank database which indicated the presence of new phylotypes in the South China Sea. Given their overwhelming abundance and richness, further phylogenetic analysis of rhizarians were performed and three new genetic clusters were revealed containing sequences retrieved from the deep waters of the South China Sea. Our results shed light on the diversity and community structure of microbial eukaryotes in this not yet fully explored area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  2. Leucine-Rich repeat receptor kinases are sporadically distributed in eukaryotic genomes

    Directory of Open Access Journals (Sweden)

    Diévart Anne

    2011-12-01

    Full Text Available Abstract Background Plant leucine-rich repeat receptor-like kinases (LRR-RLKs are receptor kinases that contain LRRs in their extracellular domain. In the last 15 years, many research groups have demonstrated major roles played by LRR-RLKs in plants during almost all developmental processes throughout the life of the plant and in defense/resistance against a large range of pathogens. Recently, a breakthrough has been made in this field that challenges the dogma of the specificity of plant LRR-RLKs. Results We analyzed ~1000 complete genomes and show that LRR-RK genes have now been identified in 8 non-plant genomes. We performed an exhaustive phylogenetic analysis of all of these receptors, revealing that all of the LRR-containing receptor subfamilies form lineage-specific clades. Our results suggest that the association of LRRs with RKs appeared independently at least four times in eukaryotic evolutionary history. Moreover, the molecular evolutionary history of the LRR-RKs found in oomycetes is reminiscent of the pattern observed in plants: expansion with amplification/deletion and evolution of the domain organization leading to the functional diversification of members of the gene family. Finally, the expression data suggest that oomycete LRR-RKs may play a role in several stages of the oomycete life cycle. Conclusions In view of the key roles that LRR-RLKs play throughout the entire lifetime of plants and plant-environment interactions, the emergence and expansion of this type of receptor in several phyla along the evolution of eukaryotes, and particularly in oomycete genomes, questions their intrinsic functions in mimicry and/or in the coevolution of receptors between hosts and pathogens.

  3. Raft-like membrane domains in pathogenic microorganisms.

    Science.gov (United States)

    Farnoud, Amir M; Toledo, Alvaro M; Konopka, James B; Del Poeta, Maurizio; London, Erwin

    2015-01-01

    The lipid bilayer of the plasma membrane is thought to be compartmentalized by the presence of lipid-protein microdomains. In eukaryotic cells, microdomains composed of sterols and sphingolipids, commonly known as lipid rafts, are believed to exist, and reports on the presence of sterol- or protein-mediated microdomains in bacterial cell membranes are also appearing. Despite increasing attention, little is known about microdomains in the plasma membrane of pathogenic microorganisms. This review attempts to provide an overview of the current state of knowledge of lipid rafts in pathogenic fungi and bacteria. The current literature on characterization of microdomains in pathogens is reviewed, and their potential role in growth, pathogenesis, and drug resistance is discussed. Better insight into the structure and function of membrane microdomains in pathogenic microorganisms might lead to a better understanding of their pathogenesis and development of raft-mediated approaches for therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Improving ITS sequence data for identification of plant pathogenic fungi

    Science.gov (United States)

    R. Henrik Nilsson; Kevin D. Hyde; Julia Pawłowska; Martin Ryberg; Leho Tedersoo; Anders Bjørnsgard Aas; Siti A. Alias; Artur Alves; Cajsa Lisa Anderson; Alexandre Antonelli; A. Elizabeth Arnold; Barbara Bahnmann; Mohammad Bahram; Johan Bengtsson-Palme; Anna Berlin; Sara Branco; Putarak Chomnunti; Asha Dissanayake; Rein Drenkhan; Hanna Friberg; Tobias Guldberg Frøslev; Bettina Halwachs; Martin Hartmann; Beatrice Henricot; Ruvishika Jayawardena; Ari Jumpponen; Håvard Kauserud; Sonja Koskela; Tomasz Kulik; Kare Liimatainen; Björn D. Lindahl; Daniel Lindner; Jian-Kui Liu; Sajeewa Maharachchikumbura; Dimuthu Manamgoda; Svante Martinsson; Maria Alice Neves; Tuula Niskanen; Stephan Nylinder; Olinto Liparini Pereira; Danilo Batista Pinho; Teresita M. Porter; Valentin Queloz; Taavi Riit; Marisol Sánchez-García; Filipe de Sousa; Emil Stefańczyk; Mariusz Tadych; Susumu Takamatsu; Qing Tian; Dhanushka Udayanga; Martin Unterseher; Zheng Wang; Saowanee Wikee; Jiye Yan; Ellen Larsson; Karl-Henrik Larsson; Urmas Kõljalg; Kessy Abarenkov

    2014-01-01

    Plant pathogenic fungi are a large and diverse assemblage of eukaryotes with substantial impacts on natural ecosystems and human endeavours. These taxa often have complex and poorly understood life cycles, lack observable, discriminatory morphological characters, and may not be amenable to in vitro culturing. As a result, species identification is frequently difficult...

  5. Bacteria between protists and phages: from antipredation strategies to the evolution of pathogenicity.

    Science.gov (United States)

    Brüssow, Harald

    2007-08-01

    Bacteriophages and protists are major causes of bacterial mortality. Genomics suggests that phages evolved well before eukaryotic protists. Bacteria were thus initially only confronted with phage predators. When protists evolved, bacteria were caught between two types of predators. One successful antigrazing strategy of bacteria was the elaboration of toxins that would kill the grazer. The released cell content would feed bystander bacteria. I suggest here that, to fight grazing protists, bacteria teamed up with those phage predators that concluded at least a temporary truce with them in the form of lysogeny. Lysogeny was perhaps initially a resource management strategy of phages that could not maintain infection chains. Subsequently, lysogeny might have evolved into a bacterium-prophage coalition attacking protists, which became a food source for them. When protists evolved into multicellular animals, the lysogenic bacteria tracked their evolving food source. This hypothesis could explain why a frequent scheme of bacterial pathogenicity is the survival in phagocytes, why a significant fraction of bacterial pathogens have prophage-encoded virulence genes, and why some virulence factors of animal pathogens are active against unicellular eukaryotes. Bacterial pathogenicity might thus be one playing option of the stone-scissor-paper game played between phages-bacteria-protists, with humans getting into the crossfire.

  6. Distinct gene number-genome size relationships for eukaryotes and non-eukaryotes: gene content estimation for dinoflagellate genomes.

    Directory of Open Access Journals (Sweden)

    Yubo Hou

    Full Text Available The ability to predict gene content is highly desirable for characterization of not-yet sequenced genomes like those of dinoflagellates. Using data from completely sequenced and annotated genomes from phylogenetically diverse lineages, we investigated the relationship between gene content and genome size using regression analyses. Distinct relationships between log(10-transformed protein-coding gene number (Y' versus log(10-transformed genome size (X', genome size in kbp were found for eukaryotes and non-eukaryotes. Eukaryotes best fit a logarithmic model, Y' = ln(-46.200+22.678X', whereas non-eukaryotes a linear model, Y' = 0.045+0.977X', both with high significance (p0.91. Total gene number shows similar trends in both groups to their respective protein coding regressions. The distinct correlations reflect lower and decreasing gene-coding percentages as genome size increases in eukaryotes (82%-1% compared to higher and relatively stable percentages in prokaryotes and viruses (97%-47%. The eukaryotic regression models project that the smallest dinoflagellate genome (3x10(6 kbp contains 38,188 protein-coding (40,086 total genes and the largest (245x10(6 kbp 87,688 protein-coding (92,013 total genes, corresponding to 1.8% and 0.05% gene-coding percentages. These estimates do not likely represent extraordinarily high functional diversity of the encoded proteome but rather highly redundant genomes as evidenced by high gene copy numbers documented for various dinoflagellate species.

  7. Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

    Science.gov (United States)

    Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas

    2015-01-01

    During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

  8. PHI-base: a new interface and further additions for the multi-species pathogen–host interactions database

    Science.gov (United States)

    Urban, Martin; Cuzick, Alayne; Rutherford, Kim; Irvine, Alistair; Pedro, Helder; Pant, Rashmi; Sadanadan, Vidyendra; Khamari, Lokanath; Billal, Santoshkumar; Mohanty, Sagar; Hammond-Kosack, Kim E.

    2017-01-01

    The pathogen–host interactions database (PHI-base) is available at www.phi-base.org. PHI-base contains expertly curated molecular and biological information on genes proven to affect the outcome of pathogen–host interactions reported in peer reviewed research articles. In addition, literature that indicates specific gene alterations that did not affect the disease interaction phenotype are curated to provide complete datasets for comparative purposes. Viruses are not included. Here we describe a revised PHI-base Version 4 data platform with improved search, filtering and extended data display functions. A PHIB-BLAST search function is provided and a link to PHI-Canto, a tool for authors to directly curate their own published data into PHI-base. The new release of PHI-base Version 4.2 (October 2016) has an increased data content containing information from 2219 manually curated references. The data provide information on 4460 genes from 264 pathogens tested on 176 hosts in 8046 interactions. Prokaryotic and eukaryotic pathogens are represented in almost equal numbers. Host species belong ∼70% to plants and 30% to other species of medical and/or environmental importance. Additional data types included into PHI-base 4 are the direct targets of pathogen effector proteins in experimental and natural host organisms. The curation problems encountered and the future directions of the PHI-base project are briefly discussed. PMID:27915230

  9. Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria

    OpenAIRE

    Denoncourt, Alix M.; Paquet, Valérie E.; Charette, Steve J.

    2014-01-01

    Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging...

  10. How natural a kind is "eukaryote?".

    Science.gov (United States)

    Doolittle, W Ford

    2014-06-02

    Systematics balances uneasily between realism and nominalism, uncommitted as to whether biological taxa are discoveries or inventions. If the former, they might be taken as natural kinds. I briefly review some philosophers' concepts of natural kinds and then argue that several of these apply well enough to "eukaryote." Although there are some sticky issues around genomic chimerism and when eukaryotes first appeared, if we allow for degrees in the naturalness of kinds, existing eukaryotes rank highly, higher than prokaryotes. Most biologists feel this intuitively: All I attempt to do here is provide some conceptual justification. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  11. Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Lykidis, Athanasios

    2006-12-01

    Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymes and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.

  12. Patterns of prokaryotic lateral gene transfers affecting parasitic microbial eukaryotes

    DEFF Research Database (Denmark)

    Alsmark, Cecilia; Foster, Peter G; Sicheritz-Pontén, Thomas

    2013-01-01

    BACKGROUND: The influence of lateral gene transfer on gene origins and biology in eukaryotes is poorly understood compared with those of prokaryotes. A number of independent investigations focusing on specific genes, individual genomes, or specific functional categories from various eukaryotes have...... approach to systematically investigate lateral gene transfer affecting the proteomes of thirteen, mainly parasitic, microbial eukaryotes, representing four of the six eukaryotic super-groups. All of the genomes investigated have been significantly affected by prokaryote-to-eukaryote lateral gene transfers...... indicated that lateral gene transfer does indeed affect eukaryotic genomes. However, the lack of common methodology and criteria in these studies makes it difficult to assess the general importance and influence of lateral gene transfer on eukaryotic genome evolution. RESULTS: We used a phylogenomic...

  13. Requirements and standards for organelle genome databases

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2006-01-09

    Mitochondria and plastids (collectively called organelles)descended from prokaryotes that adopted an intracellular, endosymbioticlifestyle within early eukaryotes. Comparisons of their remnant genomesaddress a wide variety of biological questions, especially when includingthe genomes of their prokaryotic relatives and the many genes transferredto the eukaryotic nucleus during the transitions from endosymbiont toorganelle. The pace of producing complete organellar genome sequences nowmakes it unfeasible to do broad comparisons using the primary literatureand, even if it were feasible, it is now becoming uncommon for journalsto accept detailed descriptions of genome-level features. Unfortunatelyno database is currently useful for this task, since they have littlestandardization and are riddled with error. Here I outline what iscurrently wrong and what must be done to make this data useful to thescientific community.

  14. Morphological and ecological complexity in early eukaryotic ecosystems.

    Science.gov (United States)

    Javaux, E J; Knoll, A H; Walter, M R

    2001-07-05

    Molecular phylogeny and biogeochemistry indicate that eukaryotes differentiated early in Earth history. Sequence comparisons of small-subunit ribosomal RNA genes suggest a deep evolutionary divergence of Eukarya and Archaea; C27-C29 steranes (derived from sterols synthesized by eukaryotes) and strong depletion of 13C (a biogeochemical signature of methanogenic Archaea) in 2,700 Myr old kerogens independently place a minimum age on this split. Steranes, large spheroidal microfossils, and rare macrofossils of possible eukaryotic origin occur in Palaeoproterozoic rocks. Until now, however, evidence for morphological and taxonomic diversification within the domain has generally been restricted to very late Mesoproterozoic and Neoproterozoic successions. Here we show that the cytoskeletal and ecological prerequisites for eukaryotic diversification were already established in eukaryotic microorganisms fossilized nearly 1,500 Myr ago in shales of the early Mesoproterozoic Roper Group in northern Australia.

  15. MSDB: A Comprehensive Database of Simple Sequence Repeats.

    Science.gov (United States)

    Avvaru, Akshay Kumar; Saxena, Saketh; Sowpati, Divya Tej; Mishra, Rakesh Kumar

    2017-06-01

    Microsatellites, also known as Simple Sequence Repeats (SSRs), are short tandem repeats of 1-6 nt motifs present in all genomes, particularly eukaryotes. Besides their usefulness as genome markers, SSRs have been shown to perform important regulatory functions, and variations in their length at coding regions are linked to several disorders in humans. Microsatellites show a taxon-specific enrichment in eukaryotic genomes, and some may be functional. MSDB (Microsatellite Database) is a collection of >650 million SSRs from 6,893 species including Bacteria, Archaea, Fungi, Plants, and Animals. This database is by far the most exhaustive resource to access and analyze SSR data of multiple species. In addition to exploring data in a customizable tabular format, users can view and compare the data of multiple species simultaneously using our interactive plotting system. MSDB is developed using the Django framework and MySQL. It is freely available at http://tdb.ccmb.res.in/msdb. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Targeting of the hydrophobic metabolome by pathogens.

    Science.gov (United States)

    Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F

    2015-05-01

    The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Atypical mitochondrial inheritance patterns in eukaryotes.

    Science.gov (United States)

    Breton, Sophie; Stewart, Donald T

    2015-10-01

    Mitochondrial DNA (mtDNA) is predominantly maternally inherited in eukaryotes. Diverse molecular mechanisms underlying the phenomenon of strict maternal inheritance (SMI) of mtDNA have been described, but the evolutionary forces responsible for its predominance in eukaryotes remain to be elucidated. Exceptions to SMI have been reported in diverse eukaryotic taxa, leading to the prediction that several distinct molecular mechanisms controlling mtDNA transmission are present among the eukaryotes. We propose that these mechanisms will be better understood by studying the deviations from the predominating pattern of SMI. This minireview summarizes studies on eukaryote species with unusual or rare mitochondrial inheritance patterns, i.e., other than the predominant SMI pattern, such as maternal inheritance of stable heteroplasmy, paternal leakage of mtDNA, biparental and strictly paternal inheritance, and doubly uniparental inheritance of mtDNA. The potential genes and mechanisms involved in controlling mitochondrial inheritance in these organisms are discussed. The linkage between mitochondrial inheritance and sex determination is also discussed, given that the atypical systems of mtDNA inheritance examined in this minireview are frequently found in organisms with uncommon sexual systems such as gynodioecy, monoecy, or andromonoecy. The potential of deviations from SMI for facilitating a better understanding of a number of fundamental questions in biology, such as the evolution of mtDNA inheritance, the coevolution of nuclear and mitochondrial genomes, and, perhaps, the role of mitochondria in sex determination, is considerable.

  18. Targeting eukaryotic Rab proteins: a smart strategy for chlamydial survival and replication.

    Science.gov (United States)

    Damiani, María Teresa; Gambarte Tudela, Julián; Capmany, Anahí

    2014-09-01

    Chlamydia, an obligate intracellular bacterium which passes its entire lifecycle within a membrane-bound vacuole called the inclusion, has evolved a variety of unique strategies to establish an advantageous intracellular niche for survival. This review highlights the mechanisms by which Chlamydia subverts vesicular transport in host cells, particularly by hijacking the master controllers of eukaryotic trafficking, the Rab proteins. A subset of Rabs and Rab interacting proteins that control the recycling pathway or the biosynthetic route are selectively recruited to the chlamydial inclusion membrane. By interfering with Rab-controlled transport steps, this intracellular pathogen not only prevents its own degradation in the phagocytic pathway, but also creates a favourable intracellular environment for growth and replication. Chlamydia, a highly adapted and successful intracellular pathogen, has several redundant strategies to re-direct vesicles emerging from biosynthetic compartments that carry host molecules essential for bacterial development. Although current knowledge is limited, the latest findings have shed light on the role of Rab proteins in the course of chlamydial infections and could open novel opportunities for anti-chlamydial therapy. © 2014 John Wiley & Sons Ltd.

  19. Eukaryotic cell encystation and cancer cell dormancy: is a greater devil veiled in the details of a lesser evil?

    Science.gov (United States)

    Baig, Abdul Mannan; Khan, Naveed Ahmed; Abbas, Farhat

    2015-03-01

    Cancer cell dormancy is the main cause of cancer recurrence and failure of therapy as dormant cells evade not only the anticancer drugs but also the host immune system. These dormant cells veil themselves from detection by imaging and/or using biomarkers, which imposes an additional problem in targeting such cells. A similar form of hibernation process known as encystation is studied in detail for pathogenic unicellular eukaryotic microorganisms. By examination using microarray gene expression profiles, immunocytochemistry tools, and siRNAs during the process of encystation, understanding the covert features of cancer cell dormancy as proposed could be possible. This knowledge can be extended to dormant cancer cells to uncover the mechanisms that underlie this ghost, yet dangerous state of human cancers. We propose a strategy to induce dormancy and exit this state by application of knowledge gained from the encystation induction and retrieval processes in pathogenic eukaryotic microorganisms. Given that early detection and characterization of dormant malignant tumor cells is important as a general strategy to monitor and prevent the development of overt metastatic disease, this homology may enable the design of therapies that could either awake the dormant cell from dormancy to make it available for therapies or prolong such a phase to make cancer appear as a chronic disease.

  20. Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.

    Science.gov (United States)

    Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique

    2015-06-01

    Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Unicellular eukaryotes as models in cell and molecular biology: critical appraisal of their past and future value.

    Science.gov (United States)

    Simon, Martin; Plattner, Helmut

    2014-01-01

    Unicellular eukaryotes have been appreciated as model systems for the analysis of crucial questions in cell and molecular biology. This includes Dictyostelium (chemotaxis, amoeboid movement, phagocytosis), Tetrahymena (telomere structure, telomerase function), Paramecium (variant surface antigens, exocytosis, phagocytosis cycle) or both ciliates (ciliary beat regulation, surface pattern formation), Chlamydomonas (flagellar biogenesis and beat), and yeast (S. cerevisiae) for innumerable aspects. Nowadays many problems may be tackled with "higher" eukaryotic/metazoan cells for which full genomic information as well as domain databases, etc., were available long before protozoa. Established molecular tools, commercial antibodies, and established pharmacology are additional advantages available for higher eukaryotic cells. Moreover, an increasing number of inherited genetic disturbances in humans have become elucidated and can serve as new models. Among lower eukaryotes, yeast will remain a standard model because of its peculiarities, including its reduced genome and availability in the haploid form. But do protists still have a future as models? This touches not only the basic understanding of biology but also practical aspects of research, such as fund raising. As we try to scrutinize, due to specific advantages some protozoa should and will remain favorable models for analyzing novel genes or specific aspects of cell structure and function. Outstanding examples are epigenetic phenomena-a field of rising interest. © 2014 Elsevier Inc. All rights reserved.

  2. Eukaryotes first: how could that be?

    Science.gov (United States)

    Mariscal, Carlos; Doolittle, W Ford

    2015-09-26

    In the half century since the formulation of the prokaryote : eukaryote dichotomy, many authors have proposed that the former evolved from something resembling the latter, in defiance of common (and possibly common sense) views. In such 'eukaryotes first' (EF) scenarios, the last universal common ancestor is imagined to have possessed significantly many of the complex characteristics of contemporary eukaryotes, as relics of an earlier 'progenotic' period or RNA world. Bacteria and Archaea thus must have lost these complex features secondarily, through 'streamlining'. If the canonical three-domain tree in which Archaea and Eukarya are sisters is accepted, EF entails that Bacteria and Archaea are convergently prokaryotic. We ask what this means and how it might be tested. © 2015 The Author(s).

  3. The Genome of Naegleria gruberi Illuminates Early Eukaryotic Versatility

    Energy Technology Data Exchange (ETDEWEB)

    Fritz-Laylin, Lillian K.; Prochnik, Simon E.; Ginger, Michael L.; Dacks, Joel; Carpenter, Meredith L.; Field, Mark C.; Kuo, Alan; Paredez, Alex; Chapman, Jarrod; Pham, Jonathan; Shu, Shengqiang; Neupane, Rochak; Cipriano, Michael; Mancuso, Joel; Tu, Hank; Salamov, Asaf; Lindquist, Erika; Shapiro, Harris; Lucas, Susan; Grigoriev, Igor V.; Cande, W. Zacheus; Fulton, Chandler; Rokhsar, Daniel S.; Dawson, Scott C.

    2010-03-01

    Genome sequences of diverse free-living protists are essential for understanding eukaryotic evolution and molecular and cell biology. The free-living amoeboflagellate Naegleria gruberi belongs to a varied and ubiquitous protist clade (Heterolobosea) that diverged from other eukaryotic lineages over a billion years ago. Analysis of the 15,727 protein-coding genes encoded by Naegleria's 41 Mb nuclear genome indicates a capacity for both aerobic respiration and anaerobic metabolism with concomitant hydrogen production, with fundamental implications for the evolution of organelle metabolism. The Naegleria genome facilitates substantially broader phylogenomic comparisons of free-living eukaryotes than previously possible, allowing us to identify thousands of genes likely present in the pan-eukaryotic ancestor, with 40% likely eukaryotic inventions. Moreover, we construct a comprehensive catalog of amoeboid-motility genes. The Naegleria genome, analyzed in the context of other protists, reveals a remarkably complex ancestral eukaryote with a rich repertoire of cytoskeletal, sexual, signaling, and metabolic modules.

  4. The origin of the eukaryotic cell

    Science.gov (United States)

    Hartman, H.

    1984-01-01

    The endosymbiotic hypothesis for the origin of the eukaryotic cell has been applied to the origin of the mitochondria and chloroplasts. However as has been pointed out by Mereschowsky in 1905, it should also be applied to the nucleus as well. If the nucleus, mitochondria and chloroplasts are endosymbionts, then it is likely that the organism that did the engulfing was not a DNA-based organism. In fact, it is useful to postulate that this organism was a primitive RNA-based organism. This hypothesis would explain the preponderance of RNA viruses found in eukaryotic cells. The centriole and basal body do not have a double membrane or DNA. Like all MTOCs (microtubule organising centres), they have a structural or morphic RNA implicated in their formation. This would argue for their origin in the early RNA-based organism rather than in an endosymbiotic event involving bacteria. Finally, the eukaryotic cell uses RNA in ways quite unlike bacteria, thus pointing to a greater emphasis of RNA in both control and structure in the cell. The origin of the eukaryotic cell may tell us why it rather than its prokaryotic relative evolved into the metazoans who are reading this paper.

  5. Molecular characterization of an adaptive response to alkylating agents in the opportunistic pathogen Aspergillus fumigatus.

    Science.gov (United States)

    O'Hanlon, Karen A; Margison, Geoffrey P; Hatch, Amy; Fitzpatrick, David A; Owens, Rebecca A; Doyle, Sean; Jones, Gary W

    2012-09-01

    An adaptive response to alkylating agents based upon the conformational change of a methylphosphotriester (MPT) DNA repair protein to a transcriptional activator has been demonstrated in a number of bacterial species, but this mechanism appears largely absent from eukaryotes. Here, we demonstrate that the human pathogen Aspergillus fumigatus elicits an adaptive response to sub-lethal doses of the mono-functional alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). We have identified genes that encode MPT and O(6)-alkylguanine DNA alkyltransferase (AGT) DNA repair proteins; deletions of either of these genes abolish the adaptive response and sensitize the organism to MNNG. In vitro DNA repair assays confirm the ability of MPT and AGT to repair methylphosphotriester and O(6)-methylguanine lesions respectively. In eukaryotes, the MPT protein is confined to a select group of fungal species, some of which are major mammalian and plant pathogens. The evolutionary origin of the adaptive response is bacterial and rooted within the Firmicutes phylum. Inter-kingdom horizontal gene transfer between Firmicutes and Ascomycete ancestors introduced the adaptive response into the Fungal kingdom. Our data constitute the first detailed characterization of the molecular mechanism of the adaptive response in a lower eukaryote and has applications for development of novel fungal therapeutics targeting this DNA repair system.

  6. Molecular characterization of an adaptive response to alkylating agents in the opportunistic pathogen Aspergillus fumigatus

    Science.gov (United States)

    O’Hanlon, Karen A.; Margison, Geoffrey P.; Hatch, Amy; Fitzpatrick, David A.; Owens, Rebecca A.; Doyle, Sean; Jones, Gary W.

    2012-01-01

    An adaptive response to alkylating agents based upon the conformational change of a methylphosphotriester (MPT) DNA repair protein to a transcriptional activator has been demonstrated in a number of bacterial species, but this mechanism appears largely absent from eukaryotes. Here, we demonstrate that the human pathogen Aspergillus fumigatus elicits an adaptive response to sub-lethal doses of the mono-functional alkylating agent N-methyl-N′-nitro-N-nitrosoguanidine (MNNG). We have identified genes that encode MPT and O6-alkylguanine DNA alkyltransferase (AGT) DNA repair proteins; deletions of either of these genes abolish the adaptive response and sensitize the organism to MNNG. In vitro DNA repair assays confirm the ability of MPT and AGT to repair methylphosphotriester and O6-methylguanine lesions respectively. In eukaryotes, the MPT protein is confined to a select group of fungal species, some of which are major mammalian and plant pathogens. The evolutionary origin of the adaptive response is bacterial and rooted within the Firmicutes phylum. Inter-kingdom horizontal gene transfer between Firmicutes and Ascomycete ancestors introduced the adaptive response into the Fungal kingdom. Our data constitute the first detailed characterization of the molecular mechanism of the adaptive response in a lower eukaryote and has applications for development of novel fungal therapeutics targeting this DNA repair system. PMID:22669901

  7. Single Cell Genomics and Transcriptomics for Unicellular Eukaryotes

    Energy Technology Data Exchange (ETDEWEB)

    Ciobanu, Doina; Clum, Alicia; Singh, Vasanth; Salamov, Asaf; Han, James; Copeland, Alex; Grigoriev, Igor; James, Timothy; Singer, Steven; Woyke, Tanja; Malmstrom, Rex; Cheng, Jan-Fang

    2014-03-14

    Despite their small size, unicellular eukaryotes have complex genomes with a high degree of plasticity that allow them to adapt quickly to environmental changes. Unicellular eukaryotes live with prokaryotes and higher eukaryotes, frequently in symbiotic or parasitic niches. To this day their contribution to the dynamics of the environmental communities remains to be understood. Unfortunately, the vast majority of eukaryotic microorganisms are either uncultured or unculturable, making genome sequencing impossible using traditional approaches. We have developed an approach to isolate unicellular eukaryotes of interest from environmental samples, and to sequence and analyze their genomes and transcriptomes. We have tested our methods with six species: an uncharacterized protist from cellulose-enriched compost identified as Platyophrya, a close relative of P. vorax; the fungus Metschnikowia bicuspidate, a parasite of water flea Daphnia; the mycoparasitic fungi Piptocephalis cylindrospora, a parasite of Cokeromyces and Mucor; Caulochytrium protosteloides, a parasite of Sordaria; Rozella allomycis, a parasite of the water mold Allomyces; and the microalgae Chlamydomonas reinhardtii. Here, we present the four components of our approach: pre-sequencing methods, sequence analysis for single cell genome assembly, sequence analysis of single cell transcriptomes, and genome annotation. This technology has the potential to uncover the complexity of single cell eukaryotes and their role in the environmental samples.

  8. Purification and proteomics of pathogen-modified vacuoles and membranes

    Directory of Open Access Journals (Sweden)

    Jo-Ana eHerweg

    2015-06-01

    Full Text Available Certain pathogenic bacteria adopt an intracellular lifestyle and proliferate in eukaryotic host cells. The intracellular niche protects the bacteria from cellular and humoral components of the mammalian immune system, and at the same time, allows the bacteria to gain access to otherwise restricted nutrient sources. Yet, intracellular protection and access to nutrients comes with a price, i.e. the bacteria need to overcome cell-autonomous defense mechanisms, such as the bactericidal endocytic pathway. While a few bacteria rupture the early phagosome and escape into the host cytoplasm, most intracellular pathogens form a distinct, degradation-resistant and replication-permissive membranous compartment. Intracellular bacteria that form unique pathogen vacuoles include Legionella, Mycobacterium, Chlamydia, Simkania and Salmonella species. In order to understand the formation of these pathogen niches on a global scale and in a comprehensive and quantitative manner, an inventory of compartment-associated host factors is required. To this end, the intact pathogen compartments need to be isolated, purified and biochemically characterized. Here, we review recent progress on the isolation and purification of pathogen-modified vacuoles and membranes, as well as their proteomic characterization by mass spectrometry and different validation approaches. These studies provide the basis for further investigations on the specific mechanisms of pathogen-driven compartment formation.

  9. PeroxisomeDB: a database for the peroxisomal proteome, functional genomics and disease

    NARCIS (Netherlands)

    Schlüter, Agatha; Fourcade, Stéphane; Domènech-Estévez, Enric; Gabaldón, Toni; Huerta-Cepas, Jaime; Berthommier, Guillaume; Ripp, Raymond; Wanders, Ronald J. A.; Poch, Olivier; Pujol, Aurora

    2007-01-01

    Peroxisomes are essential organelles of eukaryotic origin, ubiquitously distributed in cells and organisms, playing key roles in lipid and antioxidant metabolism. Loss or malfunction of peroxisomes causes more than 20 fatal inherited conditions. We have created a peroxisomal database

  10. Potential of industrial biotechnology with cyanobacteria and eukaryotic microalgae.

    Science.gov (United States)

    Wijffels, René H; Kruse, Olaf; Hellingwerf, Klaas J

    2013-06-01

    Both cyanobacteria and eukaryotic microalgae are promising organisms for sustainable production of bulk products such as food, feed, materials, chemicals and fuels. In this review we will summarize the potential and current biotechnological developments. Cyanobacteria are promising host organisms for the production of small molecules that can be secreted such as ethanol, butanol, fatty acids and other organic acids. Eukaryotic microalgae are interesting for products for which cellular storage is important such as proteins, lipids, starch and alkanes. For the development of new and promising lines of production, strains of both cyanobacteria and eukaryotic microalgae have to be improved. Transformation systems have been much better developed in cyanobacteria. However, several products would be preferably produced with eukaryotic microalgae. In the case of cyanobacteria a synthetic-systems biology approach has a great potential to exploit cyanobacteria as cell factories. For eukaryotic microalgae transformation systems need to be further developed. A promising strategy is transformation of heterologous (prokaryotic and eukaryotic) genes in established eukaryotic hosts such as Chlamydomonas reinhardtii. Experimental outdoor pilots under containment for the production of genetically modified cyanobacteria and microalgae are in progress. For full scale production risks of release of genetically modified organisms need to be assessed. Copyright © 2013. Published by Elsevier Ltd.

  11. Origins and evolution of viruses of eukaryotes: The ultimate modularity

    International Nuclear Information System (INIS)

    Koonin, Eugene V.; Dolja, Valerian V.; Krupovic, Mart

    2015-01-01

    Viruses and other selfish genetic elements are dominant entities in the biosphere, with respect to both physical abundance and genetic diversity. Various selfish elements parasitize on all cellular life forms. The relative abundances of different classes of viruses are dramatically different between prokaryotes and eukaryotes. In prokaryotes, the great majority of viruses possess double-stranded (ds) DNA genomes, with a substantial minority of single-stranded (ss) DNA viruses and only limited presence of RNA viruses. In contrast, in eukaryotes, RNA viruses account for the majority of the virome diversity although ssDNA and dsDNA viruses are common as well. Phylogenomic analysis yields tangible clues for the origins of major classes of eukaryotic viruses and in particular their likely roots in prokaryotes. Specifically, the ancestral genome of positive-strand RNA viruses of eukaryotes might have been assembled de novo from genes derived from prokaryotic retroelements and bacteria although a primordial origin of this class of viruses cannot be ruled out. Different groups of double-stranded RNA viruses derive either from dsRNA bacteriophages or from positive-strand RNA viruses. The eukaryotic ssDNA viruses apparently evolved via a fusion of genes from prokaryotic rolling circle-replicating plasmids and positive-strand RNA viruses. Different families of eukaryotic dsDNA viruses appear to have originated from specific groups of bacteriophages on at least two independent occasions. Polintons, the largest known eukaryotic transposons, predicted to also form virus particles, most likely, were the evolutionary intermediates between bacterial tectiviruses and several groups of eukaryotic dsDNA viruses including the proposed order “Megavirales” that unites diverse families of large and giant viruses. Strikingly, evolution of all classes of eukaryotic viruses appears to have involved fusion between structural and replicative gene modules derived from different sources

  12. Origins and evolution of viruses of eukaryotes: The ultimate modularity

    Energy Technology Data Exchange (ETDEWEB)

    Koonin, Eugene V., E-mail: koonin@ncbi.nlm.nih.gov [National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894 (United States); Dolja, Valerian V., E-mail: doljav@science.oregonstate.edu [Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331 (United States); Krupovic, Mart, E-mail: krupovic@pasteur.fr [Institut Pasteur, Unité Biologie Moléculaire du Gène chez les Extrêmophiles, Department of Microbiology, Paris 75015 (France)

    2015-05-15

    Viruses and other selfish genetic elements are dominant entities in the biosphere, with respect to both physical abundance and genetic diversity. Various selfish elements parasitize on all cellular life forms. The relative abundances of different classes of viruses are dramatically different between prokaryotes and eukaryotes. In prokaryotes, the great majority of viruses possess double-stranded (ds) DNA genomes, with a substantial minority of single-stranded (ss) DNA viruses and only limited presence of RNA viruses. In contrast, in eukaryotes, RNA viruses account for the majority of the virome diversity although ssDNA and dsDNA viruses are common as well. Phylogenomic analysis yields tangible clues for the origins of major classes of eukaryotic viruses and in particular their likely roots in prokaryotes. Specifically, the ancestral genome of positive-strand RNA viruses of eukaryotes might have been assembled de novo from genes derived from prokaryotic retroelements and bacteria although a primordial origin of this class of viruses cannot be ruled out. Different groups of double-stranded RNA viruses derive either from dsRNA bacteriophages or from positive-strand RNA viruses. The eukaryotic ssDNA viruses apparently evolved via a fusion of genes from prokaryotic rolling circle-replicating plasmids and positive-strand RNA viruses. Different families of eukaryotic dsDNA viruses appear to have originated from specific groups of bacteriophages on at least two independent occasions. Polintons, the largest known eukaryotic transposons, predicted to also form virus particles, most likely, were the evolutionary intermediates between bacterial tectiviruses and several groups of eukaryotic dsDNA viruses including the proposed order “Megavirales” that unites diverse families of large and giant viruses. Strikingly, evolution of all classes of eukaryotic viruses appears to have involved fusion between structural and replicative gene modules derived from different sources

  13. Prediction of molecular mimicry candidates in human pathogenic bacteria.

    Science.gov (United States)

    Doxey, Andrew C; McConkey, Brendan J

    2013-08-15

    Molecular mimicry of host proteins is a common strategy adopted by bacterial pathogens to interfere with and exploit host processes. Despite the availability of pathogen genomes, few studies have attempted to predict virulence-associated mimicry relationships directly from genomic sequences. Here, we analyzed the proteomes of 62 pathogenic and 66 non-pathogenic bacterial species, and screened for the top pathogen-specific or pathogen-enriched sequence similarities to human proteins. The screen identified approximately 100 potential mimicry relationships including well-characterized examples among the top-scoring hits (e.g., RalF, internalin, yopH, and others), with about 1/3 of predicted relationships supported by existing literature. Examination of homology to virulence factors, statistically enriched functions, and comparison with literature indicated that the detected mimics target key host structures (e.g., extracellular matrix, ECM) and pathways (e.g., cell adhesion, lipid metabolism, and immune signaling). The top-scoring and most widespread mimicry pattern detected among pathogens consisted of elevated sequence similarities to ECM proteins including collagens and leucine-rich repeat proteins. Unexpectedly, analysis of the pathogen counterparts of these proteins revealed that they have evolved independently in different species of bacterial pathogens from separate repeat amplifications. Thus, our analysis provides evidence for two classes of mimics: complex proteins such as enzymes that have been acquired by eukaryote-to-pathogen horizontal transfer, and simpler repeat proteins that have independently evolved to mimic the host ECM. Ultimately, computational detection of pathogen-specific and pathogen-enriched similarities to host proteins provides insights into potentially novel mimicry-mediated virulence mechanisms of pathogenic bacteria.

  14. Diverse mechanisms of metaeffector activity in an intracellular bacterial pathogen, Legionella pneumophila.

    Science.gov (United States)

    Urbanus, Malene L; Quaile, Andrew T; Stogios, Peter J; Morar, Mariya; Rao, Chitong; Di Leo, Rosa; Evdokimova, Elena; Lam, Mandy; Oatway, Christina; Cuff, Marianne E; Osipiuk, Jerzy; Michalska, Karolina; Nocek, Boguslaw P; Taipale, Mikko; Savchenko, Alexei; Ensminger, Alexander W

    2016-12-16

    Pathogens deliver complex arsenals of translocated effector proteins to host cells during infection, but the extent to which these proteins are regulated once inside the eukaryotic cell remains poorly defined. Among all bacterial pathogens, Legionella pneumophila maintains the largest known set of translocated substrates, delivering over 300 proteins to the host cell via its Type IVB, Icm/Dot translocation system. Backed by a few notable examples of effector-effector regulation in L. pneumophila, we sought to define the extent of this phenomenon through a systematic analysis of effector-effector functional interaction. We used Saccharomyces cerevisiae, an established proxy for the eukaryotic host, to query > 108,000 pairwise genetic interactions between two compatible expression libraries of ~330 L. pneumophila-translocated substrates. While capturing all known examples of effector-effector suppression, we identify fourteen novel translocated substrates that suppress the activity of other bacterial effectors and one pair with synergistic activities. In at least nine instances, this regulation is direct-a hallmark of an emerging class of proteins called metaeffectors, or "effectors of effectors". Through detailed structural and functional analysis, we show that metaeffector activity derives from a diverse range of mechanisms, shapes evolution, and can be used to reveal important aspects of each cognate effector's function. Metaeffectors, along with other, indirect, forms of effector-effector modulation, may be a common feature of many intracellular pathogens-with unrealized potential to inform our understanding of how pathogens regulate their interactions with the host cell. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  15. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  16. Compositional patterns in the genomes of unicellular eukaryotes.

    Science.gov (United States)

    Costantini, Maria; Alvarez-Valin, Fernando; Costantini, Susan; Cammarano, Rosalia; Bernardi, Giorgio

    2013-11-05

    The genomes of multicellular eukaryotes are compartmentalized in mosaics of isochores, large and fairly homogeneous stretches of DNA that belong to a small number of families characterized by different average GC levels, by different gene concentration (that increase with GC), different chromatin structures, different replication timing in the cell cycle, and other different properties. A question raised by these basic results concerns how far back in evolution the compartmentalized organization of the eukaryotic genomes arose. In the present work we approached this problem by studying the compositional organization of the genomes from the unicellular eukaryotes for which full sequences are available, the sample used being representative. The average GC levels of the genomes from unicellular eukaryotes cover an extremely wide range (19%-60% GC) and the compositional patterns of individual genomes are extremely different but all genomes tested show a compositional compartmentalization. The average GC range of the genomes of unicellular eukaryotes is very broad (as broad as that of prokaryotes) and individual compositional patterns cover a very broad range from very narrow to very complex. Both features are not surprising for organisms that are very far from each other both in terms of phylogenetic distances and of environmental life conditions. Most importantly, all genomes tested, a representative sample of all supergroups of unicellular eukaryotes, are compositionally compartmentalized, a major difference with prokaryotes.

  17. Protein prenylation: a new mode of host-pathogen interaction.

    Science.gov (United States)

    Amaya, Moushimi; Baranova, Ancha; van Hoek, Monique L

    2011-12-09

    Post translational modifications are required for proteins to be fully functional. The three step process, prenylation, leads to farnesylation or geranylgeranylation, which increase the hydrophobicity of the prenylated protein for efficient anchoring into plasma membranes and/or organellar membranes. Prenylated proteins function in a number of signaling and regulatory pathways that are responsible for basic cell operations. Well characterized prenylated proteins include Ras, Rac and Rho. Recently, pathogenic prokaryotic proteins, such as SifA and AnkB, have been shown to be prenylated by eukaryotic host cell machinery, but their functions remain elusive. The identification of other bacterial proteins undergoing this type of host-directed post-translational modification shows promise in elucidating host-pathogen interactions to develop new therapeutics. This review incorporates new advances in the study of protein prenylation into a broader aspect of biology with a focus on host-pathogen interaction. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Genome-wide identification and comprehensive analyses of the kinomes in four pathogenic microsporidia species.

    Directory of Open Access Journals (Sweden)

    Zhi Li

    Full Text Available Microsporidia have attracted considerable attention because they infect a wide range of hosts, from invertebrates to vertebrates, and cause serious human diseases and major economic losses in the livestock industry. There are no prospective drugs to counteract this pathogen. Eukaryotic protein kinases (ePKs play a central role in regulating many essential cellular processes and are therefore potential drug targets. In this study, a comprehensive summary and comparative analysis of the protein kinases in four microsporidia—Enterocytozoon bieneusi, Encephalitozoon cuniculi, Nosema bombycis and Nosema ceranae—was performed. The results show that there are 34 ePKs and 4 atypical protein kinases (aPKs in E. bieneusi, 29 ePKs and 6 aPKs in E. cuniculi, 41 ePKs and 5 aPKs in N. bombycis, and 27 ePKs and 4 aPKs in N. ceranae. These data support the previous conclusion that the microsporidian kinome is the smallest eukaryotic kinome. Microsporidian kinomes contain only serine-threonine kinases and do not contain receptor-like and tyrosine kinases. Many of the kinases related to nutrient and energy signaling and the stress response have been lost in microsporidian kinomes. However, cell cycle-, development- and growth-related kinases, which are important to parasites, are well conserved. This reduction of the microsporidian kinome is in good agreement with genome compaction, but kinome density is negatively correlated with proteome size. Furthermore, the protein kinases in each microsporidian genome are under strong purifying selection pressure. No remarkable differences in kinase family classification, domain features, gain and/or loss, and selective pressure were observed in these four species. Although microsporidia adapt to different host types, the coevolution of microsporidia and their hosts was not clearly reflected in the protein kinases. Overall, this study enriches and updates the microsporidian protein kinase database and may provide

  19. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  20. Conservation and Variability of Meiosis Across the Eukaryotes.

    Science.gov (United States)

    Loidl, Josef

    2016-11-23

    Comparisons among a variety of eukaryotes have revealed considerable variability in the structures and processes involved in their meiosis. Nevertheless, conventional forms of meiosis occur in all major groups of eukaryotes, including early-branching protists. This finding confirms that meiosis originated in the common ancestor of all eukaryotes and suggests that primordial meiosis may have had many characteristics in common with conventional extant meiosis. However, it is possible that the synaptonemal complex and the delicate crossover control related to its presence were later acquisitions. Later still, modifications to meiotic processes occurred within different groups of eukaryotes. Better knowledge on the spectrum of derived and uncommon forms of meiosis will improve our understanding of many still mysterious aspects of the meiotic process and help to explain the evolutionary basis of functional adaptations to the meiotic program.

  1. Metatranscriptomics reveals the diversity of genes expressed by eukaryotes in forest soils.

    Directory of Open Access Journals (Sweden)

    Coralie Damon

    Full Text Available Eukaryotic organisms play essential roles in the biology and fertility of soils. For example the micro and mesofauna contribute to the fragmentation and homogenization of plant organic matter, while its hydrolysis is primarily performed by the fungi. To get a global picture of the activities carried out by soil eukaryotes we sequenced 2×10,000 cDNAs synthesized from polyadenylated mRNA directly extracted from soils sampled in beech (Fagus sylvatica and spruce (Picea abies forests. Taxonomic affiliation of both cDNAs and 18S rRNA sequences showed a dominance of sequences from fungi (up to 60% and metazoans while protists represented less than 12% of the 18S rRNA sequences. Sixty percent of cDNA sequences from beech forest soil and 52% from spruce forest soil had no homologs in the GenBank/EMBL/DDJB protein database. A Gene Ontology term was attributed to 39% and 31.5% of the spruce and beech soil sequences respectively. Altogether 2076 sequences were putative homologs to different enzyme classes participating to 129 KEGG pathways among which several were implicated in the utilisation of soil nutrients such as nitrogen (ammonium, amino acids, oligopeptides, sugars, phosphates and sulfate. Specific annotation of plant cell wall degrading enzymes identified enzymes active on major polymers (cellulose, hemicelluloses, pectin, lignin and glycoside hydrolases represented 0.5% (beech soil-0.8% (spruce soil of the cDNAs. Other sequences coding enzymes active on organic matter (extracellular proteases, lipases, a phytase, P450 monooxygenases were identified, thus underlining the biotechnological potential of eukaryotic metatranscriptomes. The phylogenetic affiliation of 12 full-length carbohydrate active enzymes showed that most of them were distantly related to sequences from known fungi. For example, a putative GH45 endocellulase was closely associated to molluscan sequences, while a GH7 cellobiohydrolase was closest to crustacean sequences, thus

  2. Eukaryotic Cell Panorama

    Science.gov (United States)

    Goodsell, David S.

    2011-01-01

    Diverse biological data may be used to create illustrations of molecules in their cellular context. This report describes the scientific results that support an illustration of a eukaryotic cell, enlarged by one million times to show the distribution and arrangement of macromolecules. The panoramic cross section includes eight panels that extend…

  3. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  4. Identification and genetic mapping of highly polymorphic microsatellite loci from an EST database of the septoria tritici blotch pathogen Mycosphaerella graminicola.

    Science.gov (United States)

    Goodwin, Stephen B; van der Lee, Theo A J; Cavaletto, Jessica R; Te Lintel Hekkert, Bas; Crane, Charles F; Kema, Gert H J

    2007-05-01

    A database of 30,137 EST sequences from Mycosphaerella graminicola, the septoria tritici blotch fungus of wheat, was scanned with a custom software pipeline for di- and trinucleotide units repeated tandemly six or more times. The bioinformatics analysis identified 109 putative SSR loci, and for 99 of them, flanking primers were developed successfully and tested for amplification and polymorphism by PCR on five field isolates of diverse origin, including the parents of the standard M. graminicola mapping population. Seventy-seven of the 99 primer pairs generated an easily scored banding pattern and 51 were polymorphic, with up to four alleles per locus, among the isolates tested. Among these 51 loci, 23 were polymorphic between the parents of the mapping population. Twenty-one of these as well as two previously published microsatellite loci were positioned on the existing genetic linkage map of M. graminicola on 13 of the 24 linkage groups. Most (66%) of the primer pairs also amplified bands in the closely related barley pathogen Septoria passerinii, but only six were polymorphic among four isolates tested. A subset of the primer pairs also revealed polymorphisms when tested with DNA from the related banana black leaf streak (Black Sigatoka) pathogen, M. fijiensis. The EST database provided an excellent source of new, highly polymorphic microsatellite markers that can be multiplexed for high-throughput genetic analyses of M. graminicola and related species.

  5. Genome-reconstruction for eukaryotes from complex natural microbial communities.

    Science.gov (United States)

    West, Patrick T; Probst, Alexander J; Grigoriev, Igor V; Thomas, Brian C; Banfield, Jillian F

    2018-04-01

    Microbial eukaryotes are integral components of natural microbial communities, and their inclusion is critical for many ecosystem studies, yet the majority of published metagenome analyses ignore eukaryotes. In order to include eukaryotes in environmental studies, we propose a method to recover eukaryotic genomes from complex metagenomic samples. A key step for genome recovery is separation of eukaryotic and prokaryotic fragments. We developed a k -mer-based strategy, EukRep, for eukaryotic sequence identification and applied it to environmental samples to show that it enables genome recovery, genome completeness evaluation, and prediction of metabolic potential. We used this approach to test the effect of addition of organic carbon on a geyser-associated microbial community and detected a substantial change of the community metabolism, with selection against almost all candidate phyla bacteria and archaea and for eukaryotes. Near complete genomes were reconstructed for three fungi placed within the Eurotiomycetes and an arthropod. While carbon fixation and sulfur oxidation were important functions in the geyser community prior to carbon addition, the organic carbon-impacted community showed enrichment for secreted proteases, secreted lipases, cellulose targeting CAZymes, and methanol oxidation. We demonstrate the broader utility of EukRep by reconstructing and evaluating relatively high-quality fungal, protist, and rotifer genomes from complex environmental samples. This approach opens the way for cultivation-independent analyses of whole microbial communities. © 2018 West et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Genome-wide analysis of eukaryote thaumatin-like proteins (TLPs with an emphasis on poplar

    Directory of Open Access Journals (Sweden)

    Duplessis Sébastien

    2011-02-01

    Full Text Available Abstract Background Plant inducible immunity includes the accumulation of a set of defense proteins during infection called pathogenesis-related (PR proteins, which are grouped into families termed PR-1 to PR-17. The PR-5 family is composed of thaumatin-like proteins (TLPs, which are responsive to biotic and abiotic stress and are widely studied in plants. TLPs were also recently discovered in fungi and animals. In the poplar genome, TLPs are over-represented compared with annual species and their transcripts strongly accumulate during stress conditions. Results Our analysis of the poplar TLP family suggests that the expansion of this gene family was followed by diversification, as differences in expression patterns and predicted properties correlate with phylogeny. In particular, we identified a clade of poplar TLPs that cluster to a single 350 kb locus of chromosome I and that are up-regulated by poplar leaf rust infection. A wider phylogenetic analysis of eukaryote TLPs - including plant, animal and fungi sequences - shows that TLP gene content and diversity increased markedly during land plant evolution. Mapping the reported functions of characterized TLPs to the eukaryote phylogenetic tree showed that antifungal or glycan-lytic properties are widespread across eukaryote phylogeny, suggesting that these properties are shared by most TLPs and are likely associated with the presence of a conserved acidic cleft in their 3D structure. Also, we established an exhaustive catalog of TLPs with atypical architectures such as small-TLPs, TLP-kinases and small-TLP-kinases, which have potentially developed alternative functions (such as putative receptor kinases for pathogen sensing and signaling. Conclusion Our study, based on the most recent plant genome sequences, provides evidence for TLP gene family diversification during land plant evolution. We have shown that the diverse functions described for TLPs are not restricted to specific clades but seem

  7. On the Diversification of the Translation Apparatus across Eukaryotes

    Directory of Open Access Journals (Sweden)

    Greco Hernández

    2012-01-01

    Full Text Available Diversity is one of the most remarkable features of living organisms. Current assessments of eukaryote biodiversity reaches 1.5 million species, but the true figure could be several times that number. Diversity is ingrained in all stages and echelons of life, namely, the occupancy of ecological niches, behavioral patterns, body plans and organismal complexity, as well as metabolic needs and genetics. In this review, we will discuss that diversity also exists in a key biochemical process, translation, across eukaryotes. Translation is a fundamental process for all forms of life, and the basic components and mechanisms of translation in eukaryotes have been largely established upon the study of traditional, so-called model organisms. By using modern genome-wide, high-throughput technologies, recent studies of many nonmodel eukaryotes have unveiled a surprising diversity in the configuration of the translation apparatus across eukaryotes, showing that this apparatus is far from being evolutionarily static. For some of the components of this machinery, functional differences between different species have also been found. The recent research reviewed in this article highlights the molecular and functional diversification the translational machinery has undergone during eukaryotic evolution. A better understanding of all aspects of organismal diversity is key to a more profound knowledge of life.

  8. An Evolutionary Framework for Understanding the Origin of Eukaryotes

    Directory of Open Access Journals (Sweden)

    Neil W. Blackstone

    2016-04-01

    Full Text Available Two major obstacles hinder the application of evolutionary theory to the origin of eukaryotes. The first is more apparent than real—the endosymbiosis that led to the mitochondrion is often described as “non-Darwinian” because it deviates from the incremental evolution championed by the modern synthesis. Nevertheless, endosymbiosis can be accommodated by a multi-level generalization of evolutionary theory, which Darwin himself pioneered. The second obstacle is more serious—all of the major features of eukaryotes were likely present in the last eukaryotic common ancestor thus rendering comparative methods ineffective. In addition to a multi-level theory, the development of rigorous, sequence-based phylogenetic and comparative methods represents the greatest achievement of modern evolutionary theory. Nevertheless, the rapid evolution of major features in the eukaryotic stem group requires the consideration of an alternative framework. Such a framework, based on the contingent nature of these evolutionary events, is developed and illustrated with three examples: the putative intron proliferation leading to the nucleus and the cell cycle; conflict and cooperation in the origin of eukaryotic bioenergetics; and the inter-relationship between aerobic metabolism, sterol synthesis, membranes, and sex. The modern synthesis thus provides sufficient scope to develop an evolutionary framework to understand the origin of eukaryotes.

  9. Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.

    Science.gov (United States)

    Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel

    2011-09-01

    The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.

  10. SinEx DB: a database for single exon coding sequences in mammalian genomes.

    Science.gov (United States)

    Jorquera, Roddy; Ortiz, Rodrigo; Ossandon, F; Cárdenas, Juan Pablo; Sepúlveda, Rene; González, Carolina; Holmes, David S

    2016-01-01

    Eukaryotic genes are typically interrupted by intragenic, noncoding sequences termed introns. However, some genes lack introns in their coding sequence (CDS) and are generally known as 'single exon genes' (SEGs). In this work, a SEG is defined as a nuclear, protein-coding gene that lacks introns in its CDS. Whereas, many public databases of Eukaryotic multi-exon genes are available, there are only two specialized databases for SEGs. The present work addresses the need for a more extensive and diverse database by creating SinEx DB, a publicly available, searchable database of predicted SEGs from 10 completely sequenced mammalian genomes including human. SinEx DB houses the DNA and protein sequence information of these SEGs and includes their functional predictions (KOG) and the relative distribution of these functions within species. The information is stored in a relational database built with My SQL Server 5.1.33 and the complete dataset of SEG sequences and their functional predictions are available for downloading. SinEx DB can be interrogated by: (i) a browsable phylogenetic schema, (ii) carrying out BLAST searches to the in-house SinEx DB of SEGs and (iii) via an advanced search mode in which the database can be searched by key words and any combination of searches by species and predicted functions. SinEx DB provides a rich source of information for advancing our understanding of the evolution and function of SEGs.Database URL: www.sinex.cl. © The Author(s) 2016. Published by Oxford University Press.

  11. [MiRNA system in unicellular eukaryotes and its evolutionary implications].

    Science.gov (United States)

    Zhang, Yan-Qiong; Wen, Jian-Fan

    2010-02-01

    microRNAs (miRNAs) in higher multicellular eukaryotes have been extensively studied in recent years. Great progresses have also been achieved for miRNAs in unicellular eukaryotes. All these studies not only enrich our knowledge about the complex expression regulation system in diverse organisms, but also have evolutionary significance for understanding the origin of this system. In this review, Authors summarize the recent advance in the studies of miRNA in unicellular eukaryotes, including that on the most primitive unicellular eukaryote--Giardia. The origin and evolution of miRNA system is also discussed.

  12. RNase MRP and the RNA processing cascade in the eukaryotic ancestor.

    Science.gov (United States)

    Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J

    2007-02-08

    Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches.

  13. Eukaryotic cell flattening

    Science.gov (United States)

    Bae, Albert; Westendorf, Christian; Erlenkamper, Christoph; Galland, Edouard; Franck, Carl; Bodenschatz, Eberhard; Beta, Carsten

    2010-03-01

    Eukaryotic cell flattening is valuable for improving microscopic observations, ranging from bright field to total internal reflection fluorescence microscopy. In this talk, we will discuss traditional overlay techniques, and more modern, microfluidic based flattening, which provides a greater level of control. We demonstrate these techniques on the social amoebae Dictyostelium discoideum, comparing the advantages and disadvantages of each method.

  14. Autophagy in unicellular eukaryotes

    NARCIS (Netherlands)

    Kiel, J.A.K.W.

    2010-01-01

    Cells need a constant supply of precursors to enable the production of macromolecules to sustain growth and survival. Unlike metazoans, unicellular eukaryotes depend exclusively on the extracellular medium for this supply. When environmental nutrients become depleted, existing cytoplasmic components

  15. Nitrate storage and dissimilatory nitrate reduction by eukaryotic microbes

    DEFF Research Database (Denmark)

    Kamp, Anja; Høgslund, Signe; Risgaard-Petersen, Nils

    2015-01-01

    The microbial nitrogen cycle is one of the most complex and environmentally important element cycles on Earth and has long been thought to be mediated exclusively by prokaryotic microbes. Rather recently, it was discovered that certain eukaryotic microbes are able to store nitrate intracellularly......, suggesting that eukaryotes may rival prokaryotes in terms of dissimilatory nitrate reduction. Finally, this review article sketches some evolutionary perspectives of eukaryotic nitrate metabolism and identifies open questions that need to be addressed in future investigations....... and use it for dissimilatory nitrate reduction in the absence of oxygen. The paradigm shift that this entailed is ecologically significant because the eukaryotes in question comprise global players like diatoms, foraminifers, and fungi. This review article provides an unprecedented overview of nitrate...

  16. Comparative Genomics of Eukaryotes.

    NARCIS (Netherlands)

    Noort, V. van

    2007-01-01

    This thesis focuses on developing comparative genomics methods in eukaryotes, with an emphasis on applications for gene function prediction and regulatory element detection. In the past, methods have been developed to predict functional associations between gene pairs in prokaryotes. The challenge

  17. Current Perspectives of Telomerase Structure and Function in Eukaryotes with Emerging Views on Telomerase in Human Parasites.

    Science.gov (United States)

    Dey, Abhishek; Chakrabarti, Kausik

    2018-01-24

    Replicative capacity of a cell is strongly correlated with telomere length regulation. Aberrant lengthening or reduction in the length of telomeres can lead to health anomalies, such as cancer or premature aging. Telomerase is a master regulator for maintaining replicative potential in most eukaryotic cells. It does so by controlling telomere length at chromosome ends. Akin to cancer cells, most single-cell eukaryotic pathogens are highly proliferative and require persistent telomerase activity to maintain constant length of telomere and propagation within their host. Although telomerase is key to unlimited cellular proliferation in both cases, not much was known about the role of telomerase in human parasites (malaria, Trypanosoma , etc.) until recently. Since telomerase regulation is mediated via its own structural components, interactions with catalytic reverse transcriptase and several factors that can recruit and assemble telomerase to telomeres in a cell cycle-dependent manner, we compare and discuss here recent findings in telomerase biology in cancer, aging and parasitic diseases to give a broader perspective of telomerase function in human diseases.

  18. Do the Microbiota Influence Vaccines and Protective Immunity to Pathogens? Issues of Sovereignty, Federalism, and Points-Testing in the Prokaryotic and Eukaryotic Spaces of the Host-Microbial Superorganism.

    Science.gov (United States)

    Macpherson, Andrew J

    2018-02-01

    In contrast to live attenuated vaccines, which are designed to induce immunity through a time-limited bloom in systemic tissues, the microbiota is a persistent feature of body surfaces, especially the intestine. The immune responses to the microbiota are idiosyncratic depending on the niche intimacy of different taxa and generally adapt the host to avoid overgrowth and maintain mutualism rather than to eliminate the organisms of that taxon. Both the microbiota and the host have so much molecular cross talk controlling each other, that the prokaryotic and the eukaryotic spaces of the host-microbial superorganism are federal rather than sovereign. This molecular cross talk is vital for the immune system to develop its mature form. Nevertheless, the microbiota/host biomass spaces are rather well separated: The microbiota also limits colonization and penetration of pathogens through intense metabolic competition. Immune responses to those members of the microbiota mutually adapted to intimate association at mucosal surfaces have attractive potential durability, but for clinical use as persistent vehicles they would require personalization and engineered reversibility to manage the immune context and complications in individual human subjects. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  19. AUG is the only initiation codon in eukaryotes

    Energy Technology Data Exchange (ETDEWEB)

    Sherman, F; McKnight, G; Stewart, J W

    1980-01-01

    An analysis of mutants of the yeast Saccharomyces cerevisiae indicates that AUG is the sole codon capable of initiating translation of iso-1-cytochrome c. This result with yeast and the sequence results of numerous eukaryotic genes indicate that AUG is the only initiation codon in eukaryotes; in contrast, results with Escherichia colia and bacteriophages indicate that both AUG and GUG are initiation codons in prokaryotes. The difference can be explained by the lack of the t/sup 6/ A hypermodified nucleoside (N-(9-(..beta..-D-ribofuranosyl)purin-6-ylcarbamoyl)threonine) in prokaryotic initiator tRNA and its presence in eukaryotic initiator tRNA.

  20. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  1. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

  2. Anaerobic energy metabolism in unicellular photosynthetic eukaryotes.

    Science.gov (United States)

    Atteia, Ariane; van Lis, Robert; Tielens, Aloysius G M; Martin, William F

    2013-02-01

    Anaerobic metabolic pathways allow unicellular organisms to tolerate or colonize anoxic environments. Over the past ten years, genome sequencing projects have brought a new light on the extent of anaerobic metabolism in eukaryotes. A surprising development has been that free-living unicellular algae capable of photoautotrophic lifestyle are, in terms of their enzymatic repertoire, among the best equipped eukaryotes known when it comes to anaerobic energy metabolism. Some of these algae are marine organisms, common in the oceans, others are more typically soil inhabitants. All these species are important from the ecological (O(2)/CO(2) budget), biotechnological, and evolutionary perspectives. In the unicellular algae surveyed here, mixed-acid type fermentations are widespread while anaerobic respiration, which is more typical of eukaryotic heterotrophs, appears to be rare. The presence of a core anaerobic metabolism among the algae provides insights into its evolutionary origin, which traces to the eukaryote common ancestor. The predicted fermentative enzymes often exhibit an amino acid extension at the N-terminus, suggesting that these proteins might be compartmentalized in the cell, likely in the chloroplast or the mitochondrion. The green algae Chlamydomonas reinhardtii and Chlorella NC64 have the most extended set of fermentative enzymes reported so far. Among the eukaryotes with secondary plastids, the diatom Thalassiosira pseudonana has the most pronounced anaerobic capabilities as yet. From the standpoints of genomic, transcriptomic, and biochemical studies, anaerobic energy metabolism in C. reinhardtii remains the best characterized among photosynthetic protists. This article is part of a Special Issue entitled: The evolutionary aspects of bioenergetic systems. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. The ARTT motif and a unified structural understanding of substraterecognition in ADP ribosylating bacterial toxins and eukaryotic ADPribosyltransferases

    Energy Technology Data Exchange (ETDEWEB)

    Han, S.; Tainer, J.A.

    2001-08-01

    ADP-ribosylation is a widely occurring and biologically critical covalent chemical modification process in pathogenic mechanisms, intracellular signaling systems, DNA repair, and cell division. The reaction is catalyzed by ADP-ribosyltransferases, which transfer the ADP-ribose moiety of NAD to a target protein with nicotinamide release. A family of bacterial toxins and eukaryotic enzymes has been termed the mono-ADP-ribosyltransferases, in distinction to the poly-ADP-ribosyltransferases, which catalyze the addition of multiple ADP-ribose groups to the carboxyl terminus of eukaryotic nucleoproteins. Despite the limited primary sequence homology among the different ADP-ribosyltransferases, a central cleft bearing NAD-binding pocket formed by the two perpendicular b-sheet core has been remarkably conserved between bacterial toxins and eukaryotic mono- and poly-ADP-ribosyltransferases. The majority of bacterial toxins and eukaryotic mono-ADP-ribosyltransferases are characterized by conserved His and catalytic Glu residues. In contrast, Diphtheria toxin, Pseudomonas exotoxin A, and eukaryotic poly-ADP-ribosyltransferases are characterized by conserved Arg and catalytic Glu residues. The NAD-binding core of a binary toxin and a C3-like toxin family identified an ARTT motif (ADP-ribosylating turn-turn motif) that is implicated in substrate specificity and recognition by structural and mutagenic studies. Here we apply structure-based sequence alignment and comparative structural analyses of all known structures of ADP-ribosyltransfeases to suggest that this ARTT motif is functionally important in many ADP-ribosylating enzymes that bear a NAD binding cleft as characterized by conserved Arg and catalytic Glu residues. Overall, structure-based sequence analysis reveals common core structures and conserved active sites of ADP-ribosyltransferases to support similar NAD binding mechanisms but differing mechanisms of target protein binding via sequence variations within the ARTT

  4. In vitro studies of Rickettsia-host cell interactions: Confocal laser scanning microscopy of Rickettsia helvetica-infected eukaryotic cell lines.

    Science.gov (United States)

    Speck, Stephanie; Kern, Tanja; Aistleitner, Karin; Dilcher, Meik; Dobler, Gerhard; Essbauer, Sandra

    2018-02-01

    Rickettsia (R.) helvetica is the most prevalent rickettsia found in Ixodes ricinus ticks in Germany. Several studies reported antibodies against R. helvetica up to 12.5% in humans investigated, however, fulminant clinical cases are rare indicating a rather low pathogenicity compared to other rickettsiae. We investigated growth characteristics of R. helvetica isolate AS819 in two different eukaryotic cell lines with focus on ultra-structural changes of host cells during infection determined by confocal laser scanning microscopy. Further investigations included partially sequencing of rickA, sca4 and sca2 genes, which have been reported to encode proteins involved in cell-to-cell spread and virulence in some rickettsiae. R. helvetica grew constantly but slowly in both cell lines used. Confocal laser scanning microscopy revealed that the dissemination of R. helvetica AS819 in both cell lines was rather mediated by cell break-down and bacterial release than cell-to-cell spread. The cytoskeleton of both investigated eukaryotic cell lines was not altered. R. helvetica possesses rickA, but its expression is not sufficient to promote actin-based motility as demonstrated by confocal laser scanning microscopy. Hypothetical Sca2 and Sca4 proteins were deduced from nucleotide gene sequences but the predicted amino acid sequences were disrupted or truncated compared to other rickettsiae most likely resulting in non-functional proteins. Taken together, these results might give a first hint to the underlying causes of the reduced virulence and pathogenicity of R. helvetica.

  5. David and Goliath: chemical perturbation of eukaryotes by bacteria.

    Science.gov (United States)

    Ho, Louis K; Nodwell, Justin R

    2016-03-01

    Environmental microbes produce biologically active small molecules that have been mined extensively as antibiotics and a smaller number of drugs that act on eukaryotic cells. It is known that there are additional bioactives to be discovered from this source. While the discovery of new antibiotics is challenged by the frequent discovery of known compounds, we contend that the eukaryote-active compounds may be less saturated. Indeed, despite there being far fewer eukaryotic-active natural products these molecules interact with a far richer diversity of molecular and cellular targets.

  6. Reproduction, symbiosis, and the eukaryotic cell

    Science.gov (United States)

    Godfrey-Smith, Peter

    2015-01-01

    This paper develops a conceptual framework for addressing questions about reproduction, individuality, and the units of selection in symbiotic associations, with special attention to the origin of the eukaryotic cell. Three kinds of reproduction are distinguished, and a possible evolutionary sequence giving rise to a mitochondrion-containing eukaryotic cell from an endosymbiotic partnership is analyzed as a series of transitions between each of the three forms of reproduction. The sequence of changes seen in this “egalitarian” evolutionary transition is compared with those that apply in “fraternal” transitions, such as the evolution of multicellularity in animals. PMID:26286983

  7. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-06-01

    Full Text Available Abstract Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group.

  8. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  9. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  10. Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.

    Science.gov (United States)

    Ireton, Keith

    2013-07-17

    Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.

  11. Arsenic and Antimony Transporters in Eukaryotes

    Directory of Open Access Journals (Sweden)

    Ewa Maciaszczyk-Dziubinska

    2012-03-01

    Full Text Available Arsenic and antimony are toxic metalloids, naturally present in the environment and all organisms have developed pathways for their detoxification. The most effective metalloid tolerance systems in eukaryotes include downregulation of metalloid uptake, efflux out of the cell, and complexation with phytochelatin or glutathione followed by sequestration into the vacuole. Understanding of arsenic and antimony transport system is of high importance due to the increasing usage of arsenic-based drugs in the treatment of certain types of cancer and diseases caused by protozoan parasites as well as for the development of bio- and phytoremediation strategies for metalloid polluted areas. However, in contrast to prokaryotes, the knowledge about specific transporters of arsenic and antimony and the mechanisms of metalloid transport in eukaryotes has been very limited for a long time. Here, we review the recent advances in understanding of arsenic and antimony transport pathways in eukaryotes, including a dual role of aquaglyceroporins in uptake and efflux of metalloids, elucidation of arsenic transport mechanism by the yeast Acr3 transporter and its role in arsenic hyperaccumulation in ferns, identification of vacuolar transporters of arsenic-phytochelatin complexes in plants and forms of arsenic substrates recognized by mammalian ABC transporters.

  12. Arsenic and Antimony Transporters in Eukaryotes

    Science.gov (United States)

    Maciaszczyk-Dziubinska, Ewa; Wawrzycka, Donata; Wysocki, Robert

    2012-01-01

    Arsenic and antimony are toxic metalloids, naturally present in the environment and all organisms have developed pathways for their detoxification. The most effective metalloid tolerance systems in eukaryotes include downregulation of metalloid uptake, efflux out of the cell, and complexation with phytochelatin or glutathione followed by sequestration into the vacuole. Understanding of arsenic and antimony transport system is of high importance due to the increasing usage of arsenic-based drugs in the treatment of certain types of cancer and diseases caused by protozoan parasites as well as for the development of bio- and phytoremediation strategies for metalloid polluted areas. However, in contrast to prokaryotes, the knowledge about specific transporters of arsenic and antimony and the mechanisms of metalloid transport in eukaryotes has been very limited for a long time. Here, we review the recent advances in understanding of arsenic and antimony transport pathways in eukaryotes, including a dual role of aquaglyceroporins in uptake and efflux of metalloids, elucidation of arsenic transport mechanism by the yeast Acr3 transporter and its role in arsenic hyperaccumulation in ferns, identification of vacuolar transporters of arsenic-phytochelatin complexes in plants and forms of arsenic substrates recognized by mammalian ABC transporters. PMID:22489166

  13. dbSWEET: An Integrated Resource for SWEET Superfamily to Understand, Analyze and Predict the Function of Sugar Transporters in Prokaryotes and Eukaryotes.

    Science.gov (United States)

    Gupta, Ankita; Sankararamakrishnan, Ramasubbu

    2018-04-14

    SWEET (Sweet Will Eventually be Exported Transporter) proteins have been recently discovered and form one of the three major families of sugar transporters. Homologs of SWEET are found in both prokaryotes and eukaryotes. Bacterial SWEET homologs have three transmembrane segments forming a triple-helical bundle (THB) and the functional form is dimers. Eukaryotic SWEETs have seven transmembrane helical segments forming two THBs with a linker helix. Members of SWEET homologs have been shown to be involved in several important physiological processes in plants. However, not much is known regarding the biological significance of SWEET homologs in prokaryotes and in mammals. We have collected more than 2000 SWEET homologs from both prokaryotes and eukaryotes. For each homolog, we have modeled three different conformational states representing outward open, inward open and occluded states. We have provided details regarding substrate-interacting residues and residues forming the selectivity filter for each SWEET homolog. Several search and analysis options are available. The users can generate a phylogenetic tree and structure-based sequence alignment for selected set of sequences. With no metazoan SWEETs functionally characterized, the features observed in the selectivity filter residues can be used to predict the potential substrates that are likely to be transported across the metazoan SWEETs. We believe that this database will help the researchers to design mutational experiments and simulation studies that will aid to advance our understanding of the physiological role of SWEET homologs. This database is freely available to the scientific community at http://bioinfo.iitk.ac.in/bioinfo/dbSWEET/Home. Copyright © 2018. Published by Elsevier Ltd.

  14. Synthesis of eukaryotic lipid biomarkers in the bacterial domain

    Science.gov (United States)

    Welander, P. V.; Banta, A. B.; Lee, A. K.; Wei, J. H.

    2017-12-01

    Lipid biomarkers are organic molecules preserved in sediments and sedimentary rocks that can function as geological proxies for certain microbial taxa or for specific environmental conditions. These molecular fossils provide a link between organisms and their environments in both modern and ancient settings and have afforded significant insight into ancient climatic events, mass extinctions, and various evolutionary transitions throughout Earth's history. However, the proper interpretation of lipid biomarkers is dependent on a broad understanding of their diagenetic precursors in modern systems. This includes understanding the taphonomic transformations that these molecules undergo, their biosynthetic pathways, and the ecological conditions that affect their cellular production. In this study, we focus on one group of lipid biomarkers - the sterols. These are polycyclic isoprenoidal lipids that have a high preservation potential and play a critical role in the physiology of most eukaryotes. However, the synthesis and function of these lipids in the bacterial domain has not been fully explored. Here we utilize a combination of bioinformatics, microbial genetics, and biochemistry to demonstrate that bacterial sterol producers are more prevalent in environmental metagenomic samples than in the genomic databases of cultured organisms and to identify novel proteins required to synthesize and modify sterols in bacteria. These proteins represent a distinct pathway for sterol synthesis exclusive to bacteria and indicate that sterol synthesis in bacteria may have evolved independently of eukaryotic sterol biosynthesis. Taken together, these results demonstrate how studies in extant bacteria can provide insight into the biological sources and the biosynthetic pathways of specific lipid biomarkers and in turn may allow for more robust interpretation of biomarker signatures.

  15. A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions

    Science.gov (United States)

    Khalil, Ahmad S.; Lu, Timothy K.; Bashor, Caleb J.; Ramirez, Cherie L.; Pyenson, Nora C.; Joung, J. Keith; Collins, James J.

    2013-01-01

    SUMMARY Eukaryotic transcription factors (TFs) perform complex and combinatorial functions within transcriptional networks. Here, we present a synthetic framework for systematically constructing eukaryotic transcription functions using artificial zinc fingers, modular DNA-binding domains found within many eukaryotic TFs. Utilizing this platform, we construct a library of orthogonal synthetic transcription factors (sTFs) and use these to wire synthetic transcriptional circuits in yeast. We engineer complex functions, such as tunable output strength and transcriptional cooperativity, by rationally adjusting a decomposed set of key component properties, e.g., DNA specificity, affinity, promoter design, protein-protein interactions. We show that subtle perturbations to these properties can transform an individual sTF between distinct roles (activator, cooperative factor, inhibitory factor) within a transcriptional complex, thus drastically altering the signal processing behavior of multi-input systems. This platform provides new genetic components for synthetic biology and enables bottom-up approaches to understanding the design principles of eukaryotic transcriptional complexes and networks. PMID:22863014

  16. Disease induction by human microbial pathogens in plant-model systems: potential, problems and prospects.

    Science.gov (United States)

    van Baarlen, Peter; van Belkum, Alex; Thomma, Bart P H J

    2007-02-01

    Relatively simple eukaryotic model organisms such as the genetic model weed plant Arabidopsis thaliana possess an innate immune system that shares important similarities with its mammalian counterpart. In fact, some human pathogens infect Arabidopsis and cause overt disease with human symptomology. In such cases, decisive elements of the plant's immune system are likely to be targeted by the same microbial factors that are necessary for causing disease in humans. These similarities can be exploited to identify elementary microbial pathogenicity factors and their corresponding targets in a green host. This circumvents important cost aspects that often frustrate studies in humans or animal models and, in addition, results in facile ethical clearance.

  17. HIV-1 Replication and the Cellular Eukaryotic Translation Apparatus

    Directory of Open Access Journals (Sweden)

    Santiago Guerrero

    2015-01-01

    Full Text Available Eukaryotic translation is a complex process composed of three main steps: initiation, elongation, and termination. During infections by RNA- and DNA-viruses, the eukaryotic translation machinery is used to assure optimal viral protein synthesis. Human immunodeficiency virus type I (HIV-1 uses several non-canonical pathways to translate its own proteins, such as leaky scanning, frameshifting, shunt, and cap-independent mechanisms. Moreover, HIV-1 modulates the host translation machinery by targeting key translation factors and overcomes different cellular obstacles that affect protein translation. In this review, we describe how HIV-1 proteins target several components of the eukaryotic translation machinery, which consequently improves viral translation and replication.

  18. Archaeal “Dark Matter” and the Origin of Eukaryotes

    Science.gov (United States)

    Williams, Tom A.; Embley, T. Martin

    2014-01-01

    Current hypotheses about the history of cellular life are mainly based on analyses of cultivated organisms, but these represent only a small fraction of extant biodiversity. The sequencing of new environmental lineages therefore provides an opportunity to test, revise, or reject existing ideas about the tree of life and the origin of eukaryotes. According to the textbook three domains hypothesis, the eukaryotes emerge as the sister group to a monophyletic Archaea. However, recent analyses incorporating better phylogenetic models and an improved sampling of the archaeal domain have generally supported the competing eocyte hypothesis, in which core genes of eukaryotic cells originated from within the Archaea, with important implications for eukaryogenesis. Given this trend, it was surprising that a recent analysis incorporating new genomes from uncultivated Archaea recovered a strongly supported three domains tree. Here, we show that this result was due in part to the use of a poorly fitting phylogenetic model and also to the inclusion by an automated pipeline of genes of putative bacterial origin rather than nucleocytosolic versions for some of the eukaryotes analyzed. When these issues were resolved, analyses including the new archaeal lineages placed core eukaryotic genes within the Archaea. These results are consistent with a number of recent studies in which improved archaeal sampling and better phylogenetic models agree in supporting the eocyte tree over the three domains hypothesis. PMID:24532674

  19. Plant Responses to Pathogen Attack: Small RNAs in Focus.

    Science.gov (United States)

    Islam, Waqar; Noman, Ali; Qasim, Muhammad; Wang, Liande

    2018-02-08

    Small RNAs (sRNA) are a significant group of gene expression regulators for multiple biological processes in eukaryotes. In plants, many sRNA silencing pathways produce extensive array of sRNAs with specialized roles. The evidence on record advocates for the functions of sRNAs during plant microbe interactions. Host sRNAs are reckoned as mandatory elements of plant defense. sRNAs involved in plant defense processes via different pathways include both short interfering RNA (siRNA) and microRNA (miRNA) that actively regulate immunity in response to pathogenic attack via tackling pathogen-associated molecular patterns (PAMPs) and other effectors. In response to pathogen attack, plants protect themselves with the help of sRNA-dependent immune systems. That sRNA-mediated plant defense responses play a role during infections is an established fact. However, the regulations of several sRNAs still need extensive research. In this review, we discussed the topical advancements and findings relevant to pathogen attack and plant defense mediated by sRNAs. We attempted to point out diverse sRNAs as key defenders in plant systems. It is hoped that sRNAs would be exploited as a mainstream player to achieve food security by tackling different plant diseases.

  20. DNA mismatch repair and its many roles in eukaryotic cells

    DEFF Research Database (Denmark)

    Liu, Dekang; Keijzers, Guido; Rasmussen, Lene Juel

    2017-01-01

    in the clinic, and as a biomarker of cancer susceptibility in animal model systems. Prokaryotic MMR is well-characterized at the molecular and mechanistic level; however, MMR is considerably more complex in eukaryotic cells than in prokaryotic cells, and in recent years, it has become evident that MMR plays...... novel roles in eukaryotic cells, several of which are not yet well-defined or understood. Many MMR-deficient human cancer cells lack mutations in known human MMR genes, which strongly suggests that essential eukaryotic MMR components/cofactors remain unidentified and uncharacterized. Furthermore......, the mechanism by which the eukaryotic MMR machinery discriminates between the parental (template) and the daughter (nascent) DNA strand is incompletely understood and how cells choose between the EXO1-dependent and the EXO1–independent subpathways of MMR is not known. This review summarizes recent literature...

  1. Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells

    DEFF Research Database (Denmark)

    Møller, Henrik D.; Bojsen, Rasmus Kenneth; Tachibana, Chris

    2016-01-01

    Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs contribute to genetic variation among somatic cells in multicellular organisms and to evolution of unicellular eukaryotes. Sensitive methods...

  2. The Top 10 oomycete pathogens in molecular plant pathology.

    Science.gov (United States)

    Kamoun, Sophien; Furzer, Oliver; Jones, Jonathan D G; Judelson, Howard S; Ali, Gul Shad; Dalio, Ronaldo J D; Roy, Sanjoy Guha; Schena, Leonardo; Zambounis, Antonios; Panabières, Franck; Cahill, David; Ruocco, Michelina; Figueiredo, Andreia; Chen, Xiao-Ren; Hulvey, Jon; Stam, Remco; Lamour, Kurt; Gijzen, Mark; Tyler, Brett M; Grünwald, Niklaus J; Mukhtar, M Shahid; Tomé, Daniel F A; Tör, Mahmut; Van Den Ackerveken, Guido; McDowell, John; Daayf, Fouad; Fry, William E; Lindqvist-Kreuze, Hannele; Meijer, Harold J G; Petre, Benjamin; Ristaino, Jean; Yoshida, Kentaro; Birch, Paul R J; Govers, Francine

    2015-05-01

    Oomycetes form a deep lineage of eukaryotic organisms that includes a large number of plant pathogens which threaten natural and managed ecosystems. We undertook a survey to query the community for their ranking of plant-pathogenic oomycete species based on scientific and economic importance. In total, we received 263 votes from 62 scientists in 15 countries for a total of 33 species. The Top 10 species and their ranking are: (1) Phytophthora infestans; (2, tied) Hyaloperonospora arabidopsidis; (2, tied) Phytophthora ramorum; (4) Phytophthora sojae; (5) Phytophthora capsici; (6) Plasmopara viticola; (7) Phytophthora cinnamomi; (8, tied) Phytophthora parasitica; (8, tied) Pythium ultimum; and (10) Albugo candida. This article provides an introduction to these 10 taxa and a snapshot of current research. We hope that the list will serve as a benchmark for future trends in oomycete research. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  3. DNA to DNA transcription might exist in eukaryotic cells

    OpenAIRE

    Li, Gao-De

    2016-01-01

    Till now, in biological sciences, the term, transcription, mainly refers to DNA to RNA transcription. But our recently published experimental findings obtained from Plasmodium falciparum strongly suggest the existence of DNA to DNA transcription in the genome of eukaryotic cells, which could shed some light on the functions of certain noncoding DNA in the human and other eukaryotic genomes.

  4. UbiProt: a database of ubiquitylated proteins

    Directory of Open Access Journals (Sweden)

    Kondratieva Ekaterina V

    2007-04-01

    Full Text Available Abstract Background Post-translational protein modification with ubiquitin, or ubiquitylation, is one of the hottest topics in a modern biology due to a dramatic impact on diverse metabolic pathways and involvement in pathogenesis of severe human diseases. A great number of eukaryotic proteins was found to be ubiquitylated. However, data about particular ubiquitylated proteins are rather disembodied. Description To fill a general need for collecting and systematizing experimental data concerning ubiquitylation we have developed a new resource, UbiProt Database, a knowledgebase of ubiquitylated proteins. The database contains retrievable information about overall characteristics of a particular protein, ubiquitylation features, related ubiquitylation and de-ubiquitylation machinery and literature references reflecting experimental evidence of ubiquitylation. UbiProt is available at http://ubiprot.org.ru for free. Conclusion UbiProt Database is a public resource offering comprehensive information on ubiquitylated proteins. The resource can serve as a general reference source both for researchers in ubiquitin field and those who deal with particular ubiquitylated proteins which are of their interest. Further development of the UbiProt Database is expected to be of common interest for research groups involved in studies of the ubiquitin system.

  5. Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells

    DEFF Research Database (Denmark)

    Møller, Henrik D.; Bojsen, Rasmus Kenneth; Tachibana, Chris

    2016-01-01

    Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs contribute to genetic variation among somatic cells in multicellular organisms and to evolution of unicellular eukaryotes. Sensitive methods for d...

  6. Long non-coding RNAs as molecular players in plant defense against pathogens.

    Science.gov (United States)

    Zaynab, Madiha; Fatima, Mahpara; Abbas, Safdar; Umair, Muhammad; Sharif, Yasir; Raza, Muhammad Ammar

    2018-05-31

    Long non-coding RNAs (lncRNAs) has significant role in of gene expression and silencing pathways for several biological processes in eukaryotes. lncRNAs has been reported as key player in remodeling chromatin and genome architecture, RNA stabilization and transcription regulation, including enhancer-associated activity. Host lncRNAs are reckoned as compulsory elements of plant defense. In response to pathogen attack, plants protect themselves with the help of lncRNAs -dependent immune systems in which lncRNAs regulate pathogen-associated molecular patterns (PAMPs) and other effectors. Role of lncRNAs in plant microbe interaction has been studied extensively but regulations of several lncRNAs still need extensive research. In this study we discussed and provide as overview the topical advancements and findings relevant to pathogen attack and plant defense mediated by lncRNAs. It is hoped that lncRNAs would be exploited as a mainstream player to achieve food security by tackling different plant diseases. Copyright © 2018. Published by Elsevier Ltd.

  7. EVpedia: an integrated database of high-throughput data for systemic analyses of extracellular vesicles

    Directory of Open Access Journals (Sweden)

    Dae-Kyum Kim

    2013-03-01

    Full Text Available Secretion of extracellular vesicles is a general cellular activity that spans the range from simple unicellular organisms (e.g. archaea; Gram-positive and Gram-negative bacteria to complex multicellular ones, suggesting that this extracellular vesicle-mediated communication is evolutionarily conserved. Extracellular vesicles are spherical bilayered proteolipids with a mean diameter of 20–1,000 nm, which are known to contain various bioactive molecules including proteins, lipids, and nucleic acids. Here, we present EVpedia, which is an integrated database of high-throughput datasets from prokaryotic and eukaryotic extracellular vesicles. EVpedia provides high-throughput datasets of vesicular components (proteins, mRNAs, miRNAs, and lipids present on prokaryotic, non-mammalian eukaryotic, and mammalian extracellular vesicles. In addition, EVpedia also provides an array of tools, such as the search and browse of vesicular components, Gene Ontology enrichment analysis, network analysis of vesicular proteins and mRNAs, and a comparison of vesicular datasets by ortholog identification. Moreover, publications on extracellular vesicle studies are listed in the database. This free web-based database of EVpedia (http://evpedia.info might serve as a fundamental repository to stimulate the advancement of extracellular vesicle studies and to elucidate the novel functions of these complex extracellular organelles.

  8. Bacterial toxins as pathogen weapons against phagocytes

    Directory of Open Access Journals (Sweden)

    Ana edo Vale

    2016-02-01

    Full Text Available Bacterial toxins are virulence factors that manipulate host cell functions and take over the control of vital processes of living organisms to favour microbial infection. Some toxins directly target innate immune cells, thereby annihilating a major branch of the host immune response. In this review we will focus on bacterial toxins that act from the extracellular milieu and hinder the function of macrophages and neutrophils. In particular, we will concentrate on toxins from Gram-positive and Gram-negative bacteria that manipulate cell signalling or induce cell death by either imposing direct damage to the host cells cytoplasmic membrane or enzymatically modifying key eukaryotic targets. Outcomes regarding pathogen dissemination, host damage and disease progression will be discussed.

  9. Modify the Histone to Win the Battle: Chromatin Dynamics in Plant–Pathogen Interactions

    KAUST Repository

    Ramirez Prado, Juan Sebastian; Piquerez, Sophie J. M.; Bendahmane, Abdelhafid; Hirt, Heribert; Raynaud, Cé cile; Benhamed, Moussa

    2018-01-01

    Relying on an immune system comes with a high energetic cost for plants. Defense responses in these organisms are therefore highly regulated and fine-tuned, permitting them to respond pertinently to the attack of a microbial pathogen. In recent years, the importance of the physical modification of chromatin, a highly organized structure composed of genomic DNA and its interacting proteins, has become evident in the research field of plant-pathogen interactions. Several processes, including DNA methylation, changes in histone density and variants, and various histone modifications, have been described as regulators of various developmental and defense responses. Herein, we review the state of the art in the epigenomic aspects of plant immunity, focusing on chromatin modifications, chromatin modifiers, and their physiological consequences. In addition, we explore the exciting field of understanding how plant pathogens have adapted to manipulate the plant epigenomic regulation in order to weaken their immune system and thrive in their host, as well as how histone modifications in eukaryotic pathogens are involved in the regulation of their virulence.

  10. Modify the Histone to Win the Battle: Chromatin Dynamics in Plant–Pathogen Interactions

    KAUST Repository

    Ramirez Prado, Juan Sebastian

    2018-03-19

    Relying on an immune system comes with a high energetic cost for plants. Defense responses in these organisms are therefore highly regulated and fine-tuned, permitting them to respond pertinently to the attack of a microbial pathogen. In recent years, the importance of the physical modification of chromatin, a highly organized structure composed of genomic DNA and its interacting proteins, has become evident in the research field of plant-pathogen interactions. Several processes, including DNA methylation, changes in histone density and variants, and various histone modifications, have been described as regulators of various developmental and defense responses. Herein, we review the state of the art in the epigenomic aspects of plant immunity, focusing on chromatin modifications, chromatin modifiers, and their physiological consequences. In addition, we explore the exciting field of understanding how plant pathogens have adapted to manipulate the plant epigenomic regulation in order to weaken their immune system and thrive in their host, as well as how histone modifications in eukaryotic pathogens are involved in the regulation of their virulence.

  11. Origin and evolution of the self-organizing cytoskeleton in the network of eukaryotic organelles.

    Science.gov (United States)

    Jékely, Gáspár

    2014-09-02

    The eukaryotic cytoskeleton evolved from prokaryotic cytomotive filaments. Prokaryotic filament systems show bewildering structural and dynamic complexity and, in many aspects, prefigure the self-organizing properties of the eukaryotic cytoskeleton. Here, the dynamic properties of the prokaryotic and eukaryotic cytoskeleton are compared, and how these relate to function and evolution of organellar networks is discussed. The evolution of new aspects of filament dynamics in eukaryotes, including severing and branching, and the advent of molecular motors converted the eukaryotic cytoskeleton into a self-organizing "active gel," the dynamics of which can only be described with computational models. Advances in modeling and comparative genomics hold promise of a better understanding of the evolution of the self-organizing cytoskeleton in early eukaryotes, and its role in the evolution of novel eukaryotic functions, such as amoeboid motility, mitosis, and ciliary swimming. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  12. PHIDIAS: a pathogen-host interaction data integration and analysis system

    OpenAIRE

    Xiang, Zuoshuang; Tian, Yuying; He, Yongqun

    2007-01-01

    The Pathogen-Host Interaction Data Integration and Analysis System (PHIDIAS) is a web-based database system that serves as a centralized source to search, compare, and analyze integrated genome sequences, conserved domains, and gene expression data related to pathogen-host interactions (PHIs) for pathogen species designated as high priority agents for public health and biological security. In addition, PHIDIAS allows submission, search and analysis of PHI genes and molecular networks curated ...

  13. Comparison and optimization of in silico algorithms for predicting the pathogenicity of sodium channel variants in epilepsy.

    Science.gov (United States)

    Holland, Katherine D; Bouley, Thomas M; Horn, Paul S

    2017-07-01

    Variants in neuronal voltage-gated sodium channel α-subunits genes SCN1A, SCN2A, and SCN8A are common in early onset epileptic encephalopathies and other autosomal dominant childhood epilepsy syndromes. However, in clinical practice, missense variants are often classified as variants of uncertain significance when missense variants are identified but heritability cannot be determined. Genetic testing reports often include results of computational tests to estimate pathogenicity and the frequency of that variant in population-based databases. The objective of this work was to enhance clinicians' understanding of results by (1) determining how effectively computational algorithms predict epileptogenicity of sodium channel (SCN) missense variants; (2) optimizing their predictive capabilities; and (3) determining if epilepsy-associated SCN variants are present in population-based databases. This will help clinicians better understand the results of indeterminate SCN test results in people with epilepsy. Pathogenic, likely pathogenic, and benign variants in SCNs were identified using databases of sodium channel variants. Benign variants were also identified from population-based databases. Eight algorithms commonly used to predict pathogenicity were compared. In addition, logistic regression was used to determine if a combination of algorithms could better predict pathogenicity. Based on American College of Medical Genetic Criteria, 440 variants were classified as pathogenic or likely pathogenic and 84 were classified as benign or likely benign. Twenty-eight variants previously associated with epilepsy were present in population-based gene databases. The output provided by most computational algorithms had a high sensitivity but low specificity with an accuracy of 0.52-0.77. Accuracy could be improved by adjusting the threshold for pathogenicity. Using this adjustment, the Mendelian Clinically Applicable Pathogenicity (M-CAP) algorithm had an accuracy of 0.90 and a

  14. Pathogenicity island mobility and gene content.

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Kelly Porter

    2013-10-01

    Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.

  15. Gonococcal attachment to eukaryotic cells

    International Nuclear Information System (INIS)

    James, J.F.; Lammel, C.J.; Draper, D.L.; Brown, D.A.; Sweet, R.L.; Brooks, G.F.

    1983-01-01

    The attachment of Neisseria gonorrhoeae to eukaryotic cells grown in tissue culture was analyzed by use of light and electron microscopy and by labeling of the bacteria with [ 3 H]- and [ 14 C]adenine. Isogenic piliated and nonpiliated N. gonorrhoeae from opaque and transparent colonies were studied. The results of light microscopy studies showed that the gonococci attached to cells of human origin, including Flow 2000, HeLa 229, and HEp 2. Studies using radiolabeled gonococci gave comparable results. Piliated N. gonorrhoeae usually attached in larger numbers than nonpiliated organisms, and those from opaque colonies attached more often than isogenic variants from transparent colonies. Day-to-day variation in rate of attachment was observed. Scanning electron microscopy studies showed the gonococcal attachment to be specific for microvilli of the host cells. It is concluded that more N. gonorrhoeae from opaque colonies, as compared with isogenic variants from transparent colonies, attach to eukaryotic cells grown in tissue culture

  16. Lectins in human pathogenic fungi.

    Science.gov (United States)

    Gallegos, Belém; Martínez, Ruth; Pérez, Laura; Del Socorro Pina, María; Perez, Eduardo; Hernández, Pedro

    2014-01-01

    Lectins are carbohydrate-binding proteins widely distributed in nature. They constitute a highly diverse group of proteins consisting of many different protein families that are, in general, structurally unrelated. In the last few years, mushroom and other fungal lectins have attracted wide attention due to their antitumour, antiproliferative and immunomodulatory activities. The present mini-review provides concise information about recent developments in understanding lectins from human pathogenic fungi. A bibliographic search was performed in the Science Direct and PubMed databases, using the following keywords "lectin", "fungi", "human" and "pathogenic". Lectins present in fungi have been classified; however, the role played by lectins derived from human pathogenic fungi in infectious processes remains uncertain; thus, this is a scientific field requiring more research. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  17. Patterns of Transcript Abundance of Eukaryotic Biogeochemically-Relevant Genes in the Amazon River Plume.

    Directory of Open Access Journals (Sweden)

    Brian L Zielinski

    Full Text Available The Amazon River has the largest discharge of all rivers on Earth, and its complex plume system fuels a wide array of biogeochemical processes, across a large area of the western tropical North Atlantic. The plume thus stimulates microbial processes affecting carbon sequestration and nutrient cycles at a global scale. Chromosomal gene expression patterns of the 2.0 to 156 μm size-fraction eukaryotic microbial community were investigated in the Amazon River Plume, generating a robust dataset (more than 100 million mRNA sequences that depicts the metabolic capabilities and interactions among the eukaryotic microbes. Combining classical oceanographic field measurements with metatranscriptomics yielded characterization of the hydrographic conditions simultaneous with a quantification of transcriptional activity and identity of the community. We highlight the patterns of eukaryotic gene expression for 31 biogeochemically significant gene targets hypothesized to be valuable within forecasting models. An advantage to this targeted approach is that the database of reference sequences used to identify the target genes was selectively constructed and highly curated optimizing taxonomic coverage, throughput, and the accuracy of annotations. A coastal diatom bloom highly expressed nitrate transporters and carbonic anhydrase presumably to support high growth rates and enhance uptake of low levels of dissolved nitrate and CO2. Diatom-diazotroph association (DDA: diatoms with nitrogen fixing symbionts blooms were common when surface salinity was mesohaline and dissolved nitrate concentrations were below detection, and hence did not show evidence of nitrate utilization, suggesting they relied on ammonium transporters to aquire recently fixed nitrogen. These DDA blooms in the outer plume had rapid turnover of the photosystem D1 protein presumably caused by photodegradation under increased light penetration in clearer waters, and increased expression of silicon

  18. HTT-DB: horizontally transferred transposable elements database.

    Science.gov (United States)

    Dotto, Bruno Reis; Carvalho, Evelise Leis; Silva, Alexandre Freitas; Duarte Silva, Luiz Fernando; Pinto, Paulo Marcos; Ortiz, Mauro Freitas; Wallau, Gabriel Luz

    2015-09-01

    Horizontal transfer of transposable (HTT) elements among eukaryotes was discovered in the mid-1980s. As then, >300 new cases have been described. New findings about HTT are revealing the evolutionary impact of this phenomenon on host genomes. In order to provide an up to date, interactive and expandable database for such events, we developed the HTT-DB database. HTT-DB allows easy access to most of HTT cases reported along with rich information about each case. Moreover, it allows the user to generate tables and graphs based on searches using Transposable elements and/or host species classification and export them in several formats. This database is freely available on the web at http://lpa.saogabriel.unipampa.edu.br:8080/httdatabase. HTT-DB was developed based on Java and MySQL with all major browsers supported. Tools and software packages used are free for personal or non-profit projects. bdotto82@gmail.com or gabriel.wallau@gmail.com. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Using the genome aggregation database, computational pathogenicity prediction tools, and patch clamp heterologous expression studies to demote previously published long QT syndrome type 1 mutations from pathogenic to benign.

    Science.gov (United States)

    Clemens, Daniel J; Lentino, Anne R; Kapplinger, Jamie D; Ye, Dan; Zhou, Wei; Tester, David J; Ackerman, Michael J

    2018-04-01

    Mutations in the KCNQ1-encoded Kv7.1 potassium channel cause long QT syndrome (LQTS) type 1 (LQT1). It has been suggested that ∼10%-20% of rare LQTS case-derived variants in the literature may have been published erroneously as LQT1-causative mutations and may be "false positives." The purpose of this study was to determine which previously published KCNQ1 case variants are likely false positives. A list of all published, case-derived KCNQ1 missense variants (MVs) was compiled. The occurrence of each MV within the Genome Aggregation Database (gnomAD) was assessed. Eight in silico tools were used to predict each variant's pathogenicity. Case-derived variants that were either (1) too frequently found in gnomAD or (2) absent in gnomAD but predicted to be pathogenic by ≤2 tools were considered potential false positives. Three of these variants were characterized functionally using whole-cell patch clamp technique. Overall, there were 244 KCNQ1 case-derived MVs. Of these, 29 (12%) were seen in ≥10 individuals in gnomAD and are demotable. However, 157 of 244 MVs (64%) were absent in gnomAD. Of these, 7 (4%) were predicted to be pathogenic by ≤2 tools, 3 of which we characterized functionally. There was no significant difference in current density between heterozygous KCNQ1-F127L, -P477L, or -L619M variant-containing channels compared to KCNQ1-WT. This study offers preliminary evidence for the demotion of 32 (13%) previously published LQT1 MVs. Of these, 29 were demoted because of their frequent sighting in gnomAD. Additionally, in silico analysis and in vitro functional studies have facilitated the demotion of 3 ultra-rare MVs (F127L, P477L, L619M). Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  20. Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

    Science.gov (United States)

    Dennig, Jörg

    Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

  1. Patterns of intron gain and conservation in eukaryotic genes

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2007-10-01

    Full Text Available Abstract Background: The presence of introns in protein-coding genes is a universal feature of eukaryotic genome organization, and the genes of multicellular eukaryotes, typically, contain multiple introns, a substantial fraction of which share position in distant taxa, such as plants and animals. Depending on the methods and data sets used, researchers have reached opposite conclusions on the causes of the high fraction of shared introns in orthologous genes from distant eukaryotes. Some studies conclude that shared intron positions reflect, almost entirely, a remarkable evolutionary conservation, whereas others attribute it to parallel gain of introns. To resolve these contradictions, it is crucial to analyze the evolution of introns by using a model that minimally relies on arbitrary assumptions. Results: We developed a probabilistic model of evolution that allows for variability of intron gain and loss rates over branches of the phylogenetic tree, individual genes, and individual sites. Applying this model to an extended set of conserved eukaryotic genes, we find that parallel gain, on average, accounts for only ~8% of the shared intron positions. However, the distribution of parallel gains over the phylogenetic tree of eukaryotes is highly non-uniform. There are, practically, no parallel gains in closely related lineages, whereas for distant lineages, such as animals and plants, parallel gains appear to contribute up to 20% of the shared intron positions. In accord with these findings, we estimated that ancestral introns have a high probability to be retained in extant genomes, and conversely, that a substantial fraction of extant introns have retained their positions since the early stages of eukaryotic evolution. In addition, the density of sites that are available for intron insertion is estimated to be, approximately, one in seven basepairs. Conclusion: We obtained robust estimates of the contribution of parallel gain to the observed

  2. Eelgrass Leaf Surface Microbiomes Are Locally Variable and Highly Correlated with Epibiotic Eukaryotes

    Directory of Open Access Journals (Sweden)

    Mia M. Bengtsson

    2017-07-01

    Full Text Available Eelgrass (Zostera marina is a marine foundation species essential for coastal ecosystem services around the northern hemisphere. Like all macroscopic organisms, it possesses a microbiome (here defined as an associated prokaryotic community which may play critical roles in modulating the interaction of eelgrass with its environment. For example, its leaf surface microbiome could inhibit or attract eukaryotic epibionts which may overgrow the eelgrass leading to reduced primary productivity and subsequent eelgrass meadow decline. We used amplicon sequencing of the 16S and 18S rRNA genes of prokaryotes and eukaryotes to assess the leaf surface microbiome (prokaryotes as well as eukaryotic epibionts in- and outside lagoons on the German Baltic Sea coast. Prokaryote microbiomes varied substantially both between sites inside lagoons and between open coastal and lagoon sites. Water depth, leaf area and biofilm chlorophyll a concentration explained a large amount of variation in both prokaryotic and eukaryotic community composition. The prokaryotic microbiome and eukaryotic epibiont communities were highly correlated, and network analysis revealed disproportionate co-occurrence between a limited number of eukaryotic taxa and several bacterial taxa. This suggests that eelgrass leaf surfaces are home to a mosaic of microbiomes of several epibiotic eukaryotes, in addition to the microbiome of the eelgrass itself. Our findings thereby underline that eukaryotic diversity should be taken into account in order to explain prokaryotic microbiome assembly and dynamics in aquatic environments.

  3. Trojan Horse Transit Contributes to Blood-Brain Barrier Crossing of a Eukaryotic Pathogen.

    Science.gov (United States)

    Santiago-Tirado, Felipe H; Onken, Michael D; Cooper, John A; Klein, Robyn S; Doering, Tamara L

    2017-01-31

    The blood-brain barrier (BBB) protects the central nervous system (CNS) by restricting the passage of molecules and microorganisms. Despite this barrier, however, the fungal pathogen Cryptococcus neoformans invades the brain, causing a meningoencephalitis that is estimated to kill over 600,000 people annually. Cryptococcal infection begins in the lung, and experimental evidence suggests that host phagocytes play a role in subsequent dissemination, although this role remains ill defined. Additionally, the disparate experimental approaches that have been used to probe various potential routes of BBB transit make it impossible to assess their relative contributions, confounding any integrated understanding of cryptococcal brain entry. Here we used an in vitro model BBB to show that a "Trojan horse" mechanism contributes significantly to fungal barrier crossing and that host factors regulate this process independently of free fungal transit. We also, for the first time, directly imaged C. neoformans-containing phagocytes crossing the BBB, showing that they do so via transendothelial pores. Finally, we found that Trojan horse crossing enables CNS entry of fungal mutants that cannot otherwise traverse the BBB, and we demonstrate additional intercellular interactions that may contribute to brain entry. Our work elucidates the mechanism of cryptococcal brain invasion and offers approaches to study other neuropathogens. The fungal pathogen Cryptococcus neoformans invades the brain, causing a meningoencephalitis that kills hundreds of thousands of people each year. One route that has been proposed for this brain entry is a Trojan horse mechanism, whereby the fungus crosses the blood-brain barrier (BBB) as a passenger inside host phagocytes. Although indirect experimental evidence supports this intriguing mechanism, it has never been directly visualized. Here we directly image Trojan horse transit and show that it is regulated independently of free fungal entry, contributes

  4. An emerging cyberinfrastructure for biodefense pathogen and pathogen–host data

    Science.gov (United States)

    Zhang, C.; Crasta, O.; Cammer, S.; Will, R.; Kenyon, R.; Sullivan, D.; Yu, Q.; Sun, W.; Jha, R.; Liu, D.; Xue, T.; Zhang, Y.; Moore, M.; McGarvey, P.; Huang, H.; Chen, Y.; Zhang, J.; Mazumder, R.; Wu, C.; Sobral, B.

    2008-01-01

    The NIAID-funded Biodefense Proteomics Resource Center (RC) provides storage, dissemination, visualization and analysis capabilities for the experimental data deposited by seven Proteomics Research Centers (PRCs). The data and its publication is to support researchers working to discover candidates for the next generation of vaccines, therapeutics and diagnostics against NIAID's Category A, B and C priority pathogens. The data includes transcriptional profiles, protein profiles, protein structural data and host–pathogen protein interactions, in the context of the pathogen life cycle in vivo and in vitro. The database has stored and supported host or pathogen data derived from Bacillus, Brucella, Cryptosporidium, Salmonella, SARS, Toxoplasma, Vibrio and Yersinia, human tissue libraries, and mouse macrophages. These publicly available data cover diverse data types such as mass spectrometry, yeast two-hybrid (Y2H), gene expression profiles, X-ray and NMR determined protein structures and protein expression clones. The growing database covers over 23 000 unique genes/proteins from different experiments and organisms. All of the genes/proteins are annotated and integrated across experiments using UniProt Knowledgebase (UniProtKB) accession numbers. The web-interface for the database enables searching, querying and downloading at the level of experiment, group and individual gene(s)/protein(s) via UniProtKB accession numbers or protein function keywords. The system is accessible at http://www.proteomicsresource.org/. PMID:17984082

  5. UUCD: a family-based database of ubiquitin and ubiquitin-like conjugation.

    Science.gov (United States)

    Gao, Tianshun; Liu, Zexian; Wang, Yongbo; Cheng, Han; Yang, Qing; Guo, Anyuan; Ren, Jian; Xue, Yu

    2013-01-01

    In this work, we developed a family-based database of UUCD (http://uucd.biocuckoo.org) for ubiquitin and ubiquitin-like conjugation, which is one of the most important post-translational modifications responsible for regulating a variety of cellular processes, through a similar E1 (ubiquitin-activating enzyme)-E2 (ubiquitin-conjugating enzyme)-E3 (ubiquitin-protein ligase) enzyme thioester cascade. Although extensive experimental efforts have been taken, an integrative data resource is still not available. From the scientific literature, 26 E1s, 105 E2s, 1003 E3s and 148 deubiquitination enzymes (DUBs) were collected and classified into 1, 3, 19 and 7 families, respectively. To computationally characterize potential enzymes in eukaryotes, we constructed 1, 1, 15 and 6 hidden Markov model (HMM) profiles for E1s, E2s, E3s and DUBs at the family level, separately. Moreover, the ortholog searches were conducted for E3 and DUB families without HMM profiles. Then the UUCD database was developed with 738 E1s, 2937 E2s, 46 631 E3s and 6647 DUBs of 70 eukaryotic species. The detailed annotations and classifications were also provided. The online service of UUCD was implemented in PHP + MySQL + JavaScript + Perl.

  6. Use of prokaryotic transcriptional activators as metabolite biosensors in eukaryotic cells

    DEFF Research Database (Denmark)

    2018-01-01

    The present invention relates to the use of transcriptional activators from prokaryotic organisms for use in eukaryotic cells, such as yeast as sensors of intracellular and extracellular accumulation of a ligand or metabolite specifically activating this transcriptional activator in a eukaryot...

  7. Carotenoids Database: structures, chemical fingerprints and distribution among organisms.

    Science.gov (United States)

    Yabuzaki, Junko

    2017-01-01

    To promote understanding of how organisms are related via carotenoids, either evolutionarily or symbiotically, or in food chains through natural histories, we built the Carotenoids Database. This provides chemical information on 1117 natural carotenoids with 683 source organisms. For extracting organisms closely related through the biosynthesis of carotenoids, we offer a new similarity search system 'Search similar carotenoids' using our original chemical fingerprint 'Carotenoid DB Chemical Fingerprints'. These Carotenoid DB Chemical Fingerprints describe the chemical substructure and the modification details based upon International Union of Pure and Applied Chemistry (IUPAC) semi-systematic names of the carotenoids. The fingerprints also allow (i) easier prediction of six biological functions of carotenoids: provitamin A, membrane stabilizers, odorous substances, allelochemicals, antiproliferative activity and reverse MDR activity against cancer cells, (ii) easier classification of carotenoid structures, (iii) partial and exact structure searching and (iv) easier extraction of structural isomers and stereoisomers. We believe this to be the first attempt to establish fingerprints using the IUPAC semi-systematic names. For extracting close profiled organisms, we provide a new tool 'Search similar profiled organisms'. Our current statistics show some insights into natural history: carotenoids seem to have been spread largely by bacteria, as they produce C30, C40, C45 and C50 carotenoids, with the widest range of end groups, and they share a small portion of C40 carotenoids with eukaryotes. Archaea share an even smaller portion with eukaryotes. Eukaryotes then have evolved a considerable variety of C40 carotenoids. Considering carotenoids, eukaryotes seem more closely related to bacteria than to archaea aside from 16S rRNA lineage analysis. : http://carotenoiddb.jp. © The Author(s) 2017. Published by Oxford University Press.

  8. Inorganic phosphate uptake in unicellular eukaryotes.

    Science.gov (United States)

    Dick, Claudia F; Dos-Santos, André L A; Meyer-Fernandes, José R

    2014-07-01

    Inorganic phosphate (Pi) is an essential nutrient for all organisms. The route of Pi utilization begins with Pi transport across the plasma membrane. Here, we analyzed the gene sequences and compared the biochemical profiles, including kinetic and modulator parameters, of Pi transporters in unicellular eukaryotes. The objective of this review is to evaluate the recent findings regarding Pi uptake mechanisms in microorganisms, such as the fungi Neurospora crassa and Saccharomyces cerevisiae and the parasite protozoans Trypanosoma cruzi, Trypanosoma rangeli, Leishmania infantum and Plasmodium falciparum. Pi uptake is the key step of Pi homeostasis and in the subsequent signaling event in eukaryotic microorganisms. Biochemical and structural studies are important for clarifying mechanisms of Pi homeostasis, as well as Pi sensor and downstream pathways, and raise possibilities for future studies in this field. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. A comparative genome analysis of Cercospora sojina with other members of the pathogen genus Mycosphaerella on different plant hosts

    Directory of Open Access Journals (Sweden)

    Fanchang Zeng

    2017-09-01

    Full Text Available Fungi are the causal agents of many of the world's most serious plant diseases causing disastrous consequences for large-scale agricultural production. Pathogenicity genomic basis is complex in fungi as multicellular eukaryotic pathogens. Here, we report the genome sequence of C. sojina, and comparative genome analysis with plant pathogen members of the genus Mycosphaerella (Zymoseptoria. tritici (synonyms M. graminicola, M. pini, M. populorum and M. fijiensis - pathogens of wheat, pine, poplar and banana, respectively. Synteny or collinearity was limited between genomes of major Mycosphaerella pathogens. Comparative analysis with these related pathogen genomes indicated distinct genome-wide repeat organization features. It suggests repetitive elements might be responsible for considerable evolutionary genomic changes. These results reveal the background of genomic differences and similarities between Dothideomycete species. Wide diversity as well as conservation on genome features forms the potential genomic basis of the pathogen specialization, such as pathogenicity to woody vs. herbaceous hosts. Through comparative genome analysis among five Dothideomycete species, our results have shed light on the genome features of these related fungi species. It provides insight for understanding the genomic basis of fungal pathogenicity and disease resistance in the crop hosts.

  10. Uniting sex and eukaryote origins in an emerging oxygenic world.

    Science.gov (United States)

    Gross, Jeferson; Bhattacharya, Debashish

    2010-08-23

    Theories about eukaryote origins (eukaryogenesis) need to provide unified explanations for the emergence of diverse complex features that define this lineage. Models that propose a prokaryote-to-eukaryote transition are gridlocked between the opposing "phagocytosis first" and "mitochondria as seed" paradigms, neither of which fully explain the origins of eukaryote cell complexity. Sex (outcrossing with meiosis) is an example of an elaborate trait not yet satisfactorily addressed in theories about eukaryogenesis. The ancestral nature of meiosis and its dependence on eukaryote cell biology suggest that the emergence of sex and eukaryogenesis were simultaneous and synergic and may be explained by a common selective pressure. We propose that a local rise in oxygen levels, due to cyanobacterial photosynthesis in ancient Archean microenvironments, was highly toxic to the surrounding biota. This selective pressure drove the transformation of an archaeal (archaebacterial) lineage into the first eukaryotes. Key is that oxygen might have acted in synergy with environmental stresses such as ultraviolet (UV) radiation and/or desiccation that resulted in the accumulation of reactive oxygen species (ROS). The emergence of eukaryote features such as the endomembrane system and acquisition of the mitochondrion are posited as strategies to cope with a metabolic crisis in the cell plasma membrane and the accumulation of ROS, respectively. Selective pressure for efficient repair of ROS/UV-damaged DNA drove the evolution of sex, which required cell-cell fusions, cytoskeleton-mediated chromosome movement, and emergence of the nuclear envelope. Our model implies that evolution of sex and eukaryogenesis were inseparable processes. Several types of data can be used to test our hypothesis. These include paleontological predictions, simulation of ancient oxygenic microenvironments, and cell biological experiments with Archaea exposed to ROS and UV stresses. Studies of archaeal conjugation

  11. Sex is a ubiquitous, ancient, and inherent attribute of eukaryotic life

    NARCIS (Netherlands)

    Speijer, Dave; Lukeš, Julius; Eliáš, Marek

    2015-01-01

    Sexual reproduction and clonality in eukaryotes are mostly seen as exclusive, the latter being rather exceptional. This view might be biased by focusing almost exclusively on metazoans. We analyze and discuss reproduction in the context of extant eukaryotic diversity, paying special attention to

  12. Enzymes from Higher Eukaryotes for Industrial Biocatalysis

    Directory of Open Access Journals (Sweden)

    Zhibin Liu

    2004-01-01

    Full Text Available The industrial production of fine chemicals, feed and food ingredients, pharmaceuticals, agrochemicals and their respective intermediates relies on an increasing application of biocatalysis, i.e. on enzyme or whole-cell catalyzed conversions of molecules. Simple procedures for discovery, cloning and over-expression as well as fast growth favour fungi, yeasts and especially bacteria as sources of biocatalysts. Higher eukaryotes also harbour an almost unlimited number of potential biocatalysts, although to date the limited supply of enzymes, the high heterogeneity of enzyme preparations and the hazard of infectious contaminants keep some interesting candidates out of reach for industrial bioprocesses. In the past only a few animal and plant enzymes from agricultural waste materials were employed in food processing. The use of bacterial expression strains or non-conventional yeasts for the heterologous production of efficient eukaryotic enzymes can overcome the bottleneck in enzyme supply and provide sufficient amounts of homogenous enzyme preparations for reliable and economically feasible applications at large scale. Ideal enzymatic processes represent an environmentally friendly, »near-to-completion« conversion of (mostly non-natural substrates to pure products. Recent developments demonstrate the commercial feasibility of large-scale biocatalytic processes employing enzymes from higher eukaryotes (e.g. plants, animals and also their usefulness in some small-scale industrial applications.

  13. Evolution of DNA replication protein complexes in eukaryotes and Archaea.

    Directory of Open Access Journals (Sweden)

    Nicholas Chia

    Full Text Available BACKGROUND: The replication of DNA in Archaea and eukaryotes requires several ancillary complexes, including proliferating cell nuclear antigen (PCNA, replication factor C (RFC, and the minichromosome maintenance (MCM complex. Bacterial DNA replication utilizes comparable proteins, but these are distantly related phylogenetically to their archaeal and eukaryotic counterparts at best. METHODOLOGY/PRINCIPAL FINDINGS: While the structures of each of the complexes do not differ significantly between the archaeal and eukaryotic versions thereof, the evolutionary dynamic in the two cases does. The number of subunits in each complex is constant across all taxa. However, they vary subtly with regard to composition. In some taxa the subunits are all identical in sequence, while in others some are homologous rather than identical. In the case of eukaryotes, there is no phylogenetic variation in the makeup of each complex-all appear to derive from a common eukaryotic ancestor. This is not the case in Archaea, where the relationship between the subunits within each complex varies taxon-to-taxon. We have performed a detailed phylogenetic analysis of these relationships in order to better understand the gene duplications and divergences that gave rise to the homologous subunits in Archaea. CONCLUSION/SIGNIFICANCE: This domain level difference in evolution suggests that different forces have driven the evolution of DNA replication proteins in each of these two domains. In addition, the phylogenies of all three gene families support the distinctiveness of the proposed archaeal phylum Thaumarchaeota.

  14. Bacterial pathogen manipulation of host membrane trafficking.

    Science.gov (United States)

    Asrat, Seblewongel; de Jesús, Dennise A; Hempstead, Andrew D; Ramabhadran, Vinay; Isberg, Ralph R

    2014-01-01

    Pathogens use a vast number of strategies to alter host membrane dynamics. Targeting the host membrane machinery is important for the survival and pathogenesis of several extracellular, vacuolar, and cytosolic bacteria. Membrane manipulation promotes bacterial replication while suppressing host responses, allowing the bacterium to thrive in a hostile environment. This review provides a comprehensive summary of various strategies used by both extracellular and intracellular bacteria to hijack host membrane trafficking machinery. We start with mechanisms used by bacteria to alter the plasma membrane, delve into the hijacking of various vesicle trafficking pathways, and conclude by summarizing bacterial adaptation to host immune responses. Understanding bacterial manipulation of host membrane trafficking provides insights into bacterial pathogenesis and uncovers the molecular mechanisms behind various processes within a eukaryotic cell.

  15. Initiation of translation in bacteria by a structured eukaryotic IRES RNA.

    Science.gov (United States)

    Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S

    2015-03-05

    The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.

  16. Metabarcoding analysis of eukaryotic microbiota in the gut of HIV-infected patients.

    Directory of Open Access Journals (Sweden)

    Ibrahim Hamad

    Full Text Available Research on the relationship between changes in the gut microbiota and human disease, including AIDS, is a growing field. However, studies on the eukaryotic component of the intestinal microbiota have just begun and have not yet been conducted in HIV-infected patients. Moreover, eukaryotic community profiling is influenced by the use of different methodologies at each step of culture-independent techniques. Herein, initially, four DNA extraction protocols were compared to test the efficiency of each method in recovering eukaryotic DNA from fecal samples. Our results revealed that recovering eukaryotic components from fecal samples differs significantly among DNA extraction methods. Subsequently, the composition of the intestinal eukaryotic microbiota was evaluated in HIV-infected patients and healthy volunteers through clone sequencing, high-throughput sequencing of nuclear ribosomal internal transcribed spacers 1 (ITS1 and 2 (ITS2 amplicons and real-time PCRs. Our results revealed that not only richness (Chao-1 index and alpha diversity (Shannon diversity differ between HIV-infected patients and healthy volunteers, depending on the molecular strategy used, but also the global eukaryotic community composition, with little overlapping taxa found between techniques. Moreover, our results based on cloning libraries and ITS1/ITS2 metabarcoding sequencing showed significant differences in fungal composition between HIV-infected patients and healthy volunteers, but without distinct clusters separating the two groups. Malassezia restricta was significantly more prevalent in fecal samples of HIV-infected patients, according to cloning libraries, whereas operational taxonomic units (OTUs belonging to Candida albicans and Candida tropicalis were significantly more abundant in fecal samples of HIV-infected patients compared to healthy subjects in both ITS subregions. Finally, real-time PCR showed the presence of Microsporidia, Giardia lamblia, Blastocystis

  17. The Quantitative Basis of the Arabidopsis Innate Immune System to Endemic Pathogens Depends on Pathogen Genetics.

    Directory of Open Access Journals (Sweden)

    Jason A Corwin

    2016-02-01

    Full Text Available The most established model of the eukaryotic innate immune system is derived from examples of large effect monogenic quantitative resistance to pathogens. However, many host-pathogen interactions involve many genes of small to medium effect and exhibit quantitative resistance. We used the Arabidopsis-Botrytis pathosystem to explore the quantitative genetic architecture underlying host innate immune system in a population of Arabidopsis thaliana. By infecting a diverse panel of Arabidopsis accessions with four phenotypically and genotypically distinct isolates of the fungal necrotroph B. cinerea, we identified a total of 2,982 genes associated with quantitative resistance using lesion area and 3,354 genes associated with camalexin production as measures of the interaction. Most genes were associated with resistance to a specific Botrytis isolate, which demonstrates the influence of pathogen genetic variation in analyzing host quantitative resistance. While known resistance genes, such as receptor-like kinases (RLKs and nucleotide-binding site leucine-rich repeat proteins (NLRs, were found to be enriched among associated genes, they only account for a small fraction of the total genes associated with quantitative resistance. Using publically available co-expression data, we condensed the quantitative resistance associated genes into co-expressed gene networks. GO analysis of these networks implicated several biological processes commonly connected to disease resistance, including defense hormone signaling and ROS production, as well as novel processes, such as leaf development. Validation of single gene T-DNA knockouts in a Col-0 background demonstrate a high success rate (60% when accounting for differences in environmental and Botrytis genetic variation. This study shows that the genetic architecture underlying host innate immune system is extremely complex and is likely able to sense and respond to differential virulence among pathogen

  18. ChlamyCyc - a comprehensive database and web-portal centered on _Chlamydomonas reinhardtii_

    OpenAIRE

    Jan-Ole Christian; Patrick May; Stefan Kempa; Dirk Walther

    2009-01-01

    *Background* - The unicellular green alga _Chlamydomonas reinhardtii_ is an important eukaryotic model organism for the study of photosynthesis and growth, as well as flagella development and other cellular processes. In the era of high-throughput technologies there is an imperative need to integrate large-scale data sets from high-throughput experimental techniques using computational methods and database resources to provide comprehensive information about the whole cellular system of a sin...

  19. Genetic exchange in eukaryotes through horizontal transfer: connected by the mobilome.

    Science.gov (United States)

    Wallau, Gabriel Luz; Vieira, Cristina; Loreto, Élgion Lúcio Silva

    2018-01-01

    All living species contain genetic information that was once shared by their common ancestor. DNA is being inherited through generations by vertical transmission (VT) from parents to offspring and from ancestor to descendant species. This process was considered the sole pathway by which biological entities exchange inheritable information. However, Horizontal Transfer (HT), the exchange of genetic information by other means than parents to offspring, was discovered in prokaryotes along with strong evidence showing that it is a very important process by which prokaryotes acquire new genes. For some time now, it has been a scientific consensus that HT events were rare and non-relevant for evolution of eukaryotic species, but there is growing evidence supporting that HT is an important and frequent phenomenon in eukaryotes as well. Here, we will discuss the latest findings regarding HT among eukaryotes, mainly HT of transposons (HTT), establishing HTT once and for all as an important phenomenon that should be taken into consideration to fully understand eukaryotes genome evolution. In addition, we will discuss the latest development methods to detect such events in a broader scale and highlight the new approaches which should be pursued by researchers to fill the knowledge gaps regarding HTT among eukaryotes.

  20. Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Alix M Denoncourt

    2014-05-01

    Full Text Available Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging process. It is possible that packaging is more common than suspected and may play a major role in the persistence and transmission of pathogenic bacteria. To confirm the role of packaging in the propagation of infections, it is vital that the molecular mechanisms governing the packaging of bacteria by protozoa be identified as well as elements related to the ecology of this process in order to determine whether packaging acts as a Trojan Horse.

  1. The independent prokaryotic origins of eukaryotic fructose-1, 6-bisphosphatase and sedoheptulose-1, 7-bisphosphatase and the implications of their origins for the evolution of eukaryotic Calvin cycle

    Directory of Open Access Journals (Sweden)

    Jiang Yong-Hai

    2012-10-01

    Full Text Available Abstract Background In the Calvin cycle of eubacteria, the dephosphorylations of both fructose-1, 6-bisphosphate (FBP and sedoheptulose-1, 7-bisphosphate (SBP are catalyzed by the same bifunctional enzyme: fructose-1, 6-bisphosphatase/sedoheptulose-1, 7-bisphosphatase (F/SBPase, while in that of eukaryotic chloroplasts by two distinct enzymes: chloroplastic fructose-1, 6-bisphosphatase (FBPase and sedoheptulose-1, 7-bisphosphatase (SBPase, respectively. It was proposed that these two eukaryotic enzymes arose from the divergence of a common ancestral eubacterial bifunctional F/SBPase of mitochondrial origin. However, no specific affinity between SBPase and eubacterial FBPase or F/SBPase can be observed in the previous phylogenetic analyses, and it is hard to explain why SBPase and/or F/SBPase are/is absent from most extant nonphotosynthetic eukaryotes according to this scenario. Results Domain analysis indicated that eubacterial F/SBPase of two different resources contain distinct domains: proteobacterial F/SBPases contain typical FBPase domain, while cyanobacterial F/SBPases possess FBPase_glpX domain. Therefore, like prokaryotic FBPase, eubacterial F/SBPase can also be divided into two evolutionarily distant classes (Class I and II. Phylogenetic analysis based on a much larger taxonomic sampling than previous work revealed that all eukaryotic SBPase cluster together and form a close sister group to the clade of epsilon-proteobacterial Class I FBPase which are gluconeogenesis-specific enzymes, while all eukaryotic chloroplast FBPase group together with eukaryotic cytosolic FBPase and form another distinct clade which then groups with the Class I FBPase of diverse eubacteria. Motif analysis of these enzymes also supports these phylogenetic correlations. Conclusions There are two evolutionarily distant classes of eubacterial bifunctional F/SBPase. Eukaryotic FBPase and SBPase do not diverge from either of them but have two independent origins

  2. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  3. i-Genome: A database to summarize oligonucleotide data in genomes

    Directory of Open Access Journals (Sweden)

    Chang Yu-Chung

    2004-10-01

    Full Text Available Abstract Background Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. Results The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. Conclusions This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.

  4. Mitochondrial uncoupling proteins in unicellular eukaryotes.

    Science.gov (United States)

    Jarmuszkiewicz, Wieslawa; Woyda-Ploszczyca, Andrzej; Antos-Krzeminska, Nina; Sluse, Francis E

    2010-01-01

    Uncoupling proteins (UCPs) are members of the mitochondrial anion carrier protein family that are present in the mitochondrial inner membrane and mediate free fatty acid (FFA)-activated, purine nucleotide (PN)-inhibited proton conductance. Since 1999, the presence of UCPs has been demonstrated in some non-photosynthesising unicellular eukaryotes, including amoeboid and parasite protists, as well as in non-fermentative yeast and filamentous fungi. In the mitochondria of these organisms, UCP activity is revealed upon FFA-induced, PN-inhibited stimulation of resting respiration and a decrease in membrane potential, which are accompanied by a decrease in membranous ubiquinone (Q) reduction level. UCPs in unicellular eukaryotes are able to divert energy from oxidative phosphorylation and thus compete for a proton electrochemical gradient with ATP synthase. Our recent work indicates that membranous Q is a metabolic sensor that might utilise its redox state to release the PN inhibition of UCP-mediated mitochondrial uncoupling under conditions of phosphorylation and resting respiration. The action of reduced Q (QH2) could allow higher or complete activation of UCP. As this regulatory feature was demonstrated for microorganism UCPs (A. castellanii UCP), plant and mammalian UCP1 analogues, and UCP1 in brown adipose tissue, the process could involve all UCPs. Here, we discuss the functional connection and physiological role of UCP and alternative oxidase, two main energy-dissipating systems in the plant-type mitochondrial respiratory chain of unicellular eukaryotes, including the control of cellular energy balance as well as preventive action against the production of reactive oxygen species. Copyright © 2009 Elsevier B.V. All rights reserved.

  5. Eukaryotic acquisition of a bacterial operon

    Science.gov (United States)

    The yeast Saccharomyces cerevisiae is one of the champions of basic biomedical research due to its compact eukaryotic genome and ease of experimental manipulation. Despite these immense strengths, its impact on understanding the genetic basis of natural phenotypic variation has been limited by strai...

  6. Quantitative prediction of shrimp disease incidence via the profiles of gut eukaryotic microbiota.

    Science.gov (United States)

    Xiong, Jinbo; Yu, Weina; Dai, Wenfang; Zhang, Jinjie; Qiu, Qiongfen; Ou, Changrong

    2018-04-01

    One common notion is emerging that gut eukaryotes are commensal or beneficial, rather than detrimental. To date, however, surprisingly few studies have been taken to discern the factors that govern the assembly of gut eukaryotes, despite growing interest in the dysbiosis of gut microbiota-disease relationship. Herein, we firstly explored how the gut eukaryotic microbiotas were assembled over shrimp postlarval to adult stages and a disease progression. The gut eukaryotic communities changed markedly as healthy shrimp aged, and converged toward an adult-microbiota configuration. However, the adult-like stability was distorted by disease exacerbation. A null model untangled that the deterministic processes that governed the gut eukaryotic assembly tended to be more important over healthy shrimp development, whereas this trend was inverted as the disease progressed. After ruling out the baseline of gut eukaryotes over shrimp ages, we identified disease-discriminatory taxa (species level afforded the highest accuracy of prediction) that characteristic of shrimp health status. The profiles of these taxa contributed an overall 92.4% accuracy in predicting shrimp health status. Notably, this model can accurately diagnose the onset of shrimp disease. Interspecies interaction analysis depicted how the disease-discriminatory taxa interacted with one another in sustaining shrimp health. Taken together, our findings offer novel insights into the underlying ecological processes that govern the assembly of gut eukaryotes over shrimp postlarval to adult stages and a disease progression. Intriguingly, the established model can quantitatively and accurately predict the incidences of shrimp disease.

  7. Mechanisms and regulation of DNA replication initiation in eukaryotes.

    Science.gov (United States)

    Parker, Matthew W; Botchan, Michael R; Berger, James M

    2017-04-01

    Cellular DNA replication is initiated through the action of multiprotein complexes that recognize replication start sites in the chromosome (termed origins) and facilitate duplex DNA melting within these regions. In a typical cell cycle, initiation occurs only once per origin and each round of replication is tightly coupled to cell division. To avoid aberrant origin firing and re-replication, eukaryotes tightly regulate two events in the initiation process: loading of the replicative helicase, MCM2-7, onto chromatin by the origin recognition complex (ORC), and subsequent activation of the helicase by its incorporation into a complex known as the CMG. Recent work has begun to reveal the details of an orchestrated and sequential exchange of initiation factors on DNA that give rise to a replication-competent complex, the replisome. Here, we review the molecular mechanisms that underpin eukaryotic DNA replication initiation - from selecting replication start sites to replicative helicase loading and activation - and describe how these events are often distinctly regulated across different eukaryotic model organisms.

  8. Ensuring privacy in the study of pathogen genetics

    OpenAIRE

    Mehta, Sanjay R.; Vinterbo, Staal A.; Little, Susan J.

    2014-01-01

    Rapid growth in the genetic sequencing of pathogens in recent years has led to the creation of large sequence databases. This aggregated sequence data can be very useful for tracking and predicting epidemics of infectious diseases. However, the balance between the potential public health benefit and the risk to personal privacy for individuals whose genetic data (personal or pathogen) are included in such work has been difficult to delineate, because neither the true benefit nor the actual ri...

  9. Identifying Pathogenicity Islands in Bacterial Pathogenomics Using Computational Approaches

    Directory of Open Access Journals (Sweden)

    Dongsheng Che

    2014-01-01

    Full Text Available High-throughput sequencing technologies have made it possible to study bacteria through analyzing their genome sequences. For instance, comparative genome sequence analyses can reveal the phenomenon such as gene loss, gene gain, or gene exchange in a genome. By analyzing pathogenic bacterial genomes, we can discover that pathogenic genomic regions in many pathogenic bacteria are horizontally transferred from other bacteria, and these regions are also known as pathogenicity islands (PAIs. PAIs have some detectable properties, such as having different genomic signatures than the rest of the host genomes, and containing mobility genes so that they can be integrated into the host genome. In this review, we will discuss various pathogenicity island-associated features and current computational approaches for the identification of PAIs. Existing pathogenicity island databases and related computational resources will also be discussed, so that researchers may find it to be useful for the studies of bacterial evolution and pathogenicity mechanisms.

  10. Large-scale analysis of phosphorylation site occupancy in eukaryotic proteins

    DEFF Research Database (Denmark)

    Rao, R Shyama Prasad; Møller, Ian Max

    2012-01-01

    in proteins is currently lacking. We have therefore analyzed the occurrence and occupancy of phosphorylated sites (~ 100,281) in a large set of eukaryotic proteins (~ 22,995). Phosphorylation probability was found to be much higher in both the  termini of protein sequences and this is much pronounced...... maximum randomness. An analysis of phosphorylation motifs indicated that just 40 motifs and a much lower number of associated kinases might account for nearly 50% of the known phosphorylations in eukaryotic proteins. Our results provide a broad picture of the phosphorylation sites in eukaryotic proteins.......Many recent high throughput technologies have enabled large-scale discoveries of new phosphorylation sites and phosphoproteins. Although they have provided a number of insights into protein phosphorylation and the related processes, an inclusive analysis on the nature of phosphorylated sites...

  11. On the Archaeal Origins of Eukaryotes and the Challenges of Inferring Phenotype from Genotype.

    Science.gov (United States)

    Dey, Gautam; Thattai, Mukund; Baum, Buzz

    2016-07-01

    If eukaryotes arose through a merger between archaea and bacteria, what did the first true eukaryotic cell look like? A major step toward an answer came with the discovery of Lokiarchaeum, an archaeon whose genome encodes small GTPases related to those used by eukaryotes to regulate membrane traffic. Although 'Loki' cells have yet to be seen, their existence has prompted the suggestion that the archaeal ancestor of eukaryotes engulfed the future mitochondrion by phagocytosis. We propose instead that the archaeal ancestor was a relatively simple cell, and that eukaryotic cellular organization arose as the result of a gradual transfer of bacterial genes and membranes driven by an ever-closer symbiotic partnership between a bacterium and an archaeon. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. PHIDIAS: a pathogen-host interaction data integration and analysis system.

    Science.gov (United States)

    Xiang, Zuoshuang; Tian, Yuying; He, Yongqun

    2007-01-01

    The Pathogen-Host Interaction Data Integration and Analysis System (PHIDIAS) is a web-based database system that serves as a centralized source to search, compare, and analyze integrated genome sequences, conserved domains, and gene expression data related to pathogen-host interactions (PHIs) for pathogen species designated as high priority agents for public health and biological security. In addition, PHIDIAS allows submission, search and analysis of PHI genes and molecular networks curated from peer-reviewed literature. PHIDIAS is publicly available at http://www.phidias.us.

  13. ChlamyCyc: an integrative systems biology database and web-portal for Chlamydomonas reinhardtii

    OpenAIRE

    May, P.; Christian, J.O.; Kempa, S.; Walther, D.

    2009-01-01

    Abstract Background The unicellular green alga Chlamydomonas reinhardtii is an important eukaryotic model organism for the study of photosynthesis and plant growth. In the era of modern high-throughput technologies there is an imperative need to integrate large-scale data sets from high-throughput experimental techniques using computational methods and database resources to provide comprehensive information about the molecular and cellular organization of a single organism. Results In the fra...

  14. Symbiosis and the origin of eukaryotic motility

    Science.gov (United States)

    Margulis, L.; Hinkle, G.

    1991-01-01

    Ongoing work to test the hypothesis of the origin of eukaryotic cell organelles by microbial symbioses is discussed. Because of the widespread acceptance of the serial endosymbiotic theory (SET) of the origin of plastids and mitochondria, the idea of the symbiotic origin of the centrioles and axonemes for spirochete bacteria motility symbiosis was tested. Intracellular microtubular systems are purported to derive from symbiotic associations between ancestral eukaryotic cells and motile bacteria. Four lines of approach to this problem are being pursued: (1) cloning the gene of a tubulin-like protein discovered in Spirocheata bajacaliforniesis; (2) seeking axoneme proteins in spirochets by antibody cross-reaction; (3) attempting to cultivate larger, free-living spirochetes; and (4) studying in detail spirochetes (e.g., Cristispira) symbiotic with marine animals. Other aspects of the investigation are presented.

  15. Modelling the regulation of thermal adaptation in Candida albicans, a major fungal pathogen of humans.

    Directory of Open Access Journals (Sweden)

    Michelle D Leach

    Full Text Available Eukaryotic cells have evolved mechanisms to sense and adapt to dynamic environmental changes. Adaptation to thermal insults, in particular, is essential for their survival. The major fungal pathogen of humans, Candida albicans, is obligately associated with warm-blooded animals and hence occupies thermally buffered niches. Yet during its evolution in the host it has retained a bona fide heat shock response whilst other stress responses have diverged significantly. Furthermore the heat shock response is essential for the virulence of C. albicans. With a view to understanding the relevance of this response to infection we have explored the dynamic regulation of thermal adaptation using an integrative systems biology approach. Our mathematical model of thermal regulation, which has been validated experimentally in C. albicans, describes the dynamic autoregulation of the heat shock transcription factor Hsf1 and the essential chaperone protein Hsp90. We have used this model to show that the thermal adaptation system displays perfect adaptation, that it retains a transient molecular memory, and that Hsf1 is activated during thermal transitions that mimic fever. In addition to providing explanations for the evolutionary conservation of the heat shock response in this pathogen and the relevant of this response to infection, our model provides a platform for the analysis of thermal adaptation in other eukaryotic cells.

  16. The trans-kingdom identification of negative regulators of pathogen hypervirulence.

    Science.gov (United States)

    Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E

    2016-01-01

    Modern society and global ecosystems are increasingly under threat from pathogens, which cause a plethora of human, animal, invertebrate and plant diseases. Of increasing concern is the trans-kingdom tendency for increased pathogen virulence that is beginning to emerge in natural, clinical and agricultural settings. The study of pathogenicity has revealed multiple examples of convergently evolved virulence mechanisms. Originally described as rare, but increasingly common, are interactions where a single gene deletion in a pathogenic species causes hypervirulence. This review utilised the pathogen-host interaction database (www.PHI-base.org) to identify 112 hypervirulent mutations from 37 pathogen species, and subsequently interrogates the trans-kingdom, conserved, molecular, biochemical and cellular themes that cause hypervirulence. This study investigates 22 animal and 15 plant pathogens including 17 bacterial and 17 fungal species. Finally, the evolutionary significance and trans-kingdom requirement for negative regulators of hypervirulence and the implication of pathogen hypervirulence and emerging infectious diseases on society are discussed. © FEMS 2015.

  17. Characterization of prokaryotic and eukaryotic promoters usinghidden Markov models

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Brunak, Søren

    1996-01-01

    In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma-70 and sigma-54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...

  18. DMPD: Pathogen-induced apoptosis of macrophages: a common end for different pathogenicstrategies. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 11207583 Pathogen-induced apoptosis of macrophages: a common end for different path...ml) Show Pathogen-induced apoptosis of macrophages: a common end for different pathogenicstrategies. PubmedI...D 11207583 Title Pathogen-induced apoptosis of macrophages: a common end for diff

  19. ProteinHistorian: tools for the comparative analysis of eukaryote protein origin.

    Directory of Open Access Journals (Sweden)

    John A Capra

    Full Text Available The evolutionary history of a protein reflects the functional history of its ancestors. Recent phylogenetic studies identified distinct evolutionary signatures that characterize proteins involved in cancer, Mendelian disease, and different ontogenic stages. Despite the potential to yield insight into the cellular functions and interactions of proteins, such comparative phylogenetic analyses are rarely performed, because they require custom algorithms. We developed ProteinHistorian to make tools for performing analyses of protein origins widely available. Given a list of proteins of interest, ProteinHistorian estimates the phylogenetic age of each protein, quantifies enrichment for proteins of specific ages, and compares variation in protein age with other protein attributes. ProteinHistorian allows flexibility in the definition of protein age by including several algorithms for estimating ages from different databases of evolutionary relationships. We illustrate the use of ProteinHistorian with three example analyses. First, we demonstrate that proteins with high expression in human, compared to chimpanzee and rhesus macaque, are significantly younger than those with human-specific low expression. Next, we show that human proteins with annotated regulatory functions are significantly younger than proteins with catalytic functions. Finally, we compare protein length and age in many eukaryotic species and, as expected from previous studies, find a positive, though often weak, correlation between protein age and length. ProteinHistorian is available through a web server with an intuitive interface and as a set of command line tools; this allows biologists and bioinformaticians alike to integrate these approaches into their analysis pipelines. ProteinHistorian's modular, extensible design facilitates the integration of new datasets and algorithms. The ProteinHistorian web server, source code, and pre-computed ages for 32 eukaryotic genomes are

  20. Arabinogalactan proteins have deep roots in eukaryotes

    DEFF Research Database (Denmark)

    Hervé, Cécile; Siméon, Amandine; Jam, Murielle

    2016-01-01

    Arabinogalactan proteins (AGPs) are highly glycosylated, hydroxyproline-rich proteins found at the cell surface of plants, where they play key roles in developmental processes. Brown algae are marine, multicellular, photosynthetic eukaryotes. They belong to the phylum Stramenopiles, which...

  1. Enzymes involved in organellar DNA replication in photosynthetic eukaryotes.

    Science.gov (United States)

    Moriyama, Takashi; Sato, Naoki

    2014-01-01

    Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana, the replication-related enzymes of plastids and mitochondria are similar because many of them are dual targeted to both organelles, whereas in the red alga Cyanidioschyzon merolae, plastids and mitochondria contain different replication machinery components. The enzymes involved in organellar genome replication in green plants and red algae were derived from different origins, including proteobacterial, cyanobacterial, and eukaryotic lineages. In the present review, we summarize the available data for enzymes related to organellar genome replication in green plants and red algae. In addition, based on the type and distribution of replication enzymes in photosynthetic eukaryotes, we discuss the transitional history of replication enzymes in the organelles of plants.

  2. Ubiquitination dynamics in the early-branching eukaryote Giardia intestinalis

    Science.gov (United States)

    Niño, Carlos A; Chaparro, Jenny; Soffientini, Paolo; Polo, Simona; Wasserman, Moises

    2013-01-01

    Ubiquitination is a highly dynamic and versatile posttranslational modification that regulates protein function, stability, and interactions. To investigate the roles of ubiquitination in a primitive eukaryotic lineage, we utilized the early-branching eukaryote Giardia intestinalis. Using a combination of biochemical, immunofluorescence-based, and proteomics approaches, we assessed the ubiquitination status during the process of differentiation in Giardia. We observed that different types of ubiquitin modifications present specific cellular and temporal distribution throughout the Giardia life cycle from trophozoites to cyst maturation. Ubiquitin signal was detected in the wall of mature cysts, and enzymes implicated in cyst wall biogenesis were identified as substrates for ubiquitination. Interestingly, inhibition of proteasome activity did not affect trophozoite replication and differentiation, while it caused a decrease in cyst viability, arguing for proteasome involvement in cyst wall maturation. Using a proteomics approach, we identified around 200 high-confidence ubiquitinated candidates that vary their ubiquitination status during differentiation. Our results indicate that ubiquitination is critical for several cellular processes in this primitive eukaryote. PMID:23613346

  3. What can we infer about the origin of sex in early eukaryotes?

    NARCIS (Netherlands)

    Speijer, Dave

    2016-01-01

    Current analysis shows that the last eukaryotic common ancestor (LECA) was capable of full meiotic sex. The original eukaryotic life cycle can probably be described as clonal, interrupted by episodic sex triggered by external or internal stressors. The cycle could have started in a highly flexible

  4. Metabolism in anoxic permeable sediments is dominated by eukaryotic dark fermentation

    DEFF Research Database (Denmark)

    Bourke, Michael F.; Marriott, Philip J.; Glud, Ronnie N.

    2017-01-01

    Permeable sediments are common across continental shelves and are critical contributors to marine biogeochemical cycling. Organic matter in permeable sediments is dominated by microalgae, which as eukaryotes have different anaerobic metabolic pathways to prokaryotes such as bacteria and archaea....... Here we present analyses of flow-through reactor experiments showing that dissolved inorganic carbon is produced predominantly as a result of anaerobic eukaryotic metabolic activity. In our experiments, anaerobic production of dissolved inorganic carbon was consistently accompanied by large dissolved H....../hydrogenase pathway of fermentative eukaryotic H2 production, suggesting that pathway as the source of H2 and dissolved inorganic carbon production. Metabolomic analysis showed large increases in lipid production at the onset of anoxia, consistent with documented pathways of anoxic dark fermentation in microalgae...

  5. Metaxa: a software tool for automated detection and discrimination among ribosomal small subunit (12S/16S/18S) sequences of archaea, bacteria, eukaryotes, mitochondria, and chloroplasts in metagenomes and environmental sequencing datasets.

    Science.gov (United States)

    Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik

    2011-10-01

    The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.

  6. Avian leukosis virus is a versatile eukaryotic platform for polypeptide display

    International Nuclear Information System (INIS)

    Khare, Pranay D.; Russell, Stephen J.; Federspiel, Mark J.

    2003-01-01

    Display technology refers to methods of generating libraries of modularly coded biomolecules and screening them for particular properties. Retroviruses are good candidates to be a eukaryotic viral platform for the display of polypeptides synthesized in eukaryotic cells. Here we demonstrate that avian leukosis virus (ALV) provides an ideal platform for display of nonviral polyaeptides expressed in a eukaryotic cell substrate. Different sizes of polypeptides were genetically fused to the extreme N-terminus of the ALV envelope glycoprotein in an ALV infectious clone containing an alkaline phosphatase reporter gene. The chimeric envelope glycoproteins were efficiently incorporated into virions and were stably displayed on the surface of the virions through multiple virus replication cycles. The foreign polypeptides did not interfere with the attachment and entry functions of the underlying ALV envelope glycoproteins. The displayed polypeptides were fully functional and could efficiently mediate attachment of the recombinant viruses to their respective cognate receptors. This study demonstrates that ALV is an ideal display platform for the generation and selection of libraries of polypeptides where there is a need for expression, folding, and posttranslational modification in the endoplasmic reticulum of eukaryotic cells

  7. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.

    Science.gov (United States)

    Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G

    2000-12-15

    The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.

  8. Three distinct modes of intron dynamics in the evolution of eukaryotes.

    Science.gov (United States)

    Carmel, Liran; Wolf, Yuri I; Rogozin, Igor B; Koonin, Eugene V

    2007-07-01

    Several contrasting scenarios have been proposed for the origin and evolution of spliceosomal introns, a hallmark of eukaryotic genes. A comprehensive probabilistic model to obtain a definitive reconstruction of intron evolution was developed and applied to 391 sets of conserved genes from 19 eukaryotic species. It is inferred that a relatively high intron density was reached early, i.e., the last common ancestor of eukaryotes contained >2.15 introns/kilobase, and the last common ancestor of multicellular life forms harbored approximately 3.4 introns/kilobase, a greater intron density than in most of the extant fungi and in some animals. The rates of intron gain and intron loss appear to have been dropping during the last approximately 1.3 billion years, with the decline in the gain rate being much steeper. Eukaryotic lineages exhibit three distinct modes of evolution of the intron-exon structure. The primary, balanced mode, apparently, operates in all lineages. In this mode, intron gain and loss are strongly and positively correlated, in contrast to previous reports on inverse correlation between these processes. The second mode involves an elevated rate of intron loss and is prevalent in several lineages, such as fungi and insects. The third mode, characterized by elevated rate of intron gain, is seen only in deep branches of the tree, indicating that bursts of intron invasion occurred at key points in eukaryotic evolution, such as the origin of animals. Intron dynamics could depend on multiple mechanisms, and in the balanced mode, gain and loss of introns might share common mechanistic features.

  9. Arginine deiminase pathway enzymes: evolutionary history in metamonads and other eukaryotes.

    Science.gov (United States)

    Novák, Lukáš; Zubáčová, Zuzana; Karnkowska, Anna; Kolisko, Martin; Hroudová, Miluše; Stairs, Courtney W; Simpson, Alastair G B; Keeling, Patrick J; Roger, Andrew J; Čepička, Ivan; Hampl, Vladimír

    2016-10-06

    Multiple prokaryotic lineages use the arginine deiminase (ADI) pathway for anaerobic energy production by arginine degradation. The distribution of this pathway among eukaryotes has been thought to be very limited, with only two specialized groups living in low oxygen environments (Parabasalia and Diplomonadida) known to possess the complete set of all three enzymes. We have performed an extensive survey of available sequence data in order to map the distribution of these enzymes among eukaryotes and to reconstruct their phylogenies. We have found genes for the complete pathway in almost all examined representatives of Metamonada, the anaerobic protist group that includes parabasalids and diplomonads. Phylogenetic analyses indicate the presence of the complete pathway in the last common ancestor of metamonads and heterologous transformation experiments suggest its cytosolic localization in the metamonad ancestor. Outside Metamonada, the complete pathway occurs rarely, nevertheless, it was found in representatives of most major eukaryotic clades. Phylogenetic relationships of complete pathways are consistent with the presence of the Archaea-derived ADI pathway in the last common ancestor of all eukaryotes, although other evolutionary scenarios remain possible. The presence of the incomplete set of enzymes is relatively common among eukaryotes and it may be related to the fact that these enzymes are involved in other cellular processes, such as the ornithine-urea cycle. Single protein phylogenies suggest that the evolutionary history of all three enzymes has been shaped by frequent gene losses and horizontal transfers, which may sometimes be connected with their diverse roles in cellular metabolism.

  10. Diversity of Eukaryotic Translational Initiation Factor eIF4E in Protists.

    Science.gov (United States)

    Jagus, Rosemary; Bachvaroff, Tsvetan R; Joshi, Bhavesh; Place, Allen R

    2012-01-01

    The greatest diversity of eukaryotic species is within the microbial eukaryotes, the protists, with plants and fungi/metazoa representing just two of the estimated seventy five lineages of eukaryotes. Protists are a diverse group characterized by unusual genome features and a wide range of genome sizes from 8.2 Mb in the apicomplexan parasite Babesia bovis to 112,000-220,050 Mb in the dinoflagellate Prorocentrum micans. Protists possess numerous cellular, molecular and biochemical traits not observed in "text-book" model organisms. These features challenge some of the concepts and assumptions about the regulation of gene expression in eukaryotes. Like multicellular eukaryotes, many protists encode multiple eIF4Es, but few functional studies have been undertaken except in parasitic species. An earlier phylogenetic analysis of protist eIF4Es indicated that they cannot be grouped within the three classes that describe eIF4E family members from multicellular organisms. Many more protist sequences are now available from which three clades can be recognized that are distinct from the plant/fungi/metazoan classes. Understanding of the protist eIF4Es will be facilitated as more sequences become available particularly for the under-represented opisthokonts and amoebozoa. Similarly, a better understanding of eIF4Es within each clade will develop as more functional studies of protist eIF4Es are completed.

  11. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    Science.gov (United States)

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

  12. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    Science.gov (United States)

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  13. Identification of Alternative Splice Variants Using Unique Tryptic Peptide Sequences for Database Searches.

    Science.gov (United States)

    Tran, Trung T; Bollineni, Ravi C; Strozynski, Margarita; Koehler, Christian J; Thiede, Bernd

    2017-07-07

    Alternative splicing is a mechanism in eukaryotes by which different forms of mRNAs are generated from the same gene. Identification of alternative splice variants requires the identification of peptides specific for alternative splice forms. For this purpose, we generated a human database that contains only unique tryptic peptides specific for alternative splice forms from Swiss-Prot entries. Using this database allows an easy access to splice variant-specific peptide sequences that match to MS data. Furthermore, we combined this database without alternative splice variant-1-specific peptides with human Swiss-Prot. This combined database can be used as a general database for searching of LC-MS data. LC-MS data derived from in-solution digests of two different cell lines (LNCaP, HeLa) and phosphoproteomics studies were analyzed using these two databases. Several nonalternative splice variant-1-specific peptides were found in both cell lines, and some of them seemed to be cell-line-specific. Control and apoptotic phosphoproteomes from Jurkat T cells revealed several nonalternative splice variant-1-specific peptides, and some of them showed clear quantitative differences between the two states.

  14. Origin of phagotrophic eukaryotes as social cheaters in microbial biofilms

    Directory of Open Access Journals (Sweden)

    Jékely Gáspár

    2007-01-01

    Full Text Available Abstract Background The origin of eukaryotic cells was one of the most dramatic evolutionary transitions in the history of life. It is generally assumed that eukaryotes evolved later then prokaryotes by the transformation or fusion of prokaryotic lineages. However, as yet there is no consensus regarding the nature of the prokaryotic group(s ancestral to eukaryotes. Regardless of this, a hardly debatable fundamental novel characteristic of the last eukaryotic common ancestor was the ability to exploit prokaryotic biomass by the ingestion of entire cells, i.e. phagocytosis. The recent advances in our understanding of the social life of prokaryotes may help to explain the origin of this form of total exploitation. Presentation of the hypothesis Here I propose that eukaryotic cells originated in a social environment, a differentiated microbial mat or biofilm that was maintained by the cooperative action of its members. Cooperation was costly (e.g. the production of developmental signals or an extracellular matrix but yielded benefits that increased the overall fitness of the social group. I propose that eukaryotes originated as selfish cheaters that enjoyed the benefits of social aggregation but did not contribute to it themselves. The cheaters later evolved into predators that lysed other cells and eventually became professional phagotrophs. During several cycles of social aggregation and dispersal the number of cheaters was contained by a chicken game situation, i.e. reproductive success of cheaters was high when they were in low abundance but was reduced when they were over-represented. Radical changes in cell structure, including the loss of the rigid prokaryotic cell wall and the development of endomembranes, allowed the protoeukaryotes to avoid cheater control and to exploit nutrients more efficiently. Cellular changes were buffered by both the social benefits and the protective physico-chemical milieu of the interior of biofilms. Symbiosis

  15. Hybrid and rogue kinases encoded in the genomes of model eukaryotes.

    Directory of Open Access Journals (Sweden)

    Ramaswamy Rakshambikai

    Full Text Available The highly modular nature of protein kinases generates diverse functional roles mediated by evolutionary events such as domain recombination, insertion and deletion of domains. Usually domain architecture of a kinase is related to the subfamily to which the kinase catalytic domain belongs. However outlier kinases with unusual domain architectures serve in the expansion of the functional space of the protein kinase family. For example, Src kinases are made-up of SH2 and SH3 domains in addition to the kinase catalytic domain. A kinase which lacks these two domains but retains sequence characteristics within the kinase catalytic domain is an outlier that is likely to have modes of regulation different from classical src kinases. This study defines two types of outlier kinases: hybrids and rogues depending on the nature of domain recombination. Hybrid kinases are those where the catalytic kinase domain belongs to a kinase subfamily but the domain architecture is typical of another kinase subfamily. Rogue kinases are those with kinase catalytic domain characteristic of a kinase subfamily but the domain architecture is typical of neither that subfamily nor any other kinase subfamily. This report provides a consolidated set of such hybrid and rogue kinases gleaned from six eukaryotic genomes-S.cerevisiae, D. melanogaster, C.elegans, M.musculus, T.rubripes and H.sapiens-and discusses their functions. The presence of such kinases necessitates a revisiting of the classification scheme of the protein kinase family using full length sequences apart from classical classification using solely the sequences of kinase catalytic domains. The study of these kinases provides a good insight in engineering signalling pathways for a desired output. Lastly, identification of hybrids and rogues in pathogenic protozoa such as P.falciparum sheds light on possible strategies in host-pathogen interactions.

  16. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Diversity patterns of microbial eukaryotes mirror those of bacteria in Antarctic cryoconite holes.

    Science.gov (United States)

    Sommers, Pacifica; Darcy, John L; Gendron, Eli M S; Stanish, Lee F; Bagshaw, Elizabeth A; Porazinska, Dorota L; Schmidt, Steven K

    2018-01-01

    Ice-lidded cryoconite holes on glaciers in the Taylor Valley, Antarctica, provide a unique system of natural mesocosms for studying community structure and assembly. We used high-throughput DNA sequencing to characterize both microbial eukaryotic communities and bacterial communities within cryoconite holes across three glaciers to study similarities in their spatial patterns. We expected that the alpha (phylogenetic diversity) and beta (pairwise community dissimilarity) diversity patterns of eukaryotes in cryoconite holes would be related to those of bacteria, and that they would be related to the biogeochemical gradient within the Taylor Valley. We found that eukaryotic alpha and beta diversity were strongly related to those of bacteria across scales ranging from 140 m to 41 km apart. Alpha diversity of both was significantly related to position in the valley and surface area of the cryoconite hole, with pH also significantly correlated with the eukaryotic diversity. Beta diversity for both bacteria and eukaryotes was significantly related to position in the valley, with bacterial beta diversity also related to nitrate. These results are consistent with transport of sediments onto glaciers occurring primarily at local scales relative to the size of the valley, thus creating feedbacks in local chemistry and diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Characterization of prokaryotic and eukaryotic promoters using hidden Markov models

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, P.; Chauvin, Y.

    1996-01-01

    In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma 70 and sigma 54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...

  19. Screening the Medicines for Malaria Venture Pathogen Box across Multiple Pathogens Reclassifies Starting Points for Open-Source Drug Discovery.

    Science.gov (United States)

    Duffy, Sandra; Sykes, Melissa L; Jones, Amy J; Shelper, Todd B; Simpson, Moana; Lang, Rebecca; Poulsen, Sally-Ann; Sleebs, Brad E; Avery, Vicky M

    2017-09-01

    Open-access drug discovery provides a substantial resource for diseases primarily affecting the poor and disadvantaged. The open-access Pathogen Box collection is comprised of compounds with demonstrated biological activity against specific pathogenic organisms. The supply of this resource by the Medicines for Malaria Venture has the potential to provide new chemical starting points for a number of tropical and neglected diseases, through repurposing of these compounds for use in drug discovery campaigns for these additional pathogens. We tested the Pathogen Box against kinetoplastid parasites and malaria life cycle stages in vitro Consequently, chemical starting points for malaria, human African trypanosomiasis, Chagas disease, and leishmaniasis drug discovery efforts have been identified. Inclusive of this in vitro biological evaluation, outcomes from extensive literature reviews and database searches are provided. This information encompasses commercial availability, literature reference citations, other aliases and ChEMBL number with associated biological activity, where available. The release of this new data for the Pathogen Box collection into the public domain will aid the open-source model of drug discovery. Importantly, this will provide novel chemical starting points for drug discovery and target identification in tropical disease research. Copyright © 2017 Duffy et al.

  20. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  1. DAMPD: A manually curated antimicrobial peptide database

    KAUST Repository

    Seshadri Sundararajan, Vijayaraghava

    2011-11-21

    The demand for antimicrobial peptides (AMPs) is rising because of the increased occurrence of pathogens that are tolerant or resistant to conventional antibiotics. Since naturally occurring AMPs could serve as templates for the development of new anti-infectious agents to which pathogens are not resistant, a resource that contains relevant information on AMP is of great interest. To that extent, we developed the Dragon Antimicrobial Peptide Database (DAMPD, http://apps.sanbi.ac.za/dampd) that contains 1232 manually curated AMPs. DAMPD is an update and a replacement of the ANTIMIC database. In DAMPD an integrated interface allows in a simple fashion querying based on taxonomy, species, AMP family, citation, keywords and a combination of search terms and fields (Advanced Search). A number of tools such as Blast, ClustalW, HMMER, Hydrocalculator, SignalP, AMP predictor, as well as a number of other resources that provide additional information about the results are also provided and integrated into DAMPD to augment biological analysis of AMPs. The Author(s) 2011. Published by Oxford University Press.

  2. DAMPD: A manually curated antimicrobial peptide database

    KAUST Repository

    Seshadri Sundararajan, Vijayaraghava; Gabere, Musa Nur; Pretorius, Ashley; Adam, Saleem; Christoffels, Alan; Lehvaslaiho, Minna; Archer, John A.C.; Bajic, Vladimir B.

    2011-01-01

    The demand for antimicrobial peptides (AMPs) is rising because of the increased occurrence of pathogens that are tolerant or resistant to conventional antibiotics. Since naturally occurring AMPs could serve as templates for the development of new anti-infectious agents to which pathogens are not resistant, a resource that contains relevant information on AMP is of great interest. To that extent, we developed the Dragon Antimicrobial Peptide Database (DAMPD, http://apps.sanbi.ac.za/dampd) that contains 1232 manually curated AMPs. DAMPD is an update and a replacement of the ANTIMIC database. In DAMPD an integrated interface allows in a simple fashion querying based on taxonomy, species, AMP family, citation, keywords and a combination of search terms and fields (Advanced Search). A number of tools such as Blast, ClustalW, HMMER, Hydrocalculator, SignalP, AMP predictor, as well as a number of other resources that provide additional information about the results are also provided and integrated into DAMPD to augment biological analysis of AMPs. The Author(s) 2011. Published by Oxford University Press.

  3. In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

    Science.gov (United States)

    Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

    2017-02-01

    Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

  4. Eukaryotic ribonucleases P/MRP: the crystal structure of the P3 domain.

    Science.gov (United States)

    Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

    2010-02-17

    Ribonuclease (RNase) P is a site-specific endoribonuclease found in all kingdoms of life. Typical RNase P consists of a catalytic RNA component and a protein moiety. In the eukaryotes, the RNase P lineage has split into two, giving rise to a closely related enzyme, RNase MRP, which has similar components but has evolved to have different specificities. The eukaryotic RNases P/MRP have acquired an essential helix-loop-helix protein-binding RNA domain P3 that has an important function in eukaryotic enzymes and distinguishes them from bacterial and archaeal RNases P. Here, we present a crystal structure of the P3 RNA domain from Saccharomyces cerevisiae RNase MRP in a complex with RNase P/MRP proteins Pop6 and Pop7 solved to 2.7 A. The structure suggests similar structural organization of the P3 RNA domains in RNases P/MRP and possible functions of the P3 domains and proteins bound to them in the stabilization of the holoenzymes' structures as well as in interactions with substrates. It provides the first insight into the structural organization of the eukaryotic enzymes of the RNase P/MRP family.

  5. Transcriptome of Aphanomyces euteiches: new oomycete putative pathogenicity factors and metabolic pathways.

    Directory of Open Access Journals (Sweden)

    Elodie Gaulin

    Full Text Available Aphanomyces euteiches is an oomycete pathogen that causes seedling blight and root rot of legumes, such as alfalfa and pea. The genus Aphanomyces is phylogenically distinct from well-studied oomycetes such as Phytophthora sp., and contains species pathogenic on plants and aquatic animals. To provide the first foray into gene diversity of A. euteiches, two cDNA libraries were constructed using mRNA extracted from mycelium grown in an artificial liquid medium or in contact to plant roots. A unigene set of 7,977 sequences was obtained from 18,864 high-quality expressed sequenced tags (ESTs and characterized for potential functions. Comparisons with oomycete proteomes revealed major differences between the gene content of A. euteiches and those of Phytophthora species, leading to the identification of biosynthetic pathways absent in Phytophthora, of new putative pathogenicity genes and of expansion of gene families encoding extracellular proteins, notably different classes of proteases. Among the genes specific of A. euteiches are members of a new family of extracellular proteins putatively involved in adhesion, containing up to four protein domains similar to fungal cellulose binding domains. Comparison of A. euteiches sequences with proteomes of fully sequenced eukaryotic pathogens, including fungi, apicomplexa and trypanosomatids, allowed the identification of A. euteiches genes with close orthologs in these microorganisms but absent in other oomycetes sequenced so far, notably transporters and non-ribosomal peptide synthetases, and suggests the presence of a defense mechanism against oxidative stress which was initially characterized in the pathogenic trypanosomatids.

  6. Aminoacyl-tRNA synthetases database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewski, J

    2000-01-01

    The aminoacyl-tRNA synthetases (AARS) are a diverse group of enzymes that ensure the fidelity of transfer of genetic information from DNA into protein. They catalyse the attachment of amino acids to transfer RNAs and thereby establish the rules of the genetic code by virtue of matching the nucleotide triplet of the anticodon with its cognate amino acid. Currently, 818 AARS primary structures have been reported from archaebacteria, eubacteria, mitochondria, chloro-plasts and eukaryotic cells. The database is a compilation of the amino acid sequences of all AARSs, known to date, which are available as separate entries or alignments of related proteins via the WWW at http://rose.man.poznan.pl/aars/index.html

  7. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    Science.gov (United States)

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  8. CCDB: a curated database of genes involved in cervix cancer.

    Science.gov (United States)

    Agarwal, Subhash M; Raghav, Dhwani; Singh, Harinder; Raghava, G P S

    2011-01-01

    The Cervical Cancer gene DataBase (CCDB, http://crdd.osdd.net/raghava/ccdb) is a manually curated catalog of experimentally validated genes that are thought, or are known to be involved in the different stages of cervical carcinogenesis. In spite of the large women population that is presently affected from this malignancy still at present, no database exists that catalogs information on genes associated with cervical cancer. Therefore, we have compiled 537 genes in CCDB that are linked with cervical cancer causation processes such as methylation, gene amplification, mutation, polymorphism and change in expression level, as evident from published literature. Each record contains details related to gene like architecture (exon-intron structure), location, function, sequences (mRNA/CDS/protein), ontology, interacting partners, homology to other eukaryotic genomes, structure and links to other public databases, thus augmenting CCDB with external data. Also, manually curated literature references have been provided to support the inclusion of the gene in the database and establish its association with cervix cancer. In addition, CCDB provides information on microRNA altered in cervical cancer as well as search facility for querying, several browse options and an online tool for sequence similarity search, thereby providing researchers with easy access to the latest information on genes involved in cervix cancer.

  9. Neural/Bayes network predictor for inheritable cardiac disease pathogenicity and phenotype.

    Science.gov (United States)

    Burghardt, Thomas P; Ajtai, Katalin

    2018-04-11

    The cardiac muscle sarcomere contains multiple proteins contributing to contraction energy transduction and its regulation during a heartbeat. Inheritable heart disease mutants affect most of them but none more frequently than the ventricular myosin motor and cardiac myosin binding protein c (mybpc3). These co-localizing proteins have mybpc3 playing a regulatory role to the energy transducing motor. Residue substitution and functional domain assignment of each mutation in the protein sequence decides, under the direction of a sensible disease model, phenotype and pathogenicity. The unknown model mechanism is decided here using a method combing neural and Bayes networks. Missense single nucleotide polymorphisms (SNPs) are clues for the disease mechanism summarized in an extensive database collecting mutant sequence location and residue substitution as independent variables that imply the dependent disease phenotype and pathogenicity characteristics in 4 dimensional data points (4ddps). The SNP database contains entries with the majority having one or both dependent data entries unfulfilled. A neural network relating causes (mutant residue location and substitution) and effects (phenotype and pathogenicity) is trained, validated, and optimized using fulfilled 4ddps. It then predicts unfulfilled 4ddps providing the implicit disease model. A discrete Bayes network interprets fulfilled and predicted 4ddps with conditional probabilities for phenotype and pathogenicity given mutation location and residue substitution thus relating the neural network implicit model to explicit features of the motor and mybpc3 sequence and structural domains. Neural/Bayes network forecasting automates disease mechanism modeling by leveraging the world wide human missense SNP database that is in place and expanding. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  11. Characterization of 14-3-3 isoforms expressed in the Echinococcus granulosus pathogenic larval stage.

    Science.gov (United States)

    Teichmann, Aline; Vargas, Daiani M; Monteiro, Karina M; Meneghetti, Bruna V; Dutra, Cristine S; Paredes, Rodolfo; Galanti, Norbel; Zaha, Arnaldo; Ferreira, Henrique B

    2015-04-03

    The 14-3-3 protein family of eukaryotic regulators was studied in Echinococcus granulosus, the causative agent of cystic hydatid disease. These proteins mediate important cellular processes in eukaryotes and are expected to play important roles in parasite biology. Six isoforms of E. granulosus 14-3-3 genes and proteins (Eg14-3-3.1-6) were analyzed, and their phylogenetic relationships were established with bona fide 14-3-3 orthologous proteins from eukaryotic species. Eg14-3-3 isoforms with previous evidence of expression (Eg14-3-3.1-4) in E. granulosus pathogenic larval stage (metacestode) were cloned, and recombinant proteins were used for functional studies. These protein isoforms were detected in different components of E. granulosus metacestode, including interface components with the host. The roles that are played by Eg14-3-3 proteins in parasite biology were inferred from the repertoires of interacting proteins with each isoform, as assessed by gel overlay, cross-linking, and affinity chromatography assays. A total of 95 Eg14-3-3 protein ligands were identified by mass spectrometry. Eg14-3-3 isoforms have shared partners (44 proteins), indicating some overlapping functions; however, they also bind exclusive partners (51 proteins), suggesting Eg14-3-3 functional specialization. These ligand repertoires indicate the involvement of Eg14-3-3 proteins in multiple biochemical pathways in the E. granulosus metacestode and note some degree of isoform specialization.

  12. Visualizing Patterns of Marine Eukaryotic Diversity from Metabarcoding Data Using QIIME.

    Science.gov (United States)

    Leray, Matthieu; Knowlton, Nancy

    2016-01-01

    PCR amplification followed by deep sequencing of homologous gene regions is increasingly used to characterize the diversity and taxonomic composition of marine eukaryotic communities. This approach may generate millions of sequences for hundreds of samples simultaneously. Therefore, tools that researchers can use to visualize complex patterns of diversity for these massive datasets are essential. Efforts by microbiologists to understand the Earth and human microbiomes using high-throughput sequencing of the 16S rRNA gene has led to the development of several user-friendly, open-source software packages that can be similarly used to analyze eukaryotic datasets. Quantitative Insights Into Microbial Ecology (QIIME) offers some of the most helpful data visualization tools. Here, we describe functionalities to import OTU tables generated with any molecular marker (e.g., 18S, COI, ITS) and associated metadata into QIIME. We then present a range of analytical tools implemented within QIIME that can be used to obtain insights about patterns of alpha and beta diversity for marine eukaryotes.

  13. A second pathway to degrade pyrimidine nucleic acid precursors in eukaryotes

    DEFF Research Database (Denmark)

    Andersen, Gorm; Bjornberg, Olof; Polakova, Silvia

    2008-01-01

    Pyrimidine bases are the central precursors for RNA and DNA, and their intracellular pools are determined by de novo, salvage and catabolic pathways. In eukaryotes, degradation of uracil has been believed to proceed only via the reduction to dihydrouracil. Using a yeast model, Saccharomyces kluyv...... of the eukaryotic or prokaryotic genes involved in pyrimidine degradation described to date.......Pyrimidine bases are the central precursors for RNA and DNA, and their intracellular pools are determined by de novo, salvage and catabolic pathways. In eukaryotes, degradation of uracil has been believed to proceed only via the reduction to dihydrouracil. Using a yeast model, Saccharomyces......, respectively. The gene products of URC1 and URC4 are highly conserved proteins with so far unknown functions and they are present in a variety of prokaryotes and fungi. In bacteria and in some fungi, URC1 and URC4 are linked on the genome together with the gene for uracil phosphoribosyltransferase (URC6). Urc1...

  14. Prokaryotes versus Eukaryotes: Who is hosting whom?

    Directory of Open Access Journals (Sweden)

    Guillermo eTellez

    2014-10-01

    Full Text Available Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals’ actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a ‘forgotten organ’, functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short chain fatty acids, a process which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system,. Despite these important effects, the mechanisms by which the gut microbial community influences the host’s biology remains almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes which encourage us to postulate: Who is

  15. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  16. Database resources for the tuberculosis community.

    Science.gov (United States)

    Lew, Jocelyne M; Mao, Chunhong; Shukla, Maulik; Warren, Andrew; Will, Rebecca; Kuznetsov, Dmitry; Xenarios, Ioannis; Robertson, Brian D; Gordon, Stephen V; Schnappinger, Dirk; Cole, Stewart T; Sobral, Bruno

    2013-01-01

    Access to online repositories for genomic and associated "-omics" datasets is now an essential part of everyday research activity. It is important therefore that the Tuberculosis community is aware of the databases and tools available to them online, as well as for the database hosts to know what the needs of the research community are. One of the goals of the Tuberculosis Annotation Jamboree, held in Washington DC on March 7th-8th 2012, was therefore to provide an overview of the current status of three key Tuberculosis resources, TubercuList (tuberculist.epfl.ch), TB Database (www.tbdb.org), and Pathosystems Resource Integration Center (PATRIC, www.patricbrc.org). Here we summarize some key updates and upcoming features in TubercuList, and provide an overview of the PATRIC site and its online tools for pathogen RNA-Seq analysis. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Uncoupling of Sister Replisomes during Eukaryotic DNA Replication

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; Habuchi, Satoshi; van Oijen, Antoine M.; Walter, Johannes C.

    2010-01-01

    The duplication of eukaryotic genomes involves the replication of DNA from multiple origins of replication. In S phase, two sister replisomes assemble at each active origin, and they replicate DNA in opposite directions. Little is known about the functional relationship between sister replisomes.

  18. Molecular detection of eukaryotes in a single human stool sample from Senegal.

    Directory of Open Access Journals (Sweden)

    Ibrahim Hamad

    Full Text Available BACKGROUND: Microbial eukaryotes represent an important component of the human gut microbiome, with different beneficial or harmful roles; some species are commensal or mutualistic, whereas others are opportunistic or parasitic. The diversity of eukaryotes inhabiting humans remains relatively unexplored because of either the low abundance of these organisms in human gut or because they have received limited attention from a whole-community perspective. METHODOLOGY/PRINCIPAL FINDING: In this study, a single fecal sample from a healthy African male was studied using both culture-dependent methods and extended molecular methods targeting the 18S rRNA and ITS sequences. Our results revealed that very few fungi, including Candida spp., Galactomyces spp., and Trichosporon asahii, could be isolated using culture-based methods. In contrast, a relatively a high number of eukaryotic species could be identified in this fecal sample when culture-independent methods based on various primer sets were used. A total of 27 species from one sample were found among the 977 analyzed clones. The clone libraries were dominated by fungi (716 clones/977, 73.3%, corresponding to 16 different species. In addition, 187 sequences out of 977 (19.2% corresponded to 9 different species of plants; 59 sequences (6% belonged to other micro-eukaryotes in the gut, including Entamoeba hartmanni and Blastocystis sp; and only 15 clones/977 (1.5% were related to human 18S rRNA sequences. CONCLUSION: Our results revealed a complex eukaryotic community in the volunteer's gut, with fungi being the most abundant species in the stool sample. Larger investigations are needed to assess the generality of these results and to understand their roles in human health and disease.

  19. Structural analyses of Legionella LepB reveal a new GAP fold that catalytically mimics eukaryotic RasGAP.

    Science.gov (United States)

    Yu, Qin; Hu, Liyan; Yao, Qing; Zhu, Yongqun; Dong, Na; Wang, Da-Cheng; Shao, Feng

    2013-06-01

    Rab GTPases are emerging targets of diverse bacterial pathogens. Here, we perform biochemical and structural analyses of LepB, a Rab GTPase-activating protein (GAP) effector from Legionella pneumophila. We map LepB GAP domain to residues 313-618 and show that the GAP domain is Rab1 specific with a catalytic activity higher than the canonical eukaryotic TBC GAP and the newly identified VirA/EspG family of bacterial RabGAP effectors. Exhaustive mutation analyses identify Arg444 as the arginine finger, but no catalytically essential glutamine residues. Crystal structures of LepB313-618 alone and the GAP domain of Legionella drancourtii LepB in complex with Rab1-GDP-AlF3 support the catalytic role of Arg444, and also further reveal a 3D architecture and a GTPase-binding mode distinct from all known GAPs. Glu449, structurally equivalent to TBC RabGAP glutamine finger in apo-LepB, undergoes a drastic movement upon Rab1 binding, which induces Rab1 Gln70 side-chain flipping towards GDP-AlF3 through a strong ionic interaction. This conformationally rearranged Gln70 acts as the catalytic cis-glutamine, therefore uncovering an unexpected RasGAP-like catalytic mechanism for LepB. Our studies highlight an extraordinary structural and catalytic diversity of RabGAPs, particularly those from bacterial pathogens.

  20. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Neamphius huxleyi indicated by metagenomics

    Science.gov (United States)

    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun

    2014-01-01

    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Neamphius huxleyi at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Neamphius huxleyi. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Neamphius huxleyi. PMID:24463735

  1. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Lamellomorpha sp. indicated by metagenomics

    Science.gov (United States)

    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun

    2014-01-01

    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Lamellomorpha sp. at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Lamellomorpha sp.. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Lamellomorpha sp..

  2. Insights into the Initiation of Eukaryotic DNA Replication.

    Science.gov (United States)

    Bruck, Irina; Perez-Arnaiz, Patricia; Colbert, Max K; Kaplan, Daniel L

    2015-01-01

    The initiation of DNA replication is a highly regulated event in eukaryotic cells to ensure that the entire genome is copied once and only once during S phase. The primary target of cellular regulation of eukaryotic DNA replication initiation is the assembly and activation of the replication fork helicase, the 11-subunit assembly that unwinds DNA at a replication fork. The replication fork helicase, called CMG for Cdc45-Mcm2-7, and GINS, assembles in S phase from the constituent Cdc45, Mcm2-7, and GINS proteins. The assembly and activation of the CMG replication fork helicase during S phase is governed by 2 S-phase specific kinases, CDK and DDK. CDK stimulates the interaction between Sld2, Sld3, and Dpb11, 3 initiation factors that are each required for the initiation of DNA replication. DDK, on the other hand, phosphorylates the Mcm2, Mcm4, and Mcm6 subunits of the Mcm2-7 complex. Sld3 recruits Cdc45 to Mcm2-7 in a manner that depends on DDK, and recent work suggests that Sld3 binds directly to Mcm2-7 and also to single-stranded DNA. Furthermore, recent work demonstrates that Sld3 and its human homolog Treslin substantially stimulate DDK phosphorylation of Mcm2. These data suggest that the initiation factor Sld3/Treslin coordinates the assembly and activation of the eukaryotic replication fork helicase by recruiting Cdc45 to Mcm2-7, stimulating DDK phosphorylation of Mcm2, and binding directly to single-stranded DNA as the origin is melted.

  3. A metagenome for lacustrine Cladophora (Cladophorales) reveals remarkable diversity of eukaryotic epibionts and genes relevant to materials cycling.

    Science.gov (United States)

    Graham, Linda E; Knack, Jennifer J; Graham, Melissa E; Graham, James M; Zulkifly, Shahrizim

    2015-06-01

    Periphyton dominated by the cellulose-rich filamentous green alga Cladophora forms conspicuous growths along rocky marine and freshwater shorelines worldwide, providing habitat for diverse epibionts. Bacterial epibionts have been inferred to display diverse functions of biogeochemical significance: N-fixation and other redox reactions, phosphorus accumulation, and organic degradation. Here, we report taxonomic diversity of eukaryotic and prokaryotic epibionts and diversity of genes associated with materials cycling in a Cladophora metagenome sampled from Lake Mendota, Dane Co., WI, USA, during the growing season of 2012. A total of 1,060 distinct 16S, 173 18S, and 351 28S rRNA operational taxonomic units, from which >220 genera or species of bacteria (~60), protists (~80), fungi (6), and microscopic metazoa (~80), were distinguished with the use of reference databases. We inferred the presence of several algal taxa generally associated with marine systems and detected Jaoa, a freshwater periphytic ulvophyte previously thought endemic to China. We identified six distinct nifH gene sequences marking nitrogen fixation, >25 bacterial and eukaryotic cellulases relevant to sedimentary C-cycling and technological applications, and genes encoding enzymes in aerobic and anaerobic pathways for vitamin B12 biosynthesis. These results emphasize the importance of Cladophora in providing habitat for microscopic metazoa, fungi, protists, and bacteria that are often inconspicuous, yet play important roles in ecosystem biogeochemistry. © 2015 Phycological Society of America.

  4. Intermediary metabolism in protists: a sequence-based view of facultative anaerobic metabolism in evolutionarily diverse eukaryotes.

    Science.gov (United States)

    Ginger, Michael L; Fritz-Laylin, Lillian K; Fulton, Chandler; Cande, W Zacheus; Dawson, Scott C

    2010-12-01

    Protists account for the bulk of eukaryotic diversity. Through studies of gene and especially genome sequences the molecular basis for this diversity can be determined. Evident from genome sequencing are examples of versatile metabolism that go far beyond the canonical pathways described for eukaryotes in textbooks. In the last 2-3 years, genome sequencing and transcript profiling has unveiled several examples of heterotrophic and phototrophic protists that are unexpectedly well-equipped for ATP production using a facultative anaerobic metabolism, including some protists that can (Chlamydomonas reinhardtii) or are predicted (Naegleria gruberi, Acanthamoeba castellanii, Amoebidium parasiticum) to produce H(2) in their metabolism. It is possible that some enzymes of anaerobic metabolism were acquired and distributed among eukaryotes by lateral transfer, but it is also likely that the common ancestor of eukaryotes already had far more metabolic versatility than was widely thought a few years ago. The discussion of core energy metabolism in unicellular eukaryotes is the subject of this review. Since genomic sequencing has so far only touched the surface of protist diversity, it is anticipated that sequences of additional protists may reveal an even wider range of metabolic capabilities, while simultaneously enriching our understanding of the early evolution of eukaryotes. Copyright © 2010 Elsevier GmbH. All rights reserved.

  5. Transcriptomic insight into pathogenicity-associated factors of Conidiobolus obscurus, an obligate aphid-pathogenic fungus belonging to Entomopthoromycota.

    Science.gov (United States)

    Wang, Jianghong; Zhou, Xiang; Guo, Kai; Zhang, Xinqi; Lin, Haiping; Montalva, Cristian

    2018-01-16

    Conidiobolus obscurus is a widespread fungal entomopathogen with aphid biocontrol potential. This study focused on a de novo transcriptomic analysis of C. obscurus. A number of pathogenicity-associated factors were annotated for the first time from the assembled 17 231 fungal unigenes, including those encoding subtilisin-like proteolytic enzymes (Pr1s), trypsin-like proteases, metalloproteases, carboxypeptidases and endochitinases. Many of these genes were transcriptionally up-regulated by at least twofold in mycotized cadavers compared with the in vitro fungal cultures. The resultant transcriptomic database was validated by the transcript levels of three selected pathogenicity-related genes quantified from different in vivo and in vitro material in real-time quantitative polymerase chain reaction (PCR). The involvement of multiple Pr1 proteases in the first stage of fungal infection was also suggested. Interestingly, a unique cytolytic (Cyt)-like δ-endotoxin gene was highly expressed in both mycotized cadavers and fungal cultures, and was more or less distinct from its homologues in bacteria and other fungi. Our findings provide the first global insight into various pathogenicity-related genes in this obligate aphid pathogen and may help to develop novel biocontrol strategy against aphid pests. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  6. Mapping and characterizing N6-methyladenine in eukaryotic genomes using single molecule real-time sequencing.

    Science.gov (United States)

    Zhu, Shijia; Beaulaurier, John; Deikus, Gintaras; Wu, Tao; Strahl, Maya; Hao, Ziyang; Luo, Guanzheng; Gregory, James A; Chess, Andrew; He, Chuan; Xiao, Andrew; Sebra, Robert; Schadt, Eric E; Fang, Gang

    2018-05-15

    N6-methyladenine (m6dA) has been discovered as a novel form of DNA methylation prevalent in eukaryotes, however, methods for high resolution mapping of m6dA events are still lacking. Single-molecule real-time (SMRT) sequencing has enabled the detection of m6dA events at single-nucleotide resolution in prokaryotic genomes, but its application to detecting m6dA in eukaryotic genomes has not been rigorously examined. Herein, we identified unique characteristics of eukaryotic m6dA methylomes that fundamentally differ from those of prokaryotes. Based on these differences, we describe the first approach for mapping m6dA events using SMRT sequencing specifically designed for the study of eukaryotic genomes, and provide appropriate strategies for designing experiments and carrying out sequencing in future studies. We apply the novel approach to study two eukaryotic genomes. For green algae, we construct the first complete genome-wide map of m6dA at single nucleotide and single molecule resolution. For human lymphoblastoid cells (hLCLs), joint analyses of SMRT sequencing and independent sequencing data suggest that putative m6dA events are enriched in the promoters of young, full length LINE-1 elements (L1s). These analyses demonstrate a general method for rigorous mapping and characterization of m6dA events in eukaryotic genomes. Published by Cold Spring Harbor Laboratory Press.

  7. Machine learning for the meta-analyses of microbial pathogens' volatile signatures.

    Science.gov (United States)

    Palma, Susana I C J; Traguedo, Ana P; Porteira, Ana R; Frias, Maria J; Gamboa, Hugo; Roque, Ana C A

    2018-02-20

    Non-invasive and fast diagnostic tools based on volatolomics hold great promise in the control of infectious diseases. However, the tools to identify microbial volatile organic compounds (VOCs) discriminating between human pathogens are still missing. Artificial intelligence is increasingly recognised as an essential tool in health sciences. Machine learning algorithms based in support vector machines and features selection tools were here applied to find sets of microbial VOCs with pathogen-discrimination power. Studies reporting VOCs emitted by human microbial pathogens published between 1977 and 2016 were used as source data. A set of 18 VOCs is sufficient to predict the identity of 11 microbial pathogens with high accuracy (77%), and precision (62-100%). There is one set of VOCs associated with each of the 11 pathogens which can predict the presence of that pathogen in a sample with high accuracy and precision (86-90%). The implemented pathogen classification methodology supports future database updates to include new pathogen-VOC data, which will enrich the classifiers. The sets of VOCs identified potentiate the improvement of the selectivity of non-invasive infection diagnostics using artificial olfaction devices.

  8. A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.

    Science.gov (United States)

    Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G

    2015-05-21

    Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  10. Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

    Science.gov (United States)

    Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

    2009-04-01

    Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

  11. Oxygenation of the Mesoproterozoic ocean and the evolution of complex eukaryotes

    Science.gov (United States)

    Zhang, Kan; Zhu, Xiangkun; Wood, Rachel A.; Shi, Yao; Gao, Zhaofu; Poulton, Simon W.

    2018-05-01

    The Mesoproterozoic era (1,600-1,000 million years ago (Ma)) has long been considered a period of relative environmental stasis, with persistently low levels of atmospheric oxygen. There remains much uncertainty, however, over the evolution of ocean chemistry during this period, which may have been of profound significance for the early evolution of eukaryotic life. Here we present rare earth element, iron-speciation and inorganic carbon isotope data to investigate the redox evolution of the 1,600-1,550 Ma Yanliao Basin, North China Craton. These data confirm that the ocean at the start of the Mesoproterozoic was dominantly anoxic and ferruginous. Significantly, however, we find evidence for a progressive oxygenation event starting at 1,570 Ma, immediately prior to the occurrence of complex multicellular eukaryotes in shelf areas of the Yanliao Basin. Our study thus demonstrates that oxygenation of the Mesoproterozoic environment was far more dynamic and intense than previously envisaged, and establishes an important link between rising oxygen and the emerging record of diverse, multicellular eukaryotic life in the early Mesoproterozoic.

  12. Tracking the rise of eukaryotes to ecological dominance with zinc isotopes.

    Science.gov (United States)

    Isson, Terry T; Love, Gordon D; Dupont, Christopher L; Reinhard, Christopher T; Zumberge, Alex J; Asael, Dan; Gueguen, Bleuenn; McCrow, John; Gill, Ben C; Owens, Jeremy; Rainbird, Robert H; Rooney, Alan D; Zhao, Ming-Yu; Stueeken, Eva E; Konhauser, Kurt O; John, Seth G; Lyons, Timothy W; Planavsky, Noah J

    2018-06-05

    The biogeochemical cycling of zinc (Zn) is intimately coupled with organic carbon in the ocean. Based on an extensive new sedimentary Zn isotope record across Earth's history, we provide evidence for a fundamental shift in the marine Zn cycle ~800 million years ago. We discuss a wide range of potential drivers for this transition and propose that, within available constraints, a restructuring of marine ecosystems is the most parsimonious explanation for this shift. Using a global isotope mass balance approach, we show that a change in the organic Zn/C ratio is required to account for observed Zn isotope trends through time. Given the higher affinity of eukaryotes for Zn relative to prokaryotes, we suggest that a shift toward a more eukaryote-rich ecosystem could have provided a means of more efficiently sequestering organic-derived Zn. Despite the much earlier appearance of eukaryotes in the microfossil record (~1700 to 1600 million years ago), our data suggest a delayed rise to ecological prominence during the Neoproterozoic, consistent with the currently accepted organic biomarker records. © 2018 John Wiley & Sons Ltd.

  13. Proton-pumping rhodopsins are abundantly expressed by microbial eukaryotes in a high-Arctic fjord.

    Science.gov (United States)

    Vader, Anna; Laughinghouse, Haywood D; Griffiths, Colin; Jakobsen, Kjetill S; Gabrielsen, Tove M

    2018-02-01

    Proton-pumping rhodopsins provide an alternative pathway to photosynthesis by which solar energy can enter the marine food web. Rhodopsin genes are widely found in marine bacteria, also in the Arctic, and were recently reported from several eukaryotic lineages. So far, little is known about rhodopsin expression in Arctic eukaryotes. In this study, we used metatranscriptomics and 18S rDNA tag sequencing to examine the mid-summer function and composition of marine protists (size 0.45-10 µm) in the high-Arctic Billefjorden (Spitsbergen), especially focussing on the expression of microbial proton-pumping rhodopsins. Rhodopsin transcripts were highly abundant, at a level similar to that of genes involved in photosynthesis. Phylogenetic analyses placed the environmental rhodopsins within disparate eukaryotic lineages, including dinoflagellates, stramenopiles, haptophytes and cryptophytes. Sequence comparison indicated the presence of several functional types, including xanthorhodopsins and a eukaryotic clade of proteorhodopsin. Transcripts belonging to the proteorhodopsin clade were also abundant in published metatranscriptomes from other oceanic regions, suggesting a global distribution. The diversity and abundance of rhodopsins show that these light-driven proton pumps play an important role in Arctic microbial eukaryotes. Understanding this role is imperative to predicting the future of the Arctic marine ecosystem faced by a changing light climate due to diminishing sea-ice. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  14. Genome-wide analyses and functional classification of proline repeat-rich proteins: potential role of eIF5A in eukaryotic evolution.

    Directory of Open Access Journals (Sweden)

    Ajeet Mandal

    Full Text Available The eukaryotic translation factor, eIF5A has been recently reported as a sequence-specific elongation factor that facilitates peptide bond formation at consecutive prolines in Saccharomyces cerevisiae, as its ortholog elongation factor P (EF-P does in bacteria. We have searched the genome databases of 35 representative organisms from six kingdoms of life for PPP (Pro-Pro-Pro and/or PPG (Pro-Pro-Gly-encoding genes whose expression is expected to depend on eIF5A. We have made detailed analyses of proteome data of 5 selected species, Escherichia coli, Saccharomyces cerevisiae, Drosophila melanogaster, Mus musculus and Homo sapiens. The PPP and PPG motifs are low in the prokaryotic proteomes. However, their frequencies markedly increase with the biological complexity of eukaryotic organisms, and are higher in newly derived proteins than in those orthologous proteins commonly shared in all species. Ontology classifications of S. cerevisiae and human genes encoding the highest level of polyprolines reveal their strong association with several specific biological processes, including actin/cytoskeletal associated functions, RNA splicing/turnover, DNA binding/transcription and cell signaling. Previously reported phenotypic defects in actin polarity and mRNA decay of eIF5A mutant strains are consistent with the proposed role for eIF5A in the translation of the polyproline-containing proteins. Of all the amino acid tandem repeats (≥3 amino acids, only the proline repeat frequency correlates with functional complexity of the five organisms examined. Taken together, these findings suggest the importance of proline repeat-rich proteins and a potential role for eIF5A and its hypusine modification pathway in the course of eukaryotic evolution.

  15. Phylogenetic analysis of P5 P-type ATPases, a eukaryotic lineage of secretory pathway pumps

    DEFF Research Database (Denmark)

    Møller, Annette; Asp, Torben; Holm, Preben Bach

    2008-01-01

    prokaryotic genome. Based on a protein alignment we could group the P5 ATPases into two subfamilies, P5A and P5B that, based on the number of negative charges in conserved trans-membrane segment 4, are likely to have different ion specificities. P5A ATPases are present in all eukaryotic genomes sequenced so......Eukaryotes encompass a remarkable variety of organisms and unresolved lineages. Different phylogenetic analyses have lead to conflicting conclusions as to the origin and associations between lineages and species. In this work, we investigated evolutionary relationship of a family of cation pumps...... exclusive for the secretory pathway of eukaryotes by combining the identification of lineage-specific genes with phylogenetic evolution of common genes. Sequences of P5 ATPases, which are regarded to be cation pumps in the endoplasmic reticulum (ER), were identified in all eukaryotic lineages but not in any...

  16. The PDB database is a rich source of alpha-helical anti-microbial peptides to combat disease causing pathogens [version 2; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Sandeep Chakraborty

    2015-06-01

    Full Text Available The therapeutic potential of α-helical anti-microbial peptides (AH-AMP to combat pathogens is fast gaining prominence. Based on recently published open access software for characterizing α-helical peptides (PAGAL, we elucidate a search methodology (SCALPEL that leverages the massive structural data pre-existing in the PDB database to obtain AH-AMPs belonging to the host proteome. We provide in vitro validation of SCALPEL on plant pathogens (Xylella fastidiosa, Xanthomonas arboricola and Liberibacter crescens by identifying AH-AMPs that mirror the function and properties of cecropin B, a well-studied AH-AMP. The identified peptides include a linear AH-AMP present within the existing structure of phosphoenolpyruvate carboxylase (PPC20, and an AH-AMP mimicing the properties of the two α-helices of cecropin B from chitinase (CHITI25. The minimum inhibitory concentration of these peptides are comparable to that of cecropin B, while anionic peptides used as control failed to show any inhibitory effect on these pathogens. Substitute therapies in place of conventional chemotherapies using membrane permeabilizing peptides like these might also prove effective to target cancer cells. The use of native structures from the same organism could possibly ensure that administration of such peptides will be better tolerated and not elicit an adverse immune response. We suggest a similar approach to target Ebola epitopes, enumerated using PAGAL recently, by selecting suitable peptides from the human proteome, especially in wake of recent reports of cationic amphiphiles inhibiting virus entry and infection.

  17. Consistent mutational paths predict eukaryotic thermostability

    Directory of Open Access Journals (Sweden)

    van Noort Vera

    2013-01-01

    Full Text Available Abstract Background Proteomes of thermophilic prokaryotes have been instrumental in structural biology and successfully exploited in biotechnology, however many proteins required for eukaryotic cell function are absent from bacteria or archaea. With Chaetomium thermophilum, Thielavia terrestris and Thielavia heterothallica three genome sequences of thermophilic eukaryotes have been published. Results Studying the genomes and proteomes of these thermophilic fungi, we found common strategies of thermal adaptation across the different kingdoms of Life, including amino acid biases and a reduced genome size. A phylogenetics-guided comparison of thermophilic proteomes with those of other, mesophilic Sordariomycetes revealed consistent amino acid substitutions associated to thermophily that were also present in an independent lineage of thermophilic fungi. The most consistent pattern is the substitution of lysine by arginine, which we could find in almost all lineages but has not been extensively used in protein stability engineering. By exploiting mutational paths towards the thermophiles, we could predict particular amino acid residues in individual proteins that contribute to thermostability and validated some of them experimentally. By determining the three-dimensional structure of an exemplar protein from C. thermophilum (Arx1, we could also characterise the molecular consequences of some of these mutations. Conclusions The comparative analysis of these three genomes not only enhances our understanding of the evolution of thermophily, but also provides new ways to engineer protein stability.

  18. Signaling mechanisms of apoptosis-like programmed cell death in unicellular eukaryotes.

    Science.gov (United States)

    Shemarova, Irina V

    2010-04-01

    In unicellular eukaryotes, apoptosis-like cell death occurs during development, aging and reproduction, and can be induced by environmental stresses and exposure to toxic agents. The essence of the apoptotic machinery in unicellular organisms is similar to that in mammals, but the apoptotic signal network is less complex and of more ancient origin. The review summarizes current data about key apoptotic proteins and mechanisms of the transduction of apoptotic signals by caspase-like proteases and mitochondrial apoptogenic proteins in unicellular eukaryotes. The roles of receptor-dependent and receptor-independent caspase cascades are reviewed. 2010 Elsevier Inc. All rights reserved.

  19. ChlamyCyc: an integrative systems biology database and web-portal for Chlamydomonas reinhardtii.

    Science.gov (United States)

    May, Patrick; Christian, Jan-Ole; Kempa, Stefan; Walther, Dirk

    2009-05-04

    The unicellular green alga Chlamydomonas reinhardtii is an important eukaryotic model organism for the study of photosynthesis and plant growth. In the era of modern high-throughput technologies there is an imperative need to integrate large-scale data sets from high-throughput experimental techniques using computational methods and database resources to provide comprehensive information about the molecular and cellular organization of a single organism. In the framework of the German Systems Biology initiative GoFORSYS, a pathway database and web-portal for Chlamydomonas (ChlamyCyc) was established, which currently features about 250 metabolic pathways with associated genes, enzymes, and compound information. ChlamyCyc was assembled using an integrative approach combining the recently published genome sequence, bioinformatics methods, and experimental data from metabolomics and proteomics experiments. We analyzed and integrated a combination of primary and secondary database resources, such as existing genome annotations from JGI, EST collections, orthology information, and MapMan classification. ChlamyCyc provides a curated and integrated systems biology repository that will enable and assist in systematic studies of fundamental cellular processes in Chlamydomonas. The ChlamyCyc database and web-portal is freely available under http://chlamycyc.mpimp-golm.mpg.de.

  20. Biotransformation of arsenic by a Yellowstone thermoacidophilic eukaryotic alga.

    Science.gov (United States)

    Qin, Jie; Lehr, Corinne R; Yuan, Chungang; Le, X Chris; McDermott, Timothy R; Rosen, Barry P

    2009-03-31

    Arsenic is the most common toxic substance in the environment, ranking first on the Superfund list of hazardous substances. It is introduced primarily from geochemical sources and is acted on biologically, creating an arsenic biogeocycle. Geothermal environments are known for their elevated arsenic content and thus provide an excellent setting in which to study microbial redox transformations of arsenic. To date, most studies of microbial communities in geothermal environments have focused on Bacteria and Archaea, with little attention to eukaryotic microorganisms. Here, we show the potential of an extremophilic eukaryotic alga of the order Cyanidiales to influence arsenic cycling at elevated temperatures. Cyanidioschyzon sp. isolate 5508 oxidized arsenite [As(III)] to arsenate [As(V)], reduced As(V) to As(III), and methylated As(III) to form trimethylarsine oxide (TMAO) and dimethylarsenate [DMAs(V)]. Two arsenic methyltransferase genes, CmarsM7 and CmarsM8, were cloned from this organism and demonstrated to confer resistance to As(III) in an arsenite hypersensitive strain of Escherichia coli. The 2 recombinant CmArsMs were purified and shown to transform As(III) into monomethylarsenite, DMAs(V), TMAO, and trimethylarsine gas, with a T(opt) of 60-70 degrees C. These studies illustrate the importance of eukaryotic microorganisms to the biogeochemical cycling of arsenic in geothermal systems, offer a molecular explanation for how these algae tolerate arsenic in their environment, and provide the characterization of algal methyltransferases.

  1. Methyl labeling and TROSY NMR spectroscopy of proteins expressed in the eukaryote Pichia pastoris

    International Nuclear Information System (INIS)

    Clark, Lindsay; Zahm, Jacob A.; Ali, Rustam; Kukula, Maciej; Bian, Liangqiao; Patrie, Steven M.; Gardner, Kevin H.; Rosen, Michael K.; Rosenbaum, Daniel M.

    2015-01-01

    13 C Methyl TROSY NMR spectroscopy has emerged as a powerful method for studying the dynamics of large systems such as macromolecular assemblies and membrane proteins. Specific 13 C labeling of aliphatic methyl groups and perdeuteration has been limited primarily to proteins expressed in E. coli, preventing studies of many eukaryotic proteins of physiological and biomedical significance. We demonstrate the feasibility of efficient 13 C isoleucine δ1-methyl labeling in a deuterated background in an established eukaryotic expression host, Pichia pastoris, and show that this method can be used to label the eukaryotic protein actin, which cannot be expressed in bacteria. This approach will enable NMR studies of previously intractable targets

  2. Evolution of an intricate J-protein network driving protein disaggregation in eukaryotes.

    Science.gov (United States)

    Nillegoda, Nadinath B; Stank, Antonia; Malinverni, Duccio; Alberts, Niels; Szlachcic, Anna; Barducci, Alessandro; De Los Rios, Paolo; Wade, Rebecca C; Bukau, Bernd

    2017-05-15

    Hsp70 participates in a broad spectrum of protein folding processes extending from nascent chain folding to protein disaggregation. This versatility in function is achieved through a diverse family of J-protein cochaperones that select substrates for Hsp70. Substrate selection is further tuned by transient complexation between different classes of J-proteins, which expands the range of protein aggregates targeted by metazoan Hsp70 for disaggregation. We assessed the prevalence and evolutionary conservation of J-protein complexation and cooperation in disaggregation. We find the emergence of a eukaryote-specific signature for interclass complexation of canonical J-proteins. Consistently, complexes exist in yeast and human cells, but not in bacteria, and correlate with cooperative action in disaggregation in vitro. Signature alterations exclude some J-proteins from networking, which ensures correct J-protein pairing, functional network integrity and J-protein specialization. This fundamental change in J-protein biology during the prokaryote-to-eukaryote transition allows for increased fine-tuning and broadening of Hsp70 function in eukaryotes.

  3. Potential human pathogenic bacteria in a mixed urban watershed as revealed by pyrosequencing.

    Directory of Open Access Journals (Sweden)

    A Mark Ibekwe

    Full Text Available Current microbial source tracking (MST methods for water depend on testing for fecal indicator bacterial counts or specific marker gene sequences to identify fecal contamination where potential human pathogenic bacteria could be present. In this study, we applied 454 high-throughput pyrosequencing to identify bacterial pathogen DNA sequences, including those not traditionally monitored by MST and correlated their abundances to specific sources of contamination such as urban runoff and agricultural runoff from concentrated animal feeding operations (CAFOs, recreation park area, waste-water treatment plants, and natural sites with little or no human activities. Samples for pyrosequencing were surface water, and sediment collected from 19 sites. A total of 12,959 16S rRNA gene sequences with average length of ≤400 bp were obtained, and were assigned to corresponding taxonomic ranks using ribosomal database project (RDP, Classifier and Greengenes databases. The percent of total potential pathogens were highest in urban runoff water (7.94%, agricultural runoff sediment (6.52%, and Prado Park sediment (6.00%, respectively. Although the numbers of DNA sequence tags from pyrosequencing were very high for the natural site, corresponding percent potential pathogens were very low (3.78-4.08%. Most of the potential pathogenic bacterial sequences identified were from three major phyla, namely, Proteobacteria, Bacteroidetes, and Firmicutes. The use of deep sequencing may provide improved and faster methods for the identification of pathogen sources in most watersheds so that better risk assessment methods may be developed to enhance public health.

  4. An algorithm for detecting eukaryotic sequences in metagenomic ...

    Indian Academy of Sciences (India)

    species but also from accidental contamination from the genome of eukaryotic host cells. The latter scenario generally occurs in the case of host-associated metagenomes, e.g. microbes living in human gut. In such cases, one needs to identify and remove contaminating host DNA sequences, since the latter sequences will ...

  5. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Neamphius huxleyi [corrected]. indicated by metagenomics.

    Science.gov (United States)

    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun

    2014-01-27

    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Neamphius huxleyi [corrected] . at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Neamphius huxleyi [corrected]. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Neamphius huxleyi [corrected].

  6. Lateral transfer of tetrahymanol-synthesizing genes has allowed multiple diverse eukaryote lineages to independently adapt to environments without oxygen

    Directory of Open Access Journals (Sweden)

    Takishita Kiyotaka

    2012-02-01

    Full Text Available Abstract Sterols are key components of eukaryotic cellular membranes that are synthesized by multi-enzyme pathways that require molecular oxygen. Because prokaryotes fundamentally lack sterols, it is unclear how the vast diversity of bacterivorous eukaryotes that inhabit hypoxic environments obtain, or synthesize, sterols. Here we show that tetrahymanol, a triterpenoid that does not require molecular oxygen for its biosynthesis, likely functions as a surrogate of sterol in eukaryotes inhabiting oxygen-poor environments. Genes encoding the tetrahymanol synthesizing enzyme squalene-tetrahymanol cyclase were found from several phylogenetically diverged eukaryotes that live in oxygen-poor environments and appear to have been laterally transferred among such eukaryotes. Reviewers This article was reviewed by Eric Bapteste and Eugene Koonin.

  7. Potential of industrial biotechnology with cyanobacteria and eukaryotic microalgae.

    NARCIS (Netherlands)

    Wijffels, R.H.; Kruse, O.; Hellingwerf, K.J.

    2013-01-01

    Both cyanobacteria and eukaryotic microalgae are promising organisms for sustainable production of bulk products such as food, feed, materials, chemicals and fuels. In this review we will summarize the potential and current biotechnological developments. Cyanobacteria are promising host organisms

  8. Genome-wide mapping reveals single-origin chromosome replication in Leishmania, a eukaryotic microbe.

    Science.gov (United States)

    Marques, Catarina A; Dickens, Nicholas J; Paape, Daniel; Campbell, Samantha J; McCulloch, Richard

    2015-10-19

    DNA replication initiates on defined genome sites, termed origins. Origin usage appears to follow common rules in the eukaryotic organisms examined to date: all chromosomes are replicated from multiple origins, which display variations in firing efficiency and are selected from a larger pool of potential origins. To ask if these features of DNA replication are true of all eukaryotes, we describe genome-wide origin mapping in the parasite Leishmania. Origin mapping in Leishmania suggests a striking divergence in origin usage relative to characterized eukaryotes, since each chromosome appears to be replicated from a single origin. By comparing two species of Leishmania, we find evidence that such origin singularity is maintained in the face of chromosome fusion or fission events during evolution. Mapping Leishmania origins suggests that all origins fire with equal efficiency, and that the genomic sites occupied by origins differ from related non-origins sites. Finally, we provide evidence that origin location in Leishmania displays striking conservation with Trypanosoma brucei, despite the latter parasite replicating its chromosomes from multiple, variable strength origins. The demonstration of chromosome replication for a single origin in Leishmania, a microbial eukaryote, has implications for the evolution of origin multiplicity and associated controls, and may explain the pervasive aneuploidy that characterizes Leishmania chromosome architecture.

  9. Potential of industrial biotechnology with cyanobacteria and eukaryotic microalgae

    NARCIS (Netherlands)

    Wijffels, R.H.; Kruse, O.; Hellingwerf, K.J.

    2013-01-01

    Both cyanobacteria and eukaryotic microalgae are promising organisms for sustainable production of bulk products such as food, feed, materials, chemicals and fuels. In this review we will summarize the potential and current biotechnological developments.Cyanobacteria are promising host organisms for

  10. A reference methylome database and analysis pipeline to facilitate integrative and comparative epigenomics.

    Directory of Open Access Journals (Sweden)

    Qiang Song

    Full Text Available DNA methylation is implicated in a surprising diversity of regulatory, evolutionary processes and diseases in eukaryotes. The introduction of whole-genome bisulfite sequencing has enabled the study of DNA methylation at a single-base resolution, revealing many new aspects of DNA methylation and highlighting the usefulness of methylome data in understanding a variety of genomic phenomena. As the number of publicly available whole-genome bisulfite sequencing studies reaches into the hundreds, reliable and convenient tools for comparing and analyzing methylomes become increasingly important. We present MethPipe, a pipeline for both low and high-level methylome analysis, and MethBase, an accompanying database of annotated methylomes from the public domain. Together these resources enable researchers to extract interesting features from methylomes and compare them with those identified in public methylomes in our database.

  11. epiPATH: an information system for the storage and management of molecular epidemiology data from infectious pathogens

    Directory of Open Access Journals (Sweden)

    González-Candelas Fernando

    2007-04-01

    Full Text Available Abstract Background Most research scientists working in the fields of molecular epidemiology, population and evolutionary genetics are confronted with the management of large volumes of data. Moreover, the data used in studies of infectious diseases are complex and usually derive from different institutions such as hospitals or laboratories. Since no public database scheme incorporating clinical and epidemiological information about patients and molecular information about pathogens is currently available, we have developed an information system, composed by a main database and a web-based interface, which integrates both types of data and satisfies requirements of good organization, simple accessibility, data security and multi-user support. Results From the moment a patient arrives to a hospital or health centre until the processing and analysis of molecular sequences obtained from infectious pathogens in the laboratory, lots of information is collected from different sources. We have divided the most relevant data into 12 conceptual modules around which we have organized the database schema. Our schema is very complete and it covers many aspects of sample sources, samples, laboratory processes, molecular sequences, phylogenetics results, clinical tests and results, clinical information, treatments, pathogens, transmissions, outbreaks and bibliographic information. Communication between end-users and the selected Relational Database Management System (RDMS is carried out by default through a command-line window or through a user-friendly, web-based interface which provides access and management tools for the data. Conclusion epiPATH is an information system for managing clinical and molecular information from infectious diseases. It facilitates daily work related to infectious pathogens and sequences obtained from them. This software is intended for local installation in order to safeguard private data and provides advanced SQL-users the

  12. The reduced kinome of Ostreococcus tauri: core eukaryotic signalling components in a tractable model species.

    Science.gov (United States)

    Hindle, Matthew M; Martin, Sarah F; Noordally, Zeenat B; van Ooijen, Gerben; Barrios-Llerena, Martin E; Simpson, T Ian; Le Bihan, Thierry; Millar, Andrew J

    2014-08-02

    The current knowledge of eukaryote signalling originates from phenotypically diverse organisms. There is a pressing need to identify conserved signalling components among eukaryotes, which will lead to the transfer of knowledge across kingdoms. Two useful properties of a eukaryote model for signalling are (1) reduced signalling complexity, and (2) conservation of signalling components. The alga Ostreococcus tauri is described as the smallest free-living eukaryote. With less than 8,000 genes, it represents a highly constrained genomic palette. Our survey revealed 133 protein kinases and 34 protein phosphatases (1.7% and 0.4% of the proteome). We conducted phosphoproteomic experiments and constructed domain structures and phylogenies for the catalytic protein-kinases. For each of the major kinases families we review the completeness and divergence of O. tauri representatives in comparison to the well-studied kinomes of the laboratory models Arabidopsis thaliana and Saccharomyces cerevisiae, and of Homo sapiens. Many kinase clades in O. tauri were reduced to a single member, in preference to the loss of family diversity, whereas TKL and ABC1 clades were expanded. We also identified kinases that have been lost in A. thaliana but retained in O. tauri. For three, contrasting eukaryotic pathways - TOR, MAPK, and the circadian clock - we established the subset of conserved components and demonstrate conserved sites of substrate phosphorylation and kinase motifs. We conclude that O. tauri satisfies our two central requirements. Several of its kinases are more closely related to H. sapiens orthologs than S. cerevisiae is to H. sapiens. The greatly reduced kinome of O. tauri is therefore a suitable model for signalling in free-living eukaryotes.

  13. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  14. Blocking Modification of Eukaryotic Initiation 5A2 Antagonizes Cervical Carcinoma via Inhibition of RhoA/ROCK Signal Transduction Pathway.

    Science.gov (United States)

    Liu, Xiaojun; Chen, Dong; Liu, Jiamei; Chu, Zhangtao; Liu, Dongli

    2017-10-01

    Cervical carcinoma is one of the leading causes of cancer-related death for female worldwide. Eukaryotic initiation factor 5A2 belongs to the eukaryotic initiation factor 5A family and is proposed to be a key factor involved in the development of diverse cancers. In the current study, a series of in vivo and in vitro investigations were performed to characterize the role of eukaryotic initiation factor 5A2 in oncogenesis and metastasis of cervical carcinoma. The expression status of eukaryotic initiation factor 5A2 in 15 cervical carcinoma patients was quantified. Then, the effect of eukaryotic initiation factor 5A2 knockdown on in vivo tumorigenicity ability, cell proliferation, cell cycle distribution, and cell mobility of HeLa cells was measured. To uncover the mechanism driving the function of eukaryotic initiation factor 5A2 in cervical carcinoma, expression of members within RhoA/ROCK pathway was detected, and the results were further verified with an RhoA overexpression modification. The level of eukaryotic initiation factor 5A2 in cervical carcinoma samples was significantly higher than that in paired paratumor tissues ( P cycle arrest ( P ROCK I, and ROCK II were downregulated. The above-mentioned changes in eukaryotic initiation factor 5A2 knockdown cells were alleviated by the overexpression of RhoA. The major findings outlined in the current study confirmed the potential of eukaryotic initiation factor 5A2 as a promising prognosis predictor and therapeutic target for cervical carcinoma treatment. Also, our data inferred that eukaryotic initiation factor 5A2 might function in carcinogenesis of cervical carcinoma through an RhoA/ROCK-dependent manner.

  15. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Geminin: a major DNA replication safeguard in higher eukaryotes

    DEFF Research Database (Denmark)

    Melixetian, Marina; Helin, Kristian

    2004-01-01

    Eukaryotes have evolved multiple mechanisms to restrict DNA replication to once per cell cycle. These mechanisms prevent relicensing of origins of replication after initiation of DNA replication in S phase until the end of mitosis. Most of our knowledge of mechanisms controlling prereplication...

  17. Phylogenetic analysis of the core histone doublet and DNA topo II genes of Marseilleviridae: evidence of proto-eukaryotic provenance.

    Science.gov (United States)

    Erives, Albert J

    2017-11-28

    While the genomes of eukaryotes and Archaea both encode the histone-fold domain, only eukaryotes encode the core histone paralogs H2A, H2B, H3, and H4. With DNA, these core histones assemble into the nucleosomal octamer underlying eukaryotic chromatin. Importantly, core histones for H2A and H3 are maintained as neofunctionalized paralogs adapted for general bulk chromatin (canonical H2 and H3) or specialized chromatin (H2A.Z enriched at gene promoters and cenH3s enriched at centromeres). In this context, the identification of core histone-like "doublets" in the cytoplasmic replication factories of the Marseilleviridae (MV) is a novel finding with possible relevance to understanding the origin of eukaryotic chromatin. Here, we analyze and compare the core histone doublet genes from all known MV genomes as well as other MV genes relevant to the origin of the eukaryotic replisome. Using different phylogenetic approaches, we show that MV histone domains encode obligate H2B-H2A and H4-H3 dimers of possible proto-eukaryotic origin. MV core histone moieties form sister clades to each of the four eukaryotic clades of canonical and variant core histones. This suggests that MV core histone moieties diverged prior to eukaryotic neofunctionalizations associated with paired linear chromosomes and variant histone octamer assembly. We also show that MV genomes encode a proto-eukaryotic DNA topoisomerase II enzyme that forms a sister clade to eukaryotes. This is a relevant finding given that DNA topo II influences histone deposition and chromatin compaction and is the second most abundant nuclear protein after histones. The combined domain architecture and phylogenomic analyses presented here suggest that a primitive origin for MV histone genes is a more parsimonious explanation than horizontal gene transfers + gene fusions + sufficient divergence to eliminate relatedness to eukaryotic neofunctionalizations within the H2A and H3 clades without loss of relatedness to each of

  18. Aerially transmitted human fungal pathogens: what can we learn from metagenomics and comparative genomics?

    Science.gov (United States)

    Aliouat-Denis, Cécile-Marie; Chabé, Magali; Delhaes, Laurence; Dei-Cas, Eduardo

    2014-01-01

    In the last few decades, aerially transmitted human fungal pathogens have been increasingly recognized to impact the clinical course of chronic pulmonary diseases, such as asthma, cystic fibrosis or chronic obstructive pulmonary disease. Thanks to recent development of culture-free high-throughput sequencing methods, the metagenomic approaches are now appropriate to detect, identify and even quantify prokaryotic or eukaryotic microorganism communities inhabiting human respiratory tract and to access the complexity of even low-burden microbe communities that are likely to play a role in chronic pulmonary diseases. In this review, we explore how metagenomics and comparative genomics studies can alleviate fungal culture bottlenecks, improve our knowledge about fungal biology, lift the veil on cross-talks between host lung and fungal microbiota, and gain insights into the pathogenic impact of these aerially transmitted fungi that affect human beings. We reviewed metagenomic studies and comparative genomic analyses of carefully chosen microorganisms, and confirmed the usefulness of such approaches to better delineate biology and pathogenesis of aerially transmitted human fungal pathogens. Efforts to generate and efficiently analyze the enormous amount of data produced by such novel approaches have to be pursued, and will potentially provide the patients suffering from chronic pulmonary diseases with a better management. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  19. Challenges in Whole-Genome Annotation of Pyrosequenced Eukaryotic Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alan; Grigoriev, Igor

    2009-04-17

    Pyrosequencing technologies such as 454/Roche and Solexa/Illumina vastly lower the cost of nucleotide sequencing compared to the traditional Sanger method, and thus promise to greatly expand the number of sequenced eukaryotic genomes. However, the new technologies also bring new challenges such as shorter reads and new kinds and higher rates of sequencing errors, which complicate genome assembly and gene prediction. At JGI we are deploying 454 technology for the sequencing and assembly of ever-larger eukaryotic genomes. Here we describe our first whole-genome annotation of a purely 454-sequenced fungal genome that is larger than a yeast (>30 Mbp). The pezizomycotine (filamentous ascomycote) Aspergillus carbonarius belongs to the Aspergillus section Nigri species complex, members of which are significant as platforms for bioenergy and bioindustrial technology, as members of soil microbial communities and players in the global carbon cycle, and as agricultural toxigens. Application of a modified version of the standard JGI Annotation Pipeline has so far predicted ~;;10k genes. ~;;12percent of these preliminary annotations suffer a potential frameshift error, which is somewhat higher than the ~;;9percent rate in the Sanger-sequenced and conventionally assembled and annotated genome of fellow Aspergillus section Nigri member A. niger. Also,>90percent of A. niger genes have potential homologs in the A. carbonarius preliminary annotation. Weconclude, and with further annotation and comparative analysis expect to confirm, that 454 sequencing strategies provide a promising substrate for annotation of modestly sized eukaryotic genomes. We will also present results of annotation of a number of other pyrosequenced fungal genomes of bioenergy interest.

  20. Critical analysis of eukaryotic phylogeny: a case study based on the HSP70 family.

    Science.gov (United States)

    Germot, A; Philippe, H

    1999-01-01

    Trichomonads, together with diplomonads and microsporidia, emerge at the base of the eukaryotic tree, on the basis of the small subunit rRNA phylogeny. However, phylogenies based on protein sequences such as tubulin are markedly different with these protists emerging much later. We have investigated 70 kDa heat-shock protein (HSP70), which could be a reliable phylogenetic marker. In eukaryotes, HSP70s are found in cytosol, endoplasmic reticulum, and organelles (mitochondria and chloroplasts). In Trichomonas vaginalis we identified nine different HSP70-encoding genes and sequenced three nearly complete cDNAs corresponding to cytosolic, endoplasmic reticulum, and mitochondrial-type HSP70. Phylogenies of eukaryotes were reconstructed using the classical methods while varying the number of species and characters considered. Almost all the undoubtedly monophyletic groups, defined by ultrastructural characters, were recovered. However, due to the long branch attraction phenomenon, the evolutionary rates were the main factor determining the position of species, even with the use of a close outgroup, which is an important advantage of HSP70 with respect to many other markers. Numerous variable sites are peculiar to Trichomonas and probably generated the artefactual placement of this species at the base of the eukaryotes or as the sister group of fast-evolving species. The inter-phyla relationships were not well supported and were sensitive to the reconstruction method, the number of species; and the quantity of information used. This lack of resolution could be explained by the very rapid diversification of eukaryotes, likely after the mitochondrial endosymbiosis.

  1. Extreme Diversity of Diplonemid Eukaryotes in the Ocean

    Czech Academy of Sciences Publication Activity Database

    Flegontova, Olga; Flegontov, Pavel; Malviya, S.; Audic, S.; Wincker, P.; de Vargas, C.; Bowler, C.; Lukeš, Julius; Horák, Aleš

    2016-01-01

    Roč. 26, č. 22 (2016), s. 3060-3065 ISSN 0960-9822 R&D Projects: GA ČR GPP506/12/P931; GA ČR(CZ) GA14-23986S Institutional support: RVO:60077344 Keywords : virus-sized particles * microbial eukaryotes * sea-floor * phytoplankton * communities * euglenozoa * dispersal * ecosystem Subject RIV: EG - Zoology Impact factor: 8.851, year: 2016

  2. Strong eukaryotic IRESs have weak secondary structure.

    Directory of Open Access Journals (Sweden)

    Xuhua Xia

    Full Text Available BACKGROUND: The objective of this work was to investigate the hypothesis that eukaryotic Internal Ribosome Entry Sites (IRES lack secondary structure and to examine the generality of the hypothesis. METHODOLOGY/PRINCIPAL FINDINGS: IRESs of the yeast and the fruit fly are located in the 5'UTR immediately upstream of the initiation codon. The minimum folding energy (MFE of 60 nt RNA segments immediately upstream of the initiation codons was calculated as a proxy of secondary structure stability. MFE of the reverse complements of these 60 nt segments was also calculated. The relationship between MFE and empirically determined IRES activity was investigated to test the hypothesis that strong IRES activity is associated with weak secondary structure. We show that IRES activity in the yeast and the fruit fly correlates strongly with the structural stability, with highest IRES activity found in RNA segments that exhibit the weakest secondary structure. CONCLUSIONS: We found that a subset of eukaryotic IRESs exhibits very low secondary structure in the 5'-UTR sequences immediately upstream of the initiation codon. The consistency in results between the yeast and the fruit fly suggests a possible shared mechanism of cap-independent translation initiation that relies on an unstructured RNA segment.

  3. RNA Export through the NPC in Eukaryotes.

    Science.gov (United States)

    Okamura, Masumi; Inose, Haruko; Masuda, Seiji

    2015-03-20

    In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.

  4. Next-Generation Sequencing Assessment of Eukaryotic Diversity in Oil Sands Tailings Ponds Sediments and Surface Water.

    Science.gov (United States)

    Aguilar, Maria; Richardson, Elisabeth; Tan, BoonFei; Walker, Giselle; Dunfield, Peter F; Bass, David; Nesbø, Camilla; Foght, Julia; Dacks, Joel B

    2016-11-01

    Tailings ponds in the Athabasca oil sands (Canada) contain fluid wastes, generated by the extraction of bitumen from oil sands ores. Although the autochthonous prokaryotic communities have been relatively well characterized, almost nothing is known about microbial eukaryotes living in the anoxic soft sediments of tailings ponds or in the thin oxic layer of water that covers them. We carried out the first next-generation sequencing study of microbial eukaryotic diversity in oil sands tailings ponds. In metagenomes prepared from tailings sediment and surface water, we detected very low numbers of sequences encoding eukaryotic small subunit ribosomal RNA representing seven major taxonomic groups of protists. We also produced and analysed three amplicon-based 18S rRNA libraries prepared from sediment samples. These revealed a more diverse set of taxa, 169 different OTUs encompassing up to eleven higher order groups of eukaryotes, according to detailed classification using homology searching and phylogenetic methods. The 10 most abundant OTUs accounted for > 90% of the total of reads, vs. large numbers of rare OTUs (< 1% abundance). Despite the anoxic and hydrocarbon-enriched nature of the environment, the tailings ponds harbour complex communities of microbial eukaryotes indicating that these organisms should be taken into account when studying the microbiology of the oil sands. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  5. The construction and evaluation of reference spectra for the identification of human pathogenic microorganisms by MALDI-TOF MS.

    Directory of Open Access Journals (Sweden)

    Di Xiao

    Full Text Available Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS is an emerging technique for the rapid and high-throughput identification of microorganisms. There remains a dearth of studies in which a large number of pathogenic microorganisms from a particular country or region are utilized for systematic analyses. In this study, peptide mass reference spectra (PMRS were constructed and evaluated from numerous human pathogens (a total of 1019 strains from 94 species, including enteric (46 species, respiratory (21 species, zoonotic (17 species, and nosocomial pathogens (10 species, using a MALDI-TOF MS Biotyper system (MBS. The PMRS for 380 strains of 52 species were new contributions to the original reference database (ORD. Compared with the ORD, the new reference database (NRD allowed for 28.2% (from 71.5% to 99.7% and 42.3% (from 51.3% to 93.6% improvements in identification at the genus and species levels, respectively. Misidentification rates were 91.7% and 57.1% lower with the NRD than with the ORD for genus and species identification, respectively. Eight genera and 25 species were misidentified. For genera and species that are challenging to accurately identify, identification results must be manually determined and adjusted in accordance with the database parameters. Through augmentation, the MBS demonstrated a high identification accuracy and specificity for human pathogenic microorganisms. This study sought to provide theoretical guidance for using PMRS databases in various fields, such as clinical diagnosis and treatment, disease control, quality assurance, and food safety inspection.

  6. PAMDB: a comprehensive Pseudomonas aeruginosa metabolome database.

    Science.gov (United States)

    Huang, Weiliang; Brewer, Luke K; Jones, Jace W; Nguyen, Angela T; Marcu, Ana; Wishart, David S; Oglesby-Sherrouse, Amanda G; Kane, Maureen A; Wilks, Angela

    2018-01-04

    The Pseudomonas aeruginosaMetabolome Database (PAMDB, http://pseudomonas.umaryland.edu) is a searchable, richly annotated metabolite database specific to P. aeruginosa. P. aeruginosa is a soil organism and significant opportunistic pathogen that adapts to its environment through a versatile energy metabolism network. Furthermore, P. aeruginosa is a model organism for the study of biofilm formation, quorum sensing, and bioremediation processes, each of which are dependent on unique pathways and metabolites. The PAMDB is modelled on the Escherichia coli (ECMDB), yeast (YMDB) and human (HMDB) metabolome databases and contains >4370 metabolites and 938 pathways with links to over 1260 genes and proteins. The database information was compiled from electronic databases, journal articles and mass spectrometry (MS) metabolomic data obtained in our laboratories. For each metabolite entered, we provide detailed compound descriptions, names and synonyms, structural and physiochemical information, nuclear magnetic resonance (NMR) and MS spectra, enzymes and pathway information, as well as gene and protein sequences. The database allows extensive searching via chemical names, structure and molecular weight, together with gene, protein and pathway relationships. The PAMBD and its future iterations will provide a valuable resource to biologists, natural product chemists and clinicians in identifying active compounds, potential biomarkers and clinical diagnostics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Practical Value of Food Pathogen Traceability through Building a Whole-Genome Sequencing Network and Database.

    Science.gov (United States)

    Allard, Marc W; Strain, Errol; Melka, David; Bunning, Kelly; Musser, Steven M; Brown, Eric W; Timme, Ruth

    2016-08-01

    The FDA has created a United States-based open-source whole-genome sequencing network of state, federal, international, and commercial partners. The GenomeTrakr network represents a first-of-its-kind distributed genomic food shield for characterizing and tracing foodborne outbreak pathogens back to their sources. The GenomeTrakr network is leading investigations of outbreaks of foodborne illnesses and compliance actions with more accurate and rapid recalls of contaminated foods as well as more effective monitoring of preventive controls for food manufacturing environments. An expanded network would serve to provide an international rapid surveillance system for pathogen traceback, which is critical to support an effective public health response to bacterial outbreaks. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  8. Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

    Directory of Open Access Journals (Sweden)

    Roger Andrew J

    2003-06-01

    Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

  9. Database-Guided Discovery of Potent Peptides to Combat HIV-1 or Superbugs

    Directory of Open Access Journals (Sweden)

    Guangshun Wang

    2013-05-01

    Full Text Available Antimicrobial peptides (AMPs, small host defense proteins, are indispensable for the protection of multicellular organisms such as plants and animals from infection. The number of AMPs discovered per year increased steadily since the 1980s. Over 2,000 natural AMPs from bacteria, protozoa, fungi, plants, and animals have been registered into the antimicrobial peptide database (APD. The majority of these AMPs (>86% possess 11–50 amino acids with a net charge from 0 to +7 and hydrophobic percentages between 31–70%. This article summarizes peptide discovery on the basis of the APD. The major methods are the linguistic model, database screening, de novo design, and template-based design. Using these methods, we identified various potent peptides against human immunodeficiency virus type 1 (HIV-1 or methicillin-resistant Staphylococcus aureus (MRSA. While the stepwise designed anti-HIV peptide is disulfide-linked and rich in arginines, the ab initio designed anti-MRSA peptide is linear and rich in leucines. Thus, there are different requirements for antiviral and antibacterial peptides, which could kill pathogens via different molecular targets. The biased amino acid composition in the database-designed peptides, or natural peptides such as θ-defensins, requires the use of the improved two-dimensional NMR method for structural determination to avoid the publication of misleading structure and dynamics. In the case of human cathelicidin LL-37, structural determination requires 3D NMR techniques. The high-quality structure of LL-37 provides a solid basis for understanding its interactions with membranes of bacteria and other pathogens. In conclusion, the APD database is a comprehensive platform for storing, classifying, searching, predicting, and designing potent peptides against pathogenic bacteria, viruses, fungi, parasites, and cancer cells.

  10. Introns Protect Eukaryotic Genomes from Transcription-Associated Genetic Instability.

    Science.gov (United States)

    Bonnet, Amandine; Grosso, Ana R; Elkaoutari, Abdessamad; Coleno, Emeline; Presle, Adrien; Sridhara, Sreerama C; Janbon, Guilhem; Géli, Vincent; de Almeida, Sérgio F; Palancade, Benoit

    2017-08-17

    Transcription is a source of genetic instability that can notably result from the formation of genotoxic DNA:RNA hybrids, or R-loops, between the nascent mRNA and its template. Here we report an unexpected function for introns in counteracting R-loop accumulation in eukaryotic genomes. Deletion of endogenous introns increases R-loop formation, while insertion of an intron into an intronless gene suppresses R-loop accumulation and its deleterious impact on transcription and recombination in yeast. Recruitment of the spliceosome onto the mRNA, but not splicing per se, is shown to be critical to attenuate R-loop formation and transcription-associated genetic instability. Genome-wide analyses in a number of distant species differing in their intron content, including human, further revealed that intron-containing genes and the intron-richest genomes are best protected against R-loop accumulation and subsequent genetic instability. Our results thereby provide a possible rationale for the conservation of introns throughout the eukaryotic lineage. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Eukaryotic snoRNAs: a paradigm for gene expression flexibility.

    Science.gov (United States)

    Dieci, Giorgio; Preti, Milena; Montanini, Barbara

    2009-08-01

    Small nucleolar RNAs (snoRNAs) are one of the most ancient and numerous families of non-protein-coding RNAs (ncRNAs). The main function of snoRNAs - to guide site-specific rRNA modification - is the same in Archaea and all eukaryotic lineages. In contrast, as revealed by recent genomic and RNomic studies, their genomic organization and expression strategies are the most varied. Seemingly snoRNA coding units have adopted, in the course of evolution, all the possible ways of being transcribed, thus providing a unique paradigm of gene expression flexibility. By focusing on representative fungal, plant and animal genomes, we review here all the documented types of snoRNA gene organization and expression, and we provide a comprehensive account of snoRNA expressional freedom by precisely estimating the frequency, in each genome, of each type of genomic organization. We finally discuss the relevance of snoRNA genomic studies for our general understanding of ncRNA family evolution and expression in eukaryotes.

  12. Regulated eukaryotic DNA replication origin firing with purified proteins.

    Science.gov (United States)

    Yeeles, Joseph T P; Deegan, Tom D; Janska, Agnieszka; Early, Anne; Diffley, John F X

    2015-03-26

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric minichromosome maintenance (MCM) complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45-MCM-GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin-dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4-dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication.

  13. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

    Directory of Open Access Journals (Sweden)

    Raees Khan

    Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

  14. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis

    Science.gov (United States)

    Khan, Raees; Roy, Nazish; Choi, Kihyuck

    2018-01-01

    The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed

  15. NADPH-dependent thioredoxin reductase C plays a role in nonhost disease resistance against Pseudomonas syringae pathogens by regulating chloroplast-generated reactive oxygen species

    Directory of Open Access Journals (Sweden)

    Yasuhiro Ishiga

    2016-04-01

    Full Text Available Chloroplasts are cytoplasmic organelles for photosynthesis in eukaryotic cells. In addition, recent studies have shown that chloroplasts have a critical role in plant innate immunity against invading pathogens. Hydrogen peroxide is a toxic by-product from photosynthesis, which also functions as a signaling compound in plant innate immunity. Therefore, it is important to regulate the level of hydrogen peroxide in response to pathogens. Chloroplasts maintain components of the redox detoxification system including enzymes such as 2-Cys peroxiredoxins (2-Cys Prxs, and NADPH-dependent thioredoxin reductase C (NTRC. However, the significance of 2-Cys Prxs and NTRC in the molecular basis of nonhost disease resistance is largely unknown. We evaluated the roles of Prxs and NTRC using knock-out mutants of Arabidopsis in response to nonhost Pseudomonas syringae pathogens. Plants lacking functional NTRC showed localized cell death (LCD accompanied by the elevated accumulation of hydrogen peroxide in response to nonhost pathogens. Interestingly, the Arabidopsis ntrc mutant showed enhanced bacterial growth and disease susceptibility of nonhost pathogens. Furthermore, the expression profiles of the salicylic acid (SA and jasmonic acid (JA-mediated signaling pathways and phytohormone analyses including SA and JA revealed that the Arabidopsis ntrc mutant shows elevated JA-mediated signaling pathways in response to nonhost pathogen. These results suggest the critical role of NTRC in plant innate immunity against nonhost P. syringae pathogens.

  16. The plant cell nucleus: a true arena for the fight between plants and pathogens.

    Science.gov (United States)

    Deslandes, Laurent; Rivas, Susana

    2011-01-01

    Communication between the cytoplasm and the nucleus is a fundamental feature shared by both plant and animal cells. Cellular factors involved in the transport of macromolecules through the nuclear envelope, including nucleoporins, importins and Ran-GTP related components, are conserved among a variety of eukaryotic systems. Interestingly, mutations in these nuclear components compromise resistance signalling, illustrating the importance of nucleocytoplasmic trafficking in plant innate immunity. Indeed, spatial restriction of defence regulators by the nuclear envelope and stimulus-induced nuclear translocation constitute an important level of defence-associated gene regulation in plants. A significant number of effectors from different microbial pathogens are targeted to the plant cell nucleus. In addition, key host factors, including resistance proteins, immunity components, transcription factors and transcriptional regulators shuttle between the cytoplasm and the nucleus, and their level of nuclear accumulation determines the output of the defence response, further confirming the crucial role played by the nucleus during the interaction between plants and pathogens. Here, we discuss recent findings that situate the nucleus at the frontline of the mutual recognition between plants and invading microbes.

  17. An Interactive Exercise To Learn Eukaryotic Cell Structure and Organelle Function.

    Science.gov (United States)

    Klionsky, Daniel J.; Tomashek, John J.

    1999-01-01

    Describes a cooperative, interactive problem-solving exercise for studying eukaryotic cell structure and function. Highlights the dynamic aspects of movement through the cell. Contains 15 references. (WRM)

  18. Large variability of bathypelagic microbial eukaryotic communities across the world's oceans.

    Science.gov (United States)

    Pernice, Massimo C; Giner, Caterina R; Logares, Ramiro; Perera-Bel, Júlia; Acinas, Silvia G; Duarte, Carlos M; Gasol, Josep M; Massana, Ramon

    2016-04-01

    In this work, we study the diversity of bathypelagic microbial eukaryotes (0.8-20 μm) in the global ocean. Seawater samples from 3000 to 4000 m depth from 27 stations in the Atlantic, Pacific and Indian Oceans were analyzed by pyrosequencing the V4 region of the 18S ribosomal DNA. The relative abundance of the most abundant operational taxonomic units agreed with the results of a parallel metagenomic analysis, suggesting limited PCR biases in the tag approach. Although rarefaction curves for single stations were seldom saturated, the global analysis of all sequences together suggested an adequate recovery of bathypelagic diversity. Community composition presented a large variability among samples, which was poorly explained by linear geographic distance. In fact, the similarity between communities was better explained by water mass composition (26% of the variability) and the ratio in cell abundance between prokaryotes and microbial eukaryotes (21%). Deep diversity appeared dominated by four taxonomic groups (Collodaria, Chrysophytes, Basidiomycota and MALV-II) appearing in different proportions in each sample. Novel diversity amounted to 1% of the pyrotags and was lower than expected. Our study represents an essential step in the investigation of bathypelagic microbial eukaryotes, indicating dominating taxonomic groups and suggesting idiosyncratic assemblages in distinct oceanic regions.

  19. Metabolism in anoxic permeable sediments is dominated by eukaryotic dark fermentation

    Science.gov (United States)

    Bourke, Michael F.; Marriott, Philip J.; Glud, Ronnie N.; Hasler-Sheetal, Harald; Kamalanathan, Manoj; Beardall, John; Greening, Chris; Cook, Perran L. M.

    2017-01-01

    Permeable sediments are common across continental shelves and are critical contributors to marine biogeochemical cycling. Organic matter in permeable sediments is dominated by microalgae, which as eukaryotes have different anaerobic metabolic pathways to bacteria and archaea. Here we present analyses of flow-through reactor experiments showing that dissolved inorganic carbon is produced predominantly as a result of anaerobic eukaryotic metabolic activity. In our experiments, anaerobic production of dissolved inorganic carbon was consistently accompanied by large dissolved H2 production rates, suggesting the presence of fermentation. The production of both dissolved inorganic carbon and H2 persisted following administration of broad spectrum bactericidal antibiotics, but ceased following treatment with metronidazole. Metronidazole inhibits the ferredoxin/hydrogenase pathway of fermentative eukaryotic H2 production, suggesting that pathway as the source of H2 and dissolved inorganic carbon production. Metabolomic analysis showed large increases in lipid production at the onset of anoxia, consistent with documented pathways of anoxic dark fermentation in microalgae. Cell counts revealed a predominance of microalgae in the sediments. H2 production was observed in dark anoxic cultures of diatoms (Fragilariopsis sp.) and a chlorophyte (Pyramimonas) isolated from the study site, substantiating the hypothesis that microalgae undertake fermentation. We conclude that microalgal dark fermentation could be an important energy-conserving pathway in permeable sediments.

  20. ChlamyCyc: an integrative systems biology database and web-portal for Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Kempa Stefan

    2009-05-01

    Full Text Available Abstract Background The unicellular green alga Chlamydomonas reinhardtii is an important eukaryotic model organism for the study of photosynthesis and plant growth. In the era of modern high-throughput technologies there is an imperative need to integrate large-scale data sets from high-throughput experimental techniques using computational methods and database resources to provide comprehensive information about the molecular and cellular organization of a single organism. Results In the framework of the German Systems Biology initiative GoFORSYS, a pathway database and web-portal for Chlamydomonas (ChlamyCyc was established, which currently features about 250 metabolic pathways with associated genes, enzymes, and compound information. ChlamyCyc was assembled using an integrative approach combining the recently published genome sequence, bioinformatics methods, and experimental data from metabolomics and proteomics experiments. We analyzed and integrated a combination of primary and secondary database resources, such as existing genome annotations from JGI, EST collections, orthology information, and MapMan classification. Conclusion ChlamyCyc provides a curated and integrated systems biology repository that will enable and assist in systematic studies of fundamental cellular processes in Chlamydomonas. The ChlamyCyc database and web-portal is freely available under http://chlamycyc.mpimp-golm.mpg.de.

  1. Eukaryotic resistance to fluoride toxicity mediated by a widespread family of fluoride export proteins.

    Science.gov (United States)

    Li, Sanshu; Smith, Kathryn D; Davis, Jared H; Gordon, Patricia B; Breaker, Ronald R; Strobel, Scott A

    2013-11-19

    Fluorine is an abundant element and is toxic to organisms from bacteria to humans, but the mechanisms by which eukaryotes resist fluoride toxicity are unknown. The Escherichia coli gene crcB was recently shown to be regulated by a fluoride-responsive riboswitch, implicating it in fluoride response. There are >8,000 crcB homologs across all domains of life, indicating that it has an important role in biology. Here we demonstrate that eukaryotic homologs [renamed FEX (fluoride exporter)] function in fluoride export. FEX KOs in three eukaryotic model organisms, Neurospora crassa, Saccharomyces cerevisiae, and Candida albicans, are highly sensitized to fluoride (>200-fold) but not to other halides. Some of these KO strains are unable to grow in fluoride concentrations found in tap water. Using the radioactive isotope of fluoride, (18)F, we developed an assay to measure the intracellular fluoride concentration and show that the FEX deletion strains accumulate fluoride in excess of the external concentration, providing direct evidence of FEX function in fluoride efflux. In addition, they are more sensitive to lower pH in the presence of fluoride. These results demonstrate that eukaryotic FEX genes encode a previously unrecognized class of fluoride exporter necessary for survival in standard environmental conditions.

  2. The phytophthora genome initiative database: informatics and analysis for distributed pathogenomic research.

    Science.gov (United States)

    Waugh, M; Hraber, P; Weller, J; Wu, Y; Chen, G; Inman, J; Kiphart, D; Sobral, B

    2000-01-01

    The Phytophthora Genome Initiative (PGI) is a distributed collaboration to study the genome and evolution of a particularly destructive group of plant pathogenic oomycete, with the goal of understanding the mechanisms of infection and resistance. NCGR provides informatics support for the collaboration as well as a centralized data repository. In the pilot phase of the project, several investigators prepared Phytophthora infestans and Phytophthora sojae EST and Phytophthora sojae BAC libraries and sent them to another laboratory for sequencing. Data from sequencing reactions were transferred to NCGR for analysis and curation. An analysis pipeline transforms raw data by performing simple analyses (i.e., vector removal and similarity searching) that are stored and can be retrieved by investigators using a web browser. Here we describe the database and access tools, provide an overview of the data therein and outline future plans. This resource has provided a unique opportunity for the distributed, collaborative study of a genus from which relatively little sequence data are available. Results may lead to insight into how better to control these pathogens. The homepage of PGI can be accessed at http:www.ncgr.org/pgi, with database access through the database access hyperlink.

  3. Current ecological understanding of fungal-like pathogens of fish: what lies beneath?

    Directory of Open Access Journals (Sweden)

    Rodolphe Elie Gozlan

    2014-02-01

    Full Text Available Despite increasingly sophisticated microbiological techniques, and long after the first discovery of microbes, basic knowledge is still lacking to fully appreciate the ecological importance of microbial parasites in fish. This is likely due to the nature of their habitats as many species of fish suffer from living beneath turbid water away from easy recording. However, fishes represent key ecosystem services for millions of people around the world and the absence of a functional ecological understanding of viruses, prokaryotes, and small eukaryotes in the maintenance of fish populations and of their diversity represents an inherent barrier to aquatic conservation and food security. Among recent emerging infectious diseases responsible for severe population declines in plant and animal taxa, fungal and fungal-like microbes have emerged as significant contributors. Here, we review the current knowledge gaps of fungal and fungal-like parasites and pathogens in fish and put them into an ecological perspective with direct implications for the monitoring of fungal fish pathogens in the wild, their phylogeography as well as their associated ecological impact on fish populations. With increasing fish movement around the world for farming, releases into the wild for sport fishing and human-driven habitat changes, it is expected, along with improved environmental monitoring of fungal and fungal-like infections, that the full extent of the impact of these pathogens on wild fish populations will soon emerge as a major threat to freshwater biodiversity.

  4. Eu-Detect: An algorithm for detecting eukaryotic sequences in ...

    Indian Academy of Sciences (India)

    Supplementary figure 1. Plots depicting the classification accuracy of Eu-Detect with various combinations of. 'cumulative sequence count' (40K, 50K, 60K, 70K, 80K) and 'coverage threshold' (20%, 30%, 40%, 50%, 60%, 70%,. 80%). While blue bars represent Eu-Detect's average classification accuracy with eukaryotic ...

  5. The need for high-quality whole-genome sequence databases in microbial forensics.

    Science.gov (United States)

    Sjödin, Andreas; Broman, Tina; Melefors, Öjar; Andersson, Gunnar; Rasmusson, Birgitta; Knutsson, Rickard; Forsman, Mats

    2013-09-01

    Microbial forensics is an important part of a strengthened capability to respond to biocrime and bioterrorism incidents to aid in the complex task of distinguishing between natural outbreaks and deliberate acts. The goal of a microbial forensic investigation is to identify and criminally prosecute those responsible for a biological attack, and it involves a detailed analysis of the weapon--that is, the pathogen. The recent development of next-generation sequencing (NGS) technologies has greatly increased the resolution that can be achieved in microbial forensic analyses. It is now possible to identify, quickly and in an unbiased manner, previously undetectable genome differences between closely related isolates. This development is particularly relevant for the most deadly bacterial diseases that are caused by bacterial lineages with extremely low levels of genetic diversity. Whole-genome analysis of pathogens is envisaged to be increasingly essential for this purpose. In a microbial forensic context, whole-genome sequence analysis is the ultimate method for strain comparisons as it is informative during identification, characterization, and attribution--all 3 major stages of the investigation--and at all levels of microbial strain identity resolution (ie, it resolves the full spectrum from family to isolate). Given these capabilities, one bottleneck in microbial forensics investigations is the availability of high-quality reference databases of bacterial whole-genome sequences. To be of high quality, databases need to be curated and accurate in terms of sequences, metadata, and genetic diversity coverage. The development of whole-genome sequence databases will be instrumental in successfully tracing pathogens in the future.

  6. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  7. Investigating host-pathogen behavior and their interaction using genome-scale metabolic network models.

    Science.gov (United States)

    Sadhukhan, Priyanka P; Raghunathan, Anu

    2014-01-01

    Genome Scale Metabolic Modeling methods represent one way to compute whole cell function starting from the genome sequence of an organism and contribute towards understanding and predicting the genotype-phenotype relationship. About 80 models spanning all the kingdoms of life from archaea to eukaryotes have been built till date and used to interrogate cell phenotype under varying conditions. These models have been used to not only understand the flux distribution in evolutionary conserved pathways like glycolysis and the Krebs cycle but also in applications ranging from value added product formation in Escherichia coli to predicting inborn errors of Homo sapiens metabolism. This chapter describes a protocol that delineates the process of genome scale metabolic modeling for analysing host-pathogen behavior and interaction using flux balance analysis (FBA). The steps discussed in the process include (1) reconstruction of a metabolic network from the genome sequence, (2) its representation in a precise mathematical framework, (3) its translation to a model, and (4) the analysis using linear algebra and optimization. The methods for biological interpretations of computed cell phenotypes in the context of individual host and pathogen models and their integration are also discussed.

  8. Examining the effect of intramammary infections with minor mastitis pathogens on the acquisition of new intramammary infections with major mastitis pathogens--a systematic review and meta-analysis.

    Science.gov (United States)

    Reyher, K K; Haine, D; Dohoo, I R; Revie, C W

    2012-11-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus agalactiae, Streptococcus uberis, Streptococcus dysgalactiae, and the coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium bovis and coagulase-negative staphylococci (CNS). The current literature contains several studies detailing analyses with conflicting results as to whether intramammary infection (IMI) with the minor pathogens decreases, increases, or has no effect on the risk of a quarter acquiring a new intramammary infection (NIMI) with a major pathogen. To investigate the available scientific evidence regarding the effect of IMI with minor pathogens on the acquisition of NIMI with major pathogens, a systematic review and meta-analysis were conducted. The total extant English- and French-language literature in electronic databases was searched and all publications cited by relevant papers were investigated. Results from 68 studies were extracted from 38 relevant papers. Random-effects models were used to investigate the effects of CNS and C. bovis on acquisition of new IMI with any of the major pathogens, as well as individually for the minor pathogens and Staph. aureus. Significant heterogeneity among studies exists, some of which could be accounted for by using meta-regression. Overall, observational studies showed no effect, whereas challenge studies showed strong and significant protective effects, specifically when major pathogens were introduced into the mammary gland via methods bypassing the teat end. Underlying risk can account for several unmeasured factors, and studies with higher underlying risk found more protective effects of minor pathogens. Larger doses of challenge organisms reduced the protective effect of minor pathogens, and studies with more stringent diagnostic criteria for pathogen IMI identified less protection. Smaller studies (those utilizing fewer than 40 cows) also showed a greater

  9. The N-terminal region of eukaryotic translation initiation factor 5A signals to nuclear localization of the protein

    International Nuclear Information System (INIS)

    Parreiras-e-Silva, Lucas T.; Gomes, Marcelo D.; Oliveira, Eduardo B.; Costa-Neto, Claudio M.

    2007-01-01

    The eukaryotic translation initiation factor 5A (eIF5A) is a ubiquitous protein of eukaryotic and archaeal organisms which undergoes hypusination, a unique post-translational modification. We have generated a polyclonal antibody against murine eIF5A, which in immunocytochemical assays in B16-F10 cells revealed that the endogenous protein is preferentially localized to the nuclear region. We therefore analyzed possible structural features present in eIF5A proteins that could be responsible for that characteristic. Multiple sequence alignment analysis of eIF5A proteins from different eukaryotic and archaeal organisms showed that the former sequences have an extended N-terminal segment. We have then performed in silico prediction analyses and constructed different truncated forms of murine eIF5A to verify any possible role that the N-terminal extension might have in determining the subcellular localization of the eIF5A in eukaryotic organisms. Our results indicate that the N-terminal extension of the eukaryotic eIF5A contributes in signaling this protein to nuclear localization, despite of bearing no structural similarity with classical nuclear localization signals

  10. Pathogen-induced Caenorhabditis elegans developmental plasticity has a hormetic effect on the resistance to biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Leroy Magali

    2012-09-01

    Full Text Available Abstract Background Phenotypic plasticity, i.e. the capacity to change the phenotype in response to changes in the environment without alteration of the genotype, is important for coping with unstable environments. In spite of the ample evidence that microorganisms are a major environmental component playing a significant role in eukaryotic organisms health and disease, there is not much information about the effect of microorganism-induced developmental phenotypic plasticity on adult animals’ stress resistance and longevity. Results We examined the consequences of development of Caenorhabditis elegans larvae fed with different bacterial strains on stress resistance and lifespan of adult nematodes. Bacterial strains used in this study were either pathogenic or innocuous to nematodes. Exposure to the pathogen during development did not affect larval survival. However, the development of nematodes on the pathogenic bacterial strains increased lifespan of adult nematodes exposed to the same or a different pathogen. A longer nematode lifespan, developed on pathogens and exposed to pathogens as adults, did not result from an enhanced capacity to kill bacteria, but is likely due to an increased tolerance to the damage inflicted by the pathogenic bacteria. We observed that adult nematodes developed on a pathogen induce higher level of expression of the hsp-16.2 gene and have higher resistance to heat shock than nematodes developed on an innocuous strain. Therefore, the increased resistance to pathogens could be, at least partially, due to the early induction of the heat shock response in nematodes developed on pathogens. The lifespan increase is controlled by the DBL-1 transforming growth factor beta-like, DAF-2/DAF-16 insulin-like, and p38 MAP kinase pathways. Therefore, the observed modulation of adult nematode lifespans by developmental exposure to a pathogen is likely a genetically controlled response. Conclusions Our study shows that development

  11. A transgenic Drosophila model demonstrates that the Helicobacter pylori CagA protein functions as a eukaryotic Gab adaptor.

    Directory of Open Access Journals (Sweden)

    Crystal M Botham

    2008-05-01

    Full Text Available Infection with the human gastric pathogen Helicobacter pylori is associated with a spectrum of diseases including gastritis, peptic ulcers, gastric adenocarcinoma, and gastric mucosa-associated lymphoid tissue lymphoma. The cytotoxin-associated gene A (CagA protein of H. pylori, which is translocated into host cells via a type IV secretion system, is a major risk factor for disease development. Experiments in gastric tissue culture cells have shown that once translocated, CagA activates the phosphatase SHP-2, which is a component of receptor tyrosine kinase (RTK pathways whose over-activation is associated with cancer formation. Based on CagA's ability to activate SHP-2, it has been proposed that CagA functions as a prokaryotic mimic of the eukaryotic Grb2-associated binder (Gab adaptor protein, which normally activates SHP-2. We have developed a transgenic Drosophila model to test this hypothesis by investigating whether CagA can function in a well-characterized Gab-dependent process: the specification of photoreceptors cells in the Drosophila eye. We demonstrate that CagA expression is sufficient to rescue photoreceptor development in the absence of the Drosophila Gab homologue, Daughter of Sevenless (DOS. Furthermore, CagA's ability to promote photoreceptor development requires the SHP-2 phosphatase Corkscrew (CSW. These results provide the first demonstration that CagA functions as a Gab protein within the tissue of an organism and provide insight into CagA's oncogenic potential. Since many translocated bacterial proteins target highly conserved eukaryotic cellular processes, such as the RTK signaling pathway, the transgenic Drosophila model should be of general use for testing the in vivo function of bacterial effector proteins and for identifying the host genes through which they function.

  12. Histone H3 lysine 9 methyltransferase FvDim5 regulates fungal development, pathogenicity and osmotic stress responses in Fusarium verticillioides.

    Science.gov (United States)

    Gu, Qin; Ji, Tiantian; Sun, Xiao; Huang, Hai; Zhang, Hao; Lu, Xi; Wu, Liming; Huo, Rong; Wu, Huijun; Gao, Xuewen

    2017-10-16

    Histone methylation plays important biological roles in eukaryotic cells. Methylation of lysine 9 at histone H3 (H3K9me) is critical for regulating chromatin structure and gene transcription. Dim5 is a lysine histone methyltransferase (KHMTase) enzyme, which is responsible for the methylation of H3K9 in eukaryotes. In the current study, we identified a single ortholog of Neurospora crassa Dim5 in Fusarium verticillioides. In this study, we report that FvDim5 regulates the trimethylation of H3K9 (H3K9me3). The FvDIM5 deletion mutant (ΔFvDim5) showed significant defects in conidiation, perithecium production and fungal virulence. Unexpectedly, we found that deletion of FvDIM5 resulted in increased tolerance to osmotic stresses and upregulated FvHog1 phosphorylation. These results indicate the importance of FvDim5 for the regulation of fungal development, pathogenicity and osmotic stress responses in F. verticillioides. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Microbial eukaryote plankton communities of high-mountain lakes from three continents exhibit strong biogeographic patterns.

    Science.gov (United States)

    Filker, Sabine; Sommaruga, Ruben; Vila, Irma; Stoeck, Thorsten

    2016-05-01

    Microbial eukaryotes hold a key role in aquatic ecosystem functioning. Yet, their diversity in freshwater lakes, particularly in high-mountain lakes, is relatively unknown compared with the marine environment. Low nutrient availability, low water temperature and high ultraviolet radiation make most high-mountain lakes extremely challenging habitats for life and require specific molecular and physiological adaptations. We therefore expected that these ecosystems support a plankton diversity that differs notably from other freshwater lakes. In addition, we hypothesized that the communities under study exhibit geographic structuring. Our rationale was that geographic dispersal of small-sized eukaryotes in high-mountain lakes over continental distances seems difficult. We analysed hypervariable V4 fragments of the SSU rRNA gene to compare the genetic microbial eukaryote diversity in high-mountain lakes located in the European Alps, the Chilean Altiplano and the Ethiopian Bale Mountains. Microbial eukaryotes were not globally distributed corroborating patterns found for bacteria, multicellular animals and plants. Instead, the plankton community composition emerged as a highly specific fingerprint of a geographic region even on higher taxonomic levels. The intraregional heterogeneity of the investigated lakes was mirrored in shifts in microbial eukaryote community structure, which, however, was much less pronounced compared with interregional beta-diversity. Statistical analyses revealed that on a regional scale, environmental factors are strong predictors for plankton community structures in high-mountain lakes. While on long-distance scales (>10 000 km), isolation by distance is the most plausible scenario, on intermediate scales (up to 6000 km), both contemporary environmental factors and historical contingencies interact to shift plankton community structures. © 2016 John Wiley & Sons Ltd.

  14. Combining independent de novo assemblies optimizes the coding transcriptome for nonconventional model eukaryotic organisms.

    Science.gov (United States)

    Cerveau, Nicolas; Jackson, Daniel J

    2016-12-09

    Next-generation sequencing (NGS) technologies are arguably the most revolutionary technical development to join the list of tools available to molecular biologists since PCR. For researchers working with nonconventional model organisms one major problem with the currently dominant NGS platform (Illumina) stems from the obligatory fragmentation of nucleic acid material that occurs prior to sequencing during library preparation. This step creates a significant bioinformatic challenge for accurate de novo assembly of novel transcriptome data. This challenge becomes apparent when a variety of modern assembly tools (of which there is no shortage) are applied to the same raw NGS dataset. With the same assembly parameters these tools can generate markedly different assembly outputs. In this study we present an approach that generates an optimized consensus de novo assembly of eukaryotic coding transcriptomes. This approach does not represent a new assembler, rather it combines the outputs of a variety of established assembly packages, and removes redundancy via a series of clustering steps. We test and validate our approach using Illumina datasets from six phylogenetically diverse eukaryotes (three metazoans, two plants and a yeast) and two simulated datasets derived from metazoan reference genome annotations. All of these datasets were assembled using three currently popular assembly packages (CLC, Trinity and IDBA-tran). In addition, we experimentally demonstrate that transcripts unique to one particular assembly package are likely to be bioinformatic artefacts. For all eight datasets our pipeline generates more concise transcriptomes that in fact possess more unique annotatable protein domains than any of the three individual assemblers we employed. Another measure of assembly completeness (using the purpose built BUSCO databases) also confirmed that our approach yields more information. Our approach yields coding transcriptome assemblies that are more likely to be

  15. EUPAN enables pan-genome studies of a large number of eukaryotic genomes.

    Science.gov (United States)

    Hu, Zhiqiang; Sun, Chen; Lu, Kuang-Chen; Chu, Xixia; Zhao, Yue; Lu, Jinyuan; Shi, Jianxin; Wei, Chaochun

    2017-08-01

    Pan-genome analyses are routinely carried out for bacteria to interpret the within-species gene presence/absence variations (PAVs). However, pan-genome analyses are rare for eukaryotes due to the large sizes and higher complexities of their genomes. Here we proposed EUPAN, a eukaryotic pan-genome analysis toolkit, enabling automatic large-scale eukaryotic pan-genome analyses and detection of gene PAVs at a relatively low sequencing depth. In the previous studies, we demonstrated the effectiveness and high accuracy of EUPAN in the pan-genome analysis of 453 rice genomes, in which we also revealed widespread gene PAVs among individual rice genomes. Moreover, EUPAN can be directly applied to the current re-sequencing projects primarily focusing on single nucleotide polymorphisms. EUPAN is implemented in Perl, R and C ++. It is supported under Linux and preferred for a computer cluster with LSF and SLURM job scheduling system. EUPAN together with its standard operating procedure (SOP) is freely available for non-commercial use (CC BY-NC 4.0) at http://cgm.sjtu.edu.cn/eupan/index.html . ccwei@sjtu.edu.cn or jianxin.shi@sjtu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  16. Diatoms dominate the eukaryotic metatranscriptome during spring in coastal 'dead zone' sediments.

    Science.gov (United States)

    Broman, Elias; Sachpazidou, Varvara; Dopson, Mark; Hylander, Samuel

    2017-10-11

    An important characteristic of marine sediments is the oxygen concentration that affects many central metabolic processes. There has been a widespread increase in hypoxia in coastal systems (referred to as 'dead zones') mainly caused by eutrophication. Hence, it is central to understand the metabolism and ecology of eukaryotic life in sediments during changing oxygen conditions. Therefore, we sampled coastal 'dead zone' Baltic Sea sediment during autumn and spring, and analysed the eukaryotic metatranscriptome from field samples and after incubation in the dark under oxic or anoxic conditions. Bacillariophyta (diatoms) dominated the eukaryotic metatranscriptome in spring and were also abundant during autumn. A large fraction of the diatom RNA reads was associated with the photosystems suggesting a constitutive expression in darkness. Microscope observation showed intact diatom cells and these would, if hatched, represent a significant part of the pelagic phytoplankton biomass. Oxygenation did not significantly change the relative proportion of diatoms nor resulted in any major shifts in metabolic 'signatures'. By contrast, diatoms rapidly responded when exposed to light suggesting that light is limiting diatom development in hypoxic sediments. Hence, it is suggested that diatoms in hypoxic sediments are on 'standby' to exploit the environment if they reach suitable habitats. © 2017 The Author(s).

  17. Anionic lipids and the maintenance of membrane electrostatics in eukaryotes.

    Science.gov (United States)

    Platre, Matthieu Pierre; Jaillais, Yvon

    2017-02-01

    A wide range of signaling processes occurs at the cell surface through the reversible association of proteins from the cytosol to the plasma membrane. Some low abundant lipids are enriched at the membrane of specific compartments and thereby contribute to the identity of cell organelles by acting as biochemical landmarks. Lipids also influence membrane biophysical properties, which emerge as an important feature in specifying cellular territories. Such parameters are crucial for signal transduction and include lipid packing, membrane curvature and electrostatics. In particular, membrane electrostatics specifies the identity of the plasma membrane inner leaflet. Membrane surface charges are carried by anionic phospholipids, however the exact nature of the lipid(s) that powers the plasma membrane electrostatic field varies among eukaryotes and has been hotly debated during the last decade. Herein, we discuss the role of anionic lipids in setting up plasma membrane electrostatics and we compare similarities and differences that were found in different eukaryotic cells.

  18. Automated Eukaryotic Gene Structure Annotation Using EVidenceModeler and the Program to Assemble Spliced Alignments

    Energy Technology Data Exchange (ETDEWEB)

    Haas, B J; Salzberg, S L; Zhu, W; Pertea, M; Allen, J E; Orvis, J; White, O; Buell, C R; Wortman, J R

    2007-12-10

    EVidenceModeler (EVM) is presented as an automated eukaryotic gene structure annotation tool that reports eukaryotic gene structures as a weighted consensus of all available evidence. EVM, when combined with the Program to Assemble Spliced Alignments (PASA), yields a comprehensive, configurable annotation system that predicts protein-coding genes and alternatively spliced isoforms. Our experiments on both rice and human genome sequences demonstrate that EVM produces automated gene structure annotation approaching the quality of manual curation.

  19. Real-world clinical applicability of pathogenicity predictors assessed on SERPINA1 mutations in alpha-1-antitrypsin deficiency.

    Science.gov (United States)

    Giacopuzzi, Edoardo; Laffranchi, Mattia; Berardelli, Romina; Ravasio, Viola; Ferrarotti, Ilaria; Gooptu, Bibek; Borsani, Giuseppe; Fra, Annamaria

    2018-06-07

    The growth of publicly available data informing upon genetic variations, mechanisms of disease and disease sub-phenotypes offers great potential for personalised medicine. Computational approaches are likely required to assess large numbers of novel genetic variants. However, the integration of genetic, structural and pathophysiological data still represents a challenge for computational predictions and their clinical use. We addressed these issues for alpha-1-antitrypsin deficiency, a disease mediated by mutations in the SERPINA1 gene encoding alpha-1-antitrypsin. We compiled a comprehensive database of SERPINA1 coding mutations and assigned them apparent pathological relevance based upon available data. 'Benign' and 'Pathogenic' mutations were used to assess performance of 31 pathogenicity predictors. Well-performing algorithms clustered the subset of variants known to be severely pathogenic with high scores. Eight new mutations identified in the ExAC database and achieving high scores were selected for characterisation in cell models and showed secretory deficiency and polymer formation, supporting the predictive power of our computational approach. The behaviour of the pathogenic new variants and consistent outliers were rationalised by considering the protein structural context and residue conservation. These findings highlight the potential of computational methods to provide meaningful predictions of the pathogenic significance of novel mutations and identify areas for further investigation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database.

    Science.gov (United States)

    Bissett, Andrew; Fitzgerald, Anna; Meintjes, Thys; Mele, Pauline M; Reith, Frank; Dennis, Paul G; Breed, Martin F; Brown, Belinda; Brown, Mark V; Brugger, Joel; Byrne, Margaret; Caddy-Retalic, Stefan; Carmody, Bernie; Coates, David J; Correa, Carolina; Ferrari, Belinda C; Gupta, Vadakattu V S R; Hamonts, Kelly; Haslem, Asha; Hugenholtz, Philip; Karan, Mirko; Koval, Jason; Lowe, Andrew J; Macdonald, Stuart; McGrath, Leanne; Martin, David; Morgan, Matt; North, Kristin I; Paungfoo-Lonhienne, Chanyarat; Pendall, Elise; Phillips, Lori; Pirzl, Rebecca; Powell, Jeff R; Ragan, Mark A; Schmidt, Susanne; Seymour, Nicole; Snape, Ian; Stephen, John R; Stevens, Matthew; Tinning, Matt; Williams, Kristen; Yeoh, Yun Kit; Zammit, Carla M; Young, Andrew

    2016-01-01

    Microbial inhabitants of soils are important to ecosystem and planetary functions, yet there are large gaps in our knowledge of their diversity and ecology. The 'Biomes of Australian Soil Environments' (BASE) project has generated a database of microbial diversity with associated metadata across extensive environmental gradients at continental scale. As the characterisation of microbes rapidly expands, the BASE database provides an evolving platform for interrogating and integrating microbial diversity and function. BASE currently provides amplicon sequences and associated contextual data for over 900 sites encompassing all Australian states and territories, a wide variety of bioregions, vegetation and land-use types. Amplicons target bacteria, archaea and general and fungal-specific eukaryotes. The growing database will soon include metagenomics data. Data are provided in both raw sequence (FASTQ) and analysed OTU table formats and are accessed via the project's data portal, which provides a user-friendly search tool to quickly identify samples of interest. Processed data can be visually interrogated and intersected with other Australian diversity and environmental data using tools developed by the 'Atlas of Living Australia'. Developed within an open data framework, the BASE project is the first Australian soil microbial diversity database. The database will grow and link to other global efforts to explore microbial, plant, animal, and marine biodiversity. Its design and open access nature ensures that BASE will evolve as a valuable tool for documenting an often overlooked component of biodiversity and the many microbe-driven processes that are essential to sustain soil function and ecosystem services.

  1. PRODORIC2: the bacterial gene regulation database in 2018

    Science.gov (United States)

    Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

    2018-01-01

    Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

  2. LRRML: a conformational database and an XML description of leucine-rich repeats (LRRs).

    Science.gov (United States)

    Wei, Tiandi; Gong, Jing; Jamitzky, Ferdinand; Heckl, Wolfgang M; Stark, Robert W; Rössle, Shaila C

    2008-11-05

    Leucine-rich repeats (LRRs) are present in more than 6000 proteins. They are found in organisms ranging from viruses to eukaryotes and play an important role in protein-ligand interactions. To date, more than one hundred crystal structures of LRR containing proteins have been determined. This knowledge has increased our ability to use the crystal structures as templates to model LRR proteins with unknown structures. Since the individual three-dimensional LRR structures are not directly available from the established databases and since there are only a few detailed annotations for them, a conformational LRR database useful for homology modeling of LRR proteins is desirable. We developed LRRML, a conformational database and an extensible markup language (XML) description of LRRs. The release 0.2 contains 1261 individual LRR structures, which were identified from 112 PDB structures and annotated manually. An XML structure was defined to exchange and store the LRRs. LRRML provides a source for homology modeling and structural analysis of LRR proteins. In order to demonstrate the capabilities of the database we modeled the mouse Toll-like receptor 3 (TLR3) by multiple templates homology modeling and compared the result with the crystal structure. LRRML is an information source for investigators involved in both theoretical and applied research on LRR proteins. It is available at http://zeus.krist.geo.uni-muenchen.de/~lrrml.

  3. LRRML: a conformational database and an XML description of leucine-rich repeats (LRRs

    Directory of Open Access Journals (Sweden)

    Stark Robert W

    2008-11-01

    Full Text Available Abstract Background Leucine-rich repeats (LRRs are present in more than 6000 proteins. They are found in organisms ranging from viruses to eukaryotes and play an important role in protein-ligand interactions. To date, more than one hundred crystal structures of LRR containing proteins have been determined. This knowledge has increased our ability to use the crystal structures as templates to model LRR proteins with unknown structures. Since the individual three-dimensional LRR structures are not directly available from the established databases and since there are only a few detailed annotations for them, a conformational LRR database useful for homology modeling of LRR proteins is desirable. Description We developed LRRML, a conformational database and an extensible markup language (XML description of LRRs. The release 0.2 contains 1261 individual LRR structures, which were identified from 112 PDB structures and annotated manually. An XML structure was defined to exchange and store the LRRs. LRRML provides a source for homology modeling and structural analysis of LRR proteins. In order to demonstrate the capabilities of the database we modeled the mouse Toll-like receptor 3 (TLR3 by multiple templates homology modeling and compared the result with the crystal structure. Conclusion LRRML is an information source for investigators involved in both theoretical and applied research on LRR proteins. It is available at http://zeus.krist.geo.uni-muenchen.de/~lrrml.

  4. The importin α subunit PsIMPA1 mediates the oxidative stress response and is required for the pathogenicity of Phytophthora sojae.

    Science.gov (United States)

    Yang, Xinyu; Ding, Fa; Zhang, Lei; Sheng, Yuting; Zheng, Xiaobo; Wang, Yuanchao

    2015-09-01

    The sensing of extracellular signals and their transduction into an appropriate response are crucial for the survival and virulence of plant pathogens. Eukaryotic plant pathogens must overcome the obstacles posed by nuclear membranes to manipulate gene expression to adapt to the host challenge. A highly sophisticated mechanism is the use of importins to transport proteins into the nucleus. In this study, we identified a conserved importin α gene, PsIMPA1, in Phytophthora sojae that was differentially expressed during the life cycle of this soybean pathogen. PsIMPA1 expression was lowest in zoospores and cysts but relatively consistent during the other life cycle stages, except for a slight increase at 6h post infection. Silenced mutants Psimpa1 had a decreased growth rate, an aberrant mycelial morphology, and a severely impaired ability to form oospores and sporangia. In addition, the Psimpa1 mutants exhibited reduced pathogenicity compared to the wild type. 3,3-Diaminobenzidine (DAB) staining and in vitro hydrogen peroxide tolerance assays showed that the scavenging of reactive oxygen species by these mutants was significantly impaired. Taken together, these results indicate that PsIMPA1 regulates multiple processes during the life cycle of P. sojae. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins.

    Science.gov (United States)

    Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R

    2018-02-01

    This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

  6. MEROPS: the database of proteolytic enzymes, their substrates and inhibitors.

    Science.gov (United States)

    Rawlings, Neil D; Waller, Matthew; Barrett, Alan J; Bateman, Alex

    2014-01-01

    Peptidases, their substrates and inhibitors are of great relevance to biology, medicine and biotechnology. The MEROPS database (http://merops.sanger.ac.uk) aims to fulfill the need for an integrated source of information about these. The database has hierarchical classifications in which homologous sets of peptidases and protein inhibitors are grouped into protein species, which are grouped into families, which are in turn grouped into clans. Recent developments include the following. A community annotation project has been instigated in which acknowledged experts are invited to contribute summaries for peptidases. Software has been written to provide an Internet-based data entry form. Contributors are acknowledged on the relevant web page. A new display showing the intron/exon structures of eukaryote peptidase genes and the phasing of the junctions has been implemented. It is now possible to filter the list of peptidases from a completely sequenced bacterial genome for a particular strain of the organism. The MEROPS filing pipeline has been altered to circumvent the restrictions imposed on non-interactive blastp searches, and a HMMER search using specially generated alignments to maximize the distribution of organisms returned in the search results has been added.

  7. Counterintuitive effect of fall mixed layer deepening on eukaryotic new production in the Sargasso Sea

    Science.gov (United States)

    Fawcett, S. E.; Lomas, M. W.; Ward, B. B.; Sigman, D. M.

    2012-12-01

    The Sargasso Sea is characterized by a short period of deep vertical mixing in the late winter and early spring, followed by strong thermal stratification during the summer. Stratification persists into the fall, impeding the upward flux of nitrate from depth so that recycled forms of nitrogen (N) such as ammonium are thought to support most primary production. We collected particles from surface waters during March, July, October, and December, used flow cytometry to separate the prokaryotic and eukaryotic phytoplankton, and analyzed their respective 15N/14N. In all months, the 15N/14N of the prokaryotic genera, Prochlorococcus and Synechococcus, was low, indicative of reliance on recycled N throughout the year. In July, the 15N/14N of eukaryotic phytoplankton was variable but consistently higher than that of the prokaryotes, reflecting eukaryotic consumption of subsurface nitrate. Two eukaryotic profiles from October and December were similar to those from July. In three other fall profiles, the eukaryotes had a 15N/14N similar to that of the prokaryotes, suggesting a switch toward greater reliance on recycled N. This change in the dominant N source supporting eukaryotic production appears to be driven by the density structure of the upper water column. The very shallow low-density surface "mixed layer" (≤20 m) that develops in early-to-mid summer does not contribute to stratification at the base of the euphotic zone, and subsurface nitrate can mix up into the lower euphotic zone, facilitating continued production. The deepening of the mixed layer into the fall, typically taken as an indication of weaker overall stratification, actually strengthens the isolation of the euphotic zone as a whole, reducing the upward supply of nitrate to the photosynthetically active layer. The same counterintuitive dynamic explains the latitudinal patterns in a set of three October depth profiles. Two northern stations (32°N and 27°N) were characterized by a thick, low

  8. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Science.gov (United States)

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  9. Once in a lifetime: strategies for preventing re-replication in prokaryotic and eukaryotic cells

    DEFF Research Database (Denmark)

    Nielsen, Olaf; Løbner-Olesen, Anders

    2008-01-01

    DNA replication is an extremely accurate process and cells have evolved intricate control mechanisms to ensure that each region of their genome is replicated only once during S phase. Here, we compare what is known about the processes that prevent re-replication in prokaryotic and eukaryotic cells...... prokaryotes and eukaryotes are inactivated until the next cell cycle. Furthermore, in both systems the beta-clamp of the replicative polymerase associates with enzymatic activities that contribute to the inactivation of the helicase loaders. Finally, recent studies suggest that the control mechanism...

  10. Footprinting analysis of interactions between the largest eukaryotic RNase P/MRP protein Pop1 and RNase P/MRP RNA components.

    Science.gov (United States)

    Fagerlund, Robert D; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S

    2015-09-01

    Ribonuclease (RNase) P and RNase MRP are closely related catalytic ribonucleoproteins involved in the metabolism of a wide range of RNA molecules, including tRNA, rRNA, and some mRNAs. The catalytic RNA component of eukaryotic RNase P retains the core elements of the bacterial RNase P ribozyme; however, the peripheral RNA elements responsible for the stabilization of the global architecture are largely absent in the eukaryotic enzyme. At the same time, the protein makeup of eukaryotic RNase P is considerably more complex than that of the bacterial RNase P. RNase MRP, an essential and ubiquitous eukaryotic enzyme, has a structural organization resembling that of eukaryotic RNase P, and the two enzymes share most of their protein components. Here, we present the results of the analysis of interactions between the largest protein component of yeast RNases P/MRP, Pop1, and the RNA moieties of the enzymes, discuss structural implications of the results, and suggest that Pop1 plays the role of a scaffold for the stabilization of the global architecture of eukaryotic RNase P RNA, substituting for the network of RNA-RNA tertiary interactions that maintain the global RNA structure in bacterial RNase P. © 2015 Fagerlund et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. A study of eukaryotic response mechanisms to atmospheric pressure cold plasma by using Saccharomyces cerevisiae single gene mutants

    International Nuclear Information System (INIS)

    Feng Hongqing; Wang Ruixue; Sun Peng; Wu Haiyan; Liu Qi; Li Fangting; Fang Jing; Zhang Jue; Zhu Weidong

    2010-01-01

    The mechanisms of eukaryotic cell response to cold plasma are studied. A series of single gene mutants of eukaryotic model organism Saccharomyces cerevisiae are used to compare their sensitivity to plasma treatment with the wild type. We examined 12 mutants in the oxidative stress pathway and the cell cycle pathway, in which 8 are found to be hypersensitive to plasma processing. The mutated genes' roles in the two pathways are analyzed to understand the biological response mechanisms of plasma treatment. The results demonstrate that genes from both pathways are needed for the eukaryotic cells to survive the complex plasma treatment.

  12. In silico ionomics segregates parasitic from free-living eukaryotes.

    Science.gov (United States)

    Greganova, Eva; Steinmann, Michael; Mäser, Pascal; Fankhauser, Niklaus

    2013-01-01

    Ion transporters are fundamental to life. Due to their ancient origin and conservation in sequence, ion transporters are also particularly well suited for comparative genomics of distantly related species. Here, we perform genome-wide ion transporter profiling as a basis for comparative genomics of eukaryotes. From a given predicted proteome, we identify all bona fide ion channels, ion porters, and ion pumps. Concentrating on unicellular eukaryotes (n = 37), we demonstrate that clustering of species according to their repertoire of ion transporters segregates obligate endoparasites (n = 23) on the one hand, from free-living species and facultative parasites (n = 14) on the other hand. This surprising finding indicates strong convergent evolution of the parasites regarding the acquisition and homeostasis of inorganic ions. Random forest classification identifies transporters of ammonia, plus transporters of iron and other transition metals, as the most informative for distinguishing the obligate parasites. Thus, in silico ionomics further underscores the importance of iron in infection biology and suggests access to host sources of nitrogen and transition metals to be selective forces in the evolution of parasitism. This finding is in agreement with the phenomenon of iron withholding as a primordial antimicrobial strategy of infected mammals.

  13. topIb, a phylogenetic hallmark gene of Thaumarchaeota encodes a functional eukaryote-like topoisomerase IB.

    Science.gov (United States)

    Dahmane, Narimane; Gadelle, Danièle; Delmas, Stéphane; Criscuolo, Alexis; Eberhard, Stephan; Desnoues, Nicole; Collin, Sylvie; Zhang, Hongliang; Pommier, Yves; Forterre, Patrick; Sezonov, Guennadi

    2016-04-07

    Type IB DNA topoisomerases can eliminate torsional stresses produced during replication and transcription. These enzymes are found in all eukaryotes and a short version is present in some bacteria and viruses. Among prokaryotes, the long eukaryotic version is only observed in archaea of the phylum Thaumarchaeota. However, the activities and the roles of these topoisomerases have remained an open question. Here, we demonstrate that all available thaumarchaeal genomes contain a topoisomerase IB gene that defines a monophyletic group closely related to the eukaryotic enzymes. We show that the topIB gene is expressed in the model thaumarchaeon Nitrososphaera viennensis and we purified the recombinant enzyme from the uncultivated thaumarchaeon Candidatus Caldiarchaeum subterraneum. This enzyme is active in vitro at high temperature, making it the first thermophilic topoisomerase IB characterized so far. We have compared this archaeal type IB enzyme to its human mitochondrial and nuclear counterparts. The archaeal enzyme relaxes both negatively and positively supercoiled DNA like the eukaryotic enzymes. However, its pattern of DNA cleavage specificity is different and it is resistant to camptothecins (CPTs) and non-CPT Top1 inhibitors, LMP744 and lamellarin D. This newly described thermostable topoisomerases IB should be a promising new model for evolutionary, mechanistic and structural studies. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Interaction of the tick immune system with transmitted pathogens

    Directory of Open Access Journals (Sweden)

    Ondrej eHajdusek

    2013-07-01

    Full Text Available Ticks are hematophagous arachnids transmitting a wide variety of pathogens including viruses, bacteria, and protozoans to their vertebrate hosts. The tick vector competence has to be intimately linked to the ability of transmitted pathogens to evade tick defense mechanisms encountered on their route through the tick body comprising midgut, hemolymph, salivary glands or ovaries. Tick innate immunity is, like in other invertebrates, based on an orchestrated action of humoral and cellular immune responses. The direct antimicrobial defense in ticks is accomplished by a variety of small molecules such as defensins, lysozymes or by tick-specific antimicrobial compounds such as microplusin/hebraein or 5.3-kDa family proteins. Phagocytosis of the invading microbes by tick hemocytes seems to be mediated by the primordial complement-like system composed of thioester-containing proteins, fibrinogen-related lectins and convertase-like factors. Moreover, an important role in survival of the ingested microbes seems to be played by host proteins and redox balance maintenance in the tick midgut. Here, we summarize recent knowledge about the major components of tick immune system and focus on their interaction with the relevant tick-transmitted pathogens, represented by spirochetes (Borrelia, rickettsiae (Anaplasma, and protozoans (Babesia. Availability of the tick genomic database and feasibility of functional genomics based on RNA interference greatly contribute to the understanding of molecular and cellular interplay at the tick-pathogen interface and may provide new targets for blocking the transmission of tick pathogens.

  15. Eukaryotic translation initiation factor 2B-beta (eIF2Bβ), a new class of plant virus resistance gene.

    Science.gov (United States)

    Shopan, Jannat; Mou, Haipeng; Zhang, Lili; Zhang, Changtong; Ma, Weiwei; Walsh, John A; Hu, Zhongyuan; Yang, Jinghua; Zhang, Mingfang

    2017-06-01

    Recessive resistances to plant viruses in the Potyvirus genus have been found to be based on mutations in the plant eukaryotic translation initiation factors, eIF4E and eIF4G or their isoforms. Here we report that natural, monogenic recessive resistance to the Potyvirus Turnip mosaic virus (TuMV) has been found in a number of mustard (Brassica juncea) accessions. Bulked segregant analysis and sequencing of resistant and susceptible plant lines indicated the resistance is controlled by a single recessive gene, recessive TuMV resistance 03 (retr03), an allele of the eukaryotic translation initiation factor 2B-beta (eIF2Bβ). Silencing of eIF2Bβ in a TuMV-susceptible mustard plant line and expression of eIF2Bβ from a TuMV-susceptible line in a TuMV-resistant mustard plant line confirmed the new resistance mechanism. A functional copy of a specific allele of eIF2Bβ is required for efficient TuMV infection. eIF2Bβ represents a new class of virus resistance gene conferring resistance to any pathogen. eIF2B acts as a guanine nucleotide exchange factor (GEF) for its GTP-binding protein partner eIF2 via interaction with eIF2·GTP at an early step in translation initiation. Further genotyping indicated that a single non-synonymous substitution (A120G) in the N-terminal region of eIF2Bβ was responsible for the TuMV resistance. A reproducible marker has been developed, facilitating marker-assisted selection for TuMV resistance in B. juncea. Our findings provide a new target for seeking natural resistance to potyviruses and new opportunities for the control of potyviruses using genome editing techniques targeted on eIF2Bβ. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  16. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    Science.gov (United States)

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  17. Large variability of bathypelagic microbial eukaryotic communities across the world’s oceans

    KAUST Repository

    Pernice, Massimo C.

    2015-10-09

    In this work, we study the diversity of bathypelagic microbial eukaryotes (0.8–20 μm) in the global ocean. Seawater samples from 3000 to 4000 m depth from 27 stations in the Atlantic, Pacific and Indian Oceans were analyzed by pyrosequencing the V4 region of the 18S ribosomal DNA. The relative abundance of the most abundant operational taxonomic units agreed with the results of a parallel metagenomic analysis, suggesting limited PCR biases in the tag approach. Although rarefaction curves for single stations were seldom saturated, the global analysis of all sequences together suggested an adequate recovery of bathypelagic diversity. Community composition presented a large variability among samples, which was poorly explained by linear geographic distance. In fact, the similarity between communities was better explained by water mass composition (26% of the variability) and the ratio in cell abundance between prokaryotes and microbial eukaryotes (21%). Deep diversity appeared dominated by four taxonomic groups (Collodaria, Chrysophytes, Basidiomycota and MALV-II) appearing in different proportions in each sample. Novel diversity amounted to 1% of the pyrotags and was lower than expected. Our study represents an essential step in the investigation of bathypelagic microbial eukaryotes, indicating dominating taxonomic groups and suggesting idiosyncratic assemblages in distinct oceanic regions.

    The ISME Journal advance online publication, 9 October 2015; doi:10.1038/ismej.2015.170

  18. Lateral gene transfer between prokaryotes and multicellular eukaryotes: ongoing and significant?

    NARCIS (Netherlands)

    Ros, V.I.D.; Hurst, G.D.D.

    2009-01-01

    The expansion of genome sequencing projects has produced accumulating evidence for lateral transfer of genes between prokaryotic and eukaryotic genomes. However, it remains controversial whether these genes are of functional importance in their recipient host. Nikoh and Nakabachi, in a recent paper

  19. [Structure and evolution of the eukaryotic FANCJ-like proteins].

    Science.gov (United States)

    Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

    2015-02-01

    The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

  20. Distribution of Plasmids in Distinct Leptospira Pathogenic Species.

    Science.gov (United States)

    Wang, Yanzhuo; Zhuang, Xuran; Zhong, Yi; Zhang, Cuicai; Zhang, Yan; Zeng, Lingbing; Zhu, Yongzhang; He, Ping; Dong, Ke; Pal, Utpal; Guo, Xiaokui; Qin, Jinhong

    2015-11-01

    Leptospirosis, caused by pathogenic Leptospira, is a worldwide zoonotic infection. The genus Leptospira includes at least 21 species clustered into three groups--pathogens, non-pathogens, and intermediates--based on 16S rRNA phylogeny. Research on Leptospira is difficult due to slow growth and poor transformability of the pathogens. Recent identification of extrachromosomal elements besides the two chromosomes in L. interrogans has provided new insight into genome complexity of the genus Leptospira. The large size, low copy number, and high similarity of the sequence of these extrachromosomal elements with the chromosomes present challenges in isolating and detecting them without careful genome assembly. In this study, two extrachromosomal elements were identified in L. borgpetersenii serovar Ballum strain 56604 through whole genome assembly combined with S1 nuclease digestion following pulsed-field gel electrophoresis (S1-PFGE) analysis. Further, extrachromosomal elements in additional 15 Chinese epidemic strains of Leptospira, comprising L. borgpetersenii, L. weilii, and L. interrogans, were successfully separated and identified, independent of genome sequence data. Southern blot hybridization with extrachromosomal element-specific probes, designated as lcp1, lcp2 and lcp3-rep, further confirmed their occurrences as extrachromosomal elements. In total, 24 plasmids were detected in 13 out of 15 tested strains, among which 11 can hybridize with the lcp1-rep probe and 11 with the lcp2-rep probe, whereas two can hybridize with the lcp3-rep probe. None of them are likely to be species-specific. Blastp search of the lcp1, lcp2, and lcp3-rep genes with a nonredundant protein database of Leptospira species genomes showed that their homologous sequences are widely distributed among clades of pathogens but not non-pathogens or intermediates. These results suggest that the plasmids are widely distributed in Leptospira species, and further elucidation of their biological

  1. The Progress of Mitophagy and Related Pathogenic Mechanisms of the Neurodegenerative Diseases and Tumor

    Directory of Open Access Journals (Sweden)

    Ying Song

    2015-01-01

    Full Text Available Mitochondrion, an organelle with two layers of membrane, is extremely vital to eukaryotic cell. Its major functions are energy center and apoptosis censor inside cell. The intactness of mitochondrial membrane is important to maintain its structure and function. Mitophagy is one kind of autophagy. In recent years, studies of mitochondria have shown that mitophagy is regulated by various factors and is an important regulation mechanism for organisms to maintain their normal state. In addition, abnormal mitophagy is closely related to several neurodegenerative diseases and tumor. However, the related signal pathway and its regulation mechanism still remain unclear. As a result, summarizing the progress of mitophagy and its related pathogenic mechanism not only helps to reveal the complicated molecular mechanism, but also helps to find a new target to treat the related diseases.

  2. How MCM loading and spreading specify eukaryotic DNA replication initiation sites.

    Science.gov (United States)

    Hyrien, Olivier

    2016-01-01

    DNA replication origins strikingly differ between eukaryotic species and cell types. Origins are localized and can be highly efficient in budding yeast, are randomly located in early fly and frog embryos, which do not transcribe their genomes, and are clustered in broad (10-100 kb) non-transcribed zones, frequently abutting transcribed genes, in mammalian cells. Nonetheless, in all cases, origins are established during the G1-phase of the cell cycle by the loading of double hexamers of the Mcm 2-7 proteins (MCM DHs), the core of the replicative helicase. MCM DH activation in S-phase leads to origin unwinding, polymerase recruitment, and initiation of bidirectional DNA synthesis. Although MCM DHs are initially loaded at sites defined by the binding of the origin recognition complex (ORC), they ultimately bind chromatin in much greater numbers than ORC and only a fraction are activated in any one S-phase. Data suggest that the multiplicity and functional redundancy of MCM DHs provide robustness to the replication process and affect replication time and that MCM DHs can slide along the DNA and spread over large distances around the ORC. Recent studies further show that MCM DHs are displaced along the DNA by collision with transcription complexes but remain functional for initiation after displacement. Therefore, eukaryotic DNA replication relies on intrinsically mobile and flexible origins, a strategy fundamentally different from bacteria but conserved from yeast to human. These properties of MCM DHs likely contribute to the establishment of broad, intergenic replication initiation zones in higher eukaryotes.

  3. Structural basis for the initiation of eukaryotic transcription-coupled DNA repair.

    Science.gov (United States)

    Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A; Chong, Jenny; Hare, Alissa A; Dervan, Peter B; DiMaio, Frank; Leschziner, Andres E; Wang, Dong

    2017-11-30

    Eukaryotic transcription-coupled repair (TCR) is an important and well-conserved sub-pathway of nucleotide excision repair that preferentially removes DNA lesions from the template strand that block translocation of RNA polymerase II (Pol II). Cockayne syndrome group B (CSB, also known as ERCC6) protein in humans (or its yeast orthologues, Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe) is among the first proteins to be recruited to the lesion-arrested Pol II during the initiation of eukaryotic TCR. Mutations in CSB are associated with the autosomal-recessive neurological disorder Cockayne syndrome, which is characterized by progeriod features, growth failure and photosensitivity. The molecular mechanism of eukaryotic TCR initiation remains unclear, with several long-standing unanswered questions. How cells distinguish DNA lesion-arrested Pol II from other forms of arrested Pol II, the role of CSB in TCR initiation, and how CSB interacts with the arrested Pol II complex are all unknown. The lack of structures of CSB or the Pol II-CSB complex has hindered our ability to address these questions. Here we report the structure of the S. cerevisiae Pol II-Rad26 complex solved by cryo-electron microscopy. The structure reveals that Rad26 binds to the DNA upstream of Pol II, where it markedly alters its path. Our structural and functional data suggest that the conserved Swi2/Snf2-family core ATPase domain promotes the forward movement of Pol II, and elucidate key roles for Rad26 in both TCR and transcription elongation.

  4. The MCM Helicase Motor of the Eukaryotic Replisome.

    Science.gov (United States)

    Abid Ali, Ferdos; Costa, Alessandro

    2016-05-08

    The MCM motor of the CMG helicase powers ahead of the eukaryotic replication machinery to unwind DNA, in a process that requires ATP hydrolysis. The reconstitution of DNA replication in vitro has established the succession of events that lead to replication origin activation by the MCM and recent studies have started to elucidate the structural basis of duplex DNA unwinding. Despite the exciting progress, how the MCM translocates on DNA remains a matter of debate. Copyright © 2016. Published by Elsevier Ltd.

  5. Prokaryotic and eukaryotic features observed on the secondary structures of Giardia SSU rRNAs and its phylogenetic implications.

    Science.gov (United States)

    Hwang, Ui Wook

    2007-04-01

    Phylogenetic position of a diplomonad protist Giardia, a principle cause of diarrhea, among eukaryotes has been vigorously debated so far. Through the comparisons of primary and secondary structures of SSU rRNAs of G. intestinalis, G. microti, G. ardeae, and G. muris, I found two major indel regions (a 6-nt indel and a 22-26-nt indel), which correspond to the helix 10 of the V2 region and helices E23-8 to E23-9 of the V4 region, respectively. As generally shown in eukaryotes, G. intestinalis and G. microti have commonly a relatively longer helix 10 (a 7-bp stem and a 4-nt loop), and also the eukaryote-specific helices E23-6 to E23-9. On the other hand, G. muris and G. ardeae have a shorter helix 10: a 2-bp stem and a 6-nt loop in G. ardeae and a 3-bp stem and a 6-nt loop in G. muris. In the V4, they have a single long helix (like the P23-1 helix in prokaryotes) instead of the helices E23-6 to E23-9. Among the four Giardia species, co-appearance of prokaryote- and eukaryote-typical features might be significant evidence to suggest that Giardia (Archezoa) is a living fossil showing an "intermediate stage" during the evolution from prokaryotes to eukaryotes.

  6. Marine biofilm bacteria evade eukaryotic predation by targeted chemical defense.

    Directory of Open Access Journals (Sweden)

    Carsten Matz

    Full Text Available Many plants and animals are defended from predation or herbivory by inhibitory secondary metabolites, which in the marine environment are very common among sessile organisms. Among bacteria, where there is the greatest metabolic potential, little is known about chemical defenses against bacterivorous consumers. An emerging hypothesis is that sessile bacterial communities organized as biofilms serve as bacterial refuge from predation. By testing growth and survival of two common bacterivorous nanoflagellates, we find evidence that chemically mediated resistance against protozoan predators is common among biofilm populations in a diverse set of marine bacteria. Using bioassay-guided chemical and genetic analysis, we identified one of the most effective antiprotozoal compounds as violacein, an alkaloid that we demonstrate is produced predominately within biofilm cells. Nanomolar concentrations of violacein inhibit protozoan feeding by inducing a conserved eukaryotic cell death program. Such biofilm-specific chemical defenses could contribute to the successful persistence of biofilm bacteria in various environments and provide the ecological and evolutionary context for a number of eukaryote-targeting bacterial metabolites.

  7. Well-known surface and extracellular antigens of pathogenic microorganisms among the immunodominant proteins of the infectious microalgae Prototheca zopfii.

    Science.gov (United States)

    Irrgang, Alexandra; Murugaiyan, Jayaseelan; Weise, Christoph; Azab, Walid; Roesler, Uwe

    2015-01-01

    Microalgae of the genus Prototheca (P.) are associated with rare but severe infections (protothecosis) and represent a potential zoonotic risk. Genotype (GT) 2 of P. zopfii has been established as pathogenic agent for humans, dogs, and cattle, whereas GT1 is considered to be non-pathogenic. Since pathogenesis is poorly understood, the aim of this study was to determine immunogenic proteins and potential virulence factors of P. zopfii GT2. Therefore, 2D western blot analyses with sera and isolates of two dogs naturally infected with P. zopfii GT2 have been performed. Cross-reactivity was determined by including the type strains of P. zopfii GT2, P. zopfii GT1, and P. blaschkeae, a close relative of P. zopfii, which is known to cause subclinical forms of bovine mastitis. The sera showed a high strain-, genotype-, and species-cross-reactivity. A total of 198 immunogenic proteins have been analyzed via MALDI-TOF MS. The majority of the 86 identified proteins are intracellularly located (e.g., malate dehydrogenase, oxidoreductase, 3-dehydroquinate synthase) but some antigens and potential virulence factors, known from other pathogens, have been found (e.g., phosphomannomutase, triosephosphate isomerase). One genotype-specific antigen could be identified as heat shock protein 70 (Hsp70), a well-known antigen of eukaryotic pathogens with immunological importance when located extracellularly. Both sera were reactive to glyceraldehyde-3-phosphate-dehydrogenase of all investigated strains. This house-keeping enzyme is found to be located on the surface of several pathogens as virulence factor. Flow-cytometric analysis revealed its presence on the surface of P. blaschkeae.

  8. GFFview: A Web Server for Parsing and Visualizing Annotation Information of Eukaryotic Genome.

    Science.gov (United States)

    Deng, Feilong; Chen, Shi-Yi; Wu, Zhou-Lin; Hu, Yongsong; Jia, Xianbo; Lai, Song-Jia

    2017-10-01

    Owing to wide application of RNA sequencing (RNA-seq) technology, more and more eukaryotic genomes have been extensively annotated, such as the gene structure, alternative splicing, and noncoding loci. Annotation information of genome is prevalently stored as plain text in General Feature Format (GFF), which could be hundreds or thousands Mb in size. Therefore, it is a challenge for manipulating GFF file for biologists who have no bioinformatic skill. In this study, we provide a web server (GFFview) for parsing the annotation information of eukaryotic genome and then generating statistical description of six indices for visualization. GFFview is very useful for investigating quality and difference of the de novo assembled transcriptome in RNA-seq studies.

  9. FungiDB: An Integrated Bioinformatic Resource for Fungi and Oomycetes

    Directory of Open Access Journals (Sweden)

    Evelina Y. Basenko

    2018-03-01

    Full Text Available FungiDB (fungidb.org is a free online resource for data mining and functional genomics analysis for fungal and oomycete species. FungiDB is part of the Eukaryotic Pathogen Genomics Database Resource (EuPathDB, eupathdb.org platform that integrates genomic, transcriptomic, proteomic, and phenotypic datasets, and other types of data for pathogenic and nonpathogenic, free-living and parasitic organisms. FungiDB is one of the largest EuPathDB databases containing nearly 100 genomes obtained from GenBank, Aspergillus Genome Database (AspGD, The Broad Institute, Joint Genome Institute (JGI, Ensembl, and other sources. FungiDB offers a user-friendly web interface with embedded bioinformatics tools that support custom in silico experiments that leverage FungiDB-integrated data. In addition, a Galaxy-based workspace enables users to generate custom pipelines for large-scale data analysis (e.g., RNA-Seq, variant calling, etc.. This review provides an introduction to the FungiDB resources and focuses on available features, tools, and queries and how they can be used to mine data across a diverse range of integrated FungiDB datasets and records.

  10. The Plant Ribosome-Inactivating Proteins Play Important Roles in Defense against Pathogens and Insect Pest Attacks

    Directory of Open Access Journals (Sweden)

    Feng Zhu

    2018-02-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxic N-glycosidases that depurinate eukaryotic and prokaryotic rRNAs, thereby arresting protein synthesis during translation. RIPs are widely found in various plant species and within different tissues. It is demonstrated in vitro and in transgenic plants that RIPs have been connected to defense by antifungal, antibacterial, antiviral, and insecticidal activities. However, the mechanism of these effects is still not completely clear. There are a number of reviews of RIPs. However, there are no reviews on the biological functions of RIPs in defense against pathogens and insect pests. Therefore, in this report, we focused on the effect of RIPs from plants in defense against pathogens and insect pest attacks. First, we summarize the three different types of RIPs based on their physical properties. RIPs are generally distributed in plants. Then, we discuss the distribution of RIPs that are found in various plant species and in fungi, bacteria, algae, and animals. Various RIPs have shown unique bioactive properties including antibacterial, antifungal, antiviral, and insecticidal activity. Finally, we divided the discussion into the biological roles of RIPs in defense against bacteria, fungi, viruses, and insects. This review is focused on the role of plant RIPs in defense against bacteria, fungi, viruses, and insect attacks. The role of plant RIPs in defense against pathogens and insects is being comprehended currently. Future study utilizing transgenic technology approaches to study the mechanisms of RIPs will undoubtedly generate a better comprehending of the role of plant RIPs in defense against pathogens and insects. Discovering additional crosstalk mechanisms between RIPs and phytohormones or reactive oxygen species (ROS against pathogen and insect infections will be a significant subject in the field of biotic stress study. These studies are helpful in revealing significance of genetic control that can

  11. Insight into the transcriptome of Arthrobotrys conoides using high throughput sequencing.

    Science.gov (United States)

    Ramesh, Pandit; Reena, Patel; Amitbikram, Mohapatra; Chaitanya, Joshi; Anju, Kunjadia

    2015-12-01

    Arthrobotrys conoides is a nematode-trapping fungus belonging to Orbiliales, Ascomycota group, and traps prey nematodes by means of adhesive network. Fungus has a potential to be used as a biocontrol agent against plant parasitic nematodes. In the present study, we characterized the transcriptome of A. conoides using high-throughput sequencing technology and characterized its virulence unigenes. Total 7,255 cDNA contigs with an average length of 425 bp were generated and 6184 (61.81%) transcripts were functionally annotated and characterized. Majority of unigenes were found analogous to the genes of plant pathogenic fungi. A total of 1749 transcripts were found to be orthologous with eukaryotic proteins of KOG database. Several carbohydrate active enzymes and peptidases were identified. We also analyzed classically and nonclassically secreted proteins and confirmed by BLASTP against fungal secretome database. A total of 916 contigs were analogous to 556 unique proteins of Pathogen Host Interaction (PHI) database. Further, we identified 91 unigenes homologous to the database of fungal virulence factor (DFVF). A total of 104 putative protein kinases coding transcripts were identified by BLASTP against KinBase database, which are major players in signaling pathways. This study provides a comprehensive look at the transcriptome of A. conoides and the identified unigenes might have a role in catching and killing prey nematodes by A. conoides. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Mandibulofacial Dysostosis with Microcephaly: Mutation and Database Update

    DEFF Research Database (Denmark)

    Gregersen, Pernille Axel

    2016-01-01

    , we review the molecular basis of MFDM in the 69 individuals described to date, and report mutations in 38 new individuals, bringing the total number of reported individuals to 107 individuals from 94 kindreds. Pathogenic EFTUD2 variants comprise 76 distinct mutations and 7 microdeletions. Among point...... mutations, missense substitutions are infrequent (14/76; 18%) relative to stopgain (29/76; 38%), and splicing (33/76; 43%) mutations. Where known, mutation origin was de novo in 48/64 individuals (75%), dominantly-inherited in 12/64 (19%), and due to proven germline mosaicism in 4/64 (6%). Highly penetrant......-reported anomalies, include vestibular and ossicular malformations, reduced mouth opening, atrophy of cerebral white matter, structural brain malformations, and epibulbar dermoid. All reported EFTUD2 mutations can be found in the EFTUD2 mutation database (http://databases.lovd.nl/shared/genes/EFTUD2). This article...

  13. The Jigsaw Puzzle of mRNA Translation Initiation in Eukaryotes: A Decade of Structures Unraveling the Mechanics of the Process.

    Science.gov (United States)

    Hashem, Yaser; Frank, Joachim

    2018-03-01

    Translation initiation in eukaryotes is a highly regulated and rate-limiting process. It results in the assembly and disassembly of numerous transient and intermediate complexes involving over a dozen eukaryotic initiation factors (eIFs). This process culminates in the accommodation of a start codon marking the beginning of an open reading frame at the appropriate ribosomal site. Although this process has been extensively studied by hundreds of groups for nearly half a century, it has been only recently, especially during the last decade, that we have gained deeper insight into the mechanics of the eukaryotic translation initiation process. This advance in knowledge is due in part to the contributions of structural biology, which have shed light on the molecular mechanics underlying the different functions of various eukaryotic initiation factors. In this review, we focus exclusively on the contribution of structural biology to the understanding of the eukaryotic initiation process, a long-standing jigsaw puzzle that is just starting to yield the bigger picture. Expected final online publication date for the Annual Review of Biophysics Volume 47 is May 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  14. Computational Approaches for Prediction of Pathogen-Host Protein-Protein Interactions

    Directory of Open Access Journals (Sweden)

    Esmaeil eNourani

    2015-02-01

    Full Text Available Infectious diseases are still among the major and prevalent health problems, mostly because of the drug resistance of novel variants of pathogens. Molecular interactions between pathogens and their hosts are the key part of the infection mechanisms. Novel antimicrobial therapeutics to fight drug resistance is only possible in case of a thorough understanding of pathogen-host interaction (PHI systems. Existing databases, which contain experimentally verified PHI data, suffer from scarcity of reported interactions due to the technically challenging and time consuming process of experiments. This has motivated many researchers to address the problem by proposing computational approaches for analysis and prediction of PHIs. The computational methods primarily utilize sequence information, protein structure and known interactions. Classic machine learning techniques are used when there are sufficient known interactions to be used as training data. On the opposite case, transfer and multi task learning methods are preferred. Here, we present an overview of these computational approaches for PHI prediction, discussing their weakness and abilities, with future directions.

  15. Snapshot of the eukaryotic gene expression in muskoxen rumen--a metatranscriptomic approach.

    Directory of Open Access Journals (Sweden)

    Meng Qi

    Full Text Available BACKGROUND: Herbivores rely on digestive tract lignocellulolytic microorganisms, including bacteria, fungi and protozoa, to derive energy and carbon from plant cell wall polysaccharides. Culture independent metagenomic studies have been used to reveal the genetic content of the bacterial species within gut microbiomes. However, the nature of the genes encoded by eukaryotic protozoa and fungi within these environments has not been explored using metagenomic or metatranscriptomic approaches. METHODOLOGY/PRINCIPAL FINDINGS: In this study, a metatranscriptomic approach was used to investigate the functional diversity of the eukaryotic microorganisms within the rumen of muskoxen (Ovibos moschatus, with a focus on plant cell wall degrading enzymes. Polyadenylated RNA (mRNA was sequenced on the Illumina Genome Analyzer II system and 2.8 gigabases of sequences were obtained and 59129 contigs assembled. Plant cell wall degrading enzyme modules including glycoside hydrolases, carbohydrate esterases and polysaccharide lyases were identified from over 2500 contigs. These included a number of glycoside hydrolase family 6 (GH6, GH48 and swollenin modules, which have rarely been described in previous gut metagenomic studies. CONCLUSIONS/SIGNIFICANCE: The muskoxen rumen metatranscriptome demonstrates a much higher percentage of cellulase enzyme discovery and an 8.7x higher rate of total carbohydrate active enzyme discovery per gigabase of sequence than previous rumen metagenomes. This study provides a snapshot of eukaryotic gene expression in the muskoxen rumen, and identifies a number of candidate genes coding for potentially valuable lignocellulolytic enzymes.

  16. Snapshot of the Eukaryotic Gene Expression in Muskoxen Rumen—A Metatranscriptomic Approach

    Science.gov (United States)

    O'Toole, Nicholas; Barboza, Perry S.; Ungerfeld, Emilio; Leigh, Mary Beth; Selinger, L. Brent; Butler, Greg; Tsang, Adrian; McAllister, Tim A.; Forster, Robert J.

    2011-01-01

    Background Herbivores rely on digestive tract lignocellulolytic microorganisms, including bacteria, fungi and protozoa, to derive energy and carbon from plant cell wall polysaccharides. Culture independent metagenomic studies have been used to reveal the genetic content of the bacterial species within gut microbiomes. However, the nature of the genes encoded by eukaryotic protozoa and fungi within these environments has not been explored using metagenomic or metatranscriptomic approaches. Methodology/Principal Findings In this study, a metatranscriptomic approach was used to investigate the functional diversity of the eukaryotic microorganisms within the rumen of muskoxen (Ovibos moschatus), with a focus on plant cell wall degrading enzymes. Polyadenylated RNA (mRNA) was sequenced on the Illumina Genome Analyzer II system and 2.8 gigabases of sequences were obtained and 59129 contigs assembled. Plant cell wall degrading enzyme modules including glycoside hydrolases, carbohydrate esterases and polysaccharide lyases were identified from over 2500 contigs. These included a number of glycoside hydrolase family 6 (GH6), GH48 and swollenin modules, which have rarely been described in previous gut metagenomic studies. Conclusions/Significance The muskoxen rumen metatranscriptome demonstrates a much higher percentage of cellulase enzyme discovery and an 8.7x higher rate of total carbohydrate active enzyme discovery per gigabase of sequence than previous rumen metagenomes. This study provides a snapshot of eukaryotic gene expression in the muskoxen rumen, and identifies a number of candidate genes coding for potentially valuable lignocellulolytic enzymes. PMID:21655220

  17. Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eukaryotes

    Science.gov (United States)

    Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1994-01-01

    The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.

  18. Database Description - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Trypanosomes Database Database Description General information of database Database name Trypanosomes Database...stitute of Genetics Research Organization of Information and Systems Yata 1111, Mishima, Shizuoka 411-8540, JAPAN E mail: Database...y Name: Trypanosoma Taxonomy ID: 5690 Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database description The... Article title: Author name(s): Journal: External Links: Original website information Database maintenance s...DB (Protein Data Bank) KEGG PATHWAY Database DrugPort Entry list Available Query search Available Web servic

  19. Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

    Directory of Open Access Journals (Sweden)

    Marianna Feretzaki

    2016-03-01

    Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

  20. Eukaryotic RNA polymerase subunit RPB8 is a new relative of the OB family.

    Science.gov (United States)

    Krapp, S; Kelly, G; Reischl, J; Weinzierl, R O; Matthews, S

    1998-02-01

    RNA polymerase II subunit RPB8 is an essential subunit that is highly conserved throughout eukaryotic evolution and is present in all three types of nuclear RNA polymerases. We report the first high resolution structural insight into eukaryotic RNA polymerase architecture with the solution structure of RPB8 from Saccharomyces cerevisiae. It consists of an eight stranded, antiparallel beta-barrel, four short helical regions and a large, unstructured omega-loop. The strands are connected in classic Greek-key fashion. The overall topology is unusual and contains a striking C2 rotational symmetry. Furthermore, it is most likely a novel associate of the oligonucleotide/oligosaccharide (OB) binding protein class.

  1. Three-dimensional structural analysis of eukaryotic flagella/cilia by electron cryo-tomography

    International Nuclear Information System (INIS)

    Bui, Khanh Huy; Pigino, Gaia; Ishikawa, Takashi

    2011-01-01

    Based on the molecular architecture revealed by electron cryo-tomography, the mechanism of the bending motion of eukaryotic flagella/cilia is discussed. Electron cryo-tomography is a potential approach to analyzing the three-dimensional conformation of frozen hydrated biological macromolecules using electron microscopy. Since projections of each individual object illuminated from different orientations are merged, electron tomography is capable of structural analysis of such heterogeneous environments as in vivo or with polymorphism, although radiation damage and the missing wedge are severe problems. Here, recent results on the structure of eukaryotic flagella, which is an ATP-driven bending organelle, from green algae Chlamydomonas are presented. Tomographic analysis reveals asymmetric molecular arrangements, especially that of the dynein motor proteins, in flagella, giving insight into the mechanism of planar asymmetric bending motion. Methodological challenges to obtaining higher-resolution structures from this technique are also discussed

  2. An SVD-based comparison of nine whole eukaryotic genomes supports a coelomate rather than ecdysozoan lineage

    Directory of Open Access Journals (Sweden)

    Stuart Gary W

    2004-12-01

    Full Text Available Abstract Background Eukaryotic whole genome sequences are accumulating at an impressive rate. Effective methods for comparing multiple whole eukaryotic genomes on a large scale are needed. Most attempted solutions involve the production of large scale alignments, and many of these require a high stringency pre-screen for putative orthologs in order to reduce the effective size of the dataset and provide a reasonably high but unknown fraction of correctly aligned homologous sites for comparison. As an alternative, highly efficient methods that do not require the pre-alignment of operationally defined orthologs are also being explored. Results A non-alignment method based on the Singular Value Decomposition (SVD was used to compare the predicted protein complement of nine whole eukaryotic genomes ranging from yeast to man. This analysis resulted in the simultaneous identification and definition of a large number of well conserved motifs and gene families, and produced a species tree supporting one of two conflicting hypotheses of metazoan relationships. Conclusions Our SVD-based analysis of the entire protein complement of nine whole eukaryotic genomes suggests that highly conserved motifs and gene families can be identified and effectively compared in a single coherent definition space for the easy extraction of gene and species trees. While this occurs without the explicit definition of orthologs or homologous sites, the analysis can provide a basis for these definitions.

  3. Biological Influence of Deuterium on Procariotic and Eukaryotic Cells

    OpenAIRE

    Oleg Mosin; Ignat Ignatov

    2014-01-01

    Biologic influence of deuterium (D) on cells of various taxonomic groups of prokaryotic and eukaryotic microorganisms realizing methylotrophic, chemoheterotrophic, photo-organotrophic, and photosynthetic ways of assimilation of carbon substrates are investigated at growth on media with heavy water (D2О). The method of step by step adaptation technique of cells to D2О was developed, consisting in plating of cells on 2 % agarose nutrient media containing increasing gradient of concentration of ...

  4. An Evolutionary Framework for Understanding the Origin of Eukaryotes

    OpenAIRE

    Neil W. Blackstone

    2016-01-01

    Two major obstacles hinder the application of evolutionary theory to the origin of eukaryotes. The first is more apparent than real?the endosymbiosis that led to the mitochondrion is often described as ?non-Darwinian? because it deviates from the incremental evolution championed by the modern synthesis. Nevertheless, endosymbiosis can be accommodated by a multi-level generalization of evolutionary theory, which Darwin himself pioneered. The second obstacle is more serious?all of the major fea...

  5. Bacterial proteins pinpoint a single eukaryotic root

    Czech Academy of Sciences Publication Activity Database

    Derelle, R.; Torruella, G.; Klimeš, V.; Brinkmann, H.; Kim, E.; Vlček, Čestmír; Lang, B.F.; Eliáš, M.

    2015-01-01

    Roč. 112, č. 7 (2015), E693-E699 ISSN 0027-8424 R&D Projects: GA ČR GA13-24983S Grant - others:GA MŠk(CZ) ED2.1.00/03.0100; Howard Hughes Medical Institute International Early Career Scientist Program(US) 55007424; Spanish Ministry of Economy and Competitiveness, European Molecular Biology Organization Young Investigator Program(ES) BFU2012-31329; Spanish Ministry of Economy and Competitiveness, "Centro de Excelencia Severo Ochoa" - European Regional Development Fund(ES) Sev-2012-0208, BES-2013-064004 Institutional support: RVO:68378050 Keywords : eukaryote phylogeny * phylogenomics * Opimoda * Diphoda * LECA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.423, year: 2015

  6. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  7. Database Description - SKIP Stemcell Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us SKIP Stemcell Database Database Description General information of database Database name SKIP Stemcell Database...rsity Journal Search: Contact address http://www.skip.med.keio.ac.jp/en/contact/ Database classification Human Genes and Diseases Dat...abase classification Stemcell Article Organism Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database...ks: Original website information Database maintenance site Center for Medical Genetics, School of medicine, ...lable Web services Not available URL of Web services - Need for user registration Not available About This Database Database

  8. Database Description - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Arabidopsis Phenome Database Database Description General information of database Database n... BioResource Center Hiroshi Masuya Database classification Plant databases - Arabidopsis thaliana Organism T...axonomy Name: Arabidopsis thaliana Taxonomy ID: 3702 Database description The Arabidopsis thaliana phenome i...heir effective application. We developed the new Arabidopsis Phenome Database integrating two novel database...seful materials for their experimental research. The other, the “Database of Curated Plant Phenome” focusing

  9. Recognition of extremophilic archaeal viruses by eukaryotic cells

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch; Wu, Linping; Hall, Arnaldur

    2016-01-01

    followed viral uptake, intracellular trafficking and cell viability in human endothelial cells of brain (hCMEC/D3 cells) and umbilical vein (HUVEC) origin. Whereas SMV1 is efficiently internalized into both types of human cells, SSV2 differentiates between HUVECs and hCMEC/D3 cells, thus opening a path......Viruses from the third domain of life, Archaea, exhibit unusual features including extreme stability that allow their survival in harsh environments. In addition, these species have never been reported to integrate into human or any other eukaryotic genomes, and could thus serve for exploration...

  10. Development of a European resource on the origins of pathogens of aquaculture: The Europa Project

    DEFF Research Database (Denmark)

    Snow, M.; Barja, J.; Colquhoun, D.

    2004-01-01

    This workshop described the EUROPA project, an EU-funded program aimed at creating a web-based database of molecular sequence data-sets related to significant pathogens of aquaculture. The project aims to focus the efforts of fish health researchers into generating large, evolving and readily ava...

  11. Sex is a ubiquitous, ancient, and inherent attribute of eukaryotic life

    Czech Academy of Sciences Publication Activity Database

    Speijer, D.; Lukeš, Julius; Eliáš, M.

    2015-01-01

    Roč. 112, č. 29 (2015), s. 8827-8834 ISSN 0027-8424 R&D Projects: GA MŠk LH12104; GA ČR GA15-21974S Institutional support: RVO:60077344 Keywords : reactive oxygen species * evolution * protists * eukaryotes * sex Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.423, year: 2015

  12. Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

    Directory of Open Access Journals (Sweden)

    Klein Cátia S

    2009-12-01

    Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

  13. Six subgroups and extensive recent duplications characterize the evolution of the eukaryotic tubulin protein family.

    Science.gov (United States)

    Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin

    2014-08-27

    Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Tetrapyrroles as Endogenous TSPO Ligands in Eukaryotes and Prokaryotes: Comparisons with Synthetic Ligands

    Directory of Open Access Journals (Sweden)

    Leo Veenman

    2016-06-01

    Full Text Available The 18 kDa translocator protein (TSPO is highly 0conserved in eukaryotes and prokaryotes. Since its discovery in 1977, numerous studies established the TSPO’s importance for life essential functions. For these studies, synthetic TSPO ligands typically are applied. Tetrapyrroles present endogenous ligands for the TSPO. Tetrapyrroles are also evolutionarily conserved and regulate multiple functions. TSPO and tetrapyrroles regulate each other. In animals TSPO-tetrapyrrole interactions range from effects on embryonic development to metabolism, programmed cell death, response to stress, injury and disease, and even to life span extension. In animals TSPOs are primarily located in mitochondria. In plants TSPOs are also present in plastids, the nuclear fraction, the endoplasmic reticulum, and Golgi stacks. This may contribute to translocation of tetrapyrrole intermediates across organelles’ membranes. As in animals, plant TSPO binds heme and protoporphyrin IX. TSPO-tetrapyrrole interactions in plants appear to relate to development as well as stress conditions, including salt tolerance, abscisic acid-induced stress, reactive oxygen species homeostasis, and finally cell death regulation. In bacteria, TSPO is important for switching from aerobic to anaerobic metabolism, including the regulation of photosynthesis. As in mitochondria, in bacteria TSPO is located in the outer membrane. TSPO-tetrapyrrole interactions may be part of the establishment of the bacterial-eukaryote relationships, i.e., mitochondrial-eukaryote and plastid-plant endosymbiotic relationships.

  15. Redox characteristics of the eukaryotic cytosol

    DEFF Research Database (Denmark)

    López-Mirabal, H Reynaldo; Winther, Jakob R

    2007-01-01

    The eukaryotic cytoplasm has long been regarded as a cellular compartment in which the reduced state of protein cysteines is largely favored. Under normal conditions, the cytosolic low-molecular weight redox buffer, comprising primarily of glutathione, is highly reducing and reactive oxygen species...... (ROS) and glutathionylated proteins are maintained at very low levels. In the present review, recent progress in the understanding of the cytosolic thiol-disulfide redox metabolism and novel analytical approaches to studying cytosolic redox properties are discussed. We will focus on the yeast model...... organism, Saccharomyces cerevisiae, where the combination of genetic and biochemical approaches has brought us furthest in understanding the mechanisms underlying cellular redox regulation. It has been shown in yeast that, in addition to the enzyme glutathione reductase, other mechanisms may exist...

  16. Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

    Directory of Open Access Journals (Sweden)

    Nguyen-Hieu Tung

    2012-09-01

    Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

  17. Meeting Report: Minutes from EMBO: Ten Years of Comparative Genomics of Eukaryotic Microorganisms

    Czech Academy of Sciences Publication Activity Database

    Lukeš, Julius; López-García, P.; Louis, E.; Boekhout, T.

    2016-01-01

    Roč. 167, č. 3 (2016), s. 217-221 ISSN 1434-4610 Institutional support: RVO:60077344 Keywords : protist * eukaryotic microorganisms * genomics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.794, year: 2016

  18. Evolutionary tools for phytosanitary risk analysis: phylogenetic signal as a predictor of host range of plant pests and pathogens.

    Science.gov (United States)

    Gilbert, Gregory S; Magarey, Roger; Suiter, Karl; Webb, Campbell O

    2012-12-01

    Assessing risk from a novel pest or pathogen requires knowing which local plant species are susceptible. Empirical data on the local host range of novel pests are usually lacking, but we know that some pests are more likely to attack closely related plant species than species separated by greater evolutionary distance. We use the Global Pest and Disease Database, an internal database maintained by the United States Department of Agriculture Animal and Plant Health Inspection Service - Plant Protection and Quarantine Division (USDA APHIS-PPQ), to evaluate the strength of the phylogenetic signal in host range for nine major groups of plant pests and pathogens. Eight of nine groups showed significant phylogenetic signal in host range. Additionally, pests and pathogens with more known hosts attacked a phylogenetically broader range of hosts. This suggests that easily obtained data - the number of known hosts and the phylogenetic distance between known hosts and other species of interest - can be used to predict which plant species are likely to be susceptible to a particular pest. This can facilitate rapid assessment of risk from novel pests and pathogens when empirical host range data are not yet available and guide efficient collection of empirical data for risk evaluation.

  19. Evolutionary tools for phytosanitary risk analysis: phylogenetic signal as a predictor of host range of plant pests and pathogens

    Science.gov (United States)

    Gilbert, Gregory S; Magarey, Roger; Suiter, Karl; Webb, Campbell O

    2012-01-01

    Assessing risk from a novel pest or pathogen requires knowing which local plant species are susceptible. Empirical data on the local host range of novel pests are usually lacking, but we know that some pests are more likely to attack closely related plant species than species separated by greater evolutionary distance. We use the Global Pest and Disease Database, an internal database maintained by the United States Department of Agriculture Animal and Plant Health Inspection Service – Plant Protection and Quarantine Division (USDA APHIS-PPQ), to evaluate the strength of the phylogenetic signal in host range for nine major groups of plant pests and pathogens. Eight of nine groups showed significant phylogenetic signal in host range. Additionally, pests and pathogens with more known hosts attacked a phylogenetically broader range of hosts. This suggests that easily obtained data – the number of known hosts and the phylogenetic distance between known hosts and other species of interest – can be used to predict which plant species are likely to be susceptible to a particular pest. This can facilitate rapid assessment of risk from novel pests and pathogens when empirical host range data are not yet available and guide efficient collection of empirical data for risk evaluation. PMID:23346231

  20. Protein Export According to Schedule: Architecture, Assembly, and Regulation of Type III Secretion Systems from Plant- and Animal-Pathogenic Bacteria

    Science.gov (United States)

    2012-01-01

    Summary: Flagellar and translocation-associated type III secretion (T3S) systems are present in most Gram-negative plant- and animal-pathogenic bacteria and are often essential for bacterial motility or pathogenicity. The architectures of the complex membrane-spanning secretion apparatuses of both systems are similar, but they are associated with different extracellular appendages, including the flagellar hook and filament or the needle/pilus structures of translocation-associated T3S systems. The needle/pilus is connected to a bacterial translocon that is inserted into the host plasma membrane and mediates the transkingdom transport of bacterial effector proteins into eukaryotic cells. During the last 3 to 5 years, significant progress has been made in the characterization of membrane-associated core components and extracellular structures of T3S systems. Furthermore, transcriptional and posttranscriptional regulators that control T3S gene expression and substrate specificity have been described. Given the architecture of the T3S system, it is assumed that extracellular components of the secretion apparatus are secreted prior to effector proteins, suggesting that there is a hierarchy in T3S. The aim of this review is to summarize our current knowledge of T3S system components and associated control proteins from both plant- and animal-pathogenic bacteria. PMID:22688814

  1. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Directory of Open Access Journals (Sweden)

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  2. Well-known surface and extracellular antigens of pathogenic microorganisms among the immunodominant proteins of the infectious microalgae Prototheca zopfii

    Directory of Open Access Journals (Sweden)

    Alexandra eIrrgang

    2015-09-01

    Full Text Available Microalgae of the genus Prototheca (P. are associated with rare but severe infections (protothecosis and represent a potential zoonotic risk. Genotype (GT 2 of P. zopfii has been established as pathogenic agent for humans, dogs and cattle, whereas GT1 is considered to be non-pathogenic. Since pathogenesis is poorly understood, the aim of this study was to determine immunogenic proteins and potential virulence factors of P. zopfii GT2. Therefore, 2D western blot analyses with sera and isolates of two dogs naturally infected with P. zopfii GT2 have been performed. Cross-reactivity was determined by including the type strains of P. zopfii GT2, P. zopfii GT1 and P. blaschkeae, a close relative of P. zopfii, which is known to cause subclinical forms of bovine mastitis. The sera showed a high strain-, genotype-, and species-cross-reactivity. A total of 198 immunogenic proteins have been analysed via MALDI- TOF MS. The majority of the 86 identified proteins are intracellularly located (e.g. malate dehydrogenase, oxidoreductase, 3-dehydroquinate synthase but some antigens and potential virulence factors, known from other pathogens, have been found (e.g. phosphomannomutase, triosephosphate isomerase. One genotype-specific antigen could be identified as heat shock protein 70 (Hsp70, a well-known antigen of eukaryotic pathogens with immunological importance when located extracellularly. Both sera were reactive to glyceraldehyde-3-phosphate-dehydrogenase of all investigated strains. This house-keeping enzyme is found to be located on the surface of several pathogens as virulence factor. Flow-cytometric analysis revealed its presence on the surface of P. blaschkeae.

  3. The Big Bang of picorna-like virus evolution antedates the radiation of eukaryotic supergroups.

    Science.gov (United States)

    Koonin, Eugene V; Wolf, Yuri I; Nagasaki, Keizo; Dolja, Valerian V

    2008-12-01

    The recent discovery of RNA viruses in diverse unicellular eukaryotes and developments in evolutionary genomics have provided the means for addressing the origin of eukaryotic RNA viruses. The phylogenetic analyses of RNA polymerases and helicases presented in this Analysis article reveal close evolutionary relationships between RNA viruses infecting hosts from the Chromalveolate and Excavate supergroups and distinct families of picorna-like viruses of plants and animals. Thus, diversification of picorna-like viruses probably occurred in a 'Big Bang' concomitant with key events of eukaryogenesis. The origins of the conserved genes of picorna-like viruses are traced to likely ancestors including bacterial group II retroelements, the family of HtrA proteases and DNA bacteriophages.

  4. Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors.

    Science.gov (United States)

    Degnan, Patrick H; Yu, Yeisoo; Sisneros, Nicholas; Wing, Rod A; Moran, Nancy A

    2009-06-02

    Eukaryotes engage in a multitude of beneficial and deleterious interactions with bacteria. Hamiltonella defensa, an endosymbiont of aphids and other sap-feeding insects, protects its aphid host from attack by parasitoid wasps. Thus H. defensa is only conditionally beneficial to hosts, unlike ancient nutritional symbionts, such as Buchnera, that are obligate. Similar to pathogenic bacteria, H. defensa is able to invade naive hosts and circumvent host immune responses. We have sequenced the genome of H. defensa to identify possible mechanisms that underlie its persistence in healthy aphids and protection from parasitoids. The 2.1-Mb genome has undergone significant reduction in size relative to its closest free-living relatives, which include Yersinia and Serratia species (4.6-5.4 Mb). Auxotrophic for 8 of the 10 essential amino acids, H. defensa is reliant upon the essential amino acids produced by Buchnera. Despite these losses, the H. defensa genome retains more genes and pathways for a variety of cell structures and processes than do obligate symbionts, such as Buchnera. Furthermore, putative pathogenicity loci, encoding type-3 secretion systems, and toxin homologs, which are absent in obligate symbionts, are abundant in the H. defensa genome, as are regulatory genes that likely control the timing of their expression. The genome is also littered with mobile DNA, including phage-derived genes, plasmids, and insertion-sequence elements, highlighting its dynamic nature and the continued role horizontal gene transfer plays in shaping it.

  5. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf; Schmeier, Sebastian; Bajic, Vladimir B.

    2010-01-01

    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.

  6. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf

    2010-10-21

    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.

  7. Are maternal mitochondria the selfish entities that are masters of the cells of eukaryotic multicellular organisms?

    Science.gov (United States)

    Barlow, Peter W; Baldelli, E; Baluška, Frantisek

    2009-01-01

    The Energide concept, as well as the endosymbiotic theory of eukaryotic cell organization and evolution, proposes that present-day cells of eukaryotic organisms are mosaics of specialized and cooperating units, or organelles. Some of these units were originally free-living prokaryotes, which were engulfed during evolutionary time. Mitochondria represent one of these types of previously independent organisms, the Energide, is another type. This new perspective on the organization of the cell has been further expanded to reveal the concept of a public milieu, the cytosol, in which Energides and mitochondria live, each with their own private internal milieu. The present paper discusses how the endosymbiotic theory implicates a new hypothesis about the hierarchical and communicational organization of the integrated prokaryotic components of the eukaryotic cell and provides a new angle from which to consider the theory of evolution and its bearing upon cellular complexity. Thus, it is proposed that the “selfish gene” hypothesis of Dawkins1 is not the only possible perspective for comprehending genomic and cellular evolution. Our proposal is that maternal mitochondria are the selfish “master” entities of the eukaryotic cell with respect not only to their propagation from cell-to-cell and from generation-to-generation but also to their regulation of all other cellular functions. However, it should be recognized that the concept of “master” and “servant” cell components is a metaphor; in present-day living organisms their organellar components are considered to be interdependent and inseparable. PMID:19513277

  8. Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus

    Science.gov (United States)

    Monier, Adam; Pagarete, António; de Vargas, Colomban; Allen, Michael J.; Read, Betsy; Claverie, Jean-Michel; Ogata, Hiroyuki

    2009-01-01

    Interactions between viruses and phytoplankton, the main primary producers in the oceans, affect global biogeochemical cycles and climate. Recent studies are increasingly revealing possible cases of gene transfers between cyanobacteria and phages, which might have played significant roles in the evolution of cyanobacteria/phage systems. However, little has been documented about the occurrence of horizontal gene transfer in eukaryotic phytoplankton/virus systems. Here we report phylogenetic evidence for the transfer of seven genes involved in the sphingolipid biosynthesis pathway between the cosmopolitan eukaryotic microalga Emiliania huxleyi and its large DNA virus EhV. PCR assays indicate that these genes are prevalent in E. huxleyi and EhV strains isolated from different geographic locations. Patterns of protein and gene sequence conservation support that these genes are functional in both E. huxleyi and EhV. This is the first clear case of horizontal gene transfer of multiple functionally linked enzymes in a eukaryotic phytoplankton–virus system. We examine arguments for the possible direction of the gene transfer. The virus-to-host direction suggests the existence of ancient viruses that controlled the complex metabolic pathway in order to infect primitive eukaryotic cells. In contrast, the host-to-virus direction suggests that the serial acquisition of genes involved in the same metabolic pathway might have been a strategy for the ancestor of EhVs to stay ahead of their closest relatives in the great evolutionary race for survival. PMID:19451591

  9. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Eukaryotic community diversity and spatial variation during drinking water production (by seawater desalination) and distribution in a full-scale network

    KAUST Repository

    Belila, Abdelaziz

    2016-12-01

    Eukaryotic microorganisms are naturally present in many water resources and can enter, grow and colonize water treatment and transport systems, including reservoirs, pipes and premise plumbing. In this study, we explored the eukaryotic microbial community structure in water during the (i) production of drinking water in a seawater desalination plant and (ii) transport of the drinking water in the distribution network. The desalination plant treatment involved pre-treatment (e.g. spruce filters), reverse osmosis (RO) membrane filtration and post-treatment steps (e.g. remineralization). 454 pyrosequencing analysis of the 18S rRNA gene revealed a highly diverse (35 phyla) and spatially variable eukaryotic community during water treatment and distribution. The desalination plant feed water contained a typical marine picoeukaryotic community dominated by Stramenopiles, Alveolates and Porifera. In the desalination plant Ascomycota was the most dominant phylum (15.5% relative abundance), followed by Alveolata (11.9%), unclassified fungi clade (10.9%) and Porifera (10.7%). In the drinking water distribution network, an uncultured fungi phylum was the major group (44.0%), followed by Chordata (17.0%), Ascomycota (11.0%) and Arthropoda (8.0%). Fungi constituted 40% of the total eukaryotic community in the treatment plant and the distribution network and their taxonomic composition was dominated by an uncultured fungi clade (55%). Comparing the plant effluent to the network samples, 84 OTUs (2.1%) formed the core eukaryotic community while 35 (8.4%) and 299 (71.5%) constituted unique OTUs in the produced water at the plant and combined tap water samples from the network, respectively. RO membrane filtration treatment significantly changed the water eukaryotic community composition and structure, highlighting the fact that (i) RO produced water is not sterile and (ii) the microbial community in the final tap water is influenced by the downstream distribution system. The study

  11. Unexpected Importance of Potential Parasites in the Composition of the Freshwater Small-Eukaryote Community▿

    Science.gov (United States)

    Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

    2008-01-01

    The diversity of small eukaryotes (0.2 to 5 μm) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types. PMID:18359836

  12. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.; Oke, Muse; Hamdan, Samir

    2014-01-01

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  13. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.

    2014-11-21

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  14. Influence of Vitamin B Auxotrophy on Nitrogen Metabolism in Eukaryotic Phytoplankton

    Directory of Open Access Journals (Sweden)

    Erin M Bertrand

    2012-10-01

    Full Text Available While nitrogen availability is known to limit primary production in large parts of the ocean, vitamin starvation amongst eukaryotic phytoplankton is becoming increasingly recognized as an oceanographically relevant phenomenon. Cobalamin (B12 and thiamine (B1 auxotrophy are widespread throughout eukaryotic phytoplankton, with over 50% of cultured isolates requiring B12 and 20% requiring B1. The frequency of vitamin auxotrophy in harmful algal bloom species is even higher. Instances of colimitation between nitrogen and B vitamins have been observed in marine environments, and interactions between these nutrients have been shown to impact phytoplankton species composition. This review evaluates the potential for interactive effects of nitrogen and vitamin B12 and B1 starvation in eukaryotic phytoplankton. B12 plays essential roles in amino acid and one-carbon metabolism, while B1 is important for primary carbohydrate and amino acid metabolism and likely useful as an anti-oxidant. Here we will focus on three potential metabolic interconnections between vitamin, nitrogen and sulfur metabolism that may have ramifications for the role of vitamin and nitrogen scarcities in driving ocean productivity and species composition. These include: (1 B12, B1, and N starvation impacts on osmolyte and antioxidant production, (2 B12 and B1 starvation impacts on polyamine biosynthesis, and (3 influence of B12 and B1 starvation on the diatom urea cycle and amino acid recycling through impacts on the citric acid cycle. We evaluate evidence for these interconnections and identify oceanographic contexts in which each may impact rates of primary production and phytoplankton community composition. Major implications include that B12 and B1 deprivation may impair the ability of phytoplankton to recover from nitrogen starvation and that changes in vitamin and nitrogen availability may synergistically impact harmful algal bloom formation.

  15. How and why DNA barcodes underestimate the diversity of microbial eukaryotes.

    Directory of Open Access Journals (Sweden)

    Gwenael Piganeau

    Full Text Available BACKGROUND: Because many picoplanktonic eukaryotic species cannot currently be maintained in culture, direct sequencing of PCR-amplified 18S ribosomal gene DNA fragments from filtered sea-water has been successfully used to investigate the astounding diversity of these organisms. The recognition of many novel planktonic organisms is thus based solely on their 18S rDNA sequence. However, a species delimited by its 18S rDNA sequence might contain many cryptic species, which are highly differentiated in their protein coding sequences. PRINCIPAL FINDINGS: Here, we investigate the issue of species identification from one gene to the whole genome sequence. Using 52 whole genome DNA sequences, we estimated the global genetic divergence in protein coding genes between organisms from different lineages and compared this to their ribosomal gene sequence divergences. We show that this relationship between proteome divergence and 18S divergence is lineage dependent. Unicellular lineages have especially low 18S divergences relative to their protein sequence divergences, suggesting that 18S ribosomal genes are too conservative to assess planktonic eukaryotic diversity. We provide an explanation for this lineage dependency, which suggests that most species with large effective population sizes will show far less divergence in 18S than protein coding sequences. CONCLUSIONS: There is therefore a trade-off between using genes that are easy to amplify in all species, but which by their nature are highly conserved and underestimate the true number of species, and using genes that give a better description of the number of species, but which are more difficult to amplify. We have shown that this trade-off differs between unicellular and multicellular organisms as a likely consequence of differences in effective population sizes. We anticipate that biodiversity of microbial eukaryotic species is underestimated and that numerous "cryptic species" will become

  16. Cyclebase 3.0: a multi-organism database on cell-cycle regulation and phenotypes.

    Science.gov (United States)

    Santos, Alberto; Wernersson, Rasmus; Jensen, Lars Juhl

    2015-01-01

    The eukaryotic cell division cycle is a highly regulated process that consists of a complex series of events and involves thousands of proteins. Researchers have studied the regulation of the cell cycle in several organisms, employing a wide range of high-throughput technologies, such as microarray-based mRNA expression profiling and quantitative proteomics. Due to its complexity, the cell cycle can also fail or otherwise change in many different ways if important genes are knocked out, which has been studied in several microscopy-based knockdown screens. The data from these many large-scale efforts are not easily accessed, analyzed and combined due to their inherent heterogeneity. To address this, we have created Cyclebase--available at http://www.cyclebase.org--an online database that allows users to easily visualize and download results from genome-wide cell-cycle-related experiments. In Cyclebase version 3.0, we have updated the content of the database to reflect changes to genome annotation, added new mRNA and protein expression data, and integrated cell-cycle phenotype information from high-content screens and model-organism databases. The new version of Cyclebase also features a new web interface, designed around an overview figure that summarizes all the cell-cycle-related data for a gene. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Comparative radiobiology of genetic loci of eukaryots as the basis of the general theory of mutations

    International Nuclear Information System (INIS)

    Aleksandrov, I.D.

    1983-01-01

    One of the fundamental problems of modern molecular cellular radiobiology is to reveal general and peculiar processes of the formation of gene mutations and chromosome aberrations in each stage of their formation in the irradiated genome of the higher eukaryots. The solution of the problems depends on the development of research within the framework of comparative radiobiology of genetic loci of the higher eukaryots that makes it possible to study quantitative regularities in the formation of gene (point) mutations and chromosome aberrations in one object and in the same experiment

  18. The Opportunistic Pathogen Serratia marcescens Utilizes Type VI Secretion To Target Bacterial Competitors ▿†

    Science.gov (United States)

    Murdoch, Sarah L.; Trunk, Katharina; English, Grant; Fritsch, Maximilian J.; Pourkarimi, Ehsan; Coulthurst, Sarah J.

    2011-01-01

    The type VI secretion system (T6SS) is the most recently described and least understood of the protein secretion systems of Gram-negative bacteria. It is widely distributed and has been implicated in the virulence of various pathogens, but its mechanism and exact mode of action remain to be defined. Additionally there have been several very recent reports that some T6SSs can target bacteria rather than eukaryotic cells. Serratia marcescens is an opportunistic enteric pathogen, a class of bacteria responsible for a significant proportion of hospital-acquired infections. We describe the identification of a functional T6SS in S. marcescens strain Db10, the first report of type VI secretion by an opportunist enteric bacterium. The T6SS of S. marcescens Db10 is active, with secretion of Hcp to the culture medium readily detected, and is expressed constitutively under normal growth conditions from a large transcriptional unit. Expression of the T6SS genes did not appear to be dependent on the integrity of the T6SS. The S. marcescens Db10 T6SS is not required for virulence in three nonmammalian virulence models. It does, however, exhibit dramatic antibacterial killing activity against several other bacterial species and is required for S. marcescens to persist in a mixed culture with another opportunist pathogen, Enterobacter cloacae. Importantly, this antibacterial killing activity is highly strain specific, with the S. marcescens Db10 T6SS being highly effective against another strain of S. marcescens with a very similar and active T6SS. We conclude that type VI secretion plays a crucial role in the competitiveness, and thus indirectly the virulence, of S. marcescens and other opportunistic bacterial pathogens. PMID:21890705

  19. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  20. Different polyamine pathways from bacteria have replaced eukaryotic spermidine biosynthesis in ciliates Tetrahymena thermophila and Paramecium tetaurelia.

    Science.gov (United States)

    Li, Bin; Kim, Sok Ho; Zhang, Yang; Hanfrey, Colin C; Elliott, Katherine A; Ealick, Steven E; Michael, Anthony J

    2015-09-01

    The polyamine spermidine is absolutely required for growth and cell proliferation in eukaryotes, due to its role in post-translational modification of essential translation elongation factor eIF5A, mediated by deoxyhypusine synthase. We have found that free-living ciliates Tetrahymena and Paramecium lost the eukaryotic genes encoding spermidine biosynthesis: S-adenosylmethionine decarboxylase (AdoMetDC) and spermidine synthase (SpdSyn). In Tetrahymena, they were replaced by a gene encoding a fusion protein of bacterial AdoMetDC and SpdSyn, present as three copies. In Paramecium, a bacterial homospermidine synthase replaced the eukaryotic genes. Individual AdoMetDC-SpdSyn fusion protein paralogues from Tetrahymena exhibit undetectable AdoMetDC activity; however, when two paralogous fusion proteins are mixed, AdoMetDC activity is restored and spermidine is synthesized. Structural modelling indicates a functional active site is reconstituted by sharing critical residues from two defective protomers across the heteromer interface. Paramecium was found to accumulate homospermidine, suggesting it replaces spermidine for growth. To test this concept, a budding yeast spermidine auxotrophic strain was found to grow almost normally with homospermidine instead of spermidine. Biosynthesis of spermidine analogue aminopropylcadaverine, but not exogenously provided norspermidine, correlated with some growth. Finally, we found that diverse single-celled eukaryotic parasites and multicellular metazoan Schistosoma worms have lost the spermidine biosynthetic pathway but retain deoxyhypusine synthase. © 2015 John Wiley & Sons Ltd.

  1. Metabolic investigation of host/pathogen interaction using MS2-infected Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jain Rishi

    2009-12-01

    Full Text Available Abstract Background RNA viruses are responsible for a variety of illnesses among people, including but not limited to the common cold, the flu, HIV, and ebola. Developing new drugs and new strategies for treating diseases caused by these viruses can be an expensive and time-consuming process. Mathematical modeling may be used to elucidate host-pathogen interactions and highlight potential targets for drug development, as well providing the basis for optimizing patient treatment strategies. The purpose of this work was to determine whether a genome-scale modeling approach could be used to understand how metabolism is impacted by the host-pathogen interaction during a viral infection. Escherichia coli/MS2 was used as the host-pathogen model system as MS2 is easy to work with, harmless to humans, but shares many features with eukaryotic viruses. In addition, the genome-scale metabolic model of E. coli is the most comprehensive model at this time. Results Employing a metabolic modeling strategy known as "flux balance analysis" coupled with experimental studies, we were able to predict how viral infection would alter bacterial metabolism. Based on our simulations, we predicted that cell growth and biosynthesis of the cell wall would be halted. Furthermore, we predicted a substantial increase in metabolic activity of the pentose phosphate pathway as a means to enhance viral biosynthesis, while a break down in the citric acid cycle was predicted. Also, no changes were predicted in the glycolytic pathway. Conclusions Through our approach, we have developed a technique of modeling virus-infected host metabolism and have investigated the metabolic effects of viral infection. These studies may provide insight into how to design better drugs. They also illustrate the potential of extending such metabolic analysis to higher order organisms, including humans.

  2. Insights into the evolution of sialic acid catabolism among bacteria

    Directory of Open Access Journals (Sweden)

    Almagro-Moreno Salvador

    2009-05-01

    Full Text Available Abstract Background Sialic acids comprise a family of nine-carbon amino sugars that are prevalent in mucus rich environments. Sialic acids from the human host are used by a number of pathogens as an energy source. Here we explore the evolution of the genes involved in the catabolism of sialic acid. Results The cluster of genes encoding the enzymes N-acetylneuraminate lyase (NanA, epimerase (NanE, and kinase (NanK, necessary for the catabolism of sialic acid (the Nan cluster, are confined 46 bacterial species, 42 of which colonize mammals, 33 as pathogens and 9 as gut commensals. We found a putative sialic acid transporter associated with the Nan cluster in most species. We reconstructed the phylogenetic history of the NanA, NanE, and NanK proteins from the 46 species and compared them to the species tree based on 16S rRNA. Within the NanA phylogeny, Gram-negative and Gram-positive bacteria do not form distinct clades. NanA from Yersinia and Vibrio species was most closely related to the NanA clade from eukaryotes. To examine this further, we reconstructed the phylogeny of all NanA homologues in the databases. In this analysis of 83 NanA sequences, Bacteroidetes, a human commensal group formed a distinct clade with Verrucomicrobia, and branched with the Eukaryotes and the Yersinia/Vibrio clades. We speculate that pathogens such as V. cholerae may have acquired NanA from a commensal aiding their colonization of the human gut. Both the NanE and NanK phylogenies more closely represented the species tree but numerous incidences of incongruence are noted. We confirmed the predicted function of the sialic acid catabolism cluster in members the major intestinal pathogens Salmonella enterica, Vibrio cholerae, V. vulnificus, Yersinia enterocolitica and Y. pestis. Conclusion The Nan cluster among bacteria is confined to human pathogens and commensals conferring them the ability to utilize a ubiquitous carbon source in mucus rich surfaces of the human body

  3. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  4. Not in your usual Top 10: protists that infect plants and algae.

    Science.gov (United States)

    Schwelm, Arne; Badstöber, Julia; Bulman, Simon; Desoignies, Nicolas; Etemadi, Mohammad; Falloon, Richard E; Gachon, Claire M M; Legreve, Anne; Lukeš, Julius; Merz, Ueli; Nenarokova, Anna; Strittmatter, Martina; Sullivan, Brooke K; Neuhauser, Sigrid

    2018-04-01

    Fungi, nematodes and oomycetes belong to the most prominent eukaryotic plant pathogenic organisms. Unicellular organisms from other eukaryotic lineages, commonly addressed as protists, also infect plants. This review provides an introduction to plant pathogenic protists, including algae infecting oomycetes, and their current state of research. © 2017 THE AUTHORS. MOLECULAR PLANT PATHOLOGY PUBLISHED BY BRITISH SOCIETY FOR PLANT PATHOLOGY AND JOHN WILEY & SONS LTD.

  5. The Co-regulation Data Harvester: Automating gene annotation starting from a transcriptome database

    Science.gov (United States)

    Tsypin, Lev M.; Turkewitz, Aaron P.

    Identifying co-regulated genes provides a useful approach for defining pathway-specific machinery in an organism. To be efficient, this approach relies on thorough genome annotation, a process much slower than genome sequencing per se. Tetrahymena thermophila, a unicellular eukaryote, has been a useful model organism and has a fully sequenced but sparsely annotated genome. One important resource for studying this organism has been an online transcriptomic database. We have developed an automated approach to gene annotation in the context of transcriptome data in T. thermophila, called the Co-regulation Data Harvester (CDH). Beginning with a gene of interest, the CDH identifies co-regulated genes by accessing the Tetrahymena transcriptome database. It then identifies their closely related genes (orthologs) in other organisms by using reciprocal BLAST searches. Finally, it collates the annotations of those orthologs' functions, which provides the user with information to help predict the cellular role of the initial query. The CDH, which is freely available, represents a powerful new tool for analyzing cell biological pathways in Tetrahymena. Moreover, to the extent that genes and pathways are conserved between organisms, the inferences obtained via the CDH should be relevant, and can be explored, in many other systems.

  6. Changes in bacterial and eukaryotic communities during sewage decomposition in Mississippi River water

    Science.gov (United States)

    Microbial decay processes are one of the mechanisms whereby sewage contamination is reduced in the environment. This decomposition process involves a highly complex array of bacterial and eukaryotic communities from both sewage and ambient waters. However, relatively little is kn...

  7. Ensuring privacy in the study of pathogen genetics.

    Science.gov (United States)

    Mehta, Sanjay R; Vinterbo, Staal A; Little, Susan J

    2014-08-01

    Rapid growth in the genetic sequencing of pathogens in recent years has led to the creation of large sequence databases. This aggregated sequence data can be very useful for tracking and predicting epidemics of infectious diseases. However, the balance between the potential public health benefit and the risk to personal privacy for individuals whose genetic data (personal or pathogen) are included in such work has been difficult to delineate, because neither the true benefit nor the actual risk to participants has been adequately defined. Existing approaches to minimise the risk of privacy loss to participants are based on de-identification of data by removal of a predefined set of identifiers. These approaches neither guarantee privacy nor protect the usefulness of the data. We propose a new approach to privacy protection that will quantify the risk to participants, while still maximising the usefulness of the data to researchers. This emerging standard in privacy protection and disclosure control, which is known as differential privacy, uses a process-driven rather than data-centred approach to protecting privacy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  9. Universal Temporal Profile of Replication Origin Activation in Eukaryotes

    Science.gov (United States)

    Goldar, Arach

    2011-03-01

    The complete and faithful transmission of eukaryotic genome to daughter cells involves the timely duplication of mother cell's DNA. DNA replication starts at multiple chromosomal positions called replication origin. From each activated replication origin two replication forks progress in opposite direction and duplicate the mother cell's DNA. While it is widely accepted that in eukaryotic organisms replication origins are activated in a stochastic manner, little is known on the sources of the observed stochasticity. It is often associated to the population variability to enter S phase. We extract from a growing Saccharomyces cerevisiae population the average rate of origin activation in a single cell by combining single molecule measurements and a numerical deconvolution technique. We show that the temporal profile of the rate of origin activation in a single cell is similar to the one extracted from a replicating cell population. Taking into account this observation we exclude the population variability as the origin of observed stochasticity in origin activation. We confirm that the rate of origin activation increases in the early stage of S phase and decreases at the latter stage. The population average activation rate extracted from single molecule analysis is in prefect accordance with the activation rate extracted from published micro-array data, confirming therefore the homogeneity and genome scale invariance of dynamic of replication process. All these observations point toward a possible role of replication fork to control the rate of origin activation.

  10. Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

    Directory of Open Access Journals (Sweden)

    Katja Kriebel

    Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

  11. Determinants of the Sympatric Host-Pathogen Relationship in Tuberculosis

    Science.gov (United States)

    David, Susana; Mateus, A. R. A.; Duarte, Elsa L.; Albuquerque, José; Portugal, Clara; Sancho, Luísa; Lavinha, João; Gonçalves, Guilherme

    2015-01-01

    Major contributions from pathogen genome analysis and host genetics have equated the possibility of Mycobacterium tuberculosis co-evolution with its human host leading to more stable sympatric host–pathogen relationships. However, the attribution to either sympatric or allopatric categories depends on the resolution or grain of genotypic characterization. We explored the influence on the sympatric host-pathogen relationship of clinical (HIV infection and multidrug-resistant tuberculosis [MDRTB]) and demographic (gender and age) factors in regards to the genotypic grain by using spacer oligonucleotide typing (spoligotyping) for classification of M. tuberculosis strains within the Euro-American lineage. We analyzed a total of 547 tuberculosis (TB) cases, from six year consecutive sampling in a setting with high TB-HIV coinfection (32.0%). Of these, 62.0% were caused by major circulating pathogen genotypes. The sympatric relationship was defined according to spoligotype in comparison to the international spoligotype database SpolDB4. While no significant association with Euro-American lineage was observed with any of the factors analyzed, increasing the resolution with spoligotyping evidenced a significant association of MDRTB with sympatric strains, regardless of the HIV status. Furthermore, distribution curves of the prevalence of sympatric and allopatric TB in relation to patients’ age showed an accentuation of the relevance of the age of onset in the allopatric relationship, as reflected in the trimodal distribution. On the contrary, sympatric TB was characterized by the tendency towards a typical (standard) distribution curve. Our results suggest that within the Euro-American lineage a greater degree of genotyping fine-tuning is necessary in modeling the biological processes behind the host-pathogen interplay. Furthermore, prevalence distribution of sympatric TB to age was suggestive of host genetic determinisms driven by more common variants. PMID:26529092

  12. Database Description - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Database Description General information of database Database... name Yeast Interacting Proteins Database Alternative name - DOI 10.18908/lsdba.nbdc00742-000 Creator C...-ken 277-8561 Tel: +81-4-7136-3989 FAX: +81-4-7136-3979 E-mail : Database classif...s cerevisiae Taxonomy ID: 4932 Database description Information on interactions and related information obta...l Acad Sci U S A. 2001 Apr 10;98(8):4569-74. Epub 2001 Mar 13. External Links: Original website information Database

  13. Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

    Directory of Open Access Journals (Sweden)

    Erik Corona

    Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

  14. Update History of This Database - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Trypanosomes Database Update History of This Database Date Update contents 2014/05/07 The co...ntact information is corrected. The features and manner of utilization of the database are corrected. 2014/02/04 Trypanosomes Databas...e English archive site is opened. 2011/04/04 Trypanosomes Database ( http://www.tan...paku.org/tdb/ ) is opened. About This Database Database Description Download Lice...nse Update History of This Database Site Policy | Contact Us Update History of This Database - Trypanosomes Database | LSDB Archive ...

  15. Incoherent feedforward control governs adaptation of activated ras in a eukaryotic chemotaxis pathway.

    Science.gov (United States)

    Takeda, Kosuke; Shao, Danying; Adler, Micha; Charest, Pascale G; Loomis, William F; Levine, Herbert; Groisman, Alex; Rappel, Wouter-Jan; Firtel, Richard A

    2012-01-03

    Adaptation in signaling systems, during which the output returns to a fixed baseline after a change in the input, often involves negative feedback loops and plays a crucial role in eukaryotic chemotaxis. We determined the dynamical response to a uniform change in chemoattractant concentration of a eukaryotic chemotaxis pathway immediately downstream from G protein-coupled receptors. The response of an activated Ras showed near-perfect adaptation, leading us to attempt to fit the results using mathematical models for the two possible simple network topologies that can provide perfect adaptation. Only the incoherent feedforward network accurately described the experimental results. This analysis revealed that adaptation in this Ras pathway is achieved through the proportional activation of upstream components and not through negative feedback loops. Furthermore, these results are consistent with a local excitation, global inhibition mechanism for gradient sensing, possibly with a Ras guanosine triphosphatase-activating protein acting as a global inhibitor.

  16. Reassigning stop codons via translation termination: How a few eukaryotes broke the dogma.

    Science.gov (United States)

    Alkalaeva, Elena; Mikhailova, Tatiana

    2017-03-01

    The genetic code determines how amino acids are encoded within mRNA. It is universal among the vast majority of organisms, although several exceptions are known. Variant genetic codes are found in ciliates, mitochondria, and numerous other organisms. All revealed genetic codes (standard and variant) have at least one codon encoding a translation stop signal. However, recently two new genetic codes with a reassignment of all three stop codons were revealed in studies examining the protozoa transcriptomes. Here, we discuss this finding and the recent studies of variant genetic codes in eukaryotes. We consider the possible molecular mechanisms allowing the use of certain codons as sense and stop signals simultaneously. The results obtained by studying these amazing organisms represent a new and exciting insight into the mechanism of stop codon decoding in eukaryotes. Also see the video abstract here. © 2017 WILEY Periodicals, Inc.

  17. Production of isotopically labeled heterologous proteins in non-E. coli prokaryotic and eukaryotic cells

    International Nuclear Information System (INIS)

    Takahashi, Hideo; Shimada, Ichio

    2010-01-01

    The preparation of stable isotope-labeled proteins is necessary for the application of a wide variety of NMR methods, to study the structures and dynamics of proteins and protein complexes. The E. coli expression system is generally used for the production of isotope-labeled proteins, because of the advantages of ease of handling, rapid growth, high-level protein production, and low cost for isotope-labeling. However, many eukaryotic proteins are not functionally expressed in E. coli, due to problems related to disulfide bond formation, post-translational modifications, and folding. In such cases, other expression systems are required for producing proteins for biomolecular NMR analyses. In this paper, we review the recent advances in expression systems for isotopically labeled heterologous proteins, utilizing non-E. coli prokaryotic and eukaryotic cells.

  18. Evolutionary Inference across Eukaryotes Identifies Specific Pressures Favoring Mitochondrial Gene Retention.

    Science.gov (United States)

    Johnston, Iain G; Williams, Ben P

    2016-02-24

    Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Heterologous Expression of Toxins from Bacterial Toxin-Antitoxin Systems in Eukaryotic Cells: Strategies and Applications

    Science.gov (United States)

    Yeo, Chew Chieng; Abu Bakar, Fauziah; Chan, Wai Ting; Espinosa, Manuel; Harikrishna, Jennifer Ann

    2016-01-01

    Toxin-antitoxin (TA) systems are found in nearly all prokaryotic genomes and usually consist of a pair of co-transcribed genes, one of which encodes a stable toxin and the other, its cognate labile antitoxin. Certain environmental and physiological cues trigger the degradation of the antitoxin, causing activation of the toxin, leading either to the death or stasis of the host cell. TA systems have a variety of functions in the bacterial cell, including acting as mediators of programmed cell death, the induction of a dormant state known as persistence and the stable maintenance of plasmids and other mobile genetic elements. Some bacterial TA systems are functional when expressed in eukaryotic cells and this has led to several innovative applications, which are the subject of this review. Here, we look at how bacterial TA systems have been utilized for the genetic manipulation of yeasts and other eukaryotes, for the containment of genetically modified organisms, and for the engineering of high expression eukaryotic cell lines. We also examine how TA systems have been adopted as an important tool in developmental biology research for the ablation of specific cells and the potential for utility of TA systems in antiviral and anticancer gene therapies. PMID:26907343

  20. Heterologous Expression of Toxins from Bacterial Toxin-Antitoxin Systems in Eukaryotic Cells: Strategies and Applications

    Directory of Open Access Journals (Sweden)

    Chew Chieng Yeo

    2016-02-01

    Full Text Available Toxin-antitoxin (TA systems are found in nearly all prokaryotic genomes and usually consist of a pair of co-transcribed genes, one of which encodes a stable toxin and the other, its cognate labile antitoxin. Certain environmental and physiological cues trigger the degradation of the antitoxin, causing activation of the toxin, leading either to the death or stasis of the host cell. TA systems have a variety of functions in the bacterial cell, including acting as mediators of programmed cell death, the induction of a dormant state known as persistence and the stable maintenance of plasmids and other mobile genetic elements. Some bacterial TA systems are functional when expressed in eukaryotic cells and this has led to several innovative applications, which are the subject of this review. Here, we look at how bacterial TA systems have been utilized for the genetic manipulation of yeasts and other eukaryotes, for the containment of genetically modified organisms, and for the engineering of high expression eukaryotic cell lines. We also examine how TA systems have been adopted as an important tool in developmental biology research for the ablation of specific cells and the potential for utility of TA systems in antiviral and anticancer gene therapies.

  1. Phylogenomic analyses support the monophyly of Excavata and resolve relationships among eukaryotic "supergroups".

    Science.gov (United States)

    Hampl, Vladimir; Hug, Laura; Leigh, Jessica W; Dacks, Joel B; Lang, B Franz; Simpson, Alastair G B; Roger, Andrew J

    2009-03-10

    Nearly all of eukaryotic diversity has been classified into 6 suprakingdom-level groups (supergroups) based on molecular and morphological/cell-biological evidence; these are Opisthokonta, Amoebozoa, Archaeplastida, Rhizaria, Chromalveolata, and Excavata. However, molecular phylogeny has not provided clear evidence that either Chromalveolata or Excavata is monophyletic, nor has it resolved the relationships among the supergroups. To establish the affinities of Excavata, which contains parasites of global importance and organisms regarded previously as primitive eukaryotes, we conducted a phylogenomic analysis of a dataset of 143 proteins and 48 taxa, including 19 excavates. Previous phylogenomic studies have not included all major subgroups of Excavata, and thus have not definitively addressed their interrelationships. The enigmatic flagellate Andalucia is sister to typical jakobids. Jakobids (including Andalucia), Euglenozoa and Heterolobosea form a major clade that we name Discoba. Analyses of the complete dataset group Discoba with the mitochondrion-lacking excavates or "metamonads" (diplomonads, parabasalids, and Preaxostyla), but not with the final excavate group, Malawimonas. This separation likely results from a long-branch attraction artifact. Gradual removal of rapidly-evolving taxa from the dataset leads to moderate bootstrap support (69%) for the monophyly of all Excavata, and 90% support once all metamonads are removed. Most importantly, Excavata robustly emerges between unikonts (Amoebozoa + Opisthokonta) and "megagrouping" of Archaeplastida, Rhizaria, and chromalveolates. Our analyses indicate that Excavata forms a monophyletic suprakingdom-level group that is one of the 3 primary divisions within eukaryotes, along with unikonts and a megagroup of Archaeplastida, Rhizaria, and the chromalveolate lineages.

  2. The nature and origin of nucleus-like intracellular inclusions in Paleoproterozoic eukaryote microfossils.

    Science.gov (United States)

    Pang, K; Tang, Q; Schiffbauer, J D; Yao, J; Yuan, X; Wan, B; Chen, L; Ou, Z; Xiao, S

    2013-11-01

    The well-known debate on the nature and origin of intracellular inclusions (ICIs) in silicified microfossils from the early Neoproterozoic Bitter Springs Formation has recently been revived by reports of possible fossilized nuclei in phosphatized animal embryo-like fossils from the Ediacaran Doushantuo Formation of South China. The revisitation of this discussion prompted a critical and comprehensive investigation of ICIs in some of the oldest indisputable eukaryote microfossils-the ornamented acritarchs Dictyosphaera delicata and Shuiyousphaeridium macroreticulatum from the Paleoproterozoic Ruyang Group of North China-using a suite of characterization approaches: scanning electron microscopy (SEM), transmission electron microscopy (TEM), and focused ion beam scanning electron microscopy (FIB-SEM). Although the Ruyang acritarchs must have had nuclei when alive, our data suggest that their ICIs represent neither fossilized nuclei nor taphonomically condensed cytoplasm. We instead propose that these ICIs likely represent biologically contracted and consolidated eukaryotic protoplasts (the combination of the nucleus, surrounding cytoplasm, and plasma membrane). As opposed to degradational contraction of prokaryotic cells within a mucoidal sheath-a model proposed to explain the Bitter Springs ICIs-our model implies that protoplast condensation in the Ruyang acritarchs was an in vivo biologically programmed response to adverse conditions in preparation for encystment. While the discovery of bona fide nuclei in Paleoproterozoic acritarchs would be a substantial landmark in our understanding of eukaryote evolution, the various processes (such as degradational and biological condensation of protoplasts) capable of producing nuclei-mimicking structures require that interpretation of ICIs as fossilized nuclei be based on comprehensive investigations. © 2013 John Wiley & Sons Ltd.

  3. Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

    2011-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

  4. Database for the ampC alleles in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Nabil Karah

    Full Text Available Acinetobacter baumannii is a troublesome opportunistic pathogen with a high capacity for clonal dissemination. We announce the establishment of a database for the ampC locus in A. baumannii, in which novel ampC alleles are differentiated based on the occurrence of ≥ 1 nucleotide change, regardless of whether it is silent or missense. The database is openly accessible at the pubmlst platform for A. baumannii (http://pubmlst.org/abaumannii/. Forty-eight distinctive alleles of the ampC locus have so far been identified and deposited in the database. Isolates from clonal complex 1 (CC1, according to the Pasteur multilocus sequence typing scheme, had a variety of the ampC locus alleles, including alleles 1, 3, 4, 5, 6, 7, 8, 13, 14, 17, and 18. On the other hand, isolates from CC2 had the ampC alleles 2, 3, 19, 20, 21, 22, 23, 24, 26, 27, 28, and 46. Allele 3 was characteristic for sequence types ST3 or ST32. The ampC alleles 10, 16, and 25 were characteristic for CC10, ST16, and CC25, respectively. Our study points out that novel gene databases, in which alleles are numbered based on differences in their nucleotide identities, should replace traditional records that use amino acid substitutions to define new alleles.

  5. Bioactive Metabolites from Pathogenic and Endophytic Fungi of Forest Trees.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Scanu, Bruno; Evidente, Antonio; Cimmino, Alessio

    2018-01-01

    Fungi play an important role in terrestrial ecosystems interacting positively or negatively with plants. These interactions are complex and the outcomes are different depending on the fungal lifestyles, saprotrophic, mutualistic or pathogenic. Furthermore, fungi are well known for producing secondary metabolites, originating from different biosynthetic pathways, which possess biological properties of considerable biotechnological interest. Among the terrestrial ecosystems, temperate forests represent an enormous reservoir of fungal diversity. This review will highlight the goldmine of secondary metabolites produced by pathogenic and endophytic fungi of forest trees with focus on their biological activities. A structured search of bibliographic databases for peer-reviewed research literature was undertaken using a research discovery application providing access to a large and authoritative source of references. The papers selected were examined and the main results were reported and discussed. Two hundred forthy-one papers were included in the review, outlined a large number of secondary metabolites produced by pathogenic and endophiltic fungi and their biological activities, including phytotoxic, antifungal, antioomycetes, antibacterial, brine shrimp lethality, mosquito biting deterrence and larvicidal, cytotoxic, antiproliferative and many other bioactivities. The findings of this review confirm the importance of secondary metabolites produced by pathogenic and endophytic fungi from forest plants growing in temperate regions as an excellent prospects to discover compounds with new bioactivities and mode of actions. In addition, the potential of some metabolites as a source of new drugs and biopesticides is underlined. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engelbrecht, Jacob; Brunak, Søren

    1997-01-01

    We have developed a new method for the identification of signal peptides and their cleavage based on neural networks trained on separate sets of prokaryotic and eukaryotic sequence. The method performs significantly better than previous prediction schemes and can easily be applied on genome...

  7. DMPD: Toll-like receptors and the host defense against microbial pathogens: bringingspecificity to the innate-immune system. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15075354 Toll-like receptors and the host defense against microbial pathogens: brin...oc Biol. 2004 May;75(5):749-55. Epub 2004 Jan 14. (.png) (.svg) (.html) (.csml) Show Toll-like receptors and the host defense again...immune system. PubmedID 15075354 Title Toll-like receptors and the host defense against microbial pathogens:

  8. Microbiological food safety issues in Brazil: bacterial pathogens.

    Science.gov (United States)

    Gomes, Bruna Carrer; Franco, Bernadette Dora Gombossy de Melo; De Martinis, Elaine Cristina Pereira

    2013-03-01

    The globalization of food supply impacts patterns of foodborne disease outbreaks worldwide, and consumers are having increased concern about microbiological food safety. In this sense, the assessment of epidemiological data of foodborne diseases in different countries has not only local impact, but it can also be of general interest, especially in the case of major global producers and exporters of several agricultural food products, such as Brazil. In this review, the most common agents of foodborne illnesses registered in Brazil will be presented, compiled mainly from official databases made available to the public. In addition, some representative examples of studies on foodborne bacterial pathogens commonly found in Brazilian foods are provided.

  9. Camps 2.0: exploring the sequence and structure space of prokaryotic, eukaryotic, and viral membrane proteins.

    Science.gov (United States)

    Neumann, Sindy; Hartmann, Holger; Martin-Galiano, Antonio J; Fuchs, Angelika; Frishman, Dmitrij

    2012-03-01

    Structural bioinformatics of membrane proteins is still in its infancy, and the picture of their fold space is only beginning to emerge. Because only a handful of three-dimensional structures are available, sequence comparison and structure prediction remain the main tools for investigating sequence-structure relationships in membrane protein families. Here we present a comprehensive analysis of the structural families corresponding to α-helical membrane proteins with at least three transmembrane helices. The new version of our CAMPS database (CAMPS 2.0) covers nearly 1300 eukaryotic, prokaryotic, and viral genomes. Using an advanced classification procedure, which is based on high-order hidden Markov models and considers both sequence similarity as well as the number of transmembrane helices and loop lengths, we identified 1353 structurally homogeneous clusters roughly corresponding to membrane protein folds. Only 53 clusters are associated with experimentally determined three-dimensional structures, and for these clusters CAMPS is in reasonable agreement with structure-based classification approaches such as SCOP and CATH. We therefore estimate that ∼1300 structures would need to be determined to provide a sufficient structural coverage of polytopic membrane proteins. CAMPS 2.0 is available at http://webclu.bio.wzw.tum.de/CAMPS2.0/. Copyright © 2011 Wiley Periodicals, Inc.

  10. Effect of air pollution on the total bacteria and pathogenic bacteria in different sizes of particulate matter.

    Science.gov (United States)

    Liu, Huan; Zhang, Xu; Zhang, Hao; Yao, Xiangwu; Zhou, Meng; Wang, Jiaqi; He, Zhanfei; Zhang, Huihui; Lou, Liping; Mao, Weihua; Zheng, Ping; Hu, Baolan

    2018-02-01

    In recent years, air pollution events have occurred frequently in China during the winter. Most studies have focused on the physical and chemical composition of polluted air. Some studies have examined the bacterial bioaerosols both indoors and outdoors. But few studies have focused on the relationship between air pollution and bacteria, especially pathogenic bacteria. Airborne PM samples with different diameters and different air quality index values were collected in Hangzhou, China from December 2014 to January 2015. High-throughput sequencing of 16S rRNA was used to categorize the airborne bacteria. Based on the NCBI database, the "Human Pathogen Database" was established, which is related to human health. Among all the PM samples, the diversity and concentration of total bacteria were lowest in the moderately or heavily polluted air. However, in the PM2.5 and PM10 samples, the relative abundances of pathogenic bacteria were highest in the heavily and moderately polluted air respectively. Considering the PM samples with different particle sizes, the diversities of total bacteria and the proportion of pathogenic bacteria in the PM10 samples were different from those in the PM2.5 and TSP samples. The composition of PM samples with different sizes range may be responsible for the variances. The relative humidity, carbon monoxide and ozone concentrations were the main factors, which affected the diversity of total bacteria and the proportion of pathogenic bacteria. Among the different environmental samples, the compositions of the total bacteria were very similar in all the airborne PM samples, but different from those in the water, surface soil, and ground dust samples. Which may be attributed to that the long-distance transport of the airflow may influence the composition of the airborne bacteria. This study of the pathogenic bacteria in airborne PM samples can provide a reference for environmental and public health researchers. Copyright © 2017 Elsevier Ltd

  11. Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis.

    Science.gov (United States)

    Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu

    2013-07-19

    To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.

  12. Pathogen inactivation techniques.

    Science.gov (United States)

    Pelletier, J P R; Transue, S; Snyder, E L

    2006-01-01

    The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

  13. Ultrastructural diversity between centrioles of eukaryotes.

    Science.gov (United States)

    Gupta, Akshari; Kitagawa, Daiju

    2018-02-16

    Several decades of centriole research have revealed the beautiful symmetry present in these microtubule-based organelles, which are required to form centrosomes, cilia, and flagella in many eukaryotes. Centriole architecture is largely conserved across most organisms, however, individual centriolar features such as the central cartwheel or microtubule walls exhibit considerable variability when examined with finer resolution. Here, we review the ultrastructural characteristics of centrioles in commonly studied organisms, highlighting the subtle and not-so-subtle differences between specific structural components of these centrioles. Additionally, we survey some non-canonical centriole structures that have been discovered in various species, from the coaxial bicentrioles of protists and lower land plants to the giant irregular centrioles of the fungus gnat Sciara. Finally, we speculate on the functional significance of these differences between centrioles, and the contribution of individual structural elements such as the cartwheel or microtubules towards the stability of centrioles.Centriole structure, cartwheel, triplet microtubules, SAS-6, centrosome.

  14. Genomic impact of eukaryotic transposable elements.

    Science.gov (United States)

    Arkhipova, Irina R; Batzer, Mark A; Brosius, Juergen; Feschotte, Cédric; Moran, John V; Schmitz, Jürgen; Jurka, Jerzy

    2012-11-21

    The third international conference on the genomic impact of eukaryotic transposable elements (TEs) was held 24 to 28 February 2012 at the Asilomar Conference Center, Pacific Grove, CA, USA. Sponsored in part by the National Institutes of Health grant 5 P41 LM006252, the goal of the conference was to bring together researchers from around the world who study the impact and mechanisms of TEs using multiple computational and experimental approaches. The meeting drew close to 170 attendees and included invited floor presentations on the biology of TEs and their genomic impact, as well as numerous talks contributed by young scientists. The workshop talks were devoted to computational analysis of TEs with additional time for discussion of unresolved issues. Also, there was ample opportunity for poster presentations and informal evening discussions. The success of the meeting reflects the important role of Repbase in comparative genomic studies, and emphasizes the need for close interactions between experimental and computational biologists in the years to come.

  15. Solution structure of an archaeal DNA binding protein with an eukaryotic zinc finger fold.

    Directory of Open Access Journals (Sweden)

    Florence Guillière

    Full Text Available While the basal transcription machinery in archaea is eukaryal-like, transcription factors in archaea and their viruses are usually related to bacterial transcription factors. Nevertheless, some of these organisms show predicted classical zinc fingers motifs of the C2H2 type, which are almost exclusively found in proteins of eukaryotes and most often associated with transcription regulators. In this work, we focused on the protein AFV1p06 from the hyperthermophilic archaeal virus AFV1. The sequence of the protein consists of the classical eukaryotic C2H2 motif with the fourth histidine coordinating zinc missing, as well as of N- and C-terminal extensions. We showed that the protein AFV1p06 binds zinc and solved its solution structure by NMR. AFV1p06 displays a zinc finger fold with a novel structure extension and disordered N- and C-termini. Structure calculations show that a glutamic acid residue that coordinates zinc replaces the fourth histidine of the C2H2 motif. Electromobility gel shift assays indicate that the protein binds to DNA with different affinities depending on the DNA sequence. AFV1p06 is the first experimentally characterised archaeal zinc finger protein with a DNA binding activity. The AFV1p06 protein family has homologues in diverse viruses of hyperthermophilic archaea. A phylogenetic analysis points out a common origin of archaeal and eukaryotic C2H2 zinc fingers.

  16. Death of a dogma: eukaryotic mRNAs can code for more than one protein.

    Science.gov (United States)

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-08

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Update History of This Database - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Arabidopsis Phenome Database Update History of This Database Date Update contents 2017/02/27 Arabidopsis Phenome Data...base English archive site is opened. - Arabidopsis Phenome Database (http://jphenom...e.info/?page_id=95) is opened. About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Update History of This Database - Arabidopsis Phenome Database | LSDB Archive ...

  18. The Persistent Contributions of RNA to Eukaryotic Gen(om)e Architecture and Cellular Function

    Science.gov (United States)

    Brosius, Jürgen

    2014-01-01

    Currently, the best scenario for earliest forms of life is based on RNA molecules as they have the proven ability to catalyze enzymatic reactions and harbor genetic information. Evolutionary principles valid today become apparent in such models already. Furthermore, many features of eukaryotic genome architecture might have their origins in an RNA or RNA/protein (RNP) world, including the onset of a further transition, when DNA replaced RNA as the genetic bookkeeper of the cell. Chromosome maintenance, splicing, and regulatory function via RNA may be deeply rooted in the RNA/RNP worlds. Mostly in eukaryotes, conversion from RNA to DNA is still ongoing, which greatly impacts the plasticity of extant genomes. Raw material for novel genes encoding protein or RNA, or parts of genes including regulatory elements that selection can act on, continues to enter the evolutionary lottery. PMID:25081515

  19. AMPK in Pathogens

    OpenAIRE

    Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

    2016-01-01

    During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

  20. Sparse "1"3C labelling for solid-state NMR studies of P. pastoris expressed eukaryotic seven-transmembrane proteins

    International Nuclear Information System (INIS)

    Liu, Jing; Liu, Chang; Fan, Ying; Munro, Rachel A.; Ladizhansky, Vladimir; Brown, Leonid S.; Wang, Shenlin

    2016-01-01

    We demonstrate a novel sparse "1"3C labelling approach for methylotrophic yeast P. pastoris expression system, towards solid-state NMR studies of eukaryotic membrane proteins. The labelling scheme was achieved by co-utilizing natural abundance methanol and specifically "1"3C labelled glycerol as carbon sources in the expression medium. This strategy improves the spectral resolution by 1.5 fold, displays site-specific labelling patterns, and has advantages for collecting long-range distance restraints for structure determination of large eukaryotic membrane proteins by solid-state NMR.

  1. Refactoring databases evolutionary database design

    CERN Document Server

    Ambler, Scott W

    2006-01-01

    Refactoring has proven its value in a wide range of development projects–helping software professionals improve system designs, maintainability, extensibility, and performance. Now, for the first time, leading agile methodologist Scott Ambler and renowned consultant Pramodkumar Sadalage introduce powerful refactoring techniques specifically designed for database systems. Ambler and Sadalage demonstrate how small changes to table structures, data, stored procedures, and triggers can significantly enhance virtually any database design–without changing semantics. You’ll learn how to evolve database schemas in step with source code–and become far more effective in projects relying on iterative, agile methodologies. This comprehensive guide and reference helps you overcome the practical obstacles to refactoring real-world databases by covering every fundamental concept underlying database refactoring. Using start-to-finish examples, the authors walk you through refactoring simple standalone databas...

  2. Arginase activity in pathogenic and non-pathogenic species of Leishmania parasites.

    Science.gov (United States)

    Badirzadeh, Alireza; Taheri, Tahereh; Taslimi, Yasaman; Abdossamadi, Zahra; Heidari-Kharaji, Maryam; Gholami, Elham; Sedaghat, Baharehsadat; Niyyati, Maryam; Rafati, Sima

    2017-07-01

    Proliferation of Leishmania (L.) parasites depends on polyamine availability, which can be generated by the L-arginine catabolism and the enzymatic activity of arginase (ARG) of the parasites and of the mammalian hosts. In the present study, we characterized and compared the arginase (arg) genes from pathogenic L. major and L. tropica and from non-pathogenic L. tarentolae. We quantified the level of the ARG activity in promastigotes and macrophages infected with pathogenic L. major and L. tropica and non-pathogenic L. tarentolae amastigotes. The ARG's amino acid sequences of the pathogenic and non-pathogenic Leishmania demonstrated virtually 98.6% and 88% identities with the reference L. major Friedlin ARG. Higher ARG activity was observed in all pathogenic promastigotes as compared to non-pathogenic L. tarentolae. In vitro infection of human macrophage cell line (THP1) with pathogenic and non-pathogenic Leishmania spp. resulted in increased ARG activities in the infected macrophages. The ARG activities present in vivo were assessed in susceptible BALB/c and resistant C57BL/6 mice infected with L. major, L. tropica and L. tarentolae. We demonstrated that during the development of the infection, ARG is induced in both strains of mice infected with pathogenic Leishmania. However, in L. major infected BALB/c mice, the induction of ARG and parasite load increased simultaneously according to the time course of infection, whereas in C57BL/6 mice, the enzyme is upregulated solely during the period of footpad swelling. In L. tropica infected mice, the footpads' swellings were slow to develop and demonstrated minimal cutaneous pathology and ARG activity. In contrast, ARG activity was undetectable in mice inoculated with the non-pathogenic L. tarentolae. Our data suggest that infection by Leishmania parasites can increase ARG activity of the host and provides essential polyamines for parasite salvage and its replication. Moreover, the ARG of Leishmania is vital for parasite

  3. Update History of This Database - SKIP Stemcell Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us SKIP Stemcell Database Update History of This Database Date Update contents 2017/03/13 SKIP Stemcell Database... English archive site is opened. 2013/03/29 SKIP Stemcell Database ( https://www.skip.med.k...eio.ac.jp/SKIPSearch/top?lang=en ) is opened. About This Database Database Description Download License Update History of This Databa...se Site Policy | Contact Us Update History of This Database - SKIP Stemcell Database | LSDB Archive ...

  4. Archaeal MCM Proteins as an Analog for the Eukaryotic Mcm2–7 Helicase to Reveal Essential Features of Structure and Function

    Science.gov (United States)

    Miller, Justin M.; Enemark, Eric J.

    2015-01-01

    In eukaryotes, the replicative helicase is the large multisubunit CMG complex consisting of the Mcm2–7 hexameric ring, Cdc45, and the tetrameric GINS complex. The Mcm2–7 ring assembles from six different, related proteins and forms the core of this complex. In archaea, a homologous MCM hexameric ring functions as the replicative helicase at the replication fork. Archaeal MCM proteins form thermostable homohexamers, facilitating their use as models of the eukaryotic Mcm2–7 helicase. Here we review archaeal MCM helicase structure and function and how the archaeal findings relate to the eukaryotic Mcm2–7 ring. PMID:26539061

  5. Xylella fastidiosa comparative genomic database is an information resource to explore the annotation, genomic features, and biology of different strains

    Directory of Open Access Journals (Sweden)

    Alessandro M. Varani

    2012-01-01

    Full Text Available The Xylella fastidiosa comparative genomic database is a scientific resource with the aim to provide a user-friendly interface for accessing high-quality manually curated genomic annotation and comparative sequence analysis, as well as for identifying and mapping prophage-like elements, a marked feature of Xylella genomes. Here we describe a database and tools for exploring the biology of this important plant pathogen. The hallmarks of this database are the high quality genomic annotation, the functional and comparative genomic analysis and the identification and mapping of prophage-like elements. It is available from web site http://www.xylella.lncc.br.

  6. Database design and database administration for a kindergarten

    OpenAIRE

    Vítek, Daniel

    2009-01-01

    The bachelor thesis deals with creation of database design for a standard kindergarten, installation of the designed database into the database system Oracle Database 10g Express Edition and demonstration of the administration tasks in this database system. The verification of the database was proved by a developed access application.

  7. A molecular timescale of eukaryote evolution and the rise of complex multicellular life

    Science.gov (United States)

    Hedges, S. Blair; Blair, Jaime E.; Venturi, Maria L.; Shoe, Jason L.

    2004-01-01

    BACKGROUND: The pattern and timing of the rise in complex multicellular life during Earth's history has not been established. Great disparity persists between the pattern suggested by the fossil record and that estimated by molecular clocks, especially for plants, animals, fungi, and the deepest branches of the eukaryote tree. Here, we used all available protein sequence data and molecular clock methods to place constraints on the increase in complexity through time. RESULTS: Our phylogenetic analyses revealed that (i) animals are more closely related to fungi than to plants, (ii) red algae are closer to plants than to animals or fungi, (iii) choanoflagellates are closer to animals than to fungi or plants, (iv) diplomonads, euglenozoans, and alveolates each are basal to plants+animals+fungi, and (v) diplomonads are basal to other eukaryotes (including alveolates and euglenozoans). Divergence times were estimated from global and local clock methods using 20-188 proteins per node, with data treated separately (multigene) and concatenated (supergene). Different time estimation methods yielded similar results (within 5%): vertebrate-arthropod (964 million years ago, Ma), Cnidaria-Bilateria (1,298 Ma), Porifera-Eumetozoa (1,351 Ma), Pyrenomycetes-Plectomycetes (551 Ma), Candida-Saccharomyces (723 Ma), Hemiascomycetes-filamentous Ascomycota (982 Ma), Basidiomycota-Ascomycota (968 Ma), Mucorales-Basidiomycota (947 Ma), Fungi-Animalia (1,513 Ma), mosses-vascular plants (707 Ma), Chlorophyta-Tracheophyta (968 Ma), Rhodophyta-Chlorophyta+Embryophyta (1,428 Ma), Plantae-Animalia (1,609 Ma), Alveolata-plants+animals+fungi (1,973 Ma), Euglenozoa-plants+animals+fungi (1,961 Ma), and Giardia-plants+animals+fungi (2,309 Ma). By extrapolation, mitochondria arose approximately 2300-1800 Ma and plastids arose 1600-1500 Ma. Estimates of the maximum number of cell types of common ancestors, combined with divergence times, showed an increase from two cell types at 2500 Ma to

  8. A molecular timescale of eukaryote evolution and the rise of complex multicellular life

    Directory of Open Access Journals (Sweden)

    Venturi Maria L

    2004-01-01

    Full Text Available Abstract Background The pattern and timing of the rise in complex multicellular life during Earth's history has not been established. Great disparity persists between the pattern suggested by the fossil record and that estimated by molecular clocks, especially for plants, animals, fungi, and the deepest branches of the eukaryote tree. Here, we used all available protein sequence data and molecular clock methods to place constraints on the increase in complexity through time. Results Our phylogenetic analyses revealed that (i animals are more closely related to fungi than to plants, (ii red algae are closer to plants than to animals or fungi, (iii choanoflagellates are closer to animals than to fungi or plants, (iv diplomonads, euglenozoans, and alveolates each are basal to plants+animals+fungi, and (v diplomonads are basal to other eukaryotes (including alveolates and euglenozoans. Divergence times were estimated from global and local clock methods using 20–188 proteins per node, with data treated separately (multigene and concatenated (supergene. Different time estimation methods yielded similar results (within 5%: vertebrate-arthropod (964 million years ago, Ma, Cnidaria-Bilateria (1,298 Ma, Porifera-Eumetozoa (1,351 Ma, Pyrenomycetes-Plectomycetes (551 Ma, Candida-Saccharomyces (723 Ma, Hemiascomycetes-filamentous Ascomycota (982 Ma, Basidiomycota-Ascomycota (968 Ma, Mucorales-Basidiomycota (947 Ma, Fungi-Animalia (1,513 Ma, mosses-vascular plants (707 Ma, Chlorophyta-Tracheophyta (968 Ma, Rhodophyta-Chlorophyta+Embryophyta (1,428 Ma, Plantae-Animalia (1,609 Ma, Alveolata-plants+animals+fungi (1,973 Ma, Euglenozoa-plants+animals+fungi (1,961 Ma, and Giardia-plants+animals+fungi (2,309 Ma. By extrapolation, mitochondria arose approximately 2300-1800 Ma and plastids arose 1600-1500 Ma. Estimates of the maximum number of cell types of common ancestors, combined with divergence times, showed an increase from two cell types at 2500 Ma to ~10

  9. Database Description - Open TG-GATEs Pathological Image Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs Pathological Image Database Database Description General information of database Database... name Open TG-GATEs Pathological Image Database Alternative name - DOI 10.18908/lsdba.nbdc00954-0...iomedical Innovation 7-6-8, Saito-asagi, Ibaraki-city, Osaka 567-0085, Japan TEL:81-72-641-9826 Email: Database... classification Toxicogenomics Database Organism Taxonomy Name: Rattus norvegi... Article title: Author name(s): Journal: External Links: Original website information Database

  10. Colorimetric sensor for triphosphates and their application as a viable staining agent for prokaryotes and eukaryotes.

    Science.gov (United States)

    Ghosh, Amrita; Shrivastav, Anupama; Jose, D Amilan; Mishra, Sanjiv K; Chandrakanth, C K; Mishra, Sandhya; Das, Amitava

    2008-07-15

    The chromogenic complex 1 x Zn (where 1 is (E)-4-(4-dimethylamino-phenylazo)-N,N-bispyridin-2-ylmethyl-benzenesulfonamide) showed high affinity toward the phosphate ion in tetrabutylammonium phosphate in acetonitrile solution and could preferentially bind to adenosine triphosphate (ATP) in aqueous solution at physiological pH. This binding caused a visual change in color, whereas no such change was noticed with other related anions (adenosine monophosphate, adenosine diphosphate, pyrophosphate, and phosphate) of biological significance. Thus, 1 x Zn could be used as a staining agent for different biological cells through binding to the ATP, generated in situ by the mitochondria (in eukaryotes). For prokaryotes (bacteria) the cell membrane takes care of the cells' energy conversion, since they lack mitochondria. ATP is produced in their unique cell structure on the cell membrane, which is not found in any eukaryotes. These stained cells could be viewed with normal light microscopy. This reagent could even be used for distinguishing the gram-positive and the gram-negative bacteria (prokaryotes). This dye was found to be nonlipophilic in nature and nontoxic to living microbes (eukaryotes and prokaryotes). Further, stained cells were found to grow in their respective media, and this confirmed the maintenance of viability of the microbes even after staining, unlike with many other dyes available commercially.

  11. Protein splicing and its evolution in eukaryotes

    Directory of Open Access Journals (Sweden)

    Starokadomskyy P. L.

    2010-02-01

    Full Text Available Inteins, or protein introns, are parts of protein sequences that are post-translationally excised, their flanking regions (exteins being spliced together. This process was called protein splicing. Originally inteins were found in prokaryotic or unicellular eukaryotic organisms. But the general principles of post-translation protein rearrangement are evolving yielding different post-translation modification of proteins in multicellular organisms. For clarity, these non-intein mediated events call either protein rearrangements or protein editing. The most intriguing example of protein editing is proteasome-mediated splicing of antigens in vertebrates that may play important role in antigen presentation. Other examples of protein rearrangements are maturation of Hg-proteins (critical receptors in embryogenesis as well as maturation of several metabolic enzymes. Despite a lack of experimental data we try to analyze some intriguing examples of protein splicing evolution.

  12. Heterologous expression of pathogen-specific genes ligA and ligB in the saprophyte Leptospira biflexa confers enhanced adhesion to cultured cells and fibronectin.

    Science.gov (United States)

    Figueira, Cláudio Pereira; Croda, Julio; Choy, Henry A; Haake, David A; Reis, Mitermayer G; Ko, Albert I; Picardeau, Mathieu

    2011-06-09

    In comparison to other bacterial pathogens, our knowledge of the molecular basis of the pathogenesis of leptospirosis is extremely limited. An improved understanding of leptospiral pathogenetic mechanisms requires reliable tools for functional genetic analysis. Leptospiral immunoglobulin-like (Lig) proteins are surface proteins found in pathogenic Leptospira, but not in saprophytes. Here, we describe a system for heterologous expression of the Leptospira interrogans genes ligA and ligB in the saprophyte Leptospira biflexa serovar Patoc. The genes encoding LigA and LigB under the control of a constitutive spirochaetal promoter were inserted into the L. biflexa replicative plasmid. We were able to demonstrate expression and surface localization of LigA and LigB in L. biflexa. We found that the expression of the lig genes significantly enhanced the ability of transformed L. biflexa to adhere in vitro to extracellular matrix components and cultured cells, suggesting the involvement of Lig proteins in cell adhesion. This work reports a complete description of the system we have developed for heterologous expression of pathogen-specific proteins in the saprophytic L. biflexa. We show that expression of LigA and LigB proteins from the pathogen confers a virulence-associated phenotype on L. biflexa, namely adhesion to eukaryotic cells and fibronectin in vitro. This study indicates that L. biflexa can serve as a surrogate host to characterize the role of key virulence factors of the causative agent of leptospirosis.

  13. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  14. Solution Structure of Archaeoglobus fulgidis Peptidyl-tRNA Hydrolase(Pth2) Provides Evidence for an Extensive Conserved Family of Pth2 Enzymes in Archaea, Bacteria and Eukaryotes.

    Energy Technology Data Exchange (ETDEWEB)

    Powers, Robert; Mirkovic, Nebojsa; Goldsmith-Fischman, Sharon; Acton, Thomas; Chiang, Yiwen; Huang, Yuanpeng; Ma, LiChung; Rajan, Paranji K.; Cort, John R.; Kennedy, Michael A.; Liu, Jinfeng; Rost, Burkhard; Honig, Barry; Murray, Diana; Montelione, Gaetano

    2005-11-01

    The solution structure of protein AF2095 from the thermophilic archaea Archaeglobus fulgidis, a 123-residue (13.6 kDa) protein, has been determined by NMR methods. The structure of AF2095 is comprised of four a-helices and a mixed b-sheet consisting of four parallel and anti-parallel b-strands, where the a-helices sandwich the b-sheet. Sequence and structural comparison of AF2095 with proteins from Homo sapiens, Methanocaldococcus jannaschii and Sulfolobus solfataricus, reveals that AF2095 is a peptidyl-tRNA hydrolase (Pth2). This structural comparison also identifies putative catalytic residues and a tRNA interaction region for AF2095. The structure of AF2095 is also similar to the structure of protein TA0108 from archaea Thermoplasma acidophilum, which is deposited in the Protein Database but not functionally annotated. The NMR structure of AF2095 has been further leveraged to obtain good quality structural models for 55 other proteins. Although earlier studies have proposed that the Pth2 protein family is restricted to archeal and eukaryotic organisms, the similarity of the AF2095 structure to human Pth2, the conservation of key active-site residues, and the good quality of the resulting homology models demonstrate a large family of homologous Pth2 proteins that are conserved in eukaryotic, archaeal and bacterial organisms, providing novel insights in the evolution of the Pth and Pth2 enzyme families.

  15. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  16. Origins of robustness in translational control via eukaryotic translation initiation factor (eIF) 2.

    Science.gov (United States)

    Khan, Mohammad Farhan; Spurgeon, Sarah; von der Haar, Tobias

    2018-05-14

    Phosphorylation of eukaryotic translation initiation factor 2 (eIF2) is one of the best studied and most widely used means for regulating protein synthesis activity in eukaryotic cells. This pathway regulates protein synthesis in response to stresses, viral infections, and nutrient depletion, among others. We present analyses of an ordinary differential equation-based model of this pathway, which aim to identify its principal robustness-conferring features. Our analyses indicate that robustness is a distributed property, rather than arising from the properties of any one individual pathway species. However, robustness-conferring properties are unevenly distributed between the different species, and we identify a guanine nucleotide dissociation inhibitor (GDI) complex as a species that likely contributes strongly to the robustness of the pathway. Our analyses make further predictions on the dynamic response to different types of kinases that impinge on eIF2. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. ESLpred2: improved method for predicting subcellular localization of eukaryotic proteins

    Directory of Open Access Journals (Sweden)

    Raghava Gajendra PS

    2008-11-01

    Full Text Available Abstract Background The expansion of raw protein sequence databases in the post genomic era and availability of fresh annotated sequences for major localizations particularly motivated us to introduce a new improved version of our previously forged eukaryotic subcellular localizations prediction method namely "ESLpred". Since, subcellular localization of a protein offers essential clues about its functioning, hence, availability of localization predictor would definitely aid and expedite the protein deciphering studies. However, robustness of a predictor is highly dependent on the superiority of dataset and extracted protein attributes; hence, it becomes imperative to improve the performance of presently available method using latest dataset and crucial input features. Results Here, we describe augmentation in the prediction performance obtained for our most popular ESLpred method using new crucial features as an input to Support Vector Machine (SVM. In addition, recently available, highly non-redundant dataset encompassing three kingdoms specific protein sequence sets; 1198 fungi sequences, 2597 from animal and 491 plant sequences were also included in the present study. First, using the evolutionary information in the form of profile composition along with whole and N-terminal sequence composition as an input feature vector of 440 dimensions, overall accuracies of 72.7, 75.8 and 74.5% were achieved respectively after five-fold cross-validation. Further, enhancement in performance was observed when similarity search based results were coupled with whole and N-terminal sequence composition along with profile composition by yielding overall accuracies of 75.9, 80.8, 76.6% respectively; best accuracies reported till date on the same datasets. Conclusion These results provide confidence about the reliability and accurate prediction of SVM modules generated in the present study using sequence and profile compositions along with similarity search

  18. Signaling pathways in a Citrus EST database

    Directory of Open Access Journals (Sweden)

    Angela Mehta

    2007-01-01

    Full Text Available Citrus spp. are economically important crops, which in Brazil are grown mainly in the State of São Paulo. Citrus cultures are attacked by several pathogens, causing severe yield losses. In order to better understand this culture, the Millenium Project (IAC Cordeirópolis was launched in order to sequence Citrus ESTs (expressed sequence tags from different tissues, including leaf, bark, fruit, root and flower. Plants were submitted to biotic and abiotic stresses and investigated under different development stages (adult vs. juvenile. Several cDNA libraries were constructed and the sequences obtained formed the Citrus ESTs database with almost 200,000 sequences. Searches were performed in the Citrus database to investigate the presence of different signaling pathway components. Several of the genes involved in the signaling of sugar, calcium, cytokinin, plant hormones, inositol phosphate, MAPKinase and COP9 were found in the citrus genome and are discussed in this paper. The results obtained may indicate that similar mechanisms described in other plants, such as Arabidopsis, occur in citrus. Further experimental studies must be conducted in order to understand the different signaling pathways present.

  19. Construction and expression of eukaryotic expression vectors of full-length, amino-terminus and carboxyl-terminus Raf gene

    Directory of Open Access Journals (Sweden)

    Zhuomin WANG

    2008-06-01

    Full Text Available Background and objective Raf is a key molecule in the Ras-Raf-MEK-ERK signal transduction pathway and is highly activated in different human carcinomas. However, its biological functions and regulation mechanisms are still unclear. The aims of this study were to construct eukaryotic expression vectors with Raf full encoding region, truncated amino-terminus and carboxyl-terminus, respectively. Methods Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were constructed by gene recombination technique and confirmed by restriction enzyme analysis and DNA sequencing. Furthermore, the expression of these fusion proteins was detected by western blot in transient transfected 293T cells. Results The sequences and open reading frames of these three vectors were completely consistent with experimental design. All target proteins can be detected in 293T cells. Conclusion Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were successfully constructed and can be expressed in 293T cells.

  20. Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardia lamblia.

    Science.gov (United States)

    Zhang, Yan-Qiong; Chen, Dong-Liang; Tian, Hai-Feng; Zhang, Bao-Hong; Wen, Jian-Fan

    2009-10-01

    Using a combined computational program, we identified 50 potential microRNAs (miRNAs) in Giardia lamblia, one of the most primitive unicellular eukaryotes. These miRNAs are unique to G. lamblia and no homologues have been found in other organisms; miRNAs, currently known in other species, were not found in G. lamblia. This suggests that miRNA biogenesis and miRNA-mediated gene regulation pathway may evolve independently, especially in evolutionarily distant lineages. A majority (43) of the predicted miRNAs are located at one single locus; however, some miRNAs have two or more copies in the genome. Among the 58 miRNA genes, 28 are located in the intergenic regions whereas 30 are present in the anti-sense strands of the protein-coding sequences. Five predicted miRNAs are expressed in G. lamblia trophozoite cells evidenced by expressed sequence tags or RT-PCR. Thirty-seven identified miRNAs may target 50 protein-coding genes, including seven variant-specific surface proteins (VSPs). Our findings provide a clue that miRNA-mediated gene regulation may exist in the early stage of eukaryotic evolution, suggesting that it is an important regulation system ubiquitous in eukaryotes.

  1. Horizontal gene transfer of acetyltransferases, invertases and chorismate mutases from different bacteria to diverse recipients.

    Science.gov (United States)

    Noon, Jason B; Baum, Thomas J

    2016-04-12

    Hoplolaimina plant-parasitic nematodes (PPN) are a lineage of animals with many documented cases of horizontal gene transfer (HGT). In a recent study, we reported on three likely HGT candidate genes in the soybean cyst nematode Heterodera glycines, all of which encode secreted candidate effectors with putative functions in the host plant. Hg-GLAND1 is a putative GCN5-related N-acetyltransferase (GNAT), Hg-GLAND13 is a putative invertase (INV), and Hg-GLAND16 is a putative chorismate mutase (CM), and blastp searches of the non-redundant database resulted in highest similarity to bacterial sequences. Here, we searched nematode and non-nematode sequence databases to identify all the nematodes possible that contain these three genes, and to formulate hypotheses about when they most likely appeared in the phylum Nematoda. We then performed phylogenetic analyses combined with model selection tests of alternative models of sequence evolution to determine whether these genes were horizontally acquired from bacteria. Mining of nematode sequence databases determined that GNATs appeared in Hoplolaimina PPN late in evolution, while both INVs and CMs appeared before the radiation of the Hoplolaimina suborder. Also, Hoplolaimina GNATs, INVs and CMs formed well-supported clusters with different rhizosphere bacteria in the phylogenetic trees, and the model selection tests greatly supported models of HGT over descent via common ancestry. Surprisingly, the phylogenetic trees also revealed additional, well-supported clusters of bacterial GNATs, INVs and CMs with diverse eukaryotes and archaea. There were at least eleven and eight well-supported clusters of GNATs and INVs, respectively, from different bacteria with diverse eukaryotes and archaea. Though less frequent, CMs from different bacteria formed supported clusters with multiple different eukaryotes. Moreover, almost all individual clusters containing bacteria and eukaryotes or archaea contained species that inhabit very similar

  2. Pathogens associated with persistent diarrhoea in children in low and middle income countries: systematic review

    Directory of Open Access Journals (Sweden)

    Hart C Anthony

    2009-06-01

    Full Text Available Abstract Background Persistent diarrhoea in children is a common problem in low and middle income countries. To help target appropriate treatment for specific pathogens in the absence of diagnostic tests, we systematically reviewed pathogens most commonly associated with persistent diarrhoea in children. Methods We sought all descriptive studies of pathogens in the stool of children with diarrhoea of over 14 days duration in low and middle income countries with a comprehensive search of the MEDLINE, EMBASE, LILACS and WEB OF SCIENCE databases. We described the study designs and populations, assessed the quality of the laboratory tests, and extracted and summarised data on pathogens. For Escherichia coli, we calculated high and low prevalence estimates of all enteropathic types combined. Results across studies were compared for geographical patterns. Results Nineteen studies were included. Some used episodes of diarrhoea as the unit of analysis, others used children. The quality of reporting of laboratory procedures varied, and pathogens (particularly E. coli types were classified in different ways. As there were no apparent regional differences in pathogen prevalence, we aggregated data between studies to give a guide to overall prevalence. Enteropathic E. coli types were commonly found in children with persistent diarrhoea (up to 63%. Various other organisms, including viruses, bacteria and parasites, were detected but across all studies their prevalence was under 10%. However, these pathogens were also found in similar frequencies in children without diarrhoea. Conclusion A number of pathogens are commonly associated with persistent diarrhoea in children, but in children without diarrhoea the pathogens are found with similar frequencies. New research with carefully selected controls and standardised laboratory investigations across countries will help map causes and help explore effective options for presumptive treatment.

  3. A resurgence in field research is essential to better understand the diversity, ecology, and evolution of microbial eukaryotes.

    Science.gov (United States)

    Heger, Thierry J; Edgcomb, Virginia P; Kim, Eunsoo; Lukeš, Julius; Leander, Brian S; Yubuki, Naoji

    2014-01-01

    The discovery and characterization of protist communities from diverse environments are crucial for understanding the overall evolutionary history of life on earth. However, major questions about the diversity, ecology, and evolutionary history of protists remain unanswered, notably because data obtained from natural protist communities, especially of heterotrophic species, remain limited. In this review, we discuss the challenges associated with "field protistology", defined here as the exploration, characterization, and interpretation of microbial eukaryotic diversity within the context of natural environments or field experiments, and provide suggestions to help fill this important gap in knowledge. We also argue that increased efforts in field studies that combine molecular and microscopical methods offer the most promising path toward (1) the discovery of new lineages that expand the tree of eukaryotes; (2) the recognition of novel evolutionary patterns and processes; (3) the untangling of ecological interactions and functions, and their roles in larger ecosystem processes; and (4) the evaluation of protist adaptations to a changing climate. © 2013 The Author(s) Journal of Eukaryotic Microbiology © 2013 International Society of Protistologists.

  4. Biotransformation of mercury in pH-stat cultures of eukaryotic freshwater algae.

    Science.gov (United States)

    Kelly, David J A; Budd, Kenneth; Lefebvre, Daniel D

    2007-01-01

    Eukaryotic algae were studied to determine their ability to biotransform Hg(II) under aerated and pH controlled conditions. All algae converted Hg(II) into beta-HgS and Hg(0) to varying degrees. When Hg(II) was administered as HgCl(2) to the algae, biotransformation by species of Chlorophyceae (Selenastrum minutum and Chlorella fusca var. fusca) was initiated with beta-HgS synthesis (K (1/2) of hours) and concomitant Hg degrees evolution occurred in the first hour. Hg degrees synthesis was impeded by the formation of beta-HgS and this inhibition was released in C. fusca var. fusca when cellular thiols were oxidized by the addition of dimethylfumarate (DMF). The diatom, Navicula pelliculosa (Bacillariophyceae), converted a substantially greater proportion of the applied Hg(II) into Hg(0), whereas the thermophilic alga, Galdieria sulphuraria (Cyanidiophyceae), rapidly biotransformed as much as 90% of applied Hg(II) into beta-HgS (K (1/2) approximately 20 min). This thermophile was also able to generate Hg(0) even after all exogenously applied HgCl(2) had been biotransformed. The results suggest that beta-HgS may be the major dietary mercurial for grazers of contaminated eukaryotic algae.

  5. Transcriptome analysis of Phytophthora litchii reveals pathogenicity arsenals and confirms taxonomic status.

    Science.gov (United States)

    Sun, Jinhua; Gao, Zhaoyin; Zhang, Xinchun; Zou, Xiaoxiao; Cao, Lulu; Wang, Jiabao

    2017-01-01

    Litchi downy blight, caused by Peronophythora litchii, is one of the major diseases of litchi and has caused severe economic losses. P. litchii has the unique ability to produce downy mildew like sporangiophores under artificial culture. The pathogen had been placed in a new family Peronophytophthoraceae by some authors. In this study, the whole transcriptome of P. litchii from mycelia, sporangia, and zoospores was sequenced for the first time. A set of 23637 transcripts with an average length of 1284 bp was assembled. Using six open reading frame (ORF) predictors, 19267 representative ORFs were identified and were annotated by searching against several public databases. There were 4666 conserved gene families and various sets of lineage-specific genes among P. litchii and other four closely related oomycetes. In silico analyses revealed 490 pathogen-related proteins including 128 RXLR and 22 CRN effector candidates. Based on the phylogenetic analysis of 164 single copy orthologs from 22 species, it is validated that P. litchii is in the genus Phytophthora. Our work provides valuable data to elucidate the pathogenicity basis and ascertain the taxonomic status of P. litchii.

  6. Update History of This Database - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Update History of This Database Date Update contents 201...0/03/29 Yeast Interacting Proteins Database English archive site is opened. 2000/12/4 Yeast Interacting Proteins Database...( http://itolab.cb.k.u-tokyo.ac.jp/Y2H/ ) is released. About This Database Database Description... Download License Update History of This Database Site Policy | Contact Us Update History of This Database... - Yeast Interacting Proteins Database | LSDB Archive ...

  7. Origin and evolution of SINEs in eukaryotic genomes.

    Science.gov (United States)

    Kramerov, D A; Vassetzky, N S

    2011-12-01

    Short interspersed elements (SINEs) are one of the two most prolific mobile genomic elements in most of the higher eukaryotes. Although their biology is still not thoroughly understood, unusual life cycle of these simple elements amplified as genomic parasites makes their evolution unique in many ways. In contrast to most genetic elements including other transposons, SINEs emerged de novo many times in evolution from available molecules (for example, tRNA). The involvement of reverse transcription in their amplification cycle, huge number of genomic copies and modular structure allow variation mechanisms in SINEs uncommon or rare in other genetic elements (module exchange between SINE families, dimerization, and so on.). Overall, SINE evolution includes their emergence, progressive optimization and counteraction to the cell's defense against mobile genetic elements.

  8. Functional and evolutionary analysis of alternatively spliced genes is consistent with an early eukaryotic origin of alternative splicing

    Directory of Open Access Journals (Sweden)

    Penny David

    2007-10-01

    Full Text Available Abstract Background Alternative splicing has been reported in various eukaryotic groups including plants, apicomplexans, diatoms, amoebae, animals and fungi. However, whether widespread alternative splicing has evolved independently in the different eukaryotic groups or was inherited from their last common ancestor, and may therefore predate multicellularity, is still unknown. To better understand the origin and evolution of alternative splicing and its usage in diverse organisms, we studied alternative splicing in 12 eukaryotic species, comparing rates of alternative splicing across genes of different functional classes, cellular locations, intron/exon structures and evolutionary origins. Results For each species, we find that genes from most functional categories are alternatively spliced. Ancient genes (shared between animals, fungi and plants show high levels of alternative splicing. Genes with products expressed in the nucleus or plasma membrane are generally more alternatively spliced while those expressed in extracellular location show less alternative splicing. We find a clear correspondence between incidence of alternative splicing and intron number per gene both within and between genomes. In general, we find several similarities in patterns of alternative splicing across these diverse eukaryotes. Conclusion Along with previous studies indicating intron-rich genes with weak intron boundary consensus and complex spliceosomes in ancestral organisms, our results suggest that at least a simple form of alternative splicing may already have been present in the unicellular ancestor of plants, fungi and animals. A role for alternative splicing in the evolution of multicellularity then would largely have arisen by co-opting the preexisting process.

  9. Database Description - RMOS | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name RMOS Alternative nam...arch Unit Shoshi Kikuchi E-mail : Database classification Plant databases - Rice Microarray Data and other Gene Expression Database...s Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The Ric...19&lang=en Whole data download - Referenced database Rice Expression Database (RED) Rice full-length cDNA Database... (KOME) Rice Genome Integrated Map Database (INE) Rice Mutant Panel Database (Tos17) Rice Genome Annotation Database

  10. The FH mutation database: an online database of fumarate hydratase mutations involved in the MCUL (HLRCC tumor syndrome and congenital fumarase deficiency

    Directory of Open Access Journals (Sweden)

    Tomlinson Ian PM

    2008-03-01

    Full Text Available Abstract Background Fumarate hydratase (HGNC approved gene symbol – FH, also known as fumarase, is an enzyme of the tricarboxylic acid (TCA cycle, involved in fundamental cellular energy production. First described by Zinn et al in 1986, deficiency of FH results in early onset, severe encephalopathy. In 2002, the Multiple Leiomyoma Consortium identified heterozygous germline mutations of FH in patients with multiple cutaneous and uterine leiomyomas, (MCUL: OMIM 150800. In some families renal cell cancer also forms a component of the complex and as such has been described as hereditary leiomyomatosis and renal cell cancer (HLRCC: OMIM 605839. The identification of FH as a tumor suppressor was an unexpected finding and following the identification of subunits of succinate dehydrogenase in 2000 and 2001, was only the second description of the involvement of an enzyme of intermediary metabolism in tumorigenesis. Description The FH mutation database is a part of the TCA cycle gene mutation database (formerly the succinate dehydrogenase gene mutation database and is based on the Leiden Open (source Variation Database (LOVD system. The variants included in the database were derived from the published literature and annotated to conform to current mutation nomenclature. The FH database applies HGVS nomenclature guidelines, and will assist researchers in applying these guidelines when directly submitting new sequence variants online. Since the first molecular characterization of an FH mutation by Bourgeron et al in 1994, a series of reports of both FH deficiency patients and patients with MCUL/HLRRC have described 107 variants, of which 93 are thought to be pathogenic. The most common type of mutation is missense (57%, followed by frameshifts & nonsense (27%, and diverse deletions, insertions and duplications. Here we introduce an online database detailing all reported FH sequence variants. Conclusion The FH mutation database strives to systematically

  11. TrED: the Trichophyton rubrum Expression Database

    Directory of Open Access Journals (Sweden)

    Liu Tao

    2007-07-01

    Full Text Available Abstract Background Trichophyton rubrum is the most common dermatophyte species and the most frequent cause of fungal skin infections in humans worldwide. It's a major concern because feet and nail infections caused by this organism is extremely difficult to cure. A large set of expression data including expressed sequence tags (ESTs and transcriptional profiles of this important fungal pathogen are now available. Careful analysis of these data can give valuable information about potential virulence factors, antigens and novel metabolic pathways. We intend to create an integrated database TrED to facilitate the study of dermatophytes, and enhance the development of effective diagnostic and treatment strategies. Description All publicly available ESTs and expression profiles of T. rubrum during conidial germination in time-course experiments and challenged with antifungal agents are deposited in the database. In addition, comparative genomics hybridization results of 22 dermatophytic fungi strains from three genera, Trichophyton, Microsporum and Epidermophyton, are also included. ESTs are clustered and assembled to elongate the sequence length and abate redundancy. TrED provides functional analysis based on GenBank, Pfam, and KOG databases, along with KEGG pathway and GO vocabulary. It is integrated with a suite of custom web-based tools that facilitate querying and retrieving various EST properties, visualization and comparison of transcriptional profiles, and sequence-similarity searching by BLAST. Conclusion TrED is built upon a relational database, with a web interface offering analytic functions, to provide integrated access to various expression data of T. rubrum and comparative results of dermatophytes. It is devoted to be a comprehensive resource and platform to assist functional genomic studies in dermatophytes. TrED is available from URL: http://www.mgc.ac.cn/TrED/.

  12. Genomic impact of eukaryotic transposable elements

    Directory of Open Access Journals (Sweden)

    Arkhipova Irina R

    2012-11-01

    Full Text Available Abstract The third international conference on the genomic impact of eukaryotic transposable elements (TEs was held 24 to 28 February 2012 at the Asilomar Conference Center, Pacific Grove, CA, USA. Sponsored in part by the National Institutes of Health grant 5 P41 LM006252, the goal of the conference was to bring together researchers from around the world who study the impact and mechanisms of TEs using multiple computational and experimental approaches. The meeting drew close to 170 attendees and included invited floor presentations on the biology of TEs and their genomic impact, as well as numerous talks contributed by young scientists. The workshop talks were devoted to computational analysis of TEs with additional time for discussion of unresolved issues. Also, there was ample opportunity for poster presentations and informal evening discussions. The success of the meeting reflects the important role of Repbase in comparative genomic studies, and emphasizes the need for close interactions between experimental and computational biologists in the years to come.

  13. KALIMER database development (database configuration and design methodology)

    International Nuclear Information System (INIS)

    Jeong, Kwan Seong; Kwon, Young Min; Lee, Young Bum; Chang, Won Pyo; Hahn, Do Hee

    2001-10-01

    KALIMER Database is an advanced database to utilize the integration management for Liquid Metal Reactor Design Technology Development using Web Applicatins. KALIMER Design database consists of Results Database, Inter-Office Communication (IOC), and 3D CAD database, Team Cooperation system, and Reserved Documents, Results Database is a research results database during phase II for Liquid Metal Reactor Design Technology Develpment of mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD Database is s schematic design overview for KALIMER. Team Cooperation System is to inform team member of research cooperation and meetings. Finally, KALIMER Reserved Documents is developed to manage collected data and several documents since project accomplishment. This report describes the features of Hardware and Software and the Database Design Methodology for KALIMER

  14. The Intestinal Eukaryotic and Bacterial Biome of Spotted Hyenas: The Impact of Social Status and Age on Diversity and Composition.

    Science.gov (United States)

    Heitlinger, Emanuel; Ferreira, Susana C M; Thierer, Dagmar; Hofer, Heribert; East, Marion L

    2017-01-01

    In mammals, two factors likely to affect the diversity and composition of intestinal bacteria (bacterial microbiome) and eukaryotes (eukaryome) are social status and age. In species in which social status determines access to resources, socially dominant animals maintain better immune processes and health status than subordinates. As high species diversity is an index of ecosystem health, the intestinal biome of healthier, socially dominant animals should be more diverse than those of subordinates. Gradual colonization of the juvenile intestine after birth predicts lower intestinal biome diversity in juveniles than adults. We tested these predictions on the effect of: (1) age (juvenile/adult) and (2) social status (low/high) on bacterial microbiome and eukaryome diversity and composition in the spotted hyena ( Crocuta crocuta ), a highly social, female-dominated carnivore in which social status determines access to resources. We comprehensively screened feces from 35 individually known adult females and 7 juveniles in the Serengeti ecosystem for bacteria and eukaryotes, using a set of 48 different amplicons (4 for bacterial 16S, 44 for eukaryote 18S) in a multi-amplicon sequencing approach. We compared sequence abundances to classical coprological egg or oocyst counts. For all parasite taxa detected in more than six samples, the number of sequence reads significantly predicted the number of eggs or oocysts counted, underscoring the value of an amplicon sequencing approach for quantitative measurements of parasite load. In line with our predictions, our results revealed a significantly less diverse microbiome in juveniles than adults and a significantly higher diversity of eukaryotes in high-ranking than low-ranking animals. We propose that free-ranging wildlife can provide an intriguing model system to assess the adaptive value of intestinal biome diversity for both bacteria and eukaryotes.

  15. The largest subunit of RNA polymerase II from the Glaucocystophyta: functional constraint and short-branch exclusion in deep eukaryotic phylogeny

    Directory of Open Access Journals (Sweden)

    Stiller John W

    2005-12-01

    Full Text Available Abstract Background Evolutionary analyses of the largest subunit of RNA polymerase II (RPB1 have yielded important and at times provocative results. One particularly troublesome outcome is the consistent inference of independent origins of red algae and green plants, at odds with the more widely accepted view of a monophyletic Plantae comprising all eukaryotes with primary plastids. If the hypothesis of a broader kingdom Plantae is correct, then RPB1 trees likely reflect a persistent phylogenetic artifact. To gain a better understanding of RNAP II evolution, and the presumed artifact relating to green plants and red algae, we isolated and analyzed RPB1 from representatives of Glaucocystophyta, the third eukaryotic group with primary plastids. Results Phylogenetic analyses incorporating glaucocystophytes do not recover a monophyletic Plantae; rather they result in additional conflicts with the most widely held views on eukaryotic relationships. In particular, glaucocystophytes are recovered as sister to several amoebozoans with strong support. A detailed investigation shows that this clade can be explained by what we call "short-branch exclusion," a phylogenetic artifact integrally associated with "long-branch attraction." Other systematic discrepancies observed in RPB1 trees can be explained as phylogenetic artifacts; however, these apparent artifacts also appear in regions of the tree that support widely held views of eukaryotic evolution. In fact, most of the RPB1 tree is consistent with artifacts of rate variation among sequences and co-variation due to functional constraints related to C-terminal domain based RNAP II transcription. Conclusion Our results reveal how subtle and easily overlooked biases can dominate the overall results of molecular phylogenetic analyses of ancient eukaryotic relationships. Sources of potential phylogenetic artifact should be investigated routinely, not just when obvious "long-branch attraction" is encountered.

  16. Deciphering DNA replication dynamics in eukaryotic cell populations in relation with their averaged chromatin conformations

    Science.gov (United States)

    Goldar, A.; Arneodo, A.; Audit, B.; Argoul, F.; Rappailles, A.; Guilbaud, G.; Petryk, N.; Kahli, M.; Hyrien, O.

    2016-03-01

    We propose a non-local model of DNA replication that takes into account the observed uncertainty on the position and time of replication initiation in eukaryote cell populations. By picturing replication initiation as a two-state system and considering all possible transition configurations, and by taking into account the chromatin’s fractal dimension, we derive an analytical expression for the rate of replication initiation. This model predicts with no free parameter the temporal profiles of initiation rate, replication fork density and fraction of replicated DNA, in quantitative agreement with corresponding experimental data from both S. cerevisiae and human cells and provides a quantitative estimate of initiation site redundancy. This study shows that, to a large extent, the program that regulates the dynamics of eukaryotic DNA replication is a collective phenomenon that emerges from the stochastic nature of replication origins initiation.

  17. Reconstitution of a eukaryotic replisome reveals suppression mechanisms that define leading/lagging strand operation

    Science.gov (United States)

    Georgescu, Roxana E; Schauer, Grant D; Yao, Nina Y; Langston, Lance D; Yurieva, Olga; Zhang, Dan; Finkelstein, Jeff; O'Donnell, Mike E

    2015-01-01

    We have reconstituted a eukaryotic leading/lagging strand replisome comprising 31 distinct polypeptides. This study identifies a process unprecedented in bacterial replisomes. While bacteria and phage simply recruit polymerases to the fork, we find that suppression mechanisms are used to position the distinct eukaryotic polymerases on their respective strands. Hence, Pol ε is active with CMG on the leading strand, but it is unable to function on the lagging strand, even when Pol δ is not present. Conversely, Pol δ-PCNA is the only enzyme capable of extending Okazaki fragments in the presence of Pols ε and α. We have shown earlier that Pol δ-PCNA is suppressed on the leading strand with CMG (Georgescu et al., 2014). We propose that CMG, the 11-subunit helicase, is responsible for one or both of these suppression mechanisms that spatially control polymerase occupancy at the fork. DOI: http://dx.doi.org/10.7554/eLife.04988.001 PMID:25871847

  18. KGCAK: a K-mer based database for genome-wide phylogeny and complexity evaluation.

    Science.gov (United States)

    Wang, Dapeng; Xu, Jiayue; Yu, Jun

    2015-09-16

    The K-mer approach, treating genomic sequences as simple characters and counting the relative abundance of each string upon a fixed K, has been extensively applied to phylogeny inference for genome assembly, annotation, and comparison. To meet increasing demands for comparing large genome sequences and to promote the use of the K-mer approach, we develop a versatile database, KGCAK ( http://kgcak.big.ac.cn/KGCAK/ ), containing ~8,000 genomes that include genome sequences of diverse life forms (viruses, prokaryotes, protists, animals, and plants) and cellular organelles of eukaryotic lineages. It builds phylogeny based on genomic elements in an alignment-free fashion and provides in-depth data processing enabling users to compare the complexity of genome sequences based on K-mer distribution. We hope that KGCAK becomes a powerful tool for exploring relationship within and among groups of species in a tree of life based on genomic data.

  19. Database Description - SAHG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name SAHG Alternative nam...h: Contact address Chie Motono Tel : +81-3-3599-8067 E-mail : Database classification Structure Databases - ...e databases - Protein properties Organism Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database description... Links: Original website information Database maintenance site The Molecular Profiling Research Center for D...stration Not available About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - SAHG | LSDB Archive ...

  20. Variation in recombination frequency and distribution across eukaryotes: patterns and processes

    Science.gov (United States)

    Feulner, Philine G. D.; Johnston, Susan E.; Santure, Anna W.; Smadja, Carole M.

    2017-01-01

    Recombination, the exchange of DNA between maternal and paternal chromosomes during meiosis, is an essential feature of sexual reproduction in nearly all multicellular organisms. While the role of recombination in the evolution of sex has received theoretical and empirical attention, less is known about how recombination rate itself evolves and what influence this has on evolutionary processes within sexually reproducing organisms. Here, we explore the patterns of, and processes governing recombination in eukaryotes. We summarize patterns of variation, integrating current knowledge with an analysis of linkage map data in 353 organisms. We then discuss proximate and ultimate processes governing recombination rate variation and consider how these influence evolutionary processes. Genome-wide recombination rates (cM/Mb) can vary more than tenfold across eukaryotes, and there is large variation in the distribution of recombination events across closely related taxa, populations and individuals. We discuss how variation in rate and distribution relates to genome architecture, genetic and epigenetic mechanisms, sex, environmental perturbations and variable selective pressures. There has been great progress in determining the molecular mechanisms governing recombination, and with the continued development of new modelling and empirical approaches, there is now also great opportunity to further our understanding of how and why recombination rate varies. This article is part of the themed issue ‘Evolutionary causes and consequences of recombination rate variation in sexual organisms’. PMID:29109219

  1. Similarities and Differences in the Glycosylation Mechanisms in Prokaryotes and Eukaryotes

    Directory of Open Access Journals (Sweden)

    Anne Dell

    2010-01-01

    Full Text Available Recent years have witnessed a rapid growth in the number and diversity of prokaryotic proteins shown to carry N- and/or O-glycans, with protein glycosylation now considered as fundamental to the biology of these organisms as it is in eukaryotic systems. This article overviews the major glycosylation pathways that are known to exist in eukarya, bacteria and archaea. These are (i oligosaccharyltransferase (OST-mediated N-glycosylation which is abundant in eukarya and archaea, but is restricted to a limited range of bacteria; (ii stepwise cytoplasmic N-glycosylation that has so far only been confirmed in the bacterial domain; (iii OST-mediated O-glycosylation which appears to be characteristic of bacteria; and (iv stepwise O-glycosylation which is common in eukarya and bacteria. A key aim of the review is to integrate information from the three domains of life in order to highlight commonalities in glycosylation processes. We show how the OST-mediated N- and O-glycosylation pathways share cytoplasmic assembly of lipid-linked oligosaccharides, flipping across the ER/periplasmic/cytoplasmic membranes, and transferring “en bloc” to the protein acceptor. Moreover these hallmarks are mirrored in lipopolysaccharide biosynthesis. Like in eukaryotes, stepwise O-glycosylation occurs on diverse bacterial proteins including flagellins, adhesins, autotransporters and lipoproteins, with O-glycosylation chain extension often coupled with secretory mechanisms.

  2. Metabarcoding of benthic eukaryote communities predicts the ecological condition of estuaries

    International Nuclear Information System (INIS)

    Chariton, Anthony A.; Stephenson, Sarah; Morgan, Matthew J.; Steven, Andrew D.L.; Colloff, Matthew J.; Court, Leon N.; Hardy, Christopher M.

    2015-01-01

    DNA-derived measurements of biological composition have the potential to produce data covering all of life, and provide a tantalizing proposition for researchers and managers. We used metabarcoding to compare benthic eukaryote composition from five estuaries of varying condition. In contrast to traditional studies, we found biotic richness was greatest in the most disturbed estuary, with this being due to the large volume of extraneous material (i.e. run-off from aquaculture, agriculture and other catchment activities) being deposited in the system. In addition, we found strong correlations between composition and a number of environmental variables, including nutrients, pH and turbidity. A wide range of taxa responded to these environmental gradients, providing new insights into their sensitivities to natural and anthropogenic stressors. Metabarcoding has the capacity to bolster current monitoring techniques, enabling the decisions regarding ecological condition to be based on a more holistic view of biodiversity. - Highlights: • We used metabarcoding to examine the benthic eukaryote composition of five estuaries. • Biotic richness (based on MOTUs) was greater in the most impacted estuary. • Similarities among estuaries reflected their environmental condition. • Composition was strongly correlated with nutrients, turbidity and pH. • Metabarcoding can provide fast, comprehensive and ecologically informative data. - Using metabarcoding we were able discriminate benthos from five estuaries, and identify those taxa which responded negatively and positivity to the key environmental stressors

  3. Dynamics of antibiotic resistance genes and presence of putative pathogens during ambient temperature anaerobic digestion.

    Science.gov (United States)

    Resende, J A; Diniz, C G; Silva, V L; Otenio, M H; Bonnafous, A; Arcuri, P B; Godon, J-J

    2014-12-01

    This study was focused on evaluating the persistency of antimicrobial resistance (AR) genes and putative pathogenic bacteria in an anaerobic digesters operating at mesophilic ambient temperature, in two different year seasons: summer and winter. Abundance and dynamic of AR genes encoding resistance to macrolides (ermB), aminoglycosides (aphA2) and beta-lactams (blaTEM -1 ) and persistency of potentially pathogenic bacteria in pilot-scale anaerobic digesters were investigated. AR genes were determined in the influent and effluent in both conditions. Overall, after 60 days, reduction was observed for all evaluated genes. However, during the summer, anaerobic digestion was more related to the gene reduction as compared to winter. Persistency of potentially pathogenic bacteria was also evaluated by metagenomic analyses compared to an in-house created database. Clostridium, Acinetobacter and Stenotrophomonas were the most identified. Overall, considering the mesophilic ambient temperature during anaerobic digestion (summer and winter), a decrease in pathogenic bacteria detection through metagenomic analysis and AR genes is reported. Although the mesophilic anaerobic digestion has been efficient, the results may suggest medically important bacteria and AR genes persistency during the process. This is the first report to show AR gene dynamics and persistency of potentially pathogenic bacteria through metagenomic approach in cattle manure ambient temperature anaerobic digestion. © 2014 The Society for Applied Microbiology.

  4. Database Description - PSCDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name PSCDB Alternative n...rial Science and Technology (AIST) Takayuki Amemiya E-mail: Database classification Structure Databases - Protein structure Database...554-D558. External Links: Original website information Database maintenance site Graduate School of Informat...available URL of Web services - Need for user registration Not available About This Database Database Descri...ption Download License Update History of This Database Site Policy | Contact Us Database Description - PSCDB | LSDB Archive ...

  5. Database Description - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ASTRA Alternative n...tics Journal Search: Contact address Database classification Nucleotide Sequence Databases - Gene structure,...3702 Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The database represents classified p...(10):1211-6. External Links: Original website information Database maintenance site National Institute of Ad... for user registration Not available About This Database Database Description Dow

  6. Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

    Directory of Open Access Journals (Sweden)

    Haiwei Cheng

    Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

  7. Insight into eukaryotic topoisomerase II-inhibiting fused heterocyclic compounds in human cancer cell lines by molecular docking.

    Science.gov (United States)

    Taskin, T; Yilmaz, S; Yildiz, I; Yalcin, I; Aki, E

    2012-01-01

    Etoposide is effective as an anti-tumour drug by inhibiting eukaryotic DNA topoisomerase II via establishing a covalent complex with DNA. Unfortunately, its wide therapeutic application is often hindered by multidrug resistance (MDR), low water solubility and toxicity. In our previous study, new derivatives of benzoxazoles, benzimidazoles and related fused heterocyclic compounds, which exhibited significant eukaryotic DNA topoisomerase II inhibitory activity, were synthesized and exhibited better inhibitory activity compared with the drug etoposide itself. To expose the binding interactions between the eukaryotic topoisomerase II and the active heterocyclic compounds, docking studies were performed, using the software Discovery Studio 2.1, based on the crystal structure of the Topo IIA-bound G-segment DNA (PDB ID: 2RGR). The research was conducted on a selected set of 31 fused heterocyclic compounds with variation in structure and activity. The structural analyses indicate coordinate and hydrogen bonding interactions, van der Waals interactions and hydrophobic interactions between ligands and the protein, as Topo IIA-bound G-segment DNA are responsible for the preference of inhibition and potency. Collectively, the results demonstrate that the compounds 1a, 1c, 3b, 3c, 3e and 4a are significant anti-tumour drug candidates that should be further studied.

  8. Agrobacterium tumefaciens-mediated transformation for investigating pathogenicity genes of the phytopathogenic fungus Colletotrichum sansevieriae.

    Science.gov (United States)

    Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi

    2012-08-01

    Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.

  9. MAPPIN: a method for annotating, predicting pathogenicity and mode of inheritance for nonsynonymous variants.

    Science.gov (United States)

    Gosalia, Nehal; Economides, Aris N; Dewey, Frederick E; Balasubramanian, Suganthi

    2017-10-13

    Nonsynonymous single nucleotide variants (nsSNVs) constitute about 50% of known disease-causing mutations and understanding their functional impact is an area of active research. Existing algorithms predict pathogenicity of nsSNVs; however, they are unable to differentiate heterozygous, dominant disease-causing variants from heterozygous carrier variants that lead to disease only in the homozygous state. Here, we present MAPPIN (Method for Annotating, Predicting Pathogenicity, and mode of Inheritance for Nonsynonymous variants), a prediction method which utilizes a random forest algorithm to distinguish between nsSNVs with dominant, recessive, and benign effects. We apply MAPPIN to a set of Mendelian disease-causing mutations and accurately predict pathogenicity for all mutations. Furthermore, MAPPIN predicts mode of inheritance correctly for 70.3% of nsSNVs. MAPPIN also correctly predicts pathogenicity for 87.3% of mutations from the Deciphering Developmental Disorders Study with a 78.5% accuracy for mode of inheritance. When tested on a larger collection of mutations from the Human Gene Mutation Database, MAPPIN is able to significantly discriminate between mutations in known dominant and recessive genes. Finally, we demonstrate that MAPPIN outperforms CADD and Eigen in predicting disease inheritance modes for all validation datasets. To our knowledge, MAPPIN is the first nsSNV pathogenicity prediction algorithm that provides mode of inheritance predictions, adding another layer of information for variant prioritization. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Stable isotope database - Transport and fate of nutrient and pathogen loadings into nearshore Puget Sound: consequences for shellfish growing areas

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This project seeks to develop and apply an assessment of shellfish growing area (SGA) vulnerability to closures caused by watershed- and marine-derived pathogens....

  11. Database Description - RPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RPD Alternative name Rice Proteome Database...titute of Crop Science, National Agriculture and Food Research Organization Setsuko Komatsu E-mail: Database... classification Proteomics Resources Plant databases - Rice Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database... description Rice Proteome Database contains information on protei...and entered in the Rice Proteome Database. The database is searchable by keyword,

  12. Database Description - PLACE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name PLACE Alternative name A Database...Kannondai, Tsukuba, Ibaraki 305-8602, Japan National Institute of Agrobiological Sciences E-mail : Databas...e classification Plant databases Organism Taxonomy Name: Tracheophyta Taxonomy ID: 58023 Database...99, Vol.27, No.1 :297-300 External Links: Original website information Database maintenance site National In...- Need for user registration Not available About This Database Database Descripti

  13. Cytoplasmic Flow Enhances Organelle Dispersion in Eukaryotic Cells

    Science.gov (United States)

    Koslover, Elena; Mogre, Saurabh; Chan, Caleb; Theriot, Julie

    The cytoplasm of a living cell is an active environment through which intracellular components move and mix. We explore, using theoretical modeling coupled with microrheological measurements, the efficiency of particle dispersion via different modes of transport within this active environment. In particular, we focus on the role of cytoplasmic flow over different scales in contributing to organelle transport within two different cell types. In motile neutrophil cells, we show that bulk fluid flow associated with rapid cell deformation enhances particle transport to and from the cell periphery. In narrow fungal hyphae, localized flows due to hydrodynamic entrainment are shown to contribute to optimally efficient organelle dispersion. Our results highlight the importance of non-traditional modes of transport associated with flow of the cytoplasmic fluid in the distribution of organelles throughout eukaryotic cells.

  14. The New Higher Level Classification of Eukaryotes with Emphasis on the Taxonomy of Protists

    Science.gov (United States)

    SINA M. ADL; ALASTAIR G. B. SIMPSON; MARK A. FARMER; ROBERT A. ANDERSEN; O. ROGER ANDERSON; JOHN R. BARTA; SAMUEL S. BOWSER; GUY BRUGEROLLE; ROBERT A. FENSOME; SUZANNE FREDERICQ; TIMOTHY Y. JAMES; SERGEI KARPOV; PAUL KUGRENS; JOHN KRUG; CHRISTOPHER E. LANE; LOUISE A. LEWIS; JEAN LODGE; DENIS H. LYNN; DAVID G. MANN; RICHARD M. MCCOURT; LEONEL MENDOZA; ØJVIND MOESTRUP; SHARON E. MOZLEY-STANDRIDGE; THOMAS A. NERAD; CAROL A. SHEARER; ALEXEY V. SMIRNOV; FREDERICK W. SPIEGEL; MAX F.J.R. TAYLOR

    2005-01-01

    This revision of the classification of unicellular eukaryotes updates that of Levine et al. (1980) for the protozoa and expands it to include other protists. Whereas the previous revision was primarily to incorporate the results of ultrastructural studies, this revision incorporates results from both ultrastructural research since 1980 and molecular phylogenetic...

  15. The new higher level classification of eukaryotes with emphasis on the taxonomy of protists

    Science.gov (United States)

    Sina M. Adl; Alastair G.B. Simpson; Mark A. Farmer; Robert A. Andersen; O. Roger Anderson; John R. Barta; Samuel S. Bowser; Guy Brugerolle; Robert A. Fensome; Suzanne Fredericq; Timothy Y. James; Sergei Karpov; Paul Kugrens; John Krug; Christopher E. Lane; Louise A. Lewis; Jean Lodge; Denis H. Lynn; David G. Mann; Richard M. McCourt; Leonel Mendoza; Ojvind Moestrup; Sharon E. Mozley-Standridge; Thomas A. Nerad; Carol A. Shearer; Alexey V. Smirnov; Frederick W. Speigel; Max F.J.R. Taylor

    2005-01-01

    This revision of the classification of unicellular eukaryotes updates that of Levine et al. (1980) for the protozoa and expands it to include other protists. Whereas the previous revision was primarily to incorporate the results of ultrastructural studies, this revision incorporates results from both ultrastructural research since 1980 and molecular phylogenetic...

  16. Database Description - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name JSNP Alternative nam...n Science and Technology Agency Creator Affiliation: Contact address E-mail : Database...sapiens Taxonomy ID: 9606 Database description A database of about 197,000 polymorphisms in Japanese populat...1):605-610 External Links: Original website information Database maintenance site Institute of Medical Scien...er registration Not available About This Database Database Description Download License Update History of This Database

  17. Database Description - RED | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RED Alternative name Rice Expression Database...enome Research Unit Shoshi Kikuchi E-mail : Database classification Plant databases - Rice Database classifi...cation Microarray, Gene Expression Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database descripti... Article title: Rice Expression Database: the gateway to rice functional genomics...nt Science (2002) Dec 7 (12):563-564 External Links: Original website information Database maintenance site

  18. Database Description - ConfC | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ConfC Alternative name Database...amotsu Noguchi Tel: 042-495-8736 E-mail: Database classification Structure Database...s - Protein structure Structure Databases - Small molecules Structure Databases - Nucleic acid structure Database... services - Need for user registration - About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Database Description - ConfC | LSDB Archive ...

  19. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  20. Complex multicellular functions at a unicellular eukaryote level: Learning, memory, and immunity.

    Science.gov (United States)

    Csaba, György

    2017-06-01

    According to experimental data, eukaryote unicellulars are able to learn, have immunity and memory. Learning is carried out in a very primitive form, and the memory is not neural but an epigenetic one. However, this epigenetic memory, which is well justified by the presence and manifestation of hormonal imprinting, is strong and permanent in the life of cell and also in its progenies. This memory is epigenetically executed by the alteration and fixation of methylation pattern of genes without changes in base sequences. The immunity of unicellulars is based on self/non-self discrimination, which leads to the destruction of non-self invaders and utilization of them as nourishment (by phagocytosis). The tools of learning, memory, and immunity of unicellulars are uniformly found in plasma membrane receptors, which formed under the effect of dynamic receptor pattern generation, suggested by Koch et al., and this is the basis of hormonal imprinting, by which the encounter between a chemical substance and the cell is specifically memorized. The receptors and imprinting are also used in the later steps of evolution up to mammals (including man) in each mentioned functions. This means that learning, memory, and immunity can be deduced to a unicellular eukaryote level.