WorldWideScience

Sample records for estrogen response elements

  1. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  2. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  3. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  4. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  6. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  7. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  8. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  9. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  10. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  11. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  12. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  13. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  14. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    Science.gov (United States)

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  15. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  16. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  17. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  18. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  19. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  20. Computational method for discovery of estrogen responsive genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar

    2004-01-01

    Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...

  1. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  2. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  3. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  4. KBERG: KnowledgeBase for Estrogen Responsive Genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam

    2007-01-01

    Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...

  5. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

    Science.gov (United States)

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

    1998-01-01

    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  6. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Science.gov (United States)

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  7. Location analysis for the estrogen receptor-? reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    OpenAIRE

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-? (ER?)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ER?-bound loci and quantify the incidence of ERE sequences under two stringencies of detection:

  8. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    Science.gov (United States)

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  9. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah

    2012-10-26

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  10. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.

    2012-01-01

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  11. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  12. In Vivo Anti-estrogenic Effects of Menadione on Hepatic Estrogen-responsive Gene Expression in Male Medaka (Oryzias latipes)

    OpenAIRE

    Yamaguchi, Akemi; Kohra, Shinya; Ishibashi, Hiroshi; Arizono, Koji; Tominaga, Nobuaki

    2008-01-01

    Menadione, a synthetic vitamin K3, exhibits anti-estrogenic activity on in vitro assay. However, the in vivo anti-estrogenic effects of menadione have not been determined, while correlations between biological effects and structural changes are unclear. Thus, we investigated the in vivo anti-estrogenic activity of menadione under fluorescent light and dark conditions. Suppression of the hepatic estrogen response genes vitellogenin1 (VTG1), VTG2 and estrogen receptor-α (ER-α) was used as an in...

  13. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    Science.gov (United States)

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  14. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    OpenAIRE

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-01-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...

  15. cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.

    Science.gov (United States)

    Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R

    1989-01-01

    Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin

  16. Estrogen

    Science.gov (United States)

    ... menopause ('change of life', the end of monthly menstrual periods). Some brands of estrogen are also used ... you.Ask your pharmacist or doctor for a copy of the manufacturer's information for the patient.

  17. Transgenic zebrafish reveal tissue-specific differences in estrogen signaling in response to environmental water samples.

    Science.gov (United States)

    Gorelick, Daniel A; Iwanowicz, Luke R; Hung, Alice L; Blazer, Vicki S; Halpern, Marnie E

    2014-04-01

    Environmental endocrine disruptors (EEDs) are exogenous chemicals that mimic endogenous hormones such as estrogens. Previous studies using a zebrafish transgenic reporter demonstrated that the EEDs bisphenol A and genistein preferentially activate estrogen receptors (ERs) in the larval heart compared with the liver. However, it was not known whether the transgenic zebrafish reporter was sensitive enough to detect estrogens from environmental samples, whether environmental estrogens would exhibit tissue-specific effects similar to those of BPA and genistein, or why some compounds preferentially target receptors in the heart. We tested surface water samples using a transgenic zebrafish reporter with tandem estrogen response elements driving green fluorescent protein expression (5xERE:GFP). Reporter activation was colocalized with tissue-specific expression of ER genes by RNA in situ hybridization. We observed selective patterns of ER activation in transgenic fish exposed to river water samples from the Mid-Atlantic United States, with several samples preferentially activating receptors in embryonic and larval heart valves. We discovered that tissue specificity in ER activation was due to differences in the expression of ER subtypes. ERα was expressed in developing heart valves but not in the liver, whereas ERβ2 had the opposite profile. Accordingly, subtype-specific ER agonists activated the reporter in either the heart valves or the liver. The use of 5xERE:GFP transgenic zebrafish revealed an unexpected tissue-specific difference in the response to environmentally relevant estrogenic compounds. Exposure to estrogenic EEDs in utero was associated with adverse health effects, with the potentially unanticipated consequence of targeting developing heart valves.

  18. Estrogenic response of bisphenol A in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Lindholst, Christian; Pedersen, Knud Ladegaard; Pedersen, Søren Nørby

    2000-01-01

    Bisphenol A (BPA) previously shown to possess xenoestrogenic activities was administered to rainbow trout (Oncorhynchus mykiss) through a continuos flow system. The estrogenic response expressed as the induction of vitellogenin (VTG) synthesis was measured during 12 days of exposure, using a direct...

  19. Estrogen-Modulated Response of Breast Cancer To Vitamin D and Its Analogs: Role of IGF

    National Research Council Canada - National Science Library

    Dolezalova, Hana

    1999-01-01

    ... (LPA) and sphingosine 1-phosphate (S1P). Estrogen receptor positive and estrogen receptor negative cells express predominantly Edg-2 and Edg-4 Rs for LPA and Edg-3 for Sip, which transduce proliferative responses by direct nuclear signaling...

  20. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    OpenAIRE

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  1. Calmodulin-like protein 3 is an estrogen receptor alpha coregulator for gene expression and drug response in a SNP, estrogen, and SERM-dependent fashion.

    Science.gov (United States)

    Qin, Sisi; Ingle, James N; Liu, Mohan; Yu, Jia; Wickerham, D Lawrence; Kubo, Michiaki; Weinshilboum, Richard M; Wang, Liewei

    2017-08-18

    We previously performed a case-control genome-wide association study in women treated with selective estrogen receptor modulators (SERMs) for breast cancer prevention and identified single nucleotide polymorphisms (SNPs) in ZNF423 as potential biomarkers for response to SERM therapy. The ZNF423rs9940645 SNP, which is approximately 200 bp away from the estrogen response elements, resulted in the SNP, estrogen, and SERM-dependent regulation of ZNF423 expression and, "downstream", that of BRCA1. Electrophoretic mobility shift assay-mass spectrometry was performed to identify proteins binding to the ZNF423 SNP and coordinating with estrogen receptor alpha (ERα). Clustered, regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing was applied to generate ZR75-1 breast cancer cells with different ZNF423 SNP genotypes. Both cultured cells and mouse xenograft models with different ZNF423 SNP genotypes were used to study the cellular responses to SERMs and poly(ADP-ribose) polymerase (PARP) inhibitors. We identified calmodulin-like protein 3 (CALML3) as a key sensor of this SNP and a coregulator of ERα, which contributes to differential gene transcription regulation in an estrogen and SERM-dependent fashion. Furthermore, using CRISPR/Cas9-engineered ZR75-1 breast cancer cells with different ZNF423 SNP genotypes, striking differences in cellular responses to SERMs and PARP inhibitors, alone or in combination, were observed not only in cells but also in a mouse xenograft model. Our results have demonstrated the mechanism by which the ZNF423 rs9940645 SNP might regulate gene expression and drug response as well as its potential role in achieving more highly individualized breast cancer therapy.

  2. Genomic priming of the antisecretory response to estrogen in rat distal colon throughout the estrous cycle.

    LENUS (Irish Health Repository)

    O'Mahony, Fiona

    2009-11-01

    The secretion of Cl(-) across distal colonic crypt cells provides the driving force for the movement of fluid into the luminal space. 17beta-Estradiol (E2) produces a rapid and sustained reduction in secretion in females, which is dependent on the novel protein kinase C delta (PKC delta) isozyme and PKA isoform I targeting of KCNQ1 channels. This sexual dimorphism in the E2 response is associated with a higher expression level of PKC delta in female compared with the male tissue. The present study revealed the antisecretory response is regulated throughout the female reproductive (estrous) cycle and is primed by genomic regulation of the kinases. E2 (1-10 nm) decreased cAMP-dependent secretion in colonic epithelia during the estrus, metestrus, and diestrus stages. A weak inhibition of secretion was demonstrated in the proestrus stage. The expression levels of PKC delta and PKA fluctuated throughout the estrous cycle and correlated with the potency of the antisecretory effect of E2. The expression of PKC delta and PKA were up-regulated by estrogen at a transcriptional level via a PKC delta-MAPK-cAMP response element-binding protein-regulated pathway indicating a genomic priming of the antisecretory response. PK Cdelta was activated by the membrane-impermeant E2-BSA, and this response was inhibited by the estrogen receptor antagonist ICI 182,780. The 66-kDa estrogen receptor-alpha isoform was present at the plasma membrane of female colonic crypt cells with a lower abundance found in male colonic crypts. The study demonstrates estrogen regulation of intestinal secretion both at a rapid and transcriptional level, demonstrating an interdependent relationship between both nongenomic and genomic hormone responses.

  3. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    Science.gov (United States)

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  4. Triclosan Lacks (Anti-Estrogenic Effects in Zebrafish Cells but Modulates Estrogen Response in Zebrafish Embryos

    Directory of Open Access Journals (Sweden)

    Hélène Serra

    2018-04-01

    Full Text Available Triclosan (TCS, an antimicrobial agent widely found in the aquatic environment, is suspected to act as an endocrine disrupting compound, however mechanistic information is lacking in regards to aquatic species. This study assessed the ability of TCS to interfere with estrogen receptor (ER transcriptional activity, in zebrafish-specific in vitro and in vivo reporter gene assays. We report that TCS exhibits a lack of either agonistic or antagonistic effects on a panel of ER-expressing zebrafish (ZELH-zfERα and -zfERβ and human (MELN cell lines. At the organism level, TCS at concentrations of up to 0.3 µM had no effect on ER-regulated brain aromatase gene expression in transgenic cyp19a1b-GFP zebrafish embryos. At a concentration of 1 µM, TCS interfered with the E2 response in an ambivalent manner by potentializing a low E2 response (0.625 nM, but decreasing a high E2 response (10 nM. Altogether, our study suggests that while modulation of ER-regulated genes by TCS may occur in zebrafish, it does so irrespective of a direct binding and activation of zfERs.

  5. Estrogen signalling and the DNA damage response in hormone dependent breast cancers

    Directory of Open Access Journals (Sweden)

    C Elizabeth Caldon

    2014-05-01

    Full Text Available Estrogen is necessary for the normal growth and development of breast tissue, but high levels of estrogen are a major risk factor for breast cancer. One mechanism by which estrogen could contribute to breast cancer is via the induction of DNA damage. This perspective discusses the mechanisms by which estrogen alters the DNA damage response (DDR and DNA repair through the regulation of key effector proteins including ATM, ATR, CHK1, BRCA1 and p53 and the feedback on estrogen receptor signalling from these proteins. We put forward the hypothesis that estrogen receptor signalling converges to suppress effective DNA repair and apoptosis in favour of proliferation. This is important in hormone-dependent breast cancer as it will affect processing of estrogen-induced DNA damage, as well as other genotoxic insults. DDR and DNA repair proteins are frequently mutated or altered in estrogen responsive breast cancer which will further change the processing of DNA damage. Finally the action of estrogen signalling on DNA damage is also relevant to the therapeutic setting as the suppression of a DNA damage response by estrogen has the potential to alter the response of cancers to anti-hormone treatment or chemotherapy that induces DNA damage.

  6. Estrogen-dependent downregulation of hairy and enhancer of split homolog-1 gene expression in breast cancer cells is mediated via a 3' distal element.

    Science.gov (United States)

    Müller, Patrick; Merrell, Kenneth W; Crofts, Justin D; Rönnlund, Caroline; Lin, Chin-Yo; Gustafsson, Jan-Ake; Ström, Anders

    2009-03-01

    Regulation of hairy and enhancer of split homologue-1 (HES-1) by estradiol and all-trans retinoic acid affects proliferation of human breast cancer cells. Here, we identify and characterize cis-regulatory elements involved in HES-1 regulation. In the distal 5' promoter of the HES-1 gene, we found a retinoic acid response element and in the distal 3' region, an estrogen receptor alpha(ER)alpha binding site. The ERalpha binding site, composed of an estrogen response element (ERE) and an ERE half-site, is important for both ERalpha binding and transcriptional regulation. Chromatin immunoprecipitation assays revealed that ERalpha is recruited to the ERE and associates with the HES-1 promoter. We also show recruitment of nuclear receptor co-regulators to the ERE in response to estradiol, followed by a decrease in histone acetylation and RNA polymerase II docking in the HES-1 promoter region. Our findings are consistent with a novel type of repressive estrogen response element in the distal 3' region of the HES-1 gene.

  7. Identification of choriogenin cis-regulatory elements and production of estrogen-inducible, liver-specific transgenic Medaka.

    Science.gov (United States)

    Ueno, Tetsuro; Yasumasu, Shigeki; Hayashi, Shinji; Iuchi, Ichiro

    2004-07-01

    Choriogenins (chg-H, chg-L) are precursor proteins of egg envelope of medaka and synthesized in the spawning female liver in response to estrogen. We linked a gene construct chg-L1.5 kb/GFP (a 1.5 kb 5'-upstream region of the chg-L gene fused with a green fluorescence protein (GFP) gene) to another construct emgb/RFP (a cis-regulatory region of embryonic globin gene fused with an RFP gene), injected the double fusion gene construct into 1- or 2-cell-stage embryos, and selected embryos expressing the RFP in erythroid cells. From the embryos, we established two lines of chg-L1.5 kb/GFP-emgb/RFP-transgenic medaka. The 3-month-old spawning females and estradiol-17beta (E2)-exposed males displayed the liver-specific GFP expression. The E2-dependent GFP expression was detected in the differentiating liver of the stage 37-38 embryos. In addition, RT-PCR and whole-mount in situ hybridization showed that the E2-dependent chg expression was found in the liver of the stage 34 embryos of wild medaka, suggesting that such E2-dependency is achieved shortly after differentiation of the liver. Analysis using serial deletion mutants fused with GFP showed that the region -426 to -284 of the chg-L gene or the region -364 to -265 of the chg-H gene had the ability to promote the E2-dependent liver-specific GFP expression of its downstream gene. Further analyses suggested that an estrogen response element (ERE) at -309, an ERE half-site at -330 and a binding site for C/EBP at -363 of the chg-L gene played important roles in its downstream chg-L gene expression. In addition, this transgenic medaka may be useful as one of the test animals for detecting environmental estrogenic steroids.

  8. Nucleosome dynamics: HMGB1 facilitates nucleosome restructuring and collaborates in estrogen-responsive gene expression

    Directory of Open Access Journals (Sweden)

    William M. Scovell

    2016-12-01

    Full Text Available The genome in the human cell is extraordinarily compacted in the nucleus. As a result, much of the DNA is inaccessible and functionally inert. Notwithstanding the highly efficient packaging, mechanisms have evolved to render DNA sites accessible that then enable a multitude of factors to carry out ongoing and vital functions. The compaction is derived from DNA complexation within nucleosomes, which can further consolidate into a higher-order chromatin structure. The nucleosome and nucleosomal DNA are not static in nature, but are dynamic, undergoing structural and functional changes as the cell responds to stresses and/or metabolic or environmental cues. We are only beginning to understand the forces and the complexes that engage the nucleosome to unearth the tightly bound and inaccessible DNA sequences and provide an opening to more accessible target sites. In many cases, current findings support a major role for the action of ATP-dependent chromatin remodeling complexes (CRCs in providing an avenue to factor accessibility that leads to the activation of transcription. The estrogen receptor α (ERα does not bind to the estrogen response element (ERE in the canonical nucleosome. However, evidence will be presented that HMGB1 restructures the nucleosome in an ATP-independent manner and also facilitates access and strong binding of ERα to ERE. The features that appear important in the mechanism of action for HMGB1 will be highlighted, in addition to the characteristic features of the restructured nucleosome. These findings, together with previous evidence, suggest a collaborative role for HMGB1 in the step-wise transcription of estrogen-responsive genes. In addition, alternate mechanistic pathways will be discussed, with consideration that “HMGB1 restructuring” of the nucleosome may generally be viewed as a perturbation of the equilibrium of an ensemble of nearly isoenergetic nucleosome states in an energy landscape that is driven by

  9. Estradiol up-regulates L-type Ca2+ channels via membrane-bound estrogen receptor/phosphoinositide-3-kinase/Akt/cAMP response element-binding protein signaling pathway.

    Science.gov (United States)

    Yang, Xiaoyan; Mao, Xiaofang; Xu, Gao; Xing, Shasha; Chattopadhyay, Ansuman; Jin, Si; Salama, Guy

    2018-05-01

    In long QT syndrome type 2, women are more prone than men to the lethal arrhythmia torsades de pointes. We previously reported that 17β-estradiol (E2) up-regulates L-type Ca 2+ channels and current (I Ca,L ) (∼30%) in rabbit ventricular myocytes by a classic genomic mechanism mediated by estrogen receptor-α (ERα). In long QT syndrome type 2 (I Kr blockade or bradycardia), the higher Ca 2+ influx via I Ca,L causes Ca 2+ overload, spontaneous sarcoplasmic reticulum Ca 2+ release, and reactivation of I Ca,L that triggers early afterdepolarizations and torsades de pointes. The purpose of this study was to investigate the molecular mechanisms whereby E2 up-regulates I Ca,L , which are poorly understood. H9C2 and rat myocytes were incubated with E2 ± ER antagonist, or inhibitors of downstream transcription factors, for 24 hours, followed by western blots of Cav1.2α1C and voltage-clamp measurements of I Ca,L . Incubation of H9C2 cells with E2 (10-100 nM) increased I Ca,L density and Cav1.2α1C expression, which were suppressed by the ER antagonist ICI182,780 (1 μM). Enhanced I Ca,L and Cav1.2α1C expression by E2 was suppressed by inhibitors of phosphoinositide-3-kinase (Pi3K) (30 μM LY294002; P L via plasma membrane ER and by activating Pi3K, Akt, and CREB signaling. The promoter regions of the CACNA1C gene (human-rabbit-rat) contain adjacent/overlapping binding sites for p-CREB and ERα, which suggests a synergistic regulation by these pathways. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  10. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    Science.gov (United States)

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  11. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    Science.gov (United States)

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  12. Combinations of physiologic estrogens with xenoestrogens alter calcium and kinase responses, prolactin release, and membrane estrogen receptor trafficking in rat pituitary cells

    Directory of Open Access Journals (Sweden)

    Watson Cheryl S

    2010-10-01

    Full Text Available Abstract Background Xenoestrogens such as alkylphenols and the structurally related plastic byproduct bisphenol A have recently been shown to act potently via nongenomic signaling pathways and the membrane version of estrogen receptor-α. Though the responses to these compounds are typically measured individually, they usually contaminate organisms that already have endogenous estrogens present. Therefore, we used quantitative medium-throughput screening assays to measure the effects of physiologic estrogens in combination with these xenoestrogens. Methods We studied the effects of low concentrations of endogenous estrogens (estradiol, estriol, and estrone at 10 pM (representing pre-development levels, and 1 nM (representing higher cycle-dependent and pregnancy levels in combinations with the same levels of xenoestrogens in GH3/B6/F10 pituitary cells. These levels of xenoestrogens represent extremely low contamination levels. We monitored calcium entry into cells using Fura-2 fluorescence imaging of single cells. Prolactin release was measured by radio-immunoassay. Extracellular-regulated kinase (1 and 2 phospho-activations and the levels of three estrogen receptors in the cell membrane (ERα, ERβ, and GPER were measured using a quantitative plate immunoassay of fixed cells either permeabilized or nonpermeabilized (respectively. Results All xenoestrogens caused responses at these concentrations, and had disruptive effects on the actions of physiologic estrogens. Xenoestrogens reduced the % of cells that responded to estradiol via calcium channel opening. They also inhibited the activation (phosphorylation of extracellular-regulated kinases at some concentrations. They either inhibited or enhanced rapid prolactin release, depending upon concentration. These latter two dose-responses were nonmonotonic, a characteristic of nongenomic estrogenic responses. Conclusions Responses mediated by endogenous estrogens representing different life stages are

  13. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    Science.gov (United States)

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  14. Estrogen receptor β (ERβ1) transactivation is differentially modulated by the transcriptional coregulator Tip60 in a cis-acting element-dependent manner.

    Science.gov (United States)

    Lee, Ming-Tsung; Leung, Yuet-Kin; Chung, Irving; Tarapore, Pheruza; Ho, Shuk-Mei

    2013-08-30

    Estrogen receptor (ER) β1 and ERα have overlapping and distinct functions despite their common use of estradiol as the physiological ligand. These attributes are explained in part by their differential utilization of coregulators and ligands. Although Tip60 has been shown to interact with both receptors, its regulatory role in ERβ1 transactivation has not been defined. In this study, we found that Tip60 enhances transactivation of ERβ1 at the AP-1 site but suppresses its transcriptional activity at the estrogen-response element (ERE) site in an estradiol-independent manner. However, different estrogenic compounds can modify the Tip60 action. The corepressor activity of Tip60 at the ERE site is abolished by diarylpropionitrile, genistein, equol, and bisphenol A, whereas its coactivation at the AP-1 site is augmented by fulvestrant (ICI 182,780). GRIP1 is an important tethering mediator for ERs at the AP-1 site. We found that coexpression of GRIP1 synergizes the action of Tip60. Although Tip60 is a known acetyltransferase, it is unable to acetylate ERβ1, and its coregulatory functions are independent of its acetylation activity. In addition, we showed the co-occupancy of ERβ1 and Tip60 at ERE and AP-1 sites of ERβ1 target genes. Tip60 differentially regulates the endogenous expression of the target genes by modulating the binding of ERβ1 to the cis-regulatory regions. Thus, we have identified Tip60 as the first dual-function coregulator of ERβ1.

  15. FIELD VALIDATION OF A SHEEPSHEAD MINNOW ESTROGEN-RESPONSIVE CDNA MACROARRAY

    Science.gov (United States)

    Hemmer, Michael J., Iris Knoebl, Becky L. Hemmer, Patrick Larkin, Peggy S. Harris and Nancy D. Denslow. In press. Field Validation of a Sheepshead Minnow Estrogen-Responsive cDNA Macroarray (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portl...

  16. Effects of environmental estrogenic chemicals on AP1 mediated transcription with estrogen receptors alpha and beta.

    Science.gov (United States)

    Fujimoto, Nariaki; Honda, Hiroaki; Kitamura, Shigeyuki

    2004-01-01

    There has been much discussion concerning endocrine disrupting chemicals suspected of exerting adverse effects in both wildlife and humans. Since the majority of these compounds are estrogenic, a large number of in vitro tests for estrogenic characteristics have been developed for screening purpose. One reliable and widely used method is the reporter gene assay employing estrogen receptors (ERs) and a reporter gene with a cis-acting estrogen responsive element (ERE). Other elements such as AP1 also mediate estrogenic signals and the manner of response could be quite different from that of ERE. Since this has yet to be explored, the ER mediated AP1 activity in response to a series of environmental estrogens was investigated in comparison with ERE findings. All the compounds exhibited estrogenic properties with ERE-luc and their AP1 responses were quite similar. These was one exception, however, p,p'-DDT (1,1,1,-trichloro-2,2-bis(p-chlorophenyl)ethane) did not exert any AP1-luc activity, while it appeared to be estrogenic at 10(-7) to 10(-5)M with the ERE action. None of the compounds demonstrated ER beta:AP1 activity. These data suggest that significant differences can occur in responses through the two estrogen pathways depending on environmental chemicals.

  17. Molecular analysis of the vaginal response to estrogens in the ovariectomized rat and postmenopausal woman

    Directory of Open Access Journals (Sweden)

    Peano Bryan J

    2008-06-01

    Full Text Available Abstract Background Vaginal atrophy (VA is the thinning of the vaginal epithelial lining, typically the result of lowered estrogen levels during menopause. Some of the consequences of VA include increased susceptibility to bacterial infection, pain during sexual intercourse, and vaginal burning or itching. Although estrogen treatment is highly effective, alternative therapies are also desired for women who are not candidates for post-menopausal hormone therapy (HT. The ovariectomized (OVX rat is widely accepted as an appropriate animal model for many estrogen-dependent responses in humans; however, since reproductive biology can vary significantly between mammalian systems, this study examined how well the OVX rat recapitulates human biology. Methods We analyzed 19 vaginal biopsies from human subjects pre and post 3-month 17β-estradiol treated by expression profiling. Data were compared to transcriptional profiling generated from vaginal samples obtained from ovariectomized rats treated with 17β-estradiol for 6 hrs, 3 days or 5 days. The level of differential expression between pre- vs. post- estrogen treatment was calculated for each of the human and OVX rat datasets. Probe sets corresponding to orthologous rat and human genes were mapped to each other using NCBI Homologene. Results A positive correlation was observed between the rat and human responses to estrogen. Genes belonging to several biological pathways and GO categories were similarly differentially expressed in rat and human. A large number of the coordinately regulated biological processes are already known to be involved in human VA, such as inflammation, epithelial development, and EGF pathway activation. Conclusion At the transcriptional level, there is evidence of significant overlap of the effects of estrogen treatment between the OVX rat and human VA samples.

  18. Molecular conservation of estrogen-response associated with cell cycle regulation, hormonal carcinogenesis and cancer in zebrafish and human cancer cell lines

    Directory of Open Access Journals (Sweden)

    Govindarajan Kunde R

    2011-05-01

    Full Text Available Abstract Background The zebrafish is recognized as a versatile cancer and drug screening model. However, it is not known whether the estrogen-responsive genes and signaling pathways that are involved in estrogen-dependent carcinogenesis and human cancer are operating in zebrafish. In order to determine the potential of zebrafish model for estrogen-related cancer research, we investigated the molecular conservation of estrogen responses operating in both zebrafish and human cancer cell lines. Methods Microarray experiment was performed on zebrafish exposed to estrogen (17β-estradiol; a classified carcinogen and an anti-estrogen (ICI 182,780. Zebrafish estrogen-responsive genes sensitive to both estrogen and anti-estrogen were identified and validated using real-time PCR. Human homolog mapping and knowledge-based data mining were performed on zebrafish estrogen responsive genes followed by estrogen receptor binding site analysis and comparative transcriptome analysis with estrogen-responsive human cancer cell lines (MCF7, T47D and Ishikawa. Results Our transcriptome analysis captured multiple estrogen-responsive genes and signaling pathways that increased cell proliferation, promoted DNA damage and genome instability, and decreased tumor suppressing effects, suggesting a common mechanism for estrogen-induced carcinogenesis. Comparative analysis revealed a core set of conserved estrogen-responsive genes that demonstrate enrichment of estrogen receptor binding sites and cell cycle signaling pathways. Knowledge-based and network analysis led us to propose that the mechanism involving estrogen-activated estrogen receptor mediated down-regulation of human homolog HES1 followed by up-regulation cell cycle-related genes (human homologs E2F4, CDK2, CCNA, CCNB, CCNE, is highly conserved, and this mechanism may involve novel crosstalk with basal AHR. We also identified mitotic roles of polo-like kinase as a conserved signaling pathway with multiple entry

  19. Estrogen Responsiveness of the TFIID Subunit TAF4B in the Normal Mouse Ovary and in Ovarian Tumors1

    Science.gov (United States)

    Wardell, Jennifer R.; Hodgkinson, Kendra M.; Binder, April K.; Seymour, Kimberly A.; Korach, Kenneth S.; Vanderhyden, Barbara C.; Freiman, Richard N.

    2013-01-01

    ABSTRACT Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation. PMID:24068106

  20. Estrogen responsiveness of the TFIID subunit TAF4B in the normal mouse ovary and in ovarian tumors.

    Science.gov (United States)

    Wardell, Jennifer R; Hodgkinson, Kendra M; Binder, April K; Seymour, Kimberly A; Korach, Kenneth S; Vanderhyden, Barbara C; Freiman, Richard N

    2013-11-01

    Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation.

  1. Expression of estrogen-related gene markers in breast cancer tissue predicts aromatase inhibitor responsiveness.

    Directory of Open Access Journals (Sweden)

    Irene Moy

    Full Text Available Aromatase inhibitors (AIs are the most effective class of drugs in the endocrine treatment of breast cancer, with an approximate 50% treatment response rate. Our objective was to determine whether intratumoral expression levels of estrogen-related genes are predictive of AI responsiveness in postmenopausal women with breast cancer. Primary breast carcinomas were obtained from 112 women who received AI therapy after failing adjuvant tamoxifen therapy and developing recurrent breast cancer. Tumor ERα and PR protein expression were analyzed by immunohistochemistry (IHC. Messenger RNA (mRNA levels of 5 estrogen-related genes-AKR1C3, aromatase, ERα, and 2 estradiol/ERα target genes, BRCA1 and PR-were measured by real-time PCR. Tumor protein and mRNA levels were compared with breast cancer progression rates to determine predictive accuracy. Responsiveness to AI therapy-defined as the combined complete response, partial response, and stable disease rates for at least 6 months-was 51%; rates were 56% in ERα-IHC-positive and 14% in ERα-IHC-negative tumors. Levels of ERα, PR, or BRCA1 mRNA were independently predictive for responsiveness to AI. In cross-validated analyses, a combined measurement of tumor ERα and PR mRNA levels yielded a more superior specificity (36% and identical sensitivity (96% to the current clinical practice (ERα/PR-IHC. In patients with ERα/PR-IHC-negative tumors, analysis of mRNA expression revealed either non-significant trends or statistically significant positive predictive values for AI responsiveness. In conclusion, expression levels of estrogen-related mRNAs are predictive for AI responsiveness in postmenopausal women with breast cancer, and mRNA expression analysis may improve patient selection.

  2. Estrogen Receptor β (ERβ1) Transactivation Is Differentially Modulated by the Transcriptional Coregulator Tip60 in a cis-Acting Element-dependent Manner*

    Science.gov (United States)

    Lee, Ming-Tsung; Leung, Yuet-Kin; Chung, Irving; Tarapore, Pheruza; Ho, Shuk-Mei

    2013-01-01

    Estrogen receptor (ER) β1 and ERα have overlapping and distinct functions despite their common use of estradiol as the physiological ligand. These attributes are explained in part by their differential utilization of coregulators and ligands. Although Tip60 has been shown to interact with both receptors, its regulatory role in ERβ1 transactivation has not been defined. In this study, we found that Tip60 enhances transactivation of ERβ1 at the AP-1 site but suppresses its transcriptional activity at the estrogen-response element (ERE) site in an estradiol-independent manner. However, different estrogenic compounds can modify the Tip60 action. The corepressor activity of Tip60 at the ERE site is abolished by diarylpropionitrile, genistein, equol, and bisphenol A, whereas its coactivation at the AP-1 site is augmented by fulvestrant (ICI 182,780). GRIP1 is an important tethering mediator for ERs at the AP-1 site. We found that coexpression of GRIP1 synergizes the action of Tip60. Although Tip60 is a known acetyltransferase, it is unable to acetylate ERβ1, and its coregulatory functions are independent of its acetylation activity. In addition, we showed the co-occupancy of ERβ1 and Tip60 at ERE and AP-1 sites of ERβ1 target genes. Tip60 differentially regulates the endogenous expression of the target genes by modulating the binding of ERβ1 to the cis-regulatory regions. Thus, we have identified Tip60 as the first dual-function coregulator of ERβ1. PMID:23857583

  3. Comparison of estrogenic responses in bone and uterus depending on the parity status in Lewis rats.

    Science.gov (United States)

    Keiler, Annekathrin Martina; Bernhardt, Ricardo; Scharnweber, Dieter; Jarry, Hubertus; Vollmer, Günter; Zierau, Oliver

    2013-01-01

    The reproductive transition of women through peri- to postmenopause is characterized by changes in steroid hormone levels due to the cessation of the ovarian function. Beside several complaints associated with these hormonal changes, the deterioration of the trabecular bone micro-architecture and the loss of skeletal mass can cause osteoporosis. At this life stage, women often have a reproductive history of one to several pregnancies. The ovariectomized skeletally mature rat (>10 months old) is one of the most commonly used animal models for postmenopausal osteoporosis research. Despite the fact that mammals can undergo up to several reproductive cycles (primi-/pluriparous), nulliparous animals are often used and the question whether changes in the hormonal milieu subsequently affect the skeleton and influence the outcome of intervention studies is often neglected in study designs. Therefore, the aim of the present study was to compare the estrogen responsiveness of nulliparous and pluriparous rats. For this purpose, one year old virgin or retired breeder Lewis rats were either sham operated or ovariectomized, whereas half of the ovariectomized animals received subcutaneous 17β-estradiol pellets eight weeks after surgery. After another four weeks, the effects on the uterus were determined by expression analysis of estrogen-dependently regulated steroid receptor genes and well-established marker genes. Moreover, trabecular bone parameters in the tibia were analyzed by micro-computed tomography (μCT). Parity-dependency in estrogen responsiveness was observed with respect to the achieved serum E2 levels in response to similar E2 treatment. This led to differences both on the uterus wet weight and on the expression level of uterine target genes. In addition, a reversal of the ovariectomy-induced changes of the bone architecture after 17β-estradiol substitution was only observed among the nulliparous. In conclusion, the observations of this study support parity

  4. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  5. Differential response of two somatolactin genes to zinc or estrogen in pituitary of Cyprinus carpio.

    Science.gov (United States)

    Valenzuela, G E; Perez, A; Navarro, M; Romero, A; Figueroa, J; Kausel, G

    2015-05-01

    Environmental changes affect gene expression that we addressed in the pituitary, a central regulatory organ at the interface between the central nervous system and the endocrine system. With the aim to reveal effects of changes in the aquatic environment on the expression of hypothalamo-hypophyseal factors, we characterized somatolactin (SL) in Cyprinus carpio. SL, a fish specific pituitary hormone belonging to the prolactin (PRL) superfamily, is involved in background adaptation, osmoregulation, reproduction and fatty acid metabolism. Two sl genes, α and β, were discovered in carp and transcripts of both were detected in pituitaries. Clearly, expression of slα and slβ was modulated significantly in pituitary of male adult carp in response to treatment with ZnCl2 (Zn), but only slβ responded to 17β-estrogen (E2), relative to control carp as shown by RT-qPCR analyses. Furthermore, the amount of mRNA of related factors was assessed revealing variable effects on prl, growth hormone (gh), and factors involved in sl regulation: the pituitary transcription factor pit1 and hypothalamic pituitary adenylase cyclase activating peptide (pacap). In parallel, the physiological response of the experimental animals to Zn or E2 was confirmed by showing a significant increase of metallothionein (mt) or vitellogenin (vg) gene expression in liver, classical sentinels for exposure to heavy metal or estrogens. These data suggest that the sl genes seem to be involved in the response to Zn, as well as to estrogen, and could contribute to evaluate biological relevant changes in the aquatic environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Chronic exposure of killifish to a highly polluted environment desensitizes estrogen-responsive reproductive and biomarker genes

    International Nuclear Information System (INIS)

    Bugel, Sean M.; Bonventre, Josephine A.; White, Lori A.; Tanguay, Robert L.; Cooper, Keith R.

    2014-01-01

    Highlights: • Reproductive biomarker genes in Newark Bay killifish are desensitized to estrogen. • Gene desensitization indicates pre-transcriptional effects on estrogen signaling. • Desensitization does not have a metabolic or epigenetic basis (gene methylation). • Modulation of vitellogenin and choriogenin genes correlates with reproductive impacts. • Choriogenin L appears less prone to false negatives and may be a sensitive biomarker. - Abstract: Reproductive and endocrine disruption is commonly reported in aquatic species exposed to complex contaminant mixtures. We previously reported that Atlantic killifish (Fundulus heteroclitus) from the chronically contaminated Newark Bay, NJ, exhibit multiple endocrine disrupting effects, including inhibition of vitellogenesis (yolk protein synthesis) in females and false negative vitellogenin biomarker responses in males. Here, we characterized the effects on estrogen signaling and the transcriptional regulation of estrogen-responsive genes in this model population. First, a dose–response study tested the hypothesis that reproductive biomarkers (vtg1, vtg2, chg H, chg Hm, chg L) in Newark Bay killifish are relatively less sensitive to 17β-estradiol at the transcriptional level, relative to a reference (Tuckerton, NJ) population. The second study assessed expression for various metabolism (cyp1a, cyp3a30, mdr) and estrogen receptor (ER α, ER βa, ER βb) genes under basal and estrogen treatment conditions in both populations. Hepatic metabolism of 17β-estradiol was also evaluated in vitro as an integrated endpoint for adverse effects on metabolism. In the third study, gene methylation was evaluated for promoters of vtg1 (8 CpGs) and vtg2 (10 CpGs) in both populations, and vtg1 promoter sequences were examined for single nucleotide polymorphism (SNPs). Overall, these studies show that multi-chemical exposures at Newark Bay have desensitized all reproductive biomarkers tested to estrogen. For example, at 10 ng

  7. Chronic exposure of killifish to a highly polluted environment desensitizes estrogen-responsive reproductive and biomarker genes

    Energy Technology Data Exchange (ETDEWEB)

    Bugel, Sean M., E-mail: Sean.Bugel@oregonstate.edu [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Bonventre, Josephine A. [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); White, Lori A. [Department of Biochemistry and Microbiology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901 (United States); Tanguay, Robert L. [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Cooper, Keith R. [Department of Biochemistry and Microbiology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901 (United States)

    2014-07-01

    Highlights: • Reproductive biomarker genes in Newark Bay killifish are desensitized to estrogen. • Gene desensitization indicates pre-transcriptional effects on estrogen signaling. • Desensitization does not have a metabolic or epigenetic basis (gene methylation). • Modulation of vitellogenin and choriogenin genes correlates with reproductive impacts. • Choriogenin L appears less prone to false negatives and may be a sensitive biomarker. - Abstract: Reproductive and endocrine disruption is commonly reported in aquatic species exposed to complex contaminant mixtures. We previously reported that Atlantic killifish (Fundulus heteroclitus) from the chronically contaminated Newark Bay, NJ, exhibit multiple endocrine disrupting effects, including inhibition of vitellogenesis (yolk protein synthesis) in females and false negative vitellogenin biomarker responses in males. Here, we characterized the effects on estrogen signaling and the transcriptional regulation of estrogen-responsive genes in this model population. First, a dose–response study tested the hypothesis that reproductive biomarkers (vtg1, vtg2, chg H, chg Hm, chg L) in Newark Bay killifish are relatively less sensitive to 17β-estradiol at the transcriptional level, relative to a reference (Tuckerton, NJ) population. The second study assessed expression for various metabolism (cyp1a, cyp3a30, mdr) and estrogen receptor (ER α, ER βa, ER βb) genes under basal and estrogen treatment conditions in both populations. Hepatic metabolism of 17β-estradiol was also evaluated in vitro as an integrated endpoint for adverse effects on metabolism. In the third study, gene methylation was evaluated for promoters of vtg1 (8 CpGs) and vtg2 (10 CpGs) in both populations, and vtg1 promoter sequences were examined for single nucleotide polymorphism (SNPs). Overall, these studies show that multi-chemical exposures at Newark Bay have desensitized all reproductive biomarkers tested to estrogen. For example, at 10 ng

  8. PAK1 translocates into nucleus in response to prolactin but not to estrogen

    Energy Technology Data Exchange (ETDEWEB)

    Oladimeji, Peter, E-mail: Peter.Oladimeji@rockets.utoledo.edu; Diakonova, Maria, E-mail: mdiakon@utnet.utoledo.edu

    2016-04-22

    Tyrosyl phosphorylation of the p21-activated serine–threonine kinase 1 (PAK1) has an essential role in regulating PAK1 functions in breast cancer cells. We previously demonstrated that PAK1 serves as a common node for estrogen (E2)- and prolactin (PRL)-dependent pathways. We hypothesize herein that intracellular localization of PAK1 is affected by PRL and E2 treatments differently. We demonstrate by immunocytochemical analysis that PAK1 nuclear translocation is ligand-dependent: only PRL but not E2 stimulated PAK1 nuclear translocation. Tyrosyl phosphorylation of PAK1 is essential for this nuclear translocation because phospho-tyrosyl-deficient PAK1 Y3F mutant is retained in the cytoplasm in response to PRL. We confirmed these data by Western blot analysis of subcellular fractions. In 30 min of PRL treatment, only 48% of pTyr-PAK1 is retained in the cytoplasm of PAK1 WT clone while 52% re-distributes into the nucleus and pTyr-PAK1 shuttles back to the cytoplasm by 60 min of PRL treatment. In contrast, PAK1 Y3F is retained in the cytoplasm. E2 treatment causes nuclear translocation of neither PAK1 WT nor PAK1 Y3F. Finally, we show by an in vitro kinase assay that PRL but not E2 stimulates PAK1 kinase activity in the nuclear fraction. Thus, PAK1 nuclear translocation is ligand-dependent: PRL activates PAK1 and induces translocation of activated pTyr-PAK1 into nucleus while E2 activates pTyr-PAK1 only in the cytoplasm. - Highlights: • Prolactin but not estrogen causes translocation of PAK1 into nucleus. • Tyrosyl phosphorylation of PAK1 is required for nuclear localization. • Prolactin but not estrogen stimulates PAK1 kinase activity in nucleus.

  9. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  10. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  11. Using NMR metabolomics to identify responses of an environmental estrogen in blood plasma of fish

    International Nuclear Information System (INIS)

    Samuelsson, Linda M.; Foerlin, Lars; Karlsson, Goeran; Adolfsson-Erici, Margaretha; Larsson, D.G. Joakim

    2006-01-01

    Nuclear magnetic resonance (NMR) based metabolomics in combination with multivariate data analysis may become valuable tools to study environmental effects of pharmaceuticals and other chemicals in aquatic organisms. To explore the usefulness of this approach in fish, we have used 1 H NMR metabolomics to compare blood plasma and plasma lipid extracts from rainbow trout exposed to the synthetic contraceptive estrogen ethinylestradiol (EE 2 ) with plasma from control fish. The plasma metabolite profile was affected in fish exposed to 10 ng/L but not 0.87 ng/L of EE 2 , which was in agreement with an induced vitellogenin synthesis in the high dose group only, as measured by ELISA. The main affected metabolites were vitellogenin, alanine, phospholipids and cholesterol. The responses identified by this discovery-driven method could be put in context with previous knowledge of the effects of estrogens on fish. This adds confidence to the approach of using NMR metabolomics to identify environmental effects of pharmaceuticals and other contaminants

  12. Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on estrogenic responses

    Energy Technology Data Exchange (ETDEWEB)

    Romkes, M.

    1988-01-01

    The competitive receptor binding affinities of thirteen 2-substituted-3,7,8-trichlorodibenzo-p-dioxins to hepatic cytosol from rat, mouse, guinea pig and hamster were determined using ({sup 3}H)-2,3,7,8-tetrachlorodibenzo-p-dioxin (2,3,7,8-TCDD) as the radio-ligand. Significant species-dependent structural differences in the Ah receptor ligand binding site were observed and support the heterologous nature of the receptor protein. The interactions of 2,3,7,8-TCDD and estrogenic responses in the female rat and human breast cancer cells were also investigated. Cotreatment of 25-day-old female Long Evans rats with 20 or 80 ug/kg of 2,3,7,8-TCDD resulted in a dose-dependent decrease in both uterine and hepatic estrogen receptor (ER) levels. Moreover, these levels are decreased for at least ten days and appear to be related to the tissue persistence of 2,3,7,8-TCDD. In contrast, estradiol elevated uterine and hepatic ER levels and increased uterine wet weights. Cotreatment of the rats with 2,3,7,8-TCDD and estradiol resulted in hepatic and uterine ER levels which were comparable to those observed in the control rats; in addition, 2,3,7,8-TCDD also antagonized the effects of estradiol-induced uterine wet weights.

  13. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  14. Estrogen enhances mismatch repair by induction of MLH1 expression via estrogen receptor-β.

    Science.gov (United States)

    Lu, Jun-Yu; Jin, Peng; Gao, Wei; Wang, De-Zhi; Sheng, Jian-Qiu

    2017-06-13

    Epidemiological data demonstrated that hormone replace treatment has protective effect against colorectal cancer (CRC). Our previous studies showed that this effect may be associated with DNA mismatch repair. This study aims to investigate the mechanism of estrogen induction of MLH1, and whether colorectal tumor proliferation can be inhibited through induction of MLH1 by estrogen signal pathway. Human CRC cell lines were used to examine the regulation of MLH1 expression by over-expression and depletion of estrogen receptor-α (ERα) and estrogen receptor-β (ERβ), under the treatment with 17β-estradiol or β-Estradiol 6-(O-carboxy-methyl)oxime:BSA, followed by a real-time Q-PCR and Western blotting analysis. Luciferase reporter and chromatin immunoprecipitation assays were used to identify the estrogen response elements in the proximal promoter of MLH1 gene. Then, the influence of estrogen-induced MLH1 on CRC tumor growth were determined in vitro and in vivo. We found that mismatch repair ability and microsatellite stability of cells were enhanced by estrogen via induction of MLH1 expression, which was mediated by ERβ, through a transcriptional activation process. Furthermore, we identified that ERβ exerted an inhibitory effect on CRC tumor proliferation in vitro and in vivo, combined with 5-FU, through up-regulation of MLH1 expression. Finally, we concluded that estrogen enhances mismatch repair ability and tumor inhibition effect in vitro and in vivo, via induction of MLH1 expression mediated by ERβ.

  15. Estrogen-Responsive Genes Overlap with Triiodothyronine-Responsive Genes in a Breast Carcinoma Cell Line

    Directory of Open Access Journals (Sweden)

    Nancy Bueno Figueiredo

    2014-01-01

    Full Text Available It has been well established that estrogen plays an important role in the progression and treatment of breast cancer. However, the role of triiodothyronine (T3 remains controversial. We have previously shown its capacity to stimulate the development of positive estrogen receptor breast carcinoma, induce the expression of genes (PR, TGF-alpha normally stimulated by estradiol (E2, and suppress genes (TGF-beta normally inhibited by E2. Since T3 regulates growth hormones, metabolism, and differentiation, it is important to verify its action on other genes normally induced by E2. Therefore, we used DNA microarrays to compare gene expression patterns in MCF-7 breast adenocarcinoma cells treated with E2 and T3. Several genes were modulated by both E2 and T3 in MCF-7 cells (Student’s t-test, P 2.0, pFDR < 0.05. We confirmed our microarray results by real-time PCR. Our findings reveal that certain genes in MCF-7 cells can be regulated by both E2 and T3.

  16. Resveratrol modulates the inflammatory response via an estrogen receptor-signal integration network

    Science.gov (United States)

    Nwachukwu, Jerome C; Srinivasan, Sathish; Bruno, Nelson E; Parent, Alexander A; Hughes, Travis S; Pollock, Julie A; Gjyshi, Olsi; Cavett, Valerie; Nowak, Jason; Garcia-Ordonez, Ruben D; Houtman, René; Griffin, Patrick R; Kojetin, Douglas J; Katzenellenbogen, John A; Conkright, Michael D; Nettles, Kendall W

    2014-01-01

    Resveratrol has beneficial effects on aging, inflammation and metabolism, which are thought to result from activation of the lysine deacetylase, sirtuin 1 (SIRT1), the cAMP pathway, or AMP-activated protein kinase. In this study, we report that resveratrol acts as a pathway-selective estrogen receptor-α (ERα) ligand to modulate the inflammatory response but not cell proliferation. A crystal structure of the ERα ligand-binding domain (LBD) as a complex with resveratrol revealed a unique perturbation of the coactivator-binding surface, consistent with an altered coregulator recruitment profile. Gene expression analyses revealed significant overlap of TNFα genes modulated by resveratrol and estradiol. Furthermore, the ability of resveratrol to suppress interleukin-6 transcription was shown to require ERα and several ERα coregulators, suggesting that ERα functions as a primary conduit for resveratrol activity. DOI: http://dx.doi.org/10.7554/eLife.02057.001 PMID:24771768

  17. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  18. Fertility of Tall Girls Treated with High-Dose Estrogen, a Dose-Response Relationship

    NARCIS (Netherlands)

    Hendriks, A. E. J.; Drop, S. L. S.; Laven, J. S. E.; Boot, A. M.

    Context: High-dose estrogen treatment to reduce final height of tall girls increases their risk for infertility in later life. Objective: The aim was to study the effect of estrogen dose on fertility outcome of these women. Design/Setting: We conducted a retrospective cohort study of university

  19. Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

    Science.gov (United States)

    Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

    1999-01-01

    The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

  20. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  1. Identifying a Mechanism for Crosstalk Between the Estrogen and Glucocorticoid Receptors | Center for Cancer Research

    Science.gov (United States)

    Estrogen has long been known to play important roles in the development and progression of breast cancer. Its receptor (ER), a member of the steroid receptor family, binds to estrogen response elements (EREs) in DNA and regulates gene transcription. More recently, another steroid receptor family member, the glucocorticoid receptor (GR), has been implicated in breast cancer

  2. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    Science.gov (United States)

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the

  3. Estrogens in breast cancer

    International Nuclear Information System (INIS)

    Terzieff, V.; Vázquez, A.

    2004-01-01

    The prolonged exposure to estrogen increases the risk of cancer breast, the precise role of estrogen in the carcinogenesis process is unclear. They are capable of inducing cell proliferation through different channels receptor Estrogen (ER) known, for example through MAPkinasa sensitivity the promoter of proliferation effect depends on the level of RE, or type to â, integrity (mutations may alter its function) and ligand. The different types of estrogens and related compounds have different profile of affinity for RE and effect end. The modulatory role of progestogens proliferation is very complex, and the interaction between the effector pathways of progestin’s, estrogens, EGF and IGF family - maybe others - determines the final effect .. Estrogens are mutagenic per se weak, but is now known for its hepatic metabolism occur highly reactive species such as quinones, and catechol, powerful mutagens in vitro. Direct or indirect genotoxicity probably explains Part of the effects of estrogen on tumor cells. The use of hormone replacement (HTR) increases the risk of CM, as proportional to the time of use. The combination with progestin seems to be increased risk (R R 2). It is unclear the role of phyto estrogens in the prevention the CM. In the male breast is known that the proliferative response to parenchymal different hormonal maneuvers is different. The effect is minimal castration are and maximum with the combination of estrogen and progesterone. It is unclear, however, the risk of the population exposed to hormone therapy for cancer prostate or otherwise

  4. Mechanism of estrogen activation of c-myc oncogene expression.

    Science.gov (United States)

    Dubik, D; Shiu, R P

    1992-08-01

    The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.

  5. Increased cell survival by inhibition of BRCA1 using an antisense approach in an estrogen responsive ovarian carcinoma cell line

    International Nuclear Information System (INIS)

    Annab, Lois A; Hawkins, Rebecca E; Solomon, Greg; Barrett, J Carl; Afshari, Cynthia A

    2000-01-01

    phosphoprotein that is regulated in response to DNA damaging agents [5,6,7] and in response to estrogen-induced growth [8,9,10,11]. Germline mutations that cause breast and ovarian cancer predisposition frequently result in truncated and presumably inactive BRCA1 protein [12]. BG-1 cells were derived from a patient with stage III, poorly differentiated ovarian adenocarcinoma [13]. This cell line, which expresses wild-type BRCA1, is estrogen responsive and withdrawal of estrogen results in eventual cell death. Previous studies suggest that BRCA1 is stimulated as a result of estrogen treatment [8,9,10,11], and also that BRCA1 may be involved in the cell death process [14]. Therefore, we examined the effect of reduction of BRCA1 levels in BG-1 cells on the cellular response to hormone depletion as well as estrogen stimulation. The results suggest that reduced levels of BRCA1 correlates with a survival advantage when BG-1 cells are placed under growth-restrictive and hormone-depleted conditions. In optimum growth conditions, significantly reduced levels of BRCA1 correlates with enhanced growth both in vitro and in vivo. To test the hypothesis that BRCA1 may play a role in the regulation of ovarian tumor cell death as well as in the inhibition of ovarian cell proliferation. The estrogen receptor-positive, BG-1 cell line [13], which contains an abundant amount of estrogen receptors (600 fmoles/100 μg DNA), was infected using a pLXSN retroviral vector (provided by AD Miller) containing an inverted partial human cDNA 900-base-pair sequence of BRCA1 (from nucleotide 121 in exon 1 to nucleotide 1025 in exon 11, accession #U14680). After 2 weeks of selection in 800 μg/ml of geneticin-G418 (Gibco/Life Technologies, Gaithersburg, MD, USA), BG-1 G418-resistant colonies were pooled, or individually isolated, and assayed for growth in the presence or absence of supplemented estrogen. Virally infected pooled populations of BG-1 cells were examined for BRCA1 message levels by ribonuclease

  6. Regulation of DNA Damage Response by Estrogen Receptor β-Mediated Inhibition of Breast Cancer Associated Gene 2

    Directory of Open Access Journals (Sweden)

    Yuan-Hao Lee

    2015-04-01

    Full Text Available Accumulating evidence suggests that ubiquitin E3 ligases are involved in cancer development as their mutations correlate with genomic instability and genetic susceptibility to cancer. Despite significant findings of cancer-driving mutations in the BRCA1 gene, estrogen receptor (ER-positive breast cancers progress upon treatment with DNA damaging-cytotoxic therapies. In order to understand the underlying mechanism by which ER-positive breast cancer cells develop resistance to DNA damaging agents, we employed an estrogen receptor agonist, Erb-041, to increase the activity of ERβ and negatively regulate the expression and function of the estrogen receptor α (ERα in MCF-7 breast cancer cells. Upon Erb-041-mediated ERα down-regulation, the transcription of an ERα downstream effector, BCA2 (Breast Cancer Associated gene 2, correspondingly decreased. The ubiquitination of chromatin-bound BCA2 was induced by ultraviolet C (UVC irradiation but suppressed by Erb-041 pretreatment, resulting in a blunted DNA damage response. Upon BCA2 silencing, DNA double-stranded breaks increased with Rad51 up-regulation and ataxia telangiectasia mutated (ATM activation. Mechanistically, UV-induced BCA2 ubiquitination and chromatin binding were found to promote DNA damage response and repair via the interaction of BCA2 with ATM, γH2AX and Rad51. Taken together, this study suggests that Erb-041 potentiates BCA2 dissociation from chromatin and co-localization with Rad51, resulting in inhibition of homologous recombination repair.

  7. Estrogen binding, receptor mRNA, and biologic response in osteoblast-like osteosarcoma cells

    International Nuclear Information System (INIS)

    Komm, B.S.; Terpening, C.M.; Benz, D.J.; Graeme, K.A.; Gallegos, A.; Korc, M.; Greene, G.L.; O'Malley, B.W.; Haussler, M.R.

    1988-01-01

    High specific activity estradiol labeled with iodine-125 was used to detect approximately 200 saturable, high-affinity (dissociation constant approximately equal to 1.0 nM) nuclear binding sites in rat (ROS 17/2.8) and human (HOS TE85) clonal osteoblast-like osteosarcoma cells. Of the steroids tested, only testosterone exhibited significant cross-reactivity with estrogen binding. RNA blot analysis with a complementary DNA probe to the human estrogen receptor revealed putative receptor transcripts of 6 to 6.2 kilobases in both rat and human osteosarcoma cells. Type I procollagen and transforming growth factor-beta messenger RNA levels were enhanced in cultured human osteoblast-like cells treated with 1 nM estradiol. Thus, estrogen can act directly on osteoblasts by a receptor-mediated mechanism and thereby modulate the extracellular matrix and other proteins involved in the maintenance of skeletal mineralization and remodeling

  8. Discovery of estrogen receptor α modulators from natural compounds in Si-Wu-Tang series decoctions using estrogen-responsive MCF-7 breast cancer cells.

    Science.gov (United States)

    Liu, Li; Ma, Hongyue; Tang, Yuping; Chen, Wenxing; Lu, Yin; Guo, Jianming; Duan, Jin-Ao

    2012-01-01

    The binding between the estrogen receptor α (ER-α) and a variety of compounds in traditional Chinese formulae, Si-Wu-Tang (SWT) series decoctions, was studied using a stably-transfected human breast cancer cell line (MVLN). In 38 compounds tested from SWT series decoctions, the estrogen-like activity of 22 compounds was above 60% in 20 μg mL(-1). Furthermore, theoretical affinity of these compounds was certificated using the functional virtual screen of ER-α modulators by FlexX-Pharm. The accuracy of functional virtual screening of ER-α modulators could reach to 77.27%. The results showed that some compounds, such as organic acids and flavones in SWT series decoctions could be used as selective estrogen receptor modulators (SERMs) and could be selected for further development as potential agents for estrogen related diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Probiotic lactobacillus and estrogen effects on vaginal epithelial gene expression responses to Candida albicans.

    Science.gov (United States)

    Wagner, R Doug; Johnson, Shemedia J

    2012-06-20

    Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic

  10. Evaluation of Estrogenic Activity of Licorice Species in Comparison with Hops Used in Botanicals for Menopausal Symptoms

    Science.gov (United States)

    Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

    2013-01-01

    The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical

  11. Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

    Directory of Open Access Journals (Sweden)

    Atieh Hajirahimkhan

    Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

  12. In situ aromatase expression in primary tumor is associated with estrogen receptor expression but is not predictive of response to endocrine therapy in advanced breast cancer

    DEFF Research Database (Denmark)

    Lykkesfeldt, Anne E; Henriksen, Katrine L; Rasmussen, Birgitte B

    2009-01-01

    BACKGROUND: New, third-generation aromatase inhibitors (AIs) have proven comparable or superior to the anti-estrogen tamoxifen for treatment of estrogen receptor (ER) and/or progesterone receptor (PR) positive breast cancer. AIs suppress total body and intratumoral estrogen levels. It is unclear...... whether in situ carcinoma cell aromatization is the primary source of estrogen production for tumor growth and whether the aromatase expression is predictive of response to endocrine therapy. Due to methodological difficulties in the determination of the aromatase protein, COX-2, an enzyme involved...... of advanced breast cancer. Semi-quantitative immunohistochemical (IHC) analysis was performed for ER, PR, COX-2 and aromatase using Tissue Microarrays (TMAs). Aromatase was also analyzed using whole sections (WS). Kappa analysis was applied to compare association of protein expression levels. Univariate...

  13. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  14. Prolactin-sensitive neurons express estrogen receptor-α and depend on sex hormones for normal responsiveness to prolactin.

    Science.gov (United States)

    Furigo, Isadora C; Kim, Ki Woo; Nagaishi, Vanessa S; Ramos-Lobo, Angela M; de Alencar, Amanda; Pedroso, João A B; Metzger, Martin; Donato, Jose

    2014-05-30

    Estrogens and prolactin share important target tissues, including the gonads, brain, liver, kidneys and some types of cancer cells. Herein, we sought anatomical and functional evidence of possible crosstalk between prolactin and estrogens in the mouse brain. First, we determined the distribution of prolactin-responsive neurons that express the estrogen receptor α (ERα). A large number of prolactin-induced pSTAT5-immunoreactive neurons expressing ERα mRNA were observed in several brain areas, including the anteroventral periventricular nucleus, medial preoptic nucleus, arcuate nucleus of the hypothalamus, ventrolateral subdivision of the ventromedial nucleus of the hypothalamus (VMH), medial nucleus of the amygdala and nucleus of the solitary tract. However, although the medial preoptic area, periventricular nucleus of the hypothalamus, paraventricular nucleus of the hypothalamus, retrochiasmatic area, dorsomedial subdivision of the VMH, lateral hypothalamic area, dorsomedial nucleus of the hypothalamus and ventral premammillary nucleus contained significant numbers of prolactin-responsive neurons, these areas showed very few pSTAT5-immunoreactive cells expressing ERα mRNA. Second, we evaluated prolactin sensitivity in ovariectomized mice and observed that sex hormones are required for a normal responsiveness to prolactin as ovariectomized mice showed a lower number of prolactin-induced pSTAT5 immunoreactive neurons in all analyzed brain nuclei compared to gonad-intact females. In addition, we performed hypothalamic gene expression analyses to determine possible post-ovariectomy changes in components of prolactin signaling. We observed no significant changes in the mRNA expression of prolactin receptor, STAT5a or STAT5b. In summary, sex hormones exert a permissive role in maintaining the brain's prolactin sensitivity, most likely through post-transcriptional mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Identification of estrogen target genes during zebrafish embryonic development through transcriptomic analysis.

    Directory of Open Access Journals (Sweden)

    Ruixin Hao

    Full Text Available Estrogen signaling is important for vertebrate embryonic development. Here we have used zebrafish (Danio rerio as a vertebrate model to analyze estrogen signaling during development. Zebrafish embryos were exposed to 1 µM 17β-estradiol (E2 or vehicle from 3 hours to 4 days post fertilization (dpf, harvested at 1, 2, 3 and 4 dpf, and subjected to RNA extraction for transcriptome analysis using microarrays. Differentially expressed genes by E2-treatment were analyzed with hierarchical clustering followed by biological process and tissue enrichment analysis. Markedly distinct sets of genes were up and down-regulated by E2 at the four different time points. Among these genes, only the well-known estrogenic marker vtg1 was co-regulated at all time points. Despite this, the biological functional categories targeted by E2 were relatively similar throughout zebrafish development. According to knowledge-based tissue enrichment, estrogen responsive genes were clustered mainly in the liver, pancreas and brain. This was in line with the developmental dynamics of estrogen-target tissues that were visualized using transgenic zebrafish containing estrogen responsive elements driving the expression of GFP (Tg(5xERE:GFP. Finally, the identified embryonic estrogen-responsive genes were compared to already published estrogen-responsive genes identified in male adult zebrafish (Gene Expression Omnibus database. The expressions of a few genes were co-regulated by E2 in both embryonic and adult zebrafish. These could potentially be used as estrogenic biomarkers for exposure to estrogens or estrogenic endocrine disruptors in zebrafish. In conclusion, our data suggests that estrogen effects on early embryonic zebrafish development are stage- and tissue- specific.

  16. An Estrogen-Responsive Module in the Ventromedial Hypothalamus Selectively Drives Sex-Specific Activity in Females

    Directory of Open Access Journals (Sweden)

    Stephanie M. Correa

    2015-01-01

    Full Text Available Estrogen-receptor alpha (ERα neurons in the ventrolateral region of the ventromedial hypothalamus (VMHVL control an array of sex-specific responses to maximize reproductive success. In females, these VMHVL neurons are believed to coordinate metabolism and reproduction. However, it remains unknown whether specific neuronal populations control distinct components of this physiological repertoire. Here, we identify a subset of ERα VMHVL neurons that promotes hormone-dependent female locomotion. Activating Nkx2-1-expressing VMHVL neurons via pharmacogenetics elicits a female-specific burst of spontaneous movement, which requires ERα and Tac1 signaling. Disrupting the development of Nkx2-1+ VMHVL neurons results in female-specific obesity, inactivity, and loss of VMHVL neurons coexpressing ERα and Tac1. Unexpectedly, two responses controlled by ERα+ neurons, fertility and brown adipose tissue thermogenesis, are unaffected. We conclude that a dedicated subset of VMHVL neurons marked by ERα, NKX2-1, and Tac1 regulates estrogen-dependent fluctuations in physical activity and constitutes one of several neuroendocrine modules that drive sex-specific responses.

  17. Dietary Aloe vera components' effects on cholesterol lowering and estrogenic responses in juvenile goldfish, Carassius auratus.

    Science.gov (United States)

    Palermo, Francesco A; Cocci, Paolo; Angeletti, Mauro; Felici, Alberto; Polzonetti-Magni, Alberta Maria; Mosconi, Gilberto

    2013-08-01

    Aloes are now considered a very interesting source of bioactive compounds among which phytosterols should play a major role. The present study is an attempt to investigate the hypocholesterolemic activity of Aloe vera associated with its impact on the reproductive status of juvenile goldfish. Therefore, the short- and long-term effects of feeding supplementary diet containing aloe components (20 mg aloe/g diet; 2%) on plasma lipids, plasma vitellogenin, and hepatic estrogen receptor α/β1 mRNA levels in goldfish were examined. Results of GC-MS for phytosterols show high abundance of β-sitosterol in freeze-dried powder of Aloe vera whole leaves. Moreover, a 2% aloe powder dietary supplement was not found estrogenic in juvenile goldfish after either 7- or 30-day treatment, but was consistent in plasma hypocholesterolemic effects following long-term exposure. The present data further support that plasma cholesterol modulation induced by phytosterols may not be related to estrogen-like activity.

  18. Glyphosate induces human breast cancer cells growth via estrogen receptors.

    Science.gov (United States)

    Thongprakaisang, Siriporn; Thiantanawat, Apinya; Rangkadilok, Nuchanart; Suriyo, Tawit; Satayavivad, Jutamaad

    2013-09-01

    Glyphosate is an active ingredient of the most widely used herbicide and it is believed to be less toxic than other pesticides. However, several recent studies showed its potential adverse health effects to humans as it may be an endocrine disruptor. This study focuses on the effects of pure glyphosate on estrogen receptors (ERs) mediated transcriptional activity and their expressions. Glyphosate exerted proliferative effects only in human hormone-dependent breast cancer, T47D cells, but not in hormone-independent breast cancer, MDA-MB231 cells, at 10⁻¹² to 10⁻⁶M in estrogen withdrawal condition. The proliferative concentrations of glyphosate that induced the activation of estrogen response element (ERE) transcription activity were 5-13 fold of control in T47D-KBluc cells and this activation was inhibited by an estrogen antagonist, ICI 182780, indicating that the estrogenic activity of glyphosate was mediated via ERs. Furthermore, glyphosate also altered both ERα and β expression. These results indicated that low and environmentally relevant concentrations of glyphosate possessed estrogenic activity. Glyphosate-based herbicides are widely used for soybean cultivation, and our results also found that there was an additive estrogenic effect between glyphosate and genistein, a phytoestrogen in soybeans. However, these additive effects of glyphosate contamination in soybeans need further animal study. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Assessment of xenoestrogenic exposure by a biomarker approach: application of the E-Screen bioassay to determine estrogenic response of serum extracts

    Directory of Open Access Journals (Sweden)

    Weihe Pal

    2003-10-01

    Full Text Available Abstract Background Epidemiological documentation of endocrine disruption is complicated by imprecise exposure assessment, especially when exposures are mixed. Even if the estrogenic activity of all compounds were known, the combined effect of possible additive and/or inhibiting interaction of xenoestrogens in a biological sample may be difficult to predict from chemical analysis of single compounds alone. Thus, analysis of mixtures allows evaluation of combined effects of chemicals each present at low concentrations. Methods We have developed an optimized in vitro E-Screen test to assess the combined functional estrogenic response of human serum. The xenoestrogens in serum were separated from endogenous steroids and pharmaceuticals by solid-phase extraction followed by fractionation by high-performance liquid chromatography. After dissolution of the isolated fraction in ethanol-DMSO, the reconstituted extract was added with estrogen-depleted fetal calf serum to MCF-7 cells, the growth of which is stimulated by estrogen. After a 6-day incubation on a microwell plate, cell proliferation was assessed and compared with the effect of a 17-beta-estradiol standard. Results and conclusions To determine the applicability of this approach, we assessed the estrogenicity of serum samples from 30 pregnant and 60 non-pregnant Danish women thought to be exposed only to low levels of endocrine disruptors. We also studied 211 serum samples from pregnant Faroese women, whose marine diet included whale blubber that contain a high concentration of persistent halogenated pollutants. The estrogenicity of the serum from Danish controls exceeded the background in 22.7 % of the cases, while the same was true for 68.1 % of the Faroese samples. The increased estrogenicity response did not correlate with the lipid-based concentrations of individual suspected endocrine disruptors in the Faroese samples. When added along with the estradiol standard, an indication of an

  20. Estrogen and the female heart.

    Science.gov (United States)

    Knowlton, A A; Korzick, D H

    2014-05-25

    Estrogen has a plethora of effects in the cardiovascular system. Studies of estrogen and the heart span human clinical trials and basic cell and molecular investigations. Greater understanding of cell and molecular responses to estrogens can provide further insights into the findings of clinical studies. Differences in expression and cellular/intracellular distribution of the two main receptors, estrogen receptor (ER) α and β, are thought to account for the specificity and differences in responses to estrogen. Much remains to be learned in this area, but cellular distribution within the cardiovascular system is becoming clearer. Identification of GPER as a third ER has introduced further complexity to the system. 17β-estradiol (E2), the most potent human estrogen, clearly has protective properties activating a signaling cascade leading to cellular protection and also influencing expression of the protective heat shock proteins (HSP). E2 protects the heart from ischemic injury in basic studies, but the picture is more involved in the whole organism and clinical studies. Here the complexity of E2's widespread effects comes into play and makes interpretation of findings more challenging. Estrogen loss occurs primarily with aging, but few studies have used aged models despite clear evidence of differences between the response to estrogen deficiency in adult and aged animals. Thus more work is needed focusing on the effects of aging vs. estrogen loss on the cardiovascular system. Published by Elsevier Ireland Ltd.

  1. The role of estrogen and progesterone receptors in response rate to megestrol acetate: conservative treatment of stage Ia endometrial adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Yarandi F

    2010-12-01

    Full Text Available "nBackground: Surgery is the most effective treatment of well-differentiated endometrial cancer. But using systemic progestins, have been evaluated to treat the young patients with well-differentiated endometrial cancer who wish to preserve their fertility. The aim of this study was the evaluation of megestrol acetate on endometrial adenocarcino-ma with regard to the receptors."n "nMethods: This was a quasi-experimental study. In 16 infertile patients with stage Ia well-differentiated endometrial adenocarcinoma. The treatment initiated with 160mg/d of megestrol acetate and continued with 320mg/d for non-responsive cases. All of the patients followed with FD&C and hysteroscopy. The responsive patients were referred to IVF group and they were followed for three years."n "nResults: Of nine patient in the first step of the study, 4 (25% became pregnant. Eight patients underwent Total Abdominal Hysterectomy (TAH, and one was retreated conservatively. Of seven patient of second step of the study, five are under treatment at the time of closing the paper (three cases candidate for IVF and two are under 320 mg/d megestrol acetate, one patient is a candidate for hysterectomy, and one exited of study because of male infertility. All of the patients were progesterone receptor positive, and only one was estrogen receptor negative."n "nConclusion: Conservative treatment of early stage well-differentiated endometrial adenocarcinoma with progestins may be used in highly selected young patients who have not completed their family. Close long- term follow up in this special group of patients is necessary. The evaluation of estrogen and progesterone receptors assay may be useful in predicting response to the treatment.

  2. SCA-1 Labels a Subset of Estrogen-Responsive Bipotential Repopulating Cells within the CD24+ CD49fhi Mammary Stem Cell-Enriched Compartment

    Directory of Open Access Journals (Sweden)

    Genevieve V. Dall

    2017-02-01

    Full Text Available Estrogen stimulates breast development during puberty and mammary tumors in adulthood through estrogen receptor-α (ERα. These effects are proposed to occur via ERα+ luminal cells and not the mammary stem cells (MaSCs that are ERαneg. Since ERα+ luminal cells express stem cell antigen-1 (SCA-1, we sought to determine if SCA-1 could define an ERα+ subset of EpCAM+/CD24+/CD49fhi MaSCs. We show that the MaSC population has a distinct SCA-1+ population that is abundant in pre-pubertal mammary glands. The SCA-1+ MaSCs have less stem cell markers and less in vivo repopulating activity than their SCA-1neg counterparts. However, they express ERα and specifically enter the cell cycle at puberty. Using estrogen-deficient aromatase knockouts (ArKO, we showed that the SCA-1+ MaSC could be directly modulated by estrogen supplementation. Thus, SCA-1 enriches for an ERα+, estrogen-sensitive subpopulation within the CD24+/CD49fhi MaSC population that may be responsible for the hormonal sensitivity of the developing mammary gland.

  3. The response to estrogen deprivation on cartilage collagen degradation markers; CTX-II is unique compared to other markers of collagen turnover

    DEFF Research Database (Denmark)

    Bay-Jensen, Anne-Christine; Tabassi, Nadine; Sondergaard, Lene

    2009-01-01

    ABSTRACT: INTRODUCTION: The urinary level of type II collagen degradation marker CTX-II is increased in postmenopausal women and in ovariectomized rats, suggesting that estrogen deprivation induces cartilage breakdown. Here we investigate whether this response to estrogen holds true for other type...... II collagen turnover markers known to be affected in osteoarthritis, and whether it relates to its presence in specific areas of cartilage tissue. METHODS: The type II collagen degradation markers CTX-II and Helix-II were measured in body fluids of pre- and postmenopausal women and of ovariectomized...... rats receiving estrogen or not. Levels of PIIANP, a marker of type II collagen synthesis, were also measured in rats. Rat knee cartilage was analyzed for immunoreactivity of CTX-II and PIIANP and for type II collagen expression. RESULTS: As expected, urinary levels of CTX-II are significantly increased...

  4. A SIMPLE AND RAPID MATRIX-ASSISTED LASER DESORPTION/IONIZATION TIME OF FLIGHT MASS SPECTROMETRY METHOD TO SCREEN FISH PLASMA SAMPLES FOR ESTROGEN-RESPONSIVE BIOMARKERS

    Science.gov (United States)

    In this study, we describe and evaluate the performance of a simple and rapid mass spectral method for screening fish plasma for estrogen-responsive biomarkers using matrix assisted laster desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) couopled with a short...

  5. HIF- and Non-HIF-Regulated Hypoxic Responses Require the Estrogen-Related Receptor in Drosophila melanogaster

    Science.gov (United States)

    Li, Yan; Padmanabha, Divya; Gentile, Luciana B.; Dumur, Catherine I.; Beckstead, Robert B.; Baker, Keith D.

    2013-01-01

    Low-oxygen tolerance is supported by an adaptive response that includes a coordinate shift in metabolism and the activation of a transcriptional program that is driven by the hypoxia-inducible factor (HIF) pathway. The precise contribution of HIF-1a in the adaptive response, however, has not been determined. Here, we investigate how HIF influences hypoxic adaptation throughout Drosophila melanogaster development. We find that hypoxic-induced transcriptional changes are comprised of HIF-dependent and HIF-independent pathways that are distinct and separable. We show that normoxic set-points of carbohydrate metabolites are significantly altered in sima mutants and that these animals are unable to mobilize glycogen in hypoxia. Furthermore, we find that the estrogen-related receptor (dERR), which is a global regulator of aerobic glycolysis in larvae, is required for a competent hypoxic response. dERR binds to dHIFa and participates in the HIF-dependent transcriptional program in hypoxia. In addition, dERR acts in the absence of dHIFa in hypoxia and a significant portion of HIF-independent transcriptional responses can be attributed to dERR actions, including upregulation of glycolytic transcripts. These results indicate that competent hypoxic responses arise from complex interactions between HIF-dependent and -independent mechanisms, and that dERR plays a central role in both of these programs. PMID:23382692

  6. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents

    OpenAIRE

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J. Christopher; Ugarte, Ricardo; Antoniou, Michael N.

    2017-01-01

    The safety, including endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBl...

  7. Effects of alachlor on the early development and induction of estrogen-responsive genes in Medaka, Oryzias latipes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, C.; Ryu, J.; Park, S.Y.; Choi, K.; Jeon, S.H.; Na, J.G.; Rhee, D.G. [National Inst. of Environmental Research, Incheon (Korea)

    2004-09-15

    Alachlor is an acetanilide herbicide used to control annual grasses and weeds in field corn, soybeans, and peanuts. It is a selective systemic herbicide, absorbed by germinating shoots and by roots. Although the specific pathways are not exactly understood, the acetanilide herbicides apparently interfere with several physiological processes including biosynthesis of lipids, proteins and flavonoids. These herbicides are widely used in agriculture and are commonly detected in surface water and groundwater. Alachlor has a relatively low acute toxicity, however, repeated exposure has been reported to cause hepatotoxicity, irreversible uveal degeneration and tumour formation in some animals. Besides alachlor is one of the herbicides reported to have endocrine disrupting effects. 2,4-D, 2,4,5-T, amitrole and atrazine also belong to these types of herbicides. Alachlor is a strongly suspected endocrine disruptor in that it is listed by EPA and the World Wildlife Fund [WWF] as a potential endocrine disrupting chemical. Many mammalian and aquatic toxicological studies with alachlor were performed under the conditions of acute, subacute and chronic experiment. However, not many studies using fish have been carried out with the purpose of screening and testing of endocrine disrupting effects of alachlor. The purpose of this study was to determine the effects of alachlor on the early morphological development of medaka (Oryzias latipes). Embryonic growth, deformation and hatching success were determined to see the effects of this chemical. Also, we tried to measure the estrogenic activity of alachlor using the ELISA and RT-PCR methods. By using these techniques, we evaluated the induction of the estrogen-responsive genes, vitellogenin (precursor of yolk protein) and choriogenin (precursor of egg envelope protein) in male medaka exposed to alachlor.

  8. Estrogen-induced improvement in coronary flow responses during atrial pacing in relation to endothelin-1 levels in postmenopausal women without coronary disease

    Directory of Open Access Journals (Sweden)

    Ioannis Kallikazaros

    2008-06-01

    Full Text Available Ioannis Kallikazaros, Costas Tsioufis, Panagiotis Zambaras, Ioannis Skiadas, Marina Toutouza, Dimitrios Tousoulis, Christodoulos Stefanadis, Pavlos ToutouzasCardiology Department and University Cardiology Clinic, Hippokration Hospital of Athens, GreeceBackground: The cardioprotective role of hormonal replacement therapy remains in doubt, but interest is increasing in the vascular effects of estrogens especially in coronary circulation.Methods: Coronary blood flow (CBF was measured in 24 postmenopausal women (age 55 ± 3 years, whose coronary arteries appeared angiographically normal, during incremental atrial pacing (AP before and 20 minutes after intracoronary administration of either 75 ng/mL 17-β estradiol (treated group, n = 18 or 0.9% saline (controls, n = 6.Results: Before estrogen, no differences in the coronary vasomotor responses at AP between the two groups (p = NS could be detected. After estrogen, in the treated group, at the peak of the second AP, the coronary artery diameter decreased by 0.17 mm (p < 0.005 while the CBF increased by 61 mL/min (p < 0.05. These changes differed significantly from thoseobserved at the peak of first AP (p < 0.001 for both cases. In contrast, in the control group no such changes were observed. The endothelin-1 (ET-1 levels in the coronary sinus were significantly reduced after estrogen infusion, which was negatively correlated with the degree of coronary artery constriction (r = −0.40, p = 0.03 and positively correlated with the increase in CBF (r = 0.54, p = 0.01.Conclusions: In postmenopausal women without coronary artery disease, the intracoronary estrogen infusion mediates a greater increase in CBF and is positively correlated with the reduction of the coronary sinus ET-1 levels at the peak of AP.Keywords: estrogens, coronary blood flow, endothelin-1, coronary interventions

  9. In situ aromatase expression in primary tumor is associated with estrogen receptor expression but is not predictive of response to endocrine therapy in advanced breast cancer

    International Nuclear Information System (INIS)

    Lykkesfeldt, Anne E; Henriksen, Katrine L; Rasmussen, Birgitte B; Sasano, Hironobu; Evans, Dean B; Møller, Susanne; Ejlertsen, Bent; Mouridsen, Henning T

    2009-01-01

    New, third-generation aromatase inhibitors (AIs) have proven comparable or superior to the anti-estrogen tamoxifen for treatment of estrogen receptor (ER) and/or progesterone receptor (PR) positive breast cancer. AIs suppress total body and intratumoral estrogen levels. It is unclear whether in situ carcinoma cell aromatization is the primary source of estrogen production for tumor growth and whether the aromatase expression is predictive of response to endocrine therapy. Due to methodological difficulties in the determination of the aromatase protein, COX-2, an enzyme involved in the synthesis of aromatase, has been suggested as a surrogate marker for aromatase expression. Primary tumor material was retrospectively collected from 88 patients who participated in a randomized clinical trial comparing the AI letrozole to the anti-estrogen tamoxifen for first-line treatment of advanced breast cancer. Semi-quantitative immunohistochemical (IHC) analysis was performed for ER, PR, COX-2 and aromatase using Tissue Microarrays (TMAs). Aromatase was also analyzed using whole sections (WS). Kappa analysis was applied to compare association of protein expression levels. Univariate Wilcoxon analysis and the Cox-analysis were performed to evaluate time to progression (TTP) in relation to marker expression. Aromatase expression was associated with ER, but not with PR or COX-2 expression in carcinoma cells. Measurements of aromatase in WS were not comparable to results from TMAs. Expression of COX-2 and aromatase did not predict response to endocrine therapy. Aromatase in combination with high PR expression may select letrozole treated patients with a longer TTP. TMAs are not suitable for IHC analysis of in situ aromatase expression and we did not find COX-2 expression in carcinoma cells to be a surrogate marker for aromatase. In situ aromatase expression in tumor cells is associated with ER expression and may thus point towards good prognosis. Aromatase expression in cancer

  10. Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.

    Science.gov (United States)

    Liu, Y; Lin, L; Zarnegar, R

    1994-09-01

    Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.

  11. Defective bone formation and anabolic response to exogenous estrogen in mice with targeted disruption of endothelial nitric oxide synthase.

    Science.gov (United States)

    Armour, K E; Armour, K J; Gallagher, M E; Gödecke, A; Helfrich, M H; Reid, D M; Ralston, S H

    2001-02-01

    Nitric oxide (NO) is a pleiotropic signaling molecule that is produced by bone cells constitutively and in response to diverse stimuli such as proinflammatory cytokines, mechanical strain, and sex hormones. Endothelial nitric oxide synthase (eNOS) is the predominant NOS isoform expressed in bone, but its physiological role in regulating bone metabolism remains unclear. Here we studied various aspects of bone metabolism in female mice with targeted disruption of the eNOS gene. Mice with eNOS deficiency (eNOS KO) had reduced bone mineral density, and cortical thinning when compared with WT controls and histomorphometric analysis of bone revealed profound abnormalities of bone formation, with reduced osteoblast numbers, surfaces and mineral apposition rate. Studies in vitro showed that osteoblasts derived from eNOS KO mice had reduced rates of growth when compared with WT and were less well differentiated as reflected by lower levels of alkaline phosphatase activity. Mice with eNOS deficiency lost bone normally following ovariectomy but exhibited a significantly blunted anabolic response to high dose exogenous estrogen. We conclude that the eNOS pathway plays an essential role in regulating bone mass and bone turnover by modulating osteoblast function.

  12. Resumption of menstruation and pituitary response to gonadotropin-releasing hormone in functional hypothalamic amenorrhea subjects undertaking estrogen replacement therapy.

    Science.gov (United States)

    Shen, Z Q; Xu, J J; Lin, J F

    2013-11-01

    Functional hypothalamic amenorrhea (FHA) refers to a functional menstrual disorder with various causes and presentations. Recovery of menstrual cyclicity is common in long-term follow-up but the affecting factors remain unknown. To explore factors affecting the menstrual resumption and to evaluate the pituitary response to gonadotropin-releasing hormone (GnRH) in FHA. Thirty cases with FHA were recruited. All subjects were put on continuous 1 mg/day estradiol valerate orally and followed up monthly. Recovery was defined as the occurrence of at least three consecutive regular cycles. Responder referred to those who recovered within two years of therapy. Gonadotropin response to the 50 μg GnRH challenge was tested every three months. Nineteen (63.3%) subjects recovered with a mean time to recovery of 26.8 months. Time to recovery was negatively correlated with body mass index (BMI) before and by amenorrhea. Twentyone cases had undertaken therapy for more than two years and 10 of them recovered. BMI before and by amenorrhea were negatively correlated with the recovery. Significant increase of serum luteinizing hormone (LH) and LH response to GnRH were noted after recovery. Menstrual resumption was common in FHA undertaking estrogen replacement therapy (ERT). The likelihood of recovery was affected by their BMI before and by amenorrhea but not by the weight gain during therapy. Low serum LH and attenuated LH response to GnRH were the main features of pituitary deficiency in FHA. The menstrual resumption in FHA was accompanied by the recovery of serum LH and the LH response to GnRH.

  13. Impact of Estrogen Therapy on Lymphocyte Homeostasis and the Response to Seasonal Influenza Vaccine in Post-Menopausal Women.

    Directory of Open Access Journals (Sweden)

    Flora Engelmann

    Full Text Available It is widely recognized that changes in levels of ovarian steroids modulate severity of autoimmune disease and immune function in young adult women. These observations suggest that the loss of ovarian steroids associated with menopause could affect the age-related decline in immune function, known as immune senescence. Therefore, in this study, we determined the impact of menopause and estrogen therapy (ET on lymphocyte subset frequency as well as the immune response to seasonal influenza vaccine in three different groups: 1 young adult women (regular menstrual cycles, not on hormonal contraception; 2 post-menopausal (at least 2 years women who are not receiving any form of hormone therapy (HT and 3 post-menopausal hysterectomized women receiving ET. Although the numbers of circulating CD4 and CD20 B cells were reduced in the post-menopausal group receiving ET, we also detected a better preservation of naïve B cells, decreased CD4 T cell inflammatory cytokine production, and slightly lower circulating levels of the pro-inflammatory cytokine IL-6. Following vaccination, young adult women generated more robust antibody and T cell responses than both post-menopausal groups. Despite similar vaccine responses between the two post-menopausal groups, we observed a direct correlation between plasma 17β estradiol (E2 levels and fold increase in IgG titers within the ET group. These findings suggest that ET affects immune homeostasis and that higher plasma E2 levels may enhance humoral responses in post-menopausal women.

  14. Dimethyl sulfoxide is a potent modulator of estrogen receptor isoforms and xenoestrogen biomarker responses in primary culture of salmon hepatocytes

    International Nuclear Information System (INIS)

    Mortensen, Anne S.; Arukwe, Augustine

    2006-01-01

    Dimethyl sulfoxide (DMSO) has been frequently used as carrier solvent in toxicological experiments where the most compelling DMSO attributes are its exceptionally low toxicity and environmental impact. We were inspired by recent and consistent observations that ethanol and DMSO modulate endocrine-disruptor biomarker responses in both in vitro and in vivo studies in our laboratory, to take a critical evaluation of these effects. Quantitative (real-time) polymerase chain reaction (PCR) method with specific primer pairs was used in this study to measure DMSO-induced time-dependent modulation of estrogen receptor (ER) isoforms, vitellogenin (Vtg) and zona radiata-protein (Zr-protein) gene expression patterns in primary culture of salmon hepatocytes. In addition, immunochemical analysis, using indirect enzyme linked immunosorbent assay (ELISA) with monoclonal (Vtg) and polyclonal (Zr-proteins) antibodies was used to detect and measure Vtg and Zr-proteins secreted in culture media. Salmon hepatocytes were isolated by a two-step collagenase perfusion method and exposed to 0.1% or 10 μL/L of DMSO after 48 h pre-culture. Cells were harvested at 12, 24, 48 and 72 h after exposure and analysed for ERα, ERβ, Vtg and Zr-protein gene expression using real-time PCR method. Media samples were collected at similar time-intervals for protein analysis. Our data show that DMSO-induced significant increase in ERα, ERβ, Vtg and Zr-protein genes in a time-dependent manner. Indirect ELISA analysis showed a time-specific effect of DMSO. The use of DMSO as carrier solvent in fish endocrine disruption studies should be re-evaluated. We recommend more investigation, using other endocrine-disruptor biomarkers in order to validate the suitability of common carrier solvents used in toxicology with the aim of setting new maximum allowable concentrations. In particular, given the high sensitivity of genomic approaches in toxicology, these results may have serious consequences for the

  15. Positive association of the hepatic lipase gene polymorphism c.514C > T with estrogen replacement therapy response

    Directory of Open Access Journals (Sweden)

    Pulchinelli Alvaro

    2011-11-01

    Full Text Available Abstract Background Hepatic lipase (HL, an enzyme present in the hepatic sinusoids, is responsible for the lipolysis of lipoproteins. Human HL contains four polymorphic sites: G-250A, T-710C, A-763G, and C-514T single-nucleotide polymorphism (SNPs. The last polymorphism is the focus of the current study. The genotypes associated with the C-514T polymorphism are CC (normal homozygous - W, CT (heterozygous - H, and TT (minor-allele homozygous - M. HL activity is significantly impaired in individuals of the TT and CT genotypes. A total of 58 post-menopausal women were studied. The subjects were hysterectomized women receiving hormone replacement therapy consisting of 0.625 mg of conjugated equine estrogen once a day. The inclusion criteria were menopause of up to three years and normal blood tests, radiographs, cervical-vaginal cytology, and densitometry. DNA was extracted from the buccal and blood cells of all 58 patients using a commercially available kit (GFX® - Amersham-Pharmacia, USA. Results Statistically significant reductions in triglycerides (t = 2.16; n = 58; p = 0.03 but not in total cholesterol (t = 0.14; n = 58; p = 0.89 were found after treatment. This group of good responders were carriers of the T allele; the CT and TT genotypes were present significantly more frequently than in the group of non-responders (p = 0.02 or p = 0.07, respectively. However, no significant difference in HDL-C (t = 0.94; n = 58; p = 0.35 or LDL-C (t = -0.83; n = 58; p = 0.41 was found in these patients. Conclusions The variation in lipid profile associated with the C-514T polymorphism is significant, and the T allele is associated with the best response to ERT.

  16. Development of Androgen- and Estrogen-Responsive bio-assays, members of a panel of human cell line-based highly selective steroid-responsive bioassays

    NARCIS (Netherlands)

    Sonneveld, E.; Jansen, H.J.

    2004-01-01

    We have established highly sensitive and specific androgen and estrogen reporter cell lines which we have named AR (androgen receptor) and ERα (estrogen receptor alpha) CALUX® (Chemically Activated LUciferase eXpression), respectively. Both bioassays are member of a panel of CALUX reporter cell

  17. Development of androgen-and estrogen-responsive bioassays, members of a panel of human cell line-based highly selective steroid-responsive bioassays

    NARCIS (Netherlands)

    Sonneveld, E.; Jansen, H.J..; Riteco, J.A.C.; Brouwer, A.

    2005-01-01

    We have established highly sensitive and specific androgen and estrogen reporter cell lines which we have named AR (androgen receptor) and ERα (estrogen receptor alpha) CALUX® (Chemically Activated LUciferase eXpression), respectively. Both bioassays are member of a panel of CALUX reporter cell

  18. Effect of estrogen receptor-alpha (ESR1 gene polymorphism on high density lipoprotein levels in response to hormone replacement therapy

    Directory of Open Access Journals (Sweden)

    N.C. Nogueira-de-Souza

    2009-12-01

    Full Text Available Studies have shown that estrogen replacement therapy and estrogen plus progestin replacement therapy alter serum levels of total, LDL and HDL cholesterol levels. However, HDL cholesterol levels in women vary considerably in response to hormone replacement therapy (HRT. A significant portion of the variability of these levels has been attributed to genetic factors. Therefore, we investigated the influence of estrogen receptor-alpha (ESR1 gene polymorphisms on HDL levels in response to postmenopausal HRT. We performed a prospective cohort study on 54 postmenopausal women who had not used HRT before the study and had no significant general medical illness. HRT consisted of conjugated equine estrogen and medroxyprogesterone acetate continuously for 1 year. The lipoprotein levels were measured from blood samples taken before the start of therapy and after 1 year of HRT. ESR1 polymorphism (MspI C>T, HaeIII C>T, PvuII C>T, and XbaI A>G frequencies were assayed by restriction fragment length polymorphism. A general linear model was used to describe the relationships between HDL levels and genotypes after adjusting for age. A significant increase in HDL levels was observed after HRT (P = 0.029. Women with the ESR1 PvuII TT genotype showed a statistically significant increase in HDL levels after HRT (P = 0.032. No association was found between other ESR1 polymorphisms and HDL levels. According to our results, the ESR1 PvuII TT genotype was associated with increased levels of HDL after 1 year of HRT.

  19. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  20. High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

    Science.gov (United States)

    Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

    2009-01-01

    Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

  1. Association of estrogen receptor-alpha and vitamin D receptor genotypes with therapeutic response to calcium in postmenopausal Chinese women

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Yue-juan QIN; Qi-ren HUANG; Jin-wei HE; Miao LI; Qi ZHOU; Yun-qiu HU; Yu-juan LIU

    2004-01-01

    AIM: To investigate the correlation between calcium treatment in postmenopausal women and estrogen receptoralpha (ER-alpha) Xba Ⅰ and Pvu Ⅱ genotype and vitamin D receptor (VDR) Apa Ⅰ genotype. METHODS: One hundred fifteen postmenopausal Chinese women of Han population were enrolled and treated with calcichew-D3(1000 mg calcium and 400 U vitamin D3) daily for 1 year. At entry and after 1 year treatment, the bone mineral density (BMD), serum and urinary bone turnover biochemical markers were evaluated. ER-alpha and VDR genotype were analyzed using PCR-restriction fragment length polymorphism. RESULTS: After 1 year of calcium supplementation, a significant increase of BMD and a marked reduction in serum ALP and PTH levels, and a significant increase of serum 25-(OH) vitamin D level were observed (P<0.01 or P<0.05). At entry and after 1 year of treatment, no significant association was found between Xba Ⅰ, Pvu Ⅱ, and Apa Ⅰ genotypes and BMD in L1-4,Neck, and Troch, and all bone turnover marker levels. However, the percentage of change (median, QR) in Neck BMD was significantly different in homozygous XX [-4.14 (from -6.54 to -1.34)] in comparison with Xx [1.72(from -1.12 to 3.20)] (P<0.001) or xx [1.22 (from -1.74 to 3.06)] Xba Ⅰ ER-alpha genotype (P=0.001).CONCLUSION: Women with ER-α Xba Ⅰ genotype XX may have a higher risk of relatively fast bone mass loss in femoral neck after menopause and that they may have a poor responsiveness to calcium supplementation. The changes in BMD are not associated with ER-alpha Pvu Ⅱ genotype and VDR Apa Ⅰ genotype after 1 year of calcium supplementation.

  2. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  3. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  4. Glutamic acid ameliorates estrogen deficiency-induced menopausal-like symptoms in ovariectomized mice.

    Science.gov (United States)

    Han, Na-Ra; Kim, Hee-Yun; Yang, Woong Mo; Jeong, Hyun-Ja; Kim, Hyung-Min

    2015-09-01

    Some amino acids are considered alternative therapies for improving menopausal symptoms. Glutamic acid (GA), which is abundant in meats, fish, and protein-rich plant foods, is known to be a neurotransmitter or precursor of γ-aminobutyric acid. Although it is unclear if GA functions in menopausal symptoms, we hypothesized that GA would attenuate estrogen deficiency-induced menopausal symptoms. The objective to test our hypothesis was to examine an estrogenic effect of GA in ovariectomized (OVX) mice, estrogen receptor (ER)-positive human osteoblast-like MG-63 cells, and ER-positive human breast cancer MCF-7 cells. The results demonstrated that administration with GA to mice suppressed body weight gain and vaginal atrophy when compared with the OVX mice. A microcomputed tomographic analysis of the trabecular bone showed increases in bone mineral density, trabecular number, and connectivity density as well as a significant decrease in total porosity of the OVX mice treated with GA. In addition, GA increased serum levels of alkaline phosphatase and estrogen compared with the OVX mice. Furthermore, GA induced proliferation and increased ER-β messenger RNA (mRNA) expression, estrogen response element (ERE) activity, extracellular signal-regulated kinase phosphorylation, and alkaline phosphatase activity in MG-63 cells. In MCF-7 cells, GA also increased proliferation, Ki-67 mRNA expression, ER-β mRNA expression, and ERE activity. Estrogen response element activity increased by GA was inhibited by an estrogen antagonist. Taken together, our data demonstrated that GA has estrogenic and osteogenic activities in OVX mice, MG-63 cells, and MCF-7 cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Dioxin exerts anti-estrogenic actions in a novel dioxin-responsive telomerase-immortalized epithelial cell line of the porcine oviduct (TERT-OPEC).

    Science.gov (United States)

    Hombach-Klonisch, Sabine; Pocar, Paola; Kauffold, Johannes; Klonisch, Thomas

    2006-04-01

    Oviduct epithelial cells are important for the nourishment and survival of ovulated oocytes and early embryos, and they respond to the steroid hormones estrogen and progesterone. Endocrine-disrupting polyhalogenated aromatic hydrocarbons (PHAH) are environmental toxins that act in part through the ligand-activated transcription factor arylhydrocarbon receptor (AhR; dioxin receptor), and exposure to PHAH has been shown to decrease fertility. To investigate effects of PHAHs on the oviduct epithelium as a potential target tissue of dioxin-type endocrine disruptors, we have established a novel telomerase-immortalized oviduct porcine epithelial cell line (TERT-OPEC). TERT-OPEC exhibited active telomerase and the immunoreactive epithelial marker cytokeratin but lacked the stromal marker vimentin. TERT-OPEC contained functional estrogen receptor (ER)-alpha and AhR, as determined by the detection of ER-alpha- and AhR-specific target molecules. Treatment of TERT-OPEC with the AhR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) resulted in a significant increase in the production of the cytochrome P-450 microsomal enzyme CYP1A1. Activated AhR caused a downregulation of ER nuclear protein fraction and significantly decreased ER-signaling in TERT-OPEC as determined by ERE-luciferase transient transfection assays. In summary, the TCDD-induced and AhR-mediated anti-estrogenic responses by TERT-OPEC suggest that PHAH affect the predominantly estrogen-dependent differentiation of the oviduct epithelium within the fallopian tube. This action then alters the local endocrine milieu, potentially resulting in a largely unexplored cause of impaired embryonic development and female infertility.

  6. The immunologic effects of estrogen on psoriasis: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Melissa Danesh, B.S.

    2015-06-01

    Conclusions: Increased estrogen production in pregnancy is associated with decreased Th1 and Th17 cytokine production. While estrogen may be responsible for some of these immune shifts resulting in disease improvement, there remains no definitive evidence to prove the hypothesis that estrogen is responsible for such improvement.

  7. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  8. Molecular essence and endocrine responsiveness of estrogen receptor-negative, progesterone receptor-positive, and HER2-negative breast cancer.

    Science.gov (United States)

    Yu, Ke-Da; Jiang, Yi-Zhou; Hao, Shuang; Shao, Zhi-Ming

    2015-10-05

    The clinical significance of progesterone receptor (PgR) expression in estrogen receptor-negative (ER-) breast cancer is controversial. Herein, we systemically investigate the clinicopathologic features, molecular essence, and endocrine responsiveness of ER-/PgR+/HER2- phenotype. Four study cohorts were included. The first and second cohorts were from the Surveillance, Epidemiology, and End Results database (n = 67,932) and Fudan University Shanghai Cancer Center (n = 2,338), respectively, for clinicopathologic and survival analysis. The third and fourth cohorts were from two independent publicly available microarray datasets including 837 operable cases and 483 cases undergoing neoadjuvant chemotherapy, respectively, for clinicopathologic and gene-expression analysis. Characterized genes defining subgroups within the ER-/PgR+/HER2- phenotype were determined and further validated. Clinicopathologic features and survival outcomes of the ER-/PgR+ phenotype fell in between the ER+/PgR+ and ER-/PgR- phenotypes, but were more similar to ER-/PgR-. Among the ER-/PgR+ phenotype, 30% (95% confidence interval [CI] 17-42%, pooled by a fixed-effects method) were luminal-like and 59% (95% CI 45-72%, pooled by a fixed-effects method) were basal-like. We further refined the characterized genes for subtypes within the ER-/PgR+ phenotype and developed an immunohistochemistry-based method that could determine the molecular essence of ER-/PgR+ using three markers, TFF1, CK5, and EGFR. Either PAM50-defined or immunohistochemistry-defined basal-like ER-/PgR+ cases have a lower endocrine therapy sensitivity score compared with luminal-like ER-/PgR+ cases (P defined basal-like ER-/PgR+ cases might not benefit from adjuvant endocrine therapy (log-rank P = 0.61 for sufficient versus insufficient endocrine therapy). The majority of ER-/PgR+/HER2- phenotype breast cancers are basal-like and associated with a lower endocrine therapy sensitivity score. Additional studies are needed

  9. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    OpenAIRE

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-01-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and...

  10. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  11. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  12. No substantial changes in estrogen receptor and estrogen-related receptor orthologue gene transcription in Marisa cornuarietis exposed to estrogenic chemicals.

    Science.gov (United States)

    Bannister, Richard; Beresford, Nicola; Granger, David W; Pounds, Nadine A; Rand-Weaver, Mariann; White, Roger; Jobling, Susan; Routledge, Edwin J

    2013-09-15

    Estrogen receptor orthologues in molluscs may be targets for endocrine disruptors, although mechanistic evidence is lacking. Molluscs are reported to be highly susceptible to effects caused by very low concentrations of environmental estrogens which, if substantiated, would have a major impact on the risk assessment of many chemicals. The present paper describes the most thorough evaluation to-date of the susceptibility of Marisa cornuarietis ER and ERR gene transcription to modulation by vertebrate estrogens in vivo and in vitro. We investigated the effects of estradiol-17β and 4-tert-Octylphenol exposure on in vivo estrogen receptor (ER) and estrogen-related receptor (ERR) gene transcription in the reproductive and neural tissues of the gastropod snail M. cornuarietis over a 12-week period. There was no significant effect (p>0.05) of treatment on gene transcription levels between exposed and non-exposed snails. Absence of a direct interaction of estradiol-17β and 4-tert-Octylphenol with mollusc ER and ERR protein was also supported by in vitro studies in transfected HEK-293 cells. Additional in vitro studies with a selection of other potential ligands (including methyl-testosterone, 17α-ethinylestradiol, 4-hydroxytamoxifen, diethylstilbestrol, cyproterone acetate and ICI182780) showed no interaction when tested using this assay. In repeated in vitro tests, however, genistein (with mcER-like) and bisphenol-A (with mcERR) increased reporter gene expression at high concentrations only (>10(-6)M for Gen and >10(-5)M for BPA, respectively). Like vertebrate estrogen receptors, the mollusc ER protein bound to the consensus vertebrate estrogen-response element (ERE). Together, these data provide no substantial evidence that mcER-like and mcERR activation and transcript levels in tissues are modulated by the vertebrate estrogen estradiol-17β or 4-tert-Octylphenol in vivo, or that other ligands of vertebrate ERs and ERRs (with the possible exception of genistein and

  13. No substantial changes in estrogen receptor and estrogen-related receptor orthologue gene transcription in Marisa cornuarietis exposed to estrogenic chemicals☆☆☆

    Science.gov (United States)

    Bannister, Richard; Beresford, Nicola; Granger, David W.; Pounds, Nadine A.; Rand-Weaver, Mariann; White, Roger; Jobling, Susan; Routledge, Edwin J.

    2013-01-01

    Estrogen receptor orthologues in molluscs may be targets for endocrine disruptors, although mechanistic evidence is lacking. Molluscs are reported to be highly susceptible to effects caused by very low concentrations of environmental estrogens which, if substantiated, would have a major impact on the risk assessment of many chemicals. The present paper describes the most thorough evaluation to-date of the susceptibility of Marisa cornuarietis ER and ERR gene transcription to modulation by vertebrate estrogens in vivo and in vitro. We investigated the effects of estradiol-17β and 4-tert-Octylphenol exposure on in vivo estrogen receptor (ER) and estrogen-related receptor (ERR) gene transcription in the reproductive and neural tissues of the gastropod snail M. cornuarietis over a 12-week period. There was no significant effect (p > 0.05) of treatment on gene transcription levels between exposed and non-exposed snails. Absence of a direct interaction of estradiol-17β and 4-tert-Octylphenol with mollusc ER and ERR protein was also supported by in vitro studies in transfected HEK-293 cells. Additional in vitro studies with a selection of other potential ligands (including methyl-testosterone, 17α-ethinylestradiol, 4-hydroxytamoxifen, diethylstilbestrol, cyproterone acetate and ICI182780) showed no interaction when tested using this assay. In repeated in vitro tests, however, genistein (with mcER-like) and bisphenol-A (with mcERR) increased reporter gene expression at high concentrations only (>10−6 M for Gen and >10−5 M for BPA, respectively). Like vertebrate estrogen receptors, the mollusc ER protein bound to the consensus vertebrate estrogen-response element (ERE). Together, these data provide no substantial evidence that mcER-like and mcERR activation and transcript levels in tissues are modulated by the vertebrate estrogen estradiol-17β or 4-tert-Octylphenol in vivo, or that other ligands of vertebrate ERs and ERRs (with the possible exception of

  14. Effects of Estrogen Fluctuation during the Menstrual Cycle on the Response to Stretch-Shortening Exercise in Females

    Directory of Open Access Journals (Sweden)

    Saulė Sipavičienė

    2013-01-01

    Full Text Available The aim of this study was to investigate whether variation in estrogen levels during the menstrual cycle influences susceptibility to exercise-induced muscle damage after stretch-shortening cycle exercise. Physically active women (n=18; age = 20.2 ± 1.7 yr participated in this research. The subjects performed one session of 100 maximal drop jumps on day 1 or 2 of the follicular phase and another identical session on day 1 or 2 of the ovulatory phase; the order of the sessions was randomized. Quadriceps femoris muscle peak torque evoked by electrical stimulation and maximal voluntary contraction, muscle pain, and CK activity were measured before and at various times up to 72 h after exercise. It was found that the high estrogen level during the ovulatory phase might be related to an earlier return to baseline muscle strength after strenuous stretch-shortening cycle exercise in that phase compared with the follicular phase. The estrogen effect appears to be highly specific to the damaged site because the differences in most EIMD markers (CK, soreness, and low-frequency fatigue between the two menstrual cycle phases were small.

  15. Distinct expression of three estrogen receptors in response to bisphenol A and nonylphenol in male Nile tilapias (Oreochromis niloticus).

    Science.gov (United States)

    Huang, Weiren; Zhang, Yong; Jia, Xiaoping; Ma, Xilan; Li, Shuisheng; Liu, Yun; Zhu, Pei; Lu, Danqi; Zhao, Huihong; Luo, Wenna; Yi, Shibai; Liu, Xiaochun; Lin, Haoran

    2010-06-01

    Environmental estrogens, such as bisphenol A (BisA) and nonylphenol (NP), have been shown to affect the estrogen receptor (ER) expression and induce male reproductive abnormalities. To elucidate molecular mechanisms of action of xenoestrogenic chemicals on the expression of estrogen receptors in the testes of Nile tilapia (Oreochromis niloticus), three full-length cDNAs respectively encoding ntERalpha, ntERbeta1 and ntERbeta2 were cloned from testes. The amino acid sequences of ntERalpha, ntERbeta1 and ntERbeta2 showed a high degree of similarity to the relevant fish species. Tissue-specific expression study showed that three receptors were highly expressed in pituitary, liver, testis, kidney and intestine tissues. The ntERalpha, ntERbeta1 and ntERbeta2 mRNA expressions were significantly higher at the sexual early recrudescing stage than at other recrudesced stages. After being exposed to xenoestrogens from weeks 2 to 4, the ntERalpha mRNA levels were increased significantly in testes after NP treatment at all sampling times or after 4 weeks of exposure to BPA. The ntERbeta1 mRNA levels remained unchanged, while a significant decrease of the ntERbeta2 mRNA level was observed in testes after exposure to NP and BPA. The present study demonstrates that the regulation of all three ntER subtypes in testes may act via different molecular mechanisms of exposure to NP and BPA.

  16. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  17. Estrogen receptor-independent catechol estrogen binding activity: protein binding studies in wild-type, Estrogen receptor-alpha KO, and aromatase KO mice tissues.

    Science.gov (United States)

    Philips, Brian J; Ansell, Pete J; Newton, Leslie G; Harada, Nobuhiro; Honda, Shin-Ichiro; Ganjam, Venkataseshu K; Rottinghaus, George E; Welshons, Wade V; Lubahn, Dennis B

    2004-06-01

    Primary evidence for novel estrogen signaling pathways is based upon well-documented estrogenic responses not inhibited by estrogen receptor antagonists. In addition to 17beta-E2, the catechol estrogen 4-hydroxyestradiol (4OHE2) has been shown to elicit biological responses independent of classical estrogen receptors in estrogen receptor-alpha knockout (ERalphaKO) mice. Consequently, our research was designed to biochemically characterize the protein(s) that could be mediating the biological effects of catechol estrogens using enzymatically synthesized, radiolabeled 4-hydroxyestrone (4OHE1) and 4OHE2. Scatchard analyses identified a single class of high-affinity (K(d) approximately 1.6 nM), saturable cytosolic binding sites in several ERalphaKO estrogen-responsive tissues. Specific catechol estrogen binding was competitively inhibited by unlabeled catechol estrogens, but not by 17beta-E2 or the estrogen receptor antagonist ICI 182,780. Tissue distribution studies indicated significant binding differences both within and among various tissues in wild-type, ERalphaKO, and aromatase knockout female mice. Ligand metabolism experiments revealed extensive metabolism of labeled catechol estrogen, suggesting that catechol estrogen metabolites were responsible for the specific binding. Collectively, our data provide compelling evidence for the interaction of catechol estrogen metabolites with a novel binding protein that exhibits high affinity, specificity, and selective tissue distribution. The extensive biochemical characterization of this binding protein indicates that this protein may be a receptor, and thus may mediate ERalpha/beta-independent effects of catechol estrogens and their metabolites.

  18. Developing a Biosensor for Estrogens in Water Samples: Study ofthe Real-time Response of Live Cells of the Estrogen-sensitive YeastStrain RMY/ER-ERE using Fluorescence Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wozei, E.; Hermanowicz, S.W.; Holman, H-Y.N.

    2006-01-01

    Using a fluorescein di-{beta}-d-galactopyranoside (FDG) substrate we show that in live cells of an estrogen-sensitive yeast strain RMY/ER-ERE with human estrogen receptor (ER{alpha}) gene and the lacZ gene which encodes {beta}-galactosidase, the uptake of 17{beta}-estradiol (E2) and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximal enzyme-catalyzed product formation evident after about 30 min of exposure to E2. This finding which agrees with the well-known rates of enzyme-catalyzed reactions could have implications for shortening the duration of environmental sample screening and monitoring regimes using yeast-based estrogen assays, and the development of biosensors for environmental estrogens to complement quantification methods.

  19. Developing a Biosensor for Estrogens in Water Samples: Study ofthe Real-time Response of Live Cells of the Estrogen-sensitive YeastStrain RMY/ER-ERE using Fluorescence Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wozei, E.; Hermanowicz, S.W.; Holman, H-Y.N.

    2005-07-13

    Using a fluorescein di-{beta}-D-galactopyranoside (FDG) substrate we show that in live cells of an estrogen-sensitive yeast strain RMY/ER-ERE with human estrogen receptor (ER{alpha}) gene and the lacZ gene which encodes {beta}-galactosidase, the uptake of 17 {beta}-estradiol (E2) and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximal enzyme-catalyzed product formation evident after about 30 minutes of exposure to E2. This finding which agrees with the well-known rates of enzyme-catalyzed reactions could have implications for shortening the duration of environmental sample screening and monitoring regimes using yeast-based estrogen assays, and the development of biosensors for environmental estrogens to complement quantification methods.

  20. Life history theory and breast cancer risk: methodological and theoretical challenges: Response to "Is estrogen receptor negative breast cancer risk associated with a fast life history strategy?".

    Science.gov (United States)

    Aktipis, Athena

    2016-01-01

    In a meta-analysis published by myself and co-authors, we report differences in the life history risk factors for estrogen receptor negative (ER-) and estrogen receptor positive (ER+) breast cancers. Our meta-analysis did not find the association of ER- breast cancer risk with fast life history characteristics that Hidaka and Boddy suggest in their response to our article. There are a number of possible explanations for the differences between their conclusions and the conclusions we drew from our meta-analysis, including limitations of our meta-analysis and methodological challenges in measuring and categorizing estrogen receptor status. These challenges, along with the association of ER+ breast cancer with slow life history characteristics, may make it challenging to find a clear signal of ER- breast cancer with fast life history characteristics, even if that relationship does exist. The contradictory results regarding breast cancer risk and life history characteristics illustrate a more general challenge in evolutionary medicine: often different sub-theories in evolutionary biology make contradictory predictions about disease risk. In this case, life history models predict that breast cancer risk should increase with faster life history characteristics, while the evolutionary mismatch hypothesis predicts that breast cancer risk should increase with delayed reproduction. Whether life history tradeoffs contribute to ER- breast cancer is still an open question, but current models and several lines of evidence suggest that it is a possibility. © The Author(s) 2016. Published by Oxford University Press on behalf of the Foundation for Evolution, Medicine, and Public Health.

  1. Estrogen, Estrogen Receptor and Lung Cancer

    Directory of Open Access Journals (Sweden)

    Li-Han Hsu

    2017-08-01

    Full Text Available Estrogen has been postulated as a contributor for lung cancer development and progression. We reviewed the current knowledge about the expression and prognostic implications of the estrogen receptors (ER in lung cancer, the effect and signaling pathway of estrogen on lung cancer, the hormone replacement therapy and lung cancer risk and survival, the mechanistic relationship between the ER and the epidermal growth factor receptor (EGFR, and the relevant clinical trials combining the ER antagonist and the EGFR antagonist, to investigate the role of estrogen in lung cancer. Estrogen and its receptor have the potential to become a prognosticator and a therapeutic target in lung cancer. On the other hand, tobacco smoking aggravates the effect of estrogen and endocrine disruptive chemicals from the environment targeting ER may well contribute to the lung carcinogenesis. They have gradually become important issues in the course of preventive medicine.

  2. Estrogenic Activities of Fatty Acids and a Sterol Isolated from Royal Jelly

    Science.gov (United States)

    Isohama, Yoichiro; Maruyama, Hiroe; Yamada, Yayoi; Narita, Yukio; Ohta, Shozo; Araki, Yoko; Miyata, Takeshi; Mishima, Satoshi

    2008-01-01

    We have previously reported that royal jelly (RJ) from honeybees (Apis mellifera) has weak estrogenic activity mediated by interaction with estrogen receptors that leads to changes in gene expression and cell proliferation. In this study, we isolated four compounds from RJ that exhibit estrogenic activity as evaluated by a ligand-binding assay for the estrogen receptor (ER) β. These compounds were identified as 10-hydroxy-trans-2-decenoic acid, 10-hydroxydecanoic acid, trans-2-decenoic acid and 24-methylenecholesterol. All these compounds inhibited binding of 17β-estradiol to ERβ, although more weakly than diethylstilbestrol or phytoestrogens. However, these compounds had little or no effect on the binding of 17β-estradiol to ERα. Expression assays suggested that these compounds activated ER, as evidenced by enhanced transcription of a reporter gene containing an estrogen-responsive element. Treatment of MCF-7 cells with these compounds enhanced their proliferation, but concomitant treatment with tamoxifen blocked this effect. Exposure of immature rats to these compounds by subcutaneous injection induced mild hypertrophy of the luminal epithelium of the uterus, but was not associated with an increase in uterine weight. These findings provide evidence that these compounds contribute to the estrogenic effect of RJ. PMID:18830443

  3. Estrogenic Activities of Fatty Acids and a Sterol Isolated from Royal Jelly

    Directory of Open Access Journals (Sweden)

    Kazu-Michi Suzuki

    2008-01-01

    Full Text Available We have previously reported that royal jelly (RJ from honeybees (Apis mellifera has weak estrogenic activity mediated by interaction with estrogen receptors that leads to changes in gene expression and cell proliferation. In this study, we isolated four compounds from RJ that exhibit estrogenic activity as evaluated by a ligand-binding assay for the estrogen receptor (ER β. These compounds were identified as 10-hydroxy-trans-2-decenoic acid, 10-hydroxydecanoic acid, trans-2-decenoic acid and 24-methylenecholesterol. All these compounds inhibited binding of 17β-estradiol to ERβ, although more weakly than diethylstilbestrol or phytoestrogens. However, these compounds had little or no effect on the binding of 17β-estradiol to ERα. Expression assays suggested that these compounds activated ER, as evidenced by enhanced transcription of a reporter gene containing an estrogen-responsive element. Treatment of MCF-7 cells with these compounds enhanced their proliferation, but concomitant treatment with tamoxifen blocked this effect. Exposure of immature rats to these compounds by subcutaneous injection induced mild hypertrophy of the luminal epithelium of the uterus, but was not associated with an increase in uterine weight. These findings provide evidence that these compounds contribute to the estrogenic effect of RJ.

  4. Assessment of estrogenic activity in some common essential oil constituents.

    Science.gov (United States)

    Howes, M-J R; Houghton, P J; Barlow, D J; Pocock, V J; Milligan, S R

    2002-11-01

    Estrogenic responses have not only been associated with endocrine function, but also with cognitive function. Several studies have indicated that estrogen replacement therapy has favourable effects on cognition, and may have potential in the prevention and treatment of Alzheimer's disease. Thus, ligands for the estrogen receptor, that have a better efficacy and adverse-effect profile than drugs currently available, require investigation. This study was undertaken to investigate the potential estrogenic activity of a number of essential oil constituents. Initially, estrogenic activity was determined by a sensitive and specific bioassay using recombinant yeast cells expressing the human estrogen receptor. At high concentrations, estrogenic activity was detected for citral (geranial and neral), geraniol, nerol and trans-anethole, while eugenol showed anti-estrogenic activity. Molecular graphics studies were undertaken to identify the possible mechanisms for the interaction of geranial, neral, geraniol, nerol and eugenol with the ligand-binding domain of the estrogen alpha-receptor, using the computer program HyperChem. Citral, geraniol, nerol and eugenol were also able to displace [(3)H]17beta-estradiol from isolated alpha- and beta-human estrogen receptors, but none of these compounds showed estrogenic or anti-estrogenic activity in the estrogen-responsive human cell line Ishikawa Var I at levels below their cytotoxic concentrations, and none showed activity in a yeast screen for androgenic and anti-androgenic activity. The potential in-vivo estrogenic effects of citral and geraniol were examined in ovariectomized mice, but neither compound showed any ability to stimulate the characteristic estrogenic responses of uterine hypertrophy or acute increase in uterine vascular permeability. These results show that very high concentrations of some commonly used essential oil constituents appear to have the potential to interact with estrogen receptors, although the

  5. Endoxifen, 4-Hydroxytamoxifen and an Estrogenic Derivative Modulate Estrogen Receptor Complex Mediated Apoptosis in Breast Cancer.

    Science.gov (United States)

    Maximov, Philipp Y; Abderrahman, Balkees; Fanning, Sean W; Sengupta, Surojeet; Fan, Ping; Curpan, Ramona F; Quintana Rincon, Daniela Maria; Greenland, Jeffery A; Rajan, Shyamala S; Greene, Geoffrey L; Jordan, V Craig

    2018-05-08

    Estrogen therapy was used to treat advanced breast cancer in postmenopausal women for decades until the introduction of tamoxifen. Resistance to long-term estrogen deprivation (LTED) with tamoxifen and aromatase inhibitors used as a treatment for breast cancer inevitably occurs, but unexpectedly low dose estrogen can cause regression of breast cancer and increase disease free survival in some patients. This therapeutic effect is attributed to estrogen-induced apoptosis in LTED breast cancer. Here we describe modulation of the estrogen receptor liganded with antiestrogens (endoxifen, 4-hydroxytamoxifen) and an estrogenic triphenylethylene (TPE) EthoxyTPE (EtOXTPE) on estrogen-induced apoptosis in LTED breast cancer cells. Our results show that the angular TPE estrogen (EtOXTPE) is able to induce the ER-mediated apoptosis only at a later time compared to planar estradiol in these cells. Using RT-PCR, ChIP, Western blotting, molecular modelling and X-ray crystallography techniques we report novel conformations of the ER complex with an angular estrogen EtOXTPE and endoxifen. We propose that alteration of the conformation of the ER complexes, with changes in coactivator binding, governs estrogen-induced apoptosis through the PERK sensor system to trigger an Unfolded Protein Response (UPR). The American Society for Pharmacology and Experimental Therapeutics.

  6. Genome-wide identification of estrogen receptor alpha-binding sites in mouse liver

    DEFF Research Database (Denmark)

    Gao, Hui; Fält, Susann; Sandelin, Albin

    2007-01-01

    We report the genome-wide identification of estrogen receptor alpha (ERalpha)-binding regions in mouse liver using a combination of chromatin immunoprecipitation and tiled microarrays that cover all nonrepetitive sequences in the mouse genome. This analysis identified 5568 ERalpha-binding regions...... genes. The majority of ERalpha-binding regions lie in regions that are evolutionarily conserved between human and mouse. Motif-finding algorithms identified the estrogen response element, and variants thereof, together with binding sites for activator protein 1, basic-helix-loop-helix proteins, ETS...... signaling in mouse liver, by characterizing the first step in this signaling cascade, the binding of ERalpha to DNA in intact chromatin....

  7. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  9. Effects of continuous vs. cycling estrogen replacement on the acquisition, retention and expression of place- and response-learning in the open-field tower maze.

    Science.gov (United States)

    Lipatova, Olga; Byrd, Dennis; Green, John T; Toufexis, Donna J

    2014-10-01

    Estrogen has been shown to either enhance or impair learning and memory in female rats. The use of different experimental paradigms or estrogen treatment regimens may contribute to these disparate findings. In order to assess the effect of different estradiol (E2) treatments on several aspects of cognition, we trained ovariectomized female rats with either continuous, cycling, or vehicle E2 replacement, in an open-field tower maze task (OFTM) designed to test reference memory in a low-stress environment. In addition, in order to compare two distinct learning and memory systems, rats were trained to use either a dorsolateral striatum-based response type learning or a hippocampal-based place type learning to solve the maze. Results showed that cyclic, but not continuous, E2 replacement facilitated the acquisition of spatial memory in place-learners. Neither E2 regimen affected acquisition in response-learners. Additionally, when all experimental groups were performing at asymptote, rats were evaluated for performance stability by changing the location of their start position in the OFTM. Both regimens of E2 disrupted the expression of spatial memory in place-learners following the novel start position. However, E2 replacement protected ovariectomized female rats from the disruption of memory expression following a start position change in response-learners. Additionally all experimental groups performed equally well when tested following a 21-day period during which rats were absent from the maze. These results suggest that E2 fluctuation is particularly important in the acquisition of hippocampal-mediated spatial learning, and that hippocampal-based memory may be subject to disruption following environmental change, while striatum-based memory is subject to protection. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. The unique transcriptional response produced by concurrent estrogen and progesterone treatment in breast cancer cells results in upregulation of growth factor pathways and switching from a Luminal A to a Basal-like subtype

    International Nuclear Information System (INIS)

    Need, Eleanor F.; Selth, Luke A.; Trotta, Andrew P.; Leach, Damien A.; Giorgio, Lauren; O’Loughlin, Melissa A.; Smith, Eric; Gill, Peter G.; Ingman, Wendy V.; Graham, J. Dinny; Buchanan, Grant

    2015-01-01

    In breast cancer, progesterone receptor (PR) positivity or abundance is positively associated with survival and treatment response. It was initially believed that PR was a useful diagnostic marker of estrogen receptor activity, but increasingly PR has been recognised to play an important biological role in breast homeostasis, carcinogenesis and metastasis. Although PR expression is almost exclusively observed in estrogen receptor positive tumors, few studies have investigated the cellular mechanisms of PR action in the context of ongoing estrogen signalling. In this study, we contrast PR function in estrogen pretreated ZR-75-1 breast cancer cells with vehicle treated ZR-75-1 and T-47D breast cancer cells using expression microarrays and chromatin immunoprecipitation-sequencing. Estrogen cotreatment caused a dramatic increase in the number of genes regulated by progesterone in ZR-75-1 cells. In T-47D cells that have naturally high levels of PR, estrogen and progesterone cotreatment resulted in a reduction in the number of regulated genes in comparison to treatment with either hormone alone. At a genome level, estrogen pretreatment of ZR-75-1 cells led to a 10-fold increase in the number of PR DNA binding sites detected using ChIP-sequencing. Time course assessment of progesterone regulated genes in the context of estrogen pretreatment highlighted a series of important regulatory pathways, including those driven by epithelial growth factor receptor (EGFR). Importantly, progesterone applied to cells pretreated with estradiol resulted in switching of the PAM50-determined intrinsic breast cancer subtype from Luminal A to Basal-like, and increased the Oncotype DX® Unscaled Recurrence Score. Estrogen pretreatment of breast cancer cells increases PR steady state levels, resulting in an unequivocal progesterone response that upregulates key members of growth factor pathways. The transformative changes progesterone exerts on the breast cancer subtype suggest that these

  11. Potential mechanisms underlying estrogen-induced expression of the molluscan estrogen receptor (ER) gene

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Thi Kim Anh [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Department of Agriculture, Forestry and Fisheries, Vinh University, 182 Le Duan St., Vinh City, Nghe An (Viet Nam); MacFarlane, Geoff R. [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Kong, Richard Yuen Chong [Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region (China); O’Connor, Wayne A. [New South Wales Department of Primary Industries, Port Stephens Fisheries Institute, Taylors Beach, NSW 2316 (Australia); Yu, Richard Man Kit, E-mail: Richard.Yu@newcastle.edu.au [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia)

    2016-10-15

    Highlights: • This is the first report on the putative promoter sequence of a molluscan ER gene. • The gene promoter contains putative binding sites for direct and indirect interaction with ER. • E2 upregulates ER gene expression in the ovary in vitro and in vivo. • E2-induced gene expression may require a novel ligand-dependent receptor. • The ER proximal promoter is hypomethylated regardless of gene expression levels. - Abstract: In vertebrates, estrogens and estrogen mimicking chemicals modulate gene expression mainly through a genomic pathway mediated by the estrogen receptors (ERs). Although the existence of an ER orthologue in the mollusc genome has been known for some time, its role in estrogen signalling has yet to be deciphered. This is largely due to its constitutive (ligand-independent) activation and a limited mechanistic understanding of its regulation. To fill this knowledge gap, we cloned and characterised an ER cDNA (sgER) and the 5′-flanking region of the gene from the Sydney rock oyster Saccostrea glomerata. The sgER cDNA is predicted to encode a 477-amino acid protein that contains a DNA-binding domain (DBD) and a ligand-binding domain (LBD) typically conserved among both vertebrate and invertebrate ERs. A comparison of the sgER LBD sequence with those of other ligand-dependent ERs revealed that the sgER LBD is variable at several conserved residues known to be critical for ligand binding and receptor activation. Ligand binding assays using fluorescent-labelled E2 and purified sgER protein confirmed that sgER is devoid of estrogen binding. In silico analysis of the sgER 5′-flanking sequence indicated the presence of three putative estrogen responsive element (ERE) half-sites and several putative sites for ER-interacting transcription factors, suggesting that the sgER promoter may be autoregulated by its own gene product. sgER mRNA is ubiquitously expressed in adult oyster tissues, with the highest expression found in the ovary

  12. A fase estrogênica altera a resposta do osso e do metabolismo mineral de ratas com hipertireoidismo? Does the estrogenic phase modify the bone and mineral metabolism response in rats under hyperthyroidism?

    Directory of Open Access Journals (Sweden)

    N.M. Ocarino

    2003-08-01

    Full Text Available The effect of the estrogenic phase in the bone and in the mineral metabolism was studied in Wistar adult female rats kept under euthyroidism or hyperthyroidism for 60 days. The rats were divided, according to the stage of the estrous cycle, into four groups: 1 euthyroid (proestrus-estrus, 2 euthyroid (metaestrus-diestrus, 3 hyperthyroid (proestrus-estrus, and 4 hyperthyroid (metaestrus-diestrus. After 60 days the blood plasma was collected and the concentrations of free T4, estradiol, progesterone, calcium, phosphorus, and of alkaline phosphatase were determined. The bones (femur and tibia were analysed microscopically. Despite of the functional state of the thyroid, the levels of estrogen were significantly higher in the proestrus-estrus. The estrogenic phase increased the plasmatic concentration of calcium significantly in the euthyroid rats but it did not alter the levels of phosphorus and alkaline phosphatase. In the hyperthyroid state no significant differences in the plasmatic concentrations of calcium, phosphorus and alkaline phosphatase throughout the cycle were found. The phases of the cycle did not also influence the bone morphology in the euthyroid and hyperthyroid states. It was concluded that the estrogenic phase increases the plasmatic concentration of calcium, even without altering the bone morphology of the euthyroid rats. In addition the estrogenic phase does not increase the plasmatic calcium and it does not modify the response of the bone as well as of the mineral metabolism under effect of the hyperthyroidism.

  13. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  14. Identification of an estrogenic hormone receptor in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Mimoto, Ai; Fujii, Madoka; Usami, Makoto; Shimamura, Maki; Hirabayashi, Naoko; Kaneko, Takako; Sasagawa, Noboru; Ishiura, Shoichi

    2007-01-01

    Changes in both behavior and gene expression occur in Caenorhabditis elegans following exposure to sex hormones such as estrogen and progesterone, and to bisphenol A (BPA), an estrogenic endocrine-disrupting compound. However, only one steroid hormone receptor has been identified. Of the 284 known nuclear hormone receptors (NHRs) in C. elegans, we selected nhr-14, nhr-69, and nhr-121 for analysis as potential estrogenic hormone receptors, because they share sequence similarity with the human estrogen receptor. First, the genes were cloned and expressed in Escherichia coli, and then the affinity of each protein for estrogen was determined using a surface plasmon resonance (SPR) biosensor. All three NHRs bound estrogen in a dose-dependent fashion. To evaluate the specificity of the binding, we performed a solution competition assay using an SPR biosensor. According to our results, only NHR-14 was able to interact with estrogen. Therefore, we next examined whether nhr-14 regulates estrogen signaling in vivo. To investigate whether these interactions actually control the response of C. elegans to hormones, we investigated the expression of vitellogenin, an estrogen responsive gene, in an nhr-14 mutant. Semi-quantitative RT-PCR showed that vitellogenin expression was significantly reduced in the mutant. This suggests that NHR-14 is a C. elegans estrogenic hormone receptor and that it controls gene expression in response to estrogen

  15. A robust high-throughput fungal biosensor assay for the detection of estrogen activity.

    Science.gov (United States)

    Zutz, Christoph; Wagener, Karen; Yankova, Desislava; Eder, Stefanie; Möstl, Erich; Drillich, Marc; Rychli, Kathrin; Wagner, Martin; Strauss, Joseph

    2017-10-01

    Estrogenic active compounds are present in a variety of sources and may alter biological functions in vertebrates. Therefore, it is crucial to develop innovative analytical systems that allow us to screen a broad spectrum of matrices and deliver fast and reliable results. We present the adaptation and validation of a fungal biosensor for the detection of estrogen activity in cow derived samples and tested the clinical applicability for pregnancy diagnosis in 140 mares and 120 cows. As biosensor we used a previously engineered genetically modified strain of the filamentous fungus Aspergillus nidulans, which contains the human estrogen receptor alpha and a reporter construct, in which β-galactosidase gene expression is controlled by an estrogen-responsive-element. The estrogen response of the fungal biosensor was validated with blood, urine, feces, milk and saliva. All matrices were screened for estrogenic activity prior to and after chemical extraction and the results were compared to an enzyme immunoassay (EIA). The biosensor showed consistent results in milk, urine and feces, which were comparable to those of the EIA. In contrast to the EIA, no sample pre-treatment by chemical extraction was needed. For 17β-estradiol, the biosensor showed a limit of detection of 1ng/L. The validation of the biosensor for pregnancy diagnosis revealed a specificity of 100% and a sensitivity of more than 97%. In conclusion, we developed and validated a highly robust fungal biosensor for detection of estrogen activity, which is highly sensitive and economic as it allows analyzing in high-throughput formats without the necessity for organic solvents. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Estrogen receptor alpha regulates expression of the breast cancer 1 associated ring domain 1 (BARD1) gene through intronic DNA sequence.

    Science.gov (United States)

    Creekmore, Amy L; Ziegler, Yvonne S; Bonéy, Jamie L; Nardulli, Ann M

    2007-03-15

    We have used a chromatin immunoprecipitation (ChIP)-based cloning strategy to isolate and identify genes associated with estrogen receptor alpha (ERalpha) in MCF-7 human breast cancer cells. One of the gene regions isolated was a 288bp fragment from the ninth intron of the breast cancer 1 associated ring domain (BARD1) gene. We demonstrated that ERalpha associated with this region of the endogenous BARD 1 gene in MCF-7 cells, that ERalpha bound to three of five ERE half sites located in the 288bp BARD1 region, and that this 288bp BARD1 region conferred estrogen responsiveness to a heterologous promoter. Importantly, treatment of MCF-7 cells with estrogen increased BARD1 mRNA and protein levels. These findings demonstrate that ChIP cloning strategies can be utilized to successfully isolate regulatory regions that are far removed from the transcription start site and assist in identifying cis elements involved in conferring estrogen responsiveness.

  17. A trans-acting enhancer modulates estrogen-mediated transcription of reporter genes in osteoblasts.

    Science.gov (United States)

    Sasaki-Iwaoka, H; Maruyama, K; Endoh, H; Komori, T; Kato, S; Kawashima, H

    1999-02-01

    The presence of bone-specific estrogen agonists and discovery of the osteoblast-specific transcription factor (TF), Cbfa1, together with the discovery of synergism between a TF Pit-1 and estrogen receptor alpha (ERalpha) on rat prolactin gene, led to investigation of Cbfa1 in the modulation of osteoblast-specific actions of estrogen. Reverse transcribed-polymerase chain reaction demonstrated expression of Cbfa1 in the osteoblastic cell lines, MG63, ROS17/2.8, and MC3T3E1, but not in nonosteoblastic cell lines, MCF7, C3H10T1/2, and HeLa. An ER expression vector and a series of luciferase (Luc) reporter plasmids harboring the Cbfa1 binding site OSE2 (the osteoblast-specific cis element in the osteocalcin promoter) and palindromic estrogen response elements (EREs) were cotransfected into both osteoblastic and nonosteoblastic cells. OSE2 worked as a cis- acting element in osteoblastic cells but not nonosteoblastic cells, whereas EREs were cis- acting in all cell lines. Synergistic transactivation was observed in osteoblastic cells only when both ERE and OSE2 were placed in juxtaposition to the promoter. Forced expression of Cbfa1 in C3H10T1/2 cells also induced synergism. Tamoxifen, a partial agonist/antagonist of estrogen, acted as an osteoblast-specific agonist in cells transfected with a promoter containing ERE and acted synergistically with a promoter containing the ERE-OSE2 enhancer combination. These results support the idea that bone-specific TFs modulate the actions of estrogen in a tissue-specific manner.

  18. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  19. 9-cis-retinoic acid represses estrogen-induced expression of the very low density apolipoprotein II gene.

    Science.gov (United States)

    Schippers, I J; Kloppenburg, M; Snippe, L; Ab, G

    1994-11-01

    The chicken very low density apolipoprotein II (apoVLDLII) gene is estrogen-inducible and specifically expressed in liver. We examined the possible involvement of the retinoid X receptor (RXR) and its ligand 9-cis-retinoic acid (9-cis-RA) in the activation of the apoVLDLII promoter. We first concentrated on a potential RXR recognition site, which deviates at only one position from a perfect direct A/GGGTCA repeat spaced by one nucleotide (DR-1) and was earlier identified as a common HNF-4/COUP-TF recognition site. However, band shift analysis revealed that this imperfect DR-1 motif does not interact with RXR alpha-homodimers. In accordance with this observation we found that this regulatory element does not mediate transactivation through RXR alpha in the presence of 9-cis-RA. However, our experiments revealed another, unexpected, effect of 9-cis-RA. Instead of stimulating, 9-cis-RA attenuated estrogen-induced expression of transfected estrogen-responsive VLDL-CAT reporter plasmids. This repression appeared to take place through the main estrogen response element (ERE) of the gene. Importantly, 9-cis-RA also strongly repressed the estrogen-induced expression of the endogenous apoVLDLII gene in cultured chicken hepatoma cells.

  20. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  1. Distinct roles for aryl hydrocarbon receptor nuclear translocator and ah receptor in estrogen-mediated signaling in human cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Mark P Labrecque

    Full Text Available The activated AHR/ARNT complex (AHRC regulates the expression of target genes upon exposure to environmental contaminants such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD. Importantly, evidence has shown that TCDD represses estrogen receptor (ER target gene activation through the AHRC. Our data indicates that AHR and ARNT act independently from each other at non-dioxin response element sites. Therefore, we sought to determine the specific functions of AHR and ARNT in estrogen-dependent signaling in human MCF7 breast cancer and human ECC-1 endometrial carcinoma cells. Knockdown of AHR with siRNA abrogates dioxin-inducible repression of estrogen-dependent gene transcription. Intriguingly, knockdown of ARNT does not effect TCDD-mediated repression of estrogen-regulated transcription, suggesting that AHR represses ER function independently of ARNT. This theory is supported by the ability of the selective AHR modulator 3',4'-dimethoxy-α-naphthoflavone (DiMNF to repress estrogen-inducible transcription. Furthermore, basal and estrogen-activated transcription of the genes encoding cathepsin-D and pS2 are down-regulated in MCF7 cells but up-regulated in ECC-1 cells in response to loss of ARNT. These responses are mirrored at the protein level with cathepsin-D. Furthermore, knock-down of ARNT led to opposite but corresponding changes in estrogen-stimulated proliferation in both MCF7 and ECC-1 cells. We have obtained experimental evidence demonstrating a dioxin-dependent repressor function for AHR and a dioxin-independent co-activator/co-repressor function for ARNT in estrogen signalling. These results provide us with further insight into the mechanisms of transcription factor crosstalk and putative therapeutic targets in estrogen-positive cancers.

  2. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  3. Integrative analysis of deep sequencing data identifies estrogen receptor early response genes and links ATAD3B to poor survival in breast cancer.

    Directory of Open Access Journals (Sweden)

    Kristian Ovaska

    Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.

  4. EMMPRIN-mediated induction of uterine and vascular matrix metalloproteinases during pregnancy and in response to estrogen and progesterone.

    Science.gov (United States)

    Dang, Yiping; Li, Wei; Tran, Victoria; Khalil, Raouf A

    2013-09-15

    Pregnancy is associated with uteroplacental and vascular remodeling in order to adapt for the growing fetus and the hemodynamic changes in the maternal circulation. We have previously shown upregulation of uterine matrix metalloproteinases (MMPs) during pregnancy. Whether pregnancy-associated changes in MMPs are localized to the uterus or are generalized in feto-placental and maternal circulation is unclear. Also, the mechanisms causing the changes in uteroplacental and vascular MMPs during pregnancy are unclear. MMPs expression, activity and tissue distribution were measured in uterus, placenta and aorta of virgin, mid-pregnant (mid-Preg) and late pregnant (late-Preg) rats. Western blots and gelatin zymography revealed increases in MMP-2 and -9 in uterus and aorta of late-Preg compared with virgin and mid-Preg rats. In contrast, MMP-2 and -9 were decreased in placenta of late-Preg versus mid-Preg rats. Extracellular MMP inducer (EMMPRIN) was increased in uterus and aorta of pregnant rats, but was less in placenta of late-Preg than mid-Preg rats. Prolonged treatment of uterus or aorta of virgin rats with 17β-estradiol and progesterone increased the amount of EMMPRIN, MMP-2 and -9, and the sex hormone-induced increases in MMPs were prevented by EMMPRIN neutralizing antibody. Immunohistochemistry revealed that MMP-2 and -9 and EMMPRIN increased in uterus and aorta of pregnant rats, but decreased in placenta of late-Preg versus mid-Preg rats. Thus pregnancy-associated upregulation of uterine MMPs is paralleled by increased vascular MMPs, and both are mediated by EMMPRIN and induced by estrogen and progesterone, suggesting similar role of MMPs in uterine and vascular tissue remodeling and function during pregnancy. The decreased MMPs and EMMPRIN in placenta of late-Preg rats suggests reduced role of MMPs in feto-placental circulation during late pregnancy. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  6. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    Science.gov (United States)

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  7. The role of quantitative estrogen receptor status in predicting tumor response at surgery in breast cancer patients treated with neoadjuvant chemotherapy.

    Science.gov (United States)

    Raphael, Jacques; Gandhi, Sonal; Li, Nim; Lu, Fang-I; Trudeau, Maureen

    2017-07-01

    Estrogen receptor (ER) negative (-) breast cancer (BC) patients have better tumor response rates than ER-positive (+) patients after neoadjuvant chemotherapy (NCT). We conducted a retrospective review using the institutional database "Biomatrix" to assess the value of quantitative ER status in predicting tumor response at surgery and to identify potential predictors of survival outcomes. Univariate followed by multivariable regression analyses were conducted to assess the association between quantitative ER and tumor response assessed as tumor size reduction and pathologic complete response (pCR). Predictors of recurrence-free survival (RFS) were identified using a cox proportional hazards model (CPH). A log-rank test was used to compare RFS between groups if a significant predictor was identified. 304 patients were included with a median follow-up of 43.3 months (Q1-Q3 28.7-61.1) and a mean age of 49.7 years (SD 10.9). Quantitative ER was inversely associated with tumor size reduction and pCR (OR 0.99, 95% CI 0.99-1.00, p = 0.027 and 0.98 95% CI 0.97-0.99, p Quantitative ER status is inversely associated with tumor response in BC patients treated with NCT. A cut-off of 60 and 80% predicts best the association with tumor size reduction and pCR, respectively. Therefore, patients with an ER status higher than the cut-off might benefit from a neoadjuvant endocrine therapy approach. Patients with pCR had better survival outcomes independently of their tumor phenotype. Further prospective studies are needed to validate the clinical utility of quantitative ER as a predictive marker of tumor response.

  8. Low Estrogen Receptor (ER)-Positive Breast Cancer and Neoadjuvant Systemic Chemotherapy: Is Response Similar to Typical ER-Positive or ER-Negative Disease?

    Science.gov (United States)

    Landmann, Alessandra; Farrugia, Daniel J; Zhu, Li; Diego, Emilia J; Johnson, Ronald R; Soran, Atilla; Dabbs, David J; Clark, Beth Z; Puhalla, Shannon L; Jankowitz, Rachel C; Brufsky, Adam M; Ahrendt, Gretchen M; McAuliffe, Priscilla F; Bhargava, Rohit

    2018-05-08

    Pathologic complete response (pCR) rate after neoadjuvant chemotherapy was compared between 141 estrogen receptor (ER)-negative (43%), 41 low ER+ (13%), 47 moderate ER+ (14%), and 98 high ER+ (30%) tumors. Human epidermal growth factor receptor 2-positive cases, cases without semiquantitative ER score, and patients treated with neoadjuvant endocrine therapy alone were excluded. The pCR rate of low ER+ tumors was similar to the pCR rate of ER- tumors (37% and 26% for low ER and ER- respectively, P = .1722) but significantly different from the pCR rate of moderately ER+ (11%, P = .0049) and high ER+ tumors (4%, P < .0001). Patients with pCR had an excellent prognosis regardless of the ER status. In patients with residual disease (no pCR), the recurrence and death rate were higher in ER- and low ER+ cases compared with moderate and high ER+ cases. Low ER+ breast cancers are biologically similar to ER- tumors. Semiquantitative ER H-score is an important determinant of response to neoadjuvant chemotherapy.

  9. Estrogen induced {beta}-1,4-galactosyltransferase 1 expression regulates proliferation of human breast cancer MCF-7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hee-Jung [Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan (Korea, Republic of); Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan-city, Gyeongsangnam-do (Korea, Republic of); Chung, Tae-Wook; Kim, Cheorl-Ho [Department of Molecular and Cellular Glycobiology, College of Natural Science, Sungkyunkwan University, Suwon, Kyungki-do (Korea, Republic of); Jeong, Han-Sol; Joo, Myungsoo [Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan-city, Gyeongsangnam-do (Korea, Republic of); Youn, BuHyun, E-mail: bhyoun72@pusan.ac.kr [Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan (Korea, Republic of); Ha, Ki-Tae, E-mail: hagis@pusan.ac.kr [Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan-city, Gyeongsangnam-do (Korea, Republic of)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer We examined the regulation and biological functions of B4GALT1 expression induced by estrogen. Black-Right-Pointing-Pointer Estrogen-induced B4GALT1 expression through the direct binding of ER-{alpha} to ERE in MCF-7 cells. Black-Right-Pointing-Pointer B4GALT1 expression activates the proliferation of MCF-7 cells via its receptor function. Black-Right-Pointing-Pointer Thus, we suggest B4GALT1 as a molecular target for inhibiting breast cancer proliferation. -- Abstract: Beta 1,4-galactosyltransferase 1 (B4GALT1) synthesizes galactose {beta}-1,4-N-acetylglucosamine (Gal{beta}1-4GlcNAc) groups on N-linked sugar chains of glycoproteins, which play important roles in many biological events, including the proliferation and migration of cancer cells. A previous microarray study reported that this gene is expressed by estrogen treatment in breast cancer. In this study, we examined the regulatory mechanisms and biological functions of estrogen-induced B4GALT1 expression. Our data showed that estrogen-induced expression of B4GALT1 is localized in intracellular compartments and in the plasma membrane. In addition, B4GALT1 has an enzyme activity involved in the production of the Gal{beta}1-4GlcNAc structure. The result from a promoter assay and chromatin immunoprecipitation revealed that 3 different estrogen response elements (EREs) in the B4GALT1 promoter are critical for responsiveness to estrogen. In addition, the estrogen antagonists ICI 182,780 and ER-{alpha}-ERE binding blocker TPBM inhibit the expression of estrogen-induced B4GALT1. However, the inhibition of signal molecules relating to the extra-nuclear pathway, including the G-protein coupled receptors, Ras, and mitogen-activated protein kinases, had no inhibitory effects on B4GALT1 expression. The knock-down of the B4GALT1 gene and the inhibition of membrane B4GALT1 function resulted in the significant inhibition of estrogen-induced proliferation of MCF-7 cells. Considering

  10. Estrogen induced β-1,4-galactosyltransferase 1 expression regulates proliferation of human breast cancer MCF-7 cells

    International Nuclear Information System (INIS)

    Choi, Hee-Jung; Chung, Tae-Wook; Kim, Cheorl-Ho; Jeong, Han-Sol; Joo, Myungsoo; Youn, BuHyun; Ha, Ki-Tae

    2012-01-01

    Highlights: ► We examined the regulation and biological functions of B4GALT1 expression induced by estrogen. ► Estrogen-induced B4GALT1 expression through the direct binding of ER-α to ERE in MCF-7 cells. ► B4GALT1 expression activates the proliferation of MCF-7 cells via its receptor function. ► Thus, we suggest B4GALT1 as a molecular target for inhibiting breast cancer proliferation. -- Abstract: Beta 1,4-galactosyltransferase 1 (B4GALT1) synthesizes galactose β-1,4-N-acetylglucosamine (Galβ1-4GlcNAc) groups on N-linked sugar chains of glycoproteins, which play important roles in many biological events, including the proliferation and migration of cancer cells. A previous microarray study reported that this gene is expressed by estrogen treatment in breast cancer. In this study, we examined the regulatory mechanisms and biological functions of estrogen-induced B4GALT1 expression. Our data showed that estrogen-induced expression of B4GALT1 is localized in intracellular compartments and in the plasma membrane. In addition, B4GALT1 has an enzyme activity involved in the production of the Galβ1-4GlcNAc structure. The result from a promoter assay and chromatin immunoprecipitation revealed that 3 different estrogen response elements (EREs) in the B4GALT1 promoter are critical for responsiveness to estrogen. In addition, the estrogen antagonists ICI 182,780 and ER-α-ERE binding blocker TPBM inhibit the expression of estrogen-induced B4GALT1. However, the inhibition of signal molecules relating to the extra-nuclear pathway, including the G-protein coupled receptors, Ras, and mitogen-activated protein kinases, had no inhibitory effects on B4GALT1 expression. The knock-down of the B4GALT1 gene and the inhibition of membrane B4GALT1 function resulted in the significant inhibition of estrogen-induced proliferation of MCF-7 cells. Considering these results, we propose that estrogen regulates the expression of B4GALT1 through the direct binding of ER-α to ERE and

  11. Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene.

    Science.gov (United States)

    Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad

    2008-10-01

    The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.

  12. Global analysis of estrogen receptor beta binding to breast cancer cell genome reveals an extensive interplay with estrogen receptor alpha for target gene regulation

    Directory of Open Access Journals (Sweden)

    Papa Maria

    2011-01-01

    Full Text Available Abstract Background Estrogen receptors alpha (ERα and beta (ERβ are transcription factors (TFs that mediate estrogen signaling and define the hormone-responsive phenotype of breast cancer (BC. The two receptors can be found co-expressed and play specific, often opposite, roles, with ERβ being able to modulate the effects of ERα on gene transcription and cell proliferation. ERβ is frequently lost in BC, where its presence generally correlates with a better prognosis of the disease. The identification of the genomic targets of ERβ in hormone-responsive BC cells is thus a critical step to elucidate the roles of this receptor in estrogen signaling and tumor cell biology. Results Expression of full-length ERβ in hormone-responsive, ERα-positive MCF-7 cells resulted in a marked reduction in cell proliferation in response to estrogen and marked effects on the cell transcriptome. By ChIP-Seq we identified 9702 ERβ and 6024 ERα binding sites in estrogen-stimulated cells, comprising sites occupied by either ERβ, ERα or both ER subtypes. A search for TF binding matrices revealed that the majority of the binding sites identified comprise one or more Estrogen Response Element and the remaining show binding matrixes for other TFs known to mediate ER interaction with chromatin by tethering, including AP2, E2F and SP1. Of 921 genes differentially regulated by estrogen in ERβ+ vs ERβ- cells, 424 showed one or more ERβ site within 10 kb. These putative primary ERβ target genes control cell proliferation, death, differentiation, motility and adhesion, signal transduction and transcription, key cellular processes that might explain the biological and clinical phenotype of tumors expressing this ER subtype. ERβ binding in close proximity of several miRNA genes and in the mitochondrial genome, suggests the possible involvement of this receptor in small non-coding RNA biogenesis and mitochondrial genome functions. Conclusions Results indicate that the

  13. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  14. Estrogens and Androgens in Skeletal Physiology and Pathophysiology

    OpenAIRE

    Almeida, Maria; Laurent, Michaël R.; Dubois, Vanessa; Claessens, Frank; O'Brien, Charles A.; Bouillon, Roger; Vanderschueren, Dirk; Manolagas, Stavros C.

    2016-01-01

    Estrogens and androgens influence the growth and maintenance of the mammalian skeleton and are responsible for its sexual dimorphism. Estrogen deficiency at menopause or loss of both estrogens and androgens in elderly men contribute to the development of osteoporosis, one of the most common and impactful metabolic diseases of old age. In the last 20 years, basic and clinical research advances, genetic insights from humans and rodents, and newer imaging technologies have changed considerably t...

  15. Estrogenic Activity of Perfluoroalkyl Acids in Juvenile Rainbow Trout (Oncorhynchus Mykiss)

    Science.gov (United States)

    The potential estrogenic activity of perfluoroalkyl acids (PFAAs) was determined using separate screening and dose response studies with juvenile rainbow trout (Oncorhynchus mykiss). Results of this study indicate that some PFAAs may act as estrogens in fish.

  16. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  17. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    Science.gov (United States)

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  18. Estrogen therapy: the dangerous road to Shangri-La.

    Science.gov (United States)

    1976-11-01

    The use of estrogens almost tripled during the 1965-75 period, with usage concentrated as a cure-all for aging, for the degenerative diseases associated with aging, and for the emotional difficulties of middle age. 3 separate studies published in the last year have shown a high level of association between estrogen use and the development of endometrial cancer. Results of these studies coupled with the significant recent increase in the incidence of cancer in women over 50 who are in the high socioeconomic groups--the groups most likely to use estrogen therapy--emphasize the association. The U.S. FDA has proposed a modification in the labeling for estrogens, and a package insert for patients which would warn of possible hazards of estrogen therapy. It is recommended that estrogen be used only for vasomotor symptoms and vaginal atrophy. The lowest possible effective dosage should be used and for the shortest possible amount of time. Earlier studies had suggested that estrogen replacement therapy might protect against breast cancer; most recent studies suggest the opposite. In addition, estrogen may trigger high blood pressure and increase some blood clotting. Women with high blood pressure or a family history of early heart attacks are contraindicated from using estrogen therapy. Even for the treatment of osteoporosis, there may be safer alternative therapies. Women are cautioned as to their own responsibilities when taking estrogens.

  19. Estrogen response of MCF-7 cells grown on diverse substrates and in suspension culture: promotion of morphological heterogeneity, modulation of progestin receptor induction; cell-substrate interactions on collagen gels.

    Science.gov (United States)

    Pourreau-Schneider, N; Berthois, Y; Mittre, H; Charpin, C; Jacquemier, J; Martin, P M

    1984-12-01

    In this study we observed the incidence of hormone sensitivity in the response of MCF-7 cells to estrogen stimulation when the cells were cultured in different contact environments (hydrophilic plastic, bovine corneal extracellular matrix, type I collagen and in suspension culture). The major purpose was to describe the influence of cell to cell and cell to substrate contacts on the morphological response to estrogen treatment. However, other parameters including growth and induction of progestin receptor were also explored, keeping in mind that the MCF-7 cell line, although representative of normal mammary epithelium in that it contains a similar hormone receptivity, was selected in vitro from a metastatic population in a pleural effusion. Although substrate conditions did not modify growth enhancement by estrogens, progestin receptor levels were significantly higher in three-dimensional spheroid cultures in which cell to cell contacts were optimal due to elimination of basal contact. A careful morphological survey of large surfaces lead to an objective opinion of the overall effect of the hormone treatment on the non-cloned cell line in which a marked heterogeneity in the response of individual cells was observed. In terms of morphofunctional differentiation, the edification of acini with dense microvillus coating was best in suspension culture. When sections were made perpendicular to the plane of cultures on collagen gel rafts two other phenomena were noted: decrease in intercellular junctions, resulting in reduced cell to cell cohesion, and accumulation biodegradation products in the collagen lattice. This suggested a hormone-mediated interaction between the metastatic cells and the fibrillar substrate, collagen I, one of the major constituents of tissue stroma. This estrogen response might be related to the metastatic phenotype and must be distinct from their hormone sensitivity in terms of growth and differentiation since hormone receptivity is generally

  20. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  1. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  2. Effect-directed analysis for estrogenic compounds in a fluvial sediment sample using transgenic cyp19a1b-GFP zebrafish embryos.

    Science.gov (United States)

    Fetter, Eva; Krauss, Martin; Brion, François; Kah, Olivier; Scholz, Stefan; Brack, Werner

    2014-09-01

    Xenoestrogens may persist in the environment by binding to sediments or suspended particulate matter serving as long-term reservoir and source of exposure, particularly for organisms living in or in contact with sediments. In this study, we present for the first time an effect-directed analysis (EDA) for identifying estrogenic compounds in a sediment sample using embryos of a transgenic reporter fish strain. In the tg(cyp19a1b-GFP) transgenic zebrafish strain, the expression of GFP (green fluorescent protein) in the brain is driven by an oestrogen responsive element in the promoter of the cyp19a1b (aromatase) gene. The selected sediment sample of the Czech river Bilina had already been analysed in a previous EDA using the yeast oestrogen screening assay and had revealed fractions containing estrogenic compounds. When normal phase HPLC (high performance liquid chromatography) fractionation was used for the separation of the sediment sample, the biotest with transgenic fish embryos revealed two estrogenic fractions. Chemical analysis of candidate compounds in these sediment fractions suggested alkylphenols and estrone as candidate compounds responsible for the observed estrogenic effect. Alkylphenol concentrations could partially explain the estrogenicity of the fractions. However, xenoestrogens below the analytical detection limit or non-targeted estrogenic compounds have probably also contributed to the sample's estrogenic potency. The results indicated the suitability of the tg(cyp19a1b-GFP) fish embryo for an integrated chemical-biological analysis of estrogenic effects. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  4. Editor's Highlight: Transcriptome Profiling Reveals Bisphenol A Alternatives Activate Estrogen Receptor Alpha in Human Breast Cancer Cells.

    Science.gov (United States)

    Mesnage, Robin; Phedonos, Alexia; Arno, Matthew; Balu, Sucharitha; Corton, J Christopher; Antoniou, Michael N

    2017-08-01

    Plasticizers with estrogenic activity, such as bisphenol A (BPA), have potential adverse health effects in humans. Due to mounting evidence of these health effects, BPA is being phased out and replaced by other bisphenol variants in "BPA-free" products. We have compared estrogenic activity of BPA with 6 bisphenol analogues [bisphenol S (BPS); bisphenol F (BPF); bisphenol AP (BPAP); bisphenol AF (BPAF); bisphenol Z (BPZ); bisphenol B (BPB)] in 3 human breast cancer cell lines. Estrogenicity was assessed (10-11-10-4 M) by cell growth in an estrogen receptor (ER)-mediated cell proliferation assay, and by the induction of estrogen response element-mediated transcription in a luciferase assay. BPAF was the most potent bisphenol, followed by BPB > BPZ ∼ BPA > BPF ∼ BPAP > BPS. The addition of ICI 182,780 antagonized the activation of ERs. Data mining of ToxCast high-throughput screening assays confirm our results but also show divergence in the sensitivities of the assays. Gene expression profiles were determined in MCF-7 cells by microarray analysis. The comparison of transcriptome profile alterations resulting from BPA alternatives with an ERα gene expression biomarker further indicates that all BPA alternatives act as ERα agonists in MCF-7 cells. These results were confirmed by Illumina-based RNA sequencing. In conclusion, BPA alternatives are not necessarily less estrogenic than BPA in human breast cancer cells. BPAF, BPB, and BPZ were more estrogenic than BPA. These findings point to the importance of better understanding the risk of adverse effects from exposure to BPA alternatives, including hormone-dependent breast cancer. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology.

  5. Estrogens and Androgens in Skeletal Physiology and Pathophysiology.

    Science.gov (United States)

    Almeida, Maria; Laurent, Michaël R; Dubois, Vanessa; Claessens, Frank; O'Brien, Charles A; Bouillon, Roger; Vanderschueren, Dirk; Manolagas, Stavros C

    2017-01-01

    Estrogens and androgens influence the growth and maintenance of the mammalian skeleton and are responsible for its sexual dimorphism. Estrogen deficiency at menopause or loss of both estrogens and androgens in elderly men contribute to the development of osteoporosis, one of the most common and impactful metabolic diseases of old age. In the last 20 years, basic and clinical research advances, genetic insights from humans and rodents, and newer imaging technologies have changed considerably the landscape of our understanding of bone biology as well as the relationship between sex steroids and the physiology and pathophysiology of bone metabolism. Together with the appreciation of the side effects of estrogen-related therapies on breast cancer and cardiovascular diseases, these advances have also drastically altered the treatment of osteoporosis. In this article, we provide a comprehensive review of the molecular and cellular mechanisms of action of estrogens and androgens on bone, their influences on skeletal homeostasis during growth and adulthood, the pathogenetic mechanisms of the adverse effects of their deficiency on the female and male skeleton, as well as the role of natural and synthetic estrogenic or androgenic compounds in the pharmacotherapy of osteoporosis. We highlight latest advances on the crosstalk between hormonal and mechanical signals, the relevance of the antioxidant properties of estrogens and androgens, the difference of their cellular targets in different bone envelopes, the role of estrogen deficiency in male osteoporosis, and the contribution of estrogen or androgen deficiency to the monomorphic effects of aging on skeletal involution. Copyright © 2017 the American Physiological Society.

  6. Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

    Science.gov (United States)

    Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

    2016-05-01

    Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the

  7. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    Science.gov (United States)

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

  8. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  9. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents.

    Science.gov (United States)

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J Christopher; Ugarte, Ricardo; Antoniou, Michael N

    2017-10-01

    The safety, including the endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased the expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBluc cells, which was blocked by the estrogen antagonist ICI 182,780. Commercial GBH formulations or their adjuvants alone did not exhibit estrogenic effects in either assay. Transcriptomics analysis of MCF-7 cells treated with glyphosate revealed changes in gene expression reflective of hormone-induced cell proliferation but did not overlap with an ERα gene expression biomarker. Calculation of glyphosate binding energy to ERα predicts a weak and unstable interaction (-4.10 kcal mol -1 ) compared to estradiol (-25.79 kcal mol -1 ), which suggests that activation of this receptor by glyphosate is via a ligand-independent mechanism. Induction of ERE-luc expression by the PKA signalling activator IBMX shows that ERE-luc is responsive to ligand-independent activation, suggesting a possible mechanism of glyphosate-mediated activation. Our study reveals that glyphosate, but not other components present in GBHs, can activate ERα in vitro, albeit at relatively high concentrations. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Prenatal exposure of mice to diethylstilbestrol disrupts T-cell differentiation by regulating Fas/Fas ligand expression through estrogen receptor element and nuclear factor-κB motifs.

    Science.gov (United States)

    Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi

    2012-11-01

    Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.

  11. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  12. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  13. Estrogen, vascular estrogen receptor and hormone therapy in postmenopausal vascular disease.

    Science.gov (United States)

    Khalil, Raouf A

    2013-12-15

    Cardiovascular disease (CVD) is less common in premenopausal women than men of the same age or postmenopausal women, suggesting vascular benefits of estrogen. Estrogen activates estrogen receptors ERα, ERβ and GPR30 in endothelium and vascular smooth muscle (VSM), which trigger downstream signaling pathways and lead to genomic and non-genomic vascular effects such as vasodilation, decreased VSM contraction and growth and reduced vascular remodeling. However, randomized clinical trials (RCTs), such as the Women's Health Initiative (WHI) and Heart and Estrogen/progestin Replacement Study (HERS), have shown little vascular benefits and even adverse events with menopausal hormone therapy (MHT), likely due to factors related to the MHT used, ER profile, and RCT design. Some MHT forms, dose, combinations or route of administration may have inadequate vascular effects. Age-related changes in ER amount, distribution, integrity and post-ER signaling could alter the vascular response to MHT. The subject's age, preexisting CVD, and hormone environment could also reduce the effects of MHT. Further evaluation of natural and synthetic estrogens, phytoestrogens, and selective estrogen-receptor modulators (SERMs), and the design of appropriate MHT combinations, dose, route and 'timing' could improve the effectiveness of conventional MHT and provide alternative therapies in the peri-menopausal period. Targeting ER using specific ER agonists, localized MHT delivery, and activation of specific post-ER signaling pathways could counter age-related changes in ER. Examination of the hormone environment and conditions associated with hormone imbalance such as polycystic ovary syndrome may reveal the causes of abnormal hormone-receptor interactions. Consideration of these factors in new RCTs such as the Kronos Early Estrogen Prevention Study (KEEPS) could enhance the vascular benefits of estrogen in postmenopausal CVD. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    International Nuclear Information System (INIS)

    Pavlikova, Nela; Kortner, Trond M.; Arukwe, Augustine

    2010-01-01

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 μg/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-α (ERα), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPARα, PPARβ and PPARγ mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ERα mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ERα mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly and also in combination. GST mRNA was

  15. Estrogen-mediated inactivation of FOXO3a by the G protein-coupled estrogen receptor GPER

    International Nuclear Information System (INIS)

    Zekas, Erin; Prossnitz, Eric R.

    2015-01-01

    Estrogen (17β-estradiol) promotes the survival and proliferation of breast cancer cells and its receptors represent important therapeutic targets. The cellular actions of estrogen are mediated by the nuclear estrogen receptors ERα and ERβ as well as the 7-transmembrane spanning G protein-coupled estrogen receptor (GPER). We previously reported that estrogen activates the phosphoinositide 3-kinase (PI3Kinase) pathway via GPER, resulting in phosphatidylinositol (3,4,5)-trisphosphate (PIP3) production within the nucleus of breast cancer cells; however, the mechanisms and consequences of this activity remained unclear. MCF7 breast cancer cells were transfected with GFP-fused Forkhead box O3 (FOXO3) as a reporter to assess localization in response to estrogen stimulation. Inhibitors of PI3Kinases and EGFR were employed to determine the mechanisms of estrogen-mediated FOXO3a inactivation. Receptor knockdown with siRNA and the selective GPER agonist G-1 elucidated the estrogen receptor(s) responsible for estrogen-mediated FOXO3a inactivation. The effects of selective estrogen receptor modulators and downregulators (SERMs and SERDs) on FOXO3a in MCF7 cells were also determined. Cell survival (inhibition of apoptosis) was assessed by caspase activation. In the estrogen-responsive breast cancer cell line MCF7, FOXO3a inactivation occurs on a rapid time scale as a result of GPER, but not ERα, stimulation by estrogen, established by the GPER-selective agonist G-1 and knockdown of GPER and ERα. GPER-mediated inactivation of FOXO3a is effected by the p110α catalytic subunit of PI3Kinase as a result of transactivation of the EGFR. The SERMs tamoxifen and raloxifene, as well as the SERD ICI182,780, were active in mediating FOXO3a inactivation in a GPER-dependent manner. Additionally, estrogen-and G-1-mediated stimulation of MCF7 cells results in a decrease in caspase activation under proapoptotic conditions. Our results suggest that non-genomic signaling by GPER contributes

  16. Characterizing the Estrogenic Potential of 1060 Environmental ...

    Science.gov (United States)

    In order to detect environmental chemicals that pose a risk of endocrine disruption, high-throughput screening (HTS) tests capable of testing thousands of environmental chemicals are needed. Alteration of estrogen signaling has been implicated in a variety of adverse health effects including cancer promotion, reproductive deficits, and vascular effects. Here we investigate the estrogenic potential of 1060 chemicals of environmental relevance using a real-time measure of growth kinetics by electrode impedance in the estrogen-responsive human ductal carcinoma, T47D cell line. Cells were treated in concentration response and measurements of cellular impedance were recorded every hour for six days. Progestens, androgens, and mineralocortocoids (progesterone, dihydrotestosterone, aldosterone) invoked a biphasic impedance signature that contrasted with the anticipated exponential impedance observed in response to known estrogen receptor agonists (17β-estradiol, genestein, bisphenol-A, nonylphenol, 4-tert-octylphenol). Several compounds, including bisphenol-A, and genestein caused impedance comparable to that of 17β-estradiol, although at much higher concentrations. Additionally, trenbolone and cyproterone acetate invoked the characteristic biphasic signature observed with other endogenous steroid hormones. The continuous real-time nature of this assay allows for the rapid detection of differential growth characteristics not easily detected by traditional cell prol

  17. Channel catfish (Ictalurus punctatus) leukocytes express estrogen receptor isoforms ERα and ERβ2 and are functionally modulated by estrogens.

    Science.gov (United States)

    Iwanowicz, Luke R; Stafford, James L; Patiño, Reynaldo; Bengten, Eva; Miller, Norman W; Blazer, Vicki S

    2014-09-01

    Estrogens are recognized as modulators of immune responses in mammals and teleosts. While it is known that the effects of estrogens are mediated via leukocyte-specific estrogen receptors (ERs) in humans and mice, leucocyte-specific estrogen receptor expression and the effects of estrogens on this cell population is less explored and poorly understood in teleosts. Here in, we verify that channel catfish (Ictalurus punctaus) leukocytes express ERα and ERβ2. Transcripts of these isoforms were detected in tissue-associated leukocyte populations by PCR, but ERβ2 was rarely detected in PBLs. Expression of these receptors was temporally regulated in PBLs following polyclonal activation by concanavalin A, lipopolysaccharide or alloantigen based on evaluation by quantitative and end-point PCR. Examination of long-term leukocyte cell lines demonstrated that these receptors are differentially expressed depending on leukocyte lineage and phenotype. Expression of ERs was also temporally dynamic in some leukocyte lineages and may reflect stage of cell maturity. Estrogens affect the responsiveness of channel catfish peripheral blood leukocytes (PBLs) to mitogens in vitro. Similarly, bactericidal activity and phorbol 12-myristate 13-acetate induced respiratory burst was modulated by 17β-estradiol. These actions were blocked by the pure ER antagonist ICI 182780 indicating that response is, in part, mediated via ERα. In summary, estrogen receptors are expressed in channel catfish leukocytes and participate in the regulation of the immune response. This is the first time leukocyte lineage expression has been reported in teleost cell lines. Published by Elsevier Ltd.

  18. Investigating the Regulation of Estrogen Receptor-Mediated Transcription

    National Research Council Canada - National Science Library

    Thackray, Varykina

    2002-01-01

    ...-mediated regulation of specific target genes are still lacking. We have developed an estrogen responsive system in the fruit fly, Drosophila melanogaster in order to explore the functional interactions between ER and other cellular proteins...

  19. Investigating the Regulation of Estrogen Receptor-Mediated Transcription

    National Research Council Canada - National Science Library

    Thackray, Varykina

    2001-01-01

    ...-mediated regulation of specific target genes are still lacking. We have developed an estrogen responsive system in the fruit fly, Drosophila melanogaster in order to explore the functional interactions between ER and other cellular proteins...

  20. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  1. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  2. Anaerobic biotransformation of estrogens

    International Nuclear Information System (INIS)

    Czajka, Cynthia P.; Londry, Kathleen L.

    2006-01-01

    Estrogens are important environmental contaminants that disrupt endocrine systems and feminize male fish. We investigated the potential for anaerobic biodegradation of the estrogens 17-α-ethynylestradiol (EE2) and 17-β-estradiol (E2) in order to understand their fate in aquatic and terrestrial environments. Cultures were established using lake water and sediment under methanogenic, sulfate-, iron-, and nitrate-reducing conditions. Anaerobic degradation of EE2 (added at 5 mg/L) was not observed in multiple trials over long incubation periods (over three years). E2 (added at 5 mg/L) was transformed to estrone (E1) under all four anaerobic conditions (99-176 μg L -1 day -1 ), but the extent of conversion was different for each electron acceptor. The oxidation of E2 to E1 was not inhibited by E1. Under some conditions, reversible inter-conversion of E2 and E1 was observed, and the final steady state concentration of E2 depended on the electron-accepting condition but was independent of the total amount of estrogens added. In addition, racemization occurred and E1 was also transformed to 17-α-estradiol under all but nitrate-reducing conditions. Although E2 could be readily transformed to E1 and in many cases 17-α-estradiol under anaerobic conditions, the complete degradation of estrogens under these conditions was minimal, suggesting that they would accumulate in anoxic environments

  3. Expression and function of the human estrogen receptor in yeast

    International Nuclear Information System (INIS)

    White, J.H.; Metzger, D.; Chambon, P.

    1988-01-01

    Gene expression in eukaryotes is regulated at many levels. Moreover, there is increasing evidence that the basic control mechanisms of transcription initiation have been conserved across the range of eukaryotes from yeast to man. In vertebrates, the nuclear receptors, whose activity is dependent on the binding of specific ligands, stimulate transcription by interacting with specific cis-acting sequences and display all of the hallmarks of inducible enhancer factors. Alignment of their amino acid sequences indicates that they are composed of a series of conserved domains. The domain structure of the human estrogen receptor (hER) is typical of receptor proteins. Region C, containing two putative zinc fingers, comprises the DNA-binding domain responsible for specific recognition of estrogen response elements (ERE). Region E contains the hormone-binding domain and domain(s) responsible for transcription activation. A mutant of the hER, called HE15, which lacks the hormone-binding domain, binds DNA in vivo and in vitro but activates transcription only poorly in a constitutive manner in vivo in HeLa cells. A series of studies have demonstrated that the hormone- and DNA-binding domains of the nuclear receptors function independently. Chimeric proteins consisting of the DNA-binding domain of yeast GAL4 coupled to the hormone-binding domains of either the hER or glucocorticoid receptor element (GRE) will stimulate transcription in HeLa cells when bound to a UAS. Taken together, these results demonstrate that the hER and other nuclear receptors, as well as GAL4 and GCN4 proteins of yeast, consist of discrete and separable DNA-binding and transcription-activation functions. To investigate these striking parallels further, the authors have expressed the hER in the yeast Saccharomyces cerevisiae and have analyzed its hormone- and DNA-binding properties in vitro and its ability to stimulate transcription in vivo

  4. Evaluation of the Biological Activity of Opuntia ficus indica as a Tissue- and Estrogen Receptor Subtype-Selective Modulator.

    Science.gov (United States)

    An, Byoung Ha; Jeong, Hyesoo; Zhou, Wenmei; Liu, Xiyuan; Kim, Soolin; Jang, Chang Young; Kim, Hyun-Sook; Sohn, Johann; Park, Hye-Jin; Sung, Na-Hye; Hong, Cheol Yi; Chang, Minsun

    2016-06-01

    Phytoestrogens are selective estrogen receptor modulators (SERMs) with potential for use in hormone replacement therapy (HRT) to relieve peri/postmenopausal symptoms. This study was aimed at elucidating the molecular mechanisms underlying the SERM properties of the extract of Korean-grown Opuntia ficus-indica (KOFI). The KOFI extract induced estrogen response element (ERE)-driven transcription in breast and endometrial cancer cell lines and the expression of endogenous estrogen-responsive genes in breast cancer cells. The flavonoid content of different KOFI preparations affected ERE-luciferase activities, implying that the flavonoid composition likely mediated the estrogenic activities in cells. Oral administration of KOFI decreased the weight gain and levels of both serum glucose and triglyceride in ovariectomized (OVX) rats. Finally, KOFI had an inhibitory effect on the 17β-estradiol-induced proliferation of the endometrial epithelium in OVX rats. Our data demonstrate that KOFI exhibited SERM activity with no uterotrophic side effects. Therefore, KOFI alone or in combination with other botanical supplements, vitamins, or minerals may be an effective and safe alternative active ingredient to HRTs, for the management of postmenopausal symptoms. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  5. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    Science.gov (United States)

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  6. Functional adaptation in female rats: the role of estrogen signaling.

    Directory of Open Access Journals (Sweden)

    Susannah J Sample

    Full Text Available Sex steroids have direct effects on the skeleton. Estrogen acts on the skeleton via the classical genomic estrogen receptors alpha and beta (ERα and ERβ, a membrane ER, and the non-genomic G-protein coupled estrogen receptor (GPER. GPER is distributed throughout the nervous system, but little is known about its effects on bone. In male rats, adaptation to loading is neuronally regulated, but this has not been studied in females.We used the rat ulna end-loading model to induce an adaptive modeling response in ovariectomized (OVX female Sprague-Dawley rats. Rats were treated with a placebo, estrogen (17β-estradiol, or G-1, a GPER-specific agonist. Fourteen days after OVX, rats underwent unilateral cyclic loading of the right ulna; half of the rats in each group had brachial plexus anesthesia (BPA of the loaded limb before loading. Ten days after loading, serum estrogen concentrations, dorsal root ganglion (DRG gene expression of ERα, ERβ, GPER, CGRPα, TRPV1, TRPV4 and TRPA1, and load-induced skeletal responses were quantified. We hypothesized that estrogen and G-1 treatment would influence skeletal responses to cyclic loading through a neuronal mechanism. We found that estrogen suppresses periosteal bone formation in female rats. This physiological effect is not GPER-mediated. We also found that absolute mechanosensitivity in female rats was decreased, when compared with male rats. Blocking of adaptive bone formation by BPA in Placebo OVX females was reduced.Estrogen acts to decrease periosteal bone formation in female rats in vivo. This effect is not GPER-mediated. Gender differences in absolute bone mechanosensitivity exist in young Sprague-Dawley rats with reduced mechanosensitivity in females, although underlying bone formation rate associated with growth likely influences this observation. In contrast to female and male rats, central neuronal signals had a diminished effect on adaptive bone formation in estrogen-deficient female rats.

  7. Estrogenic effects of marijuana smoke condensate and cannabinoid compounds

    International Nuclear Information System (INIS)

    Lee, Soo Yeun; Oh, Seung Min; Chung, Kyu Hyuck

    2006-01-01

    Chronic exposure to marijuana produces adverse effects on the endocrine and reproductive systems in humans; however, the experimental evidence for this presented thus far has not been without controversy. In this study, the estrogenic effect of marijuana smoke condensate (MSC) was evaluated using in vitro bioassays, viz., the cell proliferation assay, the reporter gene assay, and the ER competitive binding assay. The results of these assays were compared with those of three major cannabinoids, i.e., THC, CBD, and CBN. The estrogenic effect of MSC was further confirmed by the immature female rat uterotrophic assay. MSC stimulated the estrogenicity related to the ER-mediated pathway, while neither THC, CBD, nor CBN did. Moreover, treatment with 10 and 25 mg/kg MSC induced significant uterine response, and 10 mg/kg MSC resulted in an obvious change in the uterine epithelial cell appearance. MSC also enhanced the IGFBP-1 gene expression in a dose-dependent manner. To identify the constituents of MSC responsible for its estrogenicity, the MSC fractionated samples were examined using another cell proliferation assay, and the estrogenic active fraction was analyzed using GC-MS. In the organic acid fraction that showed the strongest estrogenic activity among the seven fractions of MSC, phenols were identified. Our results suggest that marijuana abuse is considered an endocrine-disrupting factor. Furthermore, these results suggest that the phenolic compounds contained in MSC play a role in its estrogenic effect

  8. Estrogen regulates estrogen receptors and antioxidant gene expression in mouse skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Kristen A Baltgalvis

    Full Text Available BACKGROUND: Estrogens are associated with the loss of skeletal muscle strength in women with age. Ovarian hormone removal by ovariectomy in mice leads to a loss of muscle strength, which is reversed with 17beta-estradiol replacement. Aging is also associated with an increase in antioxidant stress, and estrogens can improve antioxidant status via their interaction with estrogen receptors (ER to regulate antioxidant gene expression. The purpose of this study was to determine if ER and antioxidant gene expression in skeletal muscle are responsive to changes in circulating estradiol, and if ERs regulate antioxidant gene expression in this tissue. METHODOLOGY/PRINCIPAL FINDINGS: Adult C57BL/6 mice underwent ovariectomies or sham surgeries to remove circulating estrogens. These mice were implanted with placebo or 17beta-estradiol pellets acutely or chronically. A separate experiment examined mice that received weekly injections of Faslodex to chronically block ERs. Skeletal muscles were analyzed for expression of ER genes and proteins and antioxidant genes. ERalpha was the most abundant, followed by Gper and ERbeta in both soleus and EDL muscles. The loss of estrogens through ovariectomy induced ERalpha gene and protein expression in the soleus, EDL, and TA muscles at both the acute and chronic time points. Gpx3 mRNA was also induced both acutely and chronically in all 3 muscles in mice receiving 17beta-estradiol. When ERs were blocked using Faslodex, Gpx3 mRNA was downregulated in the soleus muscle, but not the EDL and TA muscles. CONCLUSIONS/SIGNIFICANCE: These data suggest that Gpx3 and ERalpha gene expression are sensitive to circulating estrogens in skeletal muscle. ERs may regulate Gpx3 gene expression in the soleus muscle, but skeletal muscle regulation of Gpx3 via ERs is dependent upon muscle type. Further work is needed to determine the indirect effects of estrogen and ERalpha on Gpx3 expression in skeletal muscle, and their importance in the

  9. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  10. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    Energy Technology Data Exchange (ETDEWEB)

    Pavlikova, Nela [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); RECETOX Research Centre for Environmental Chemistry and Ecotoxicology, Masaryk University, Kamenice 3, CZ62500 Brno (Czech Republic); Kortner, Trond M. [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); Arukwe, Augustine, E-mail: arukwe@bio.ntnu.no [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway)

    2010-08-15

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 {mu}g/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-{alpha} (ER{alpha}), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPAR{alpha}, PPAR{beta} and PPAR{gamma} mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ER{alpha} mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ER{alpha} mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly

  11. Androgenic and Estrogenic Response of Green Mussel Extracts from Singapore’s Coastal Environment Using a Human Cell-Based Bioassay

    Science.gov (United States)

    Bayen, Stéphane; Gong, Yinhan; Chin, Hong Soon; Lee, Hian Kee; Leong, Yong Eu; Obbard, Jeffrey Philip

    2004-01-01

    In the last decade, evidence of endocrine disruption in biota exposed to environmental pollutants has raised serious concern. Human cell-based bioassays have been developed to evaluate induced androgenic and estrogenic activities of chemical compounds. However, bioassays have been sparsely applied to environmental samples. In this study we present data on sex hormone activities in the green mussel, Perna viridis, in Singapore’s coastal waters. P. viridis is a common bioindicator of marine contamination, and this study is a follow-up to an earlier investigation that reported the presence of sex hormone activities in seawater samples from Singapore’s coastal environment. Specimens were collected from eight locations around the Singapore coastline and analyzed for persistent organic pollutants (POPs) and heavy metals. Tissue extracts were then screened for activities on androgen receptors (ARs) and estrogen receptors (ER-α and ER-β) using a reporter gene bio-assay based on a HeLa human cell line. Mussel extracts alone did not exhibit AR activity, but in the presence of the reference androgenic hormone dihydrotestosterone (DHT), activities were up to 340% higher than those observed for DHT alone. Peak activities were observed in locations adjacent to industrial and shipping activities. Estrogenic activities of the mussel extract both alone and in the presence of reference hormone were positive. Correlations were statistically investigated between sex hormone activities, levels of pollutants in the mussel tissues, and various biological parameters (specimen size, sex ratio, lipid and moisture content). Significant correlations exist between AR activities, in the presence of DHT, and total concentration of POPs (r = 0.725, p < 0.05). PMID:15531429

  12. Hpm of Estrogen Model on the Dynamics of Breast Cancer

    Science.gov (United States)

    Govindarajan, A.; Balamuralitharan, S.; Sundaresan, T.

    2018-04-01

    We enhance a deterministic mathematical model involving universal dynamics on breast cancer with immune response. This is population model so includes Normal cells class, Tumor cells, Immune cells and Estrogen. The eects regarding Estrogen are below incorporated in the model. The effects show to that amount the arrival of greater Estrogen increases the danger over growing breast cancer. Furthermore, approximate solution regarding nonlinear differential equations is arrived by Homotopy Perturbation Method (HPM). Hes HPM is good and correct technique after solve nonlinear differential equation directly. Approximate solution learnt with the support of that method is suitable same as like the actual results in accordance with this models.

  13. An Assessment of the Model of Concentration Addition for Predicting the Estrogenic Activity of Chemical Mixtures in Wastewater Treatment Works Effluents

    Science.gov (United States)

    Thorpe, Karen L.; Gross-Sorokin, Melanie; Johnson, Ian; Brighty, Geoff; Tyler, Charles R.

    2006-01-01

    The effects of simple mixtures of chemicals, with similar mechanisms of action, can be predicted using the concentration addition model (CA). The ability of this model to predict the estrogenic effects of more complex mixtures such as effluent discharges, however, has yet to be established. Effluents from 43 U.K. wastewater treatment works were analyzed for the presence of the principal estrogenic chemical contaminants, estradiol, estrone, ethinylestradiol, and nonylphenol. The measured concentrations were used to predict the estrogenic activity of each effluent, employing the model of CA, based on the relative potencies of the individual chemicals in an in vitro recombinant yeast estrogen screen (rYES) and a short-term (14-day) in vivo rainbow trout vitellogenin induction assay. Based on the measured concentrations of the four chemicals in the effluents and their relative potencies in each assay, the calculated in vitro and in vivo responses compared well and ranged between 3.5 and 87 ng/L of estradiol equivalents (E2 EQ) for the different effluents. In the rYES, however, the measured E2 EQ concentrations in the effluents ranged between 0.65 and 43 ng E2 EQ/L, and they varied against those predicted by the CA model. Deviations in the estimation of the estrogenic potency of the effluents by the CA model, compared with the measured responses in the rYES, are likely to have resulted from inaccuracies associated with the measurement of the chemicals in the extracts derived from the complex effluents. Such deviations could also result as a consequence of interactions between chemicals present in the extracts that disrupted the activation of the estrogen response elements in the rYES. E2 EQ concentrations derived from the vitellogenic response in fathead minnows exposed to a series of effluent dilutions were highly comparable with the E2 EQ concentrations derived from assessments of the estrogenic potency of these dilutions in the rYES. Together these data support the

  14. Trichostatin A enhances estrogen receptor-alpha repression in MCF-7 breast cancer cells under hypoxia

    International Nuclear Information System (INIS)

    Noh, Hyunggyun; Park, Joonwoo; Shim, Myeongguk; Lee, YoungJoo

    2016-01-01

    Estrogen receptor (ER) is a crucial determinant of resistance to endocrine therapy, which may change during the progression of breast cancer. We previously showed that hypoxia induces ESR1 gene repression and ERα protein degradation via proteasome-mediated pathway in breast cancer cells. HDAC plays important roles in the regulation of histone and non-histone protein post-translational modification. HDAC inhibitors can induce epigenetic changes and have therapeutic potential for targeting various cancers. Trichostatin A exerts potent antitumor activities against breast cancer cells in vitro and in vivo. In this report, we show that TSA augments ESR1 gene repression at the transcriptional level and downregulates ERα protein expression under hypoxic conditions through a proteasome-mediated pathway. TSA-induced estrogen response element-driven reporter activity in the absence of estrogen was synergistically enhanced under hypoxia; however, TSA inhibited cell proliferation under both normoxia and hypoxia. Our data show that the hypoxia-induced repression of ESR1 and degradation of ERα are enhanced by concomitant treatment with TSA. These findings expand our understanding of hormone responsiveness in the tumor microenvironment; however, additional in-depth studies are required to elucidate the detailed mechanisms of TSA-induced ERα regulation under hypoxia. - Highlights: • TSA augments ESR1 gene repression at the transcriptional level under hypoxia. • TSA downregulates ERα protein expression under hypoxia. • TSA-induced ERα regulation under hypoxia is essential for understanding the behavior and progression of breast cancer.

  15. Trichostatin A enhances estrogen receptor-alpha repression in MCF-7 breast cancer cells under hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Noh, Hyunggyun; Park, Joonwoo; Shim, Myeongguk; Lee, YoungJoo, E-mail: yjlee@sejong.ac.kr

    2016-02-12

    Estrogen receptor (ER) is a crucial determinant of resistance to endocrine therapy, which may change during the progression of breast cancer. We previously showed that hypoxia induces ESR1 gene repression and ERα protein degradation via proteasome-mediated pathway in breast cancer cells. HDAC plays important roles in the regulation of histone and non-histone protein post-translational modification. HDAC inhibitors can induce epigenetic changes and have therapeutic potential for targeting various cancers. Trichostatin A exerts potent antitumor activities against breast cancer cells in vitro and in vivo. In this report, we show that TSA augments ESR1 gene repression at the transcriptional level and downregulates ERα protein expression under hypoxic conditions through a proteasome-mediated pathway. TSA-induced estrogen response element-driven reporter activity in the absence of estrogen was synergistically enhanced under hypoxia; however, TSA inhibited cell proliferation under both normoxia and hypoxia. Our data show that the hypoxia-induced repression of ESR1 and degradation of ERα are enhanced by concomitant treatment with TSA. These findings expand our understanding of hormone responsiveness in the tumor microenvironment; however, additional in-depth studies are required to elucidate the detailed mechanisms of TSA-induced ERα regulation under hypoxia. - Highlights: • TSA augments ESR1 gene repression at the transcriptional level under hypoxia. • TSA downregulates ERα protein expression under hypoxia. • TSA-induced ERα regulation under hypoxia is essential for understanding the behavior and progression of breast cancer.

  16. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  17. The Determinations of Estrogen and Progesterone Receptor in Breast Cancer Cell by Radioimmunoassay Method

    International Nuclear Information System (INIS)

    Kim, Chi Yeul

    1981-01-01

    The estrogen and progesterone receptors which are bound to the cytoplasmic protein of cancer cells were measured in 20 patients with the early breast cancer by means of radioimmunoassay using charcoal. 1) The patients with estrogen receptor positive were 13 (65%) of 20 cases and with progestrone receptor positive were 7 cases (35%) in the early breast cancer. 2) Coexistence of estrogen and progesterone receptor positive was noted in 7 cases (35%). The cases of estrogen receptor positive and progesterone receptor negative were 6 cases (33.3%), while there were no cases of estrogen receptor negative with progesterone receptor positive. 3) Coincidence of estrogen and progesterone negative was noticed in 7 cases (35%). Conclusively it is considered that the measurement of estrogen and progesterone receptors has relevance as predictive value, in the response to hormonal manipulations and chemotherapy for breast cancer patients.

  18. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  19. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  20. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  1. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  2. Dose-response effects of estrogenic mycotoxins (zearalenone, alpha- and beta-zearalenol on motility, hyperactivation and the acrosome reaction of stallion sperm

    Directory of Open Access Journals (Sweden)

    Colenbrander Ben

    2011-10-01

    Full Text Available Abstract Background The aim of this study was to investigate the in vitro effects of the Fusarium fungus-derived mycotoxin, zearalenone and its derivatives alpha-zearalenol and beta-zearalenol on motility parameters and the acrosome reaction of stallion sperm. Since the toxic effects of zearalenone and its derivatives are thought to result from their structural similarity to 17beta-estradiol, 17beta-estradiol was used as a positive control for 'estrogen-like' effects. Methods Stallion spermatozoa were exposed in vitro to zearalenone, alpha-zearalenol, beta-zearalenol or 17beta-estradiol at concentrations ranging from 1 pM - 0.1 mM. After 2 hours exposure, motility parameters were evaluated by computer-assisted analysis, and acrosome integrity was examined by flow cytometry after staining with fluoroscein-conjugated peanut agglutinin. Results Mycotoxins affected sperm parameters only at the highest concentration tested (0.1 mM after 2 hours exposure. In this respect, all of the compounds reduced the average path velocity, but only alpha-zearalenol reduced percentages of motile and progressively motile sperm. Induction of motility patterns consistent with hyperactivation was stimulated according to the following rank of potency: alpha-zearalenol >17beta-estradiol > zearalenone = beta-zearalenol. The hyperactivity-associated changes observed included reductions in straight-line velocity and linearity of movement, and an increase in the amplitude of lateral head displacement, while curvilinear velocity was unchanged. In addition, whereas alpha- and beta- zearalenol increased the percentages of live acrosome-reacted sperm, zearalenone and 17beta-estradiol had no apparent effect on acrosome status. In short, alpha-zearalenol inhibited normal sperm motility, but stimulated hyperactive motility in the remaining motile cells and simultaneously induced the acrosome reaction. Beta-zearalenol induced the acrosome reaction without altering motility

  3. Skeletal Muscle Estrogen Receptor Activation in Response to Eccentric Exercise Up-Regulates Myogenic-Related Gene Expression Independent of Differing Serum Estradiol Levels Occurring during the Human Menstrual Cycle.

    Science.gov (United States)

    Haines, Mackenzie; McKinley-Barnard, Sarah K; Andre, Thomas L; Gann, Josh J; Hwang, Paul S; Willoughby, Darryn S

    2018-03-01

    This study sought to determine if the differences in serum estradiol we have previously observed to occur during the mid-follicular (MF) and mid-luteal (ML) phases of the female menstrual cycle could be attributed to estrogen-induced receptor activation and subsequent effects on myogenic-related genes which may otherwise impact muscle regeneration in response to eccentric exercise. Twenty-two physically-active females (20.9 ± 1.4 years, 63.5 ± 9.0 kg, 1.65 ± 0.08 m) underwent an eccentric exercise bout of the knee extensors during the MF and ML phases of their 28-day menstrual cycle. Prior to (PRE), at 6 (6HRPOST), and 24 (24HRPOST) hours post-exercise for each session, participants had muscle biopsies obtained. Skeletal muscle estradiol and estrogen receptor-α (ER-α) content and ER-DNA binding were determined with ELISA. Real-time PCR was used to assess ER-α, Myo-D, and cyclin D1 mRNA expression. Data were analyzed utilizing a 2 x 3 repeated measures univariate analyses of variance (ANOVA) for each criterion variable (p ≤ .05). Skeletal muscle estradiol levels were not significantly impacted by either menstrual phase (p > 0.05); however, both ER-α mRNA and protein were significantly increased during MF (p < 0.05). ER-DNA binding and Myo-D mRNA expression increased significantly in both menstrual phases in response to exercise but were not different from one another; however, cyclin D1 mRNA expression was significantly greater during MF. This study demonstrates that skeletal muscle ER-α activation in response to eccentric exercise up-regulates myogenic-related gene expression independent of serum estradiol levels occurring during the human menstrual cycle.

  4. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  5. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  6. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  7. Estrogen inhibits RANKL-stimulated osteoclastic differentiation of human monocytes through estrogen and RANKL-regulated interaction of estrogen receptor-α with BCAR1 and Traf6

    International Nuclear Information System (INIS)

    Robinson, Lisa J.; Yaroslavskiy, Beatrice B.; Griswold, Reed D.; Zadorozny, Eva V.; Guo, Lida; Tourkova, Irina L.; Blair, Harry C.

    2009-01-01

    The effects of estrogen on osteoclast survival and differentiation were studied using CD14-selected mononuclear osteoclast precursors from peripheral blood. Estradiol at ∼ 1 nM reduced RANKL-dependent osteoclast differentiation by 40-50%. Osteoclast differentiation was suppressed 14 days after addition of RANKL even when estradiol was withdrawn after 18 h. In CD14+ cells apoptosis was rare and was not augmented by RANKL or by 17-β-estradiol. Estrogen receptor-α (ERα) expression was strongly down-regulated by RANKL, whether or not estradiol was present. Mature human osteoclasts thus cannot respond to estrogen via ERα. However, ERα was present in CD14+ osteoclast progenitors, and a scaffolding protein, BCAR1, which binds ERα in the presence of estrogen, was abundant. Immunoprecipitation showed rapid (∼ 5 min) estrogen-dependent formation of ERα-BCAR1 complexes, which were increased by RANKL co-treatment. The RANKL-signaling intermediate Traf6, which regulates NF-κB activity, precipitated with this complex. Reduction of NF-κB nuclear localization occurred within 30 min of RANKL stimulation, and estradiol inhibited the phosphorylation of IκB in response to RANKL. Inhibition by estradiol was abolished by siRNA knockdown of BCAR1. We conclude that estrogen directly, but only partially, curtails human osteoclast formation. This effect requires BCAR1 and involves a non-genomic interaction with ERα.

  8. Estrogen inhibits RANKL-stimulated osteoclastic differentiation of human monocytes through estrogen and RANKL-regulated interaction of estrogen receptor-{alpha} with BCAR1 and Traf6

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Lisa J., E-mail: robinsonlj@msx.upmc.edu [Department of Pathology, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Yaroslavskiy, Beatrice B.; Griswold, Reed D.; Zadorozny, Eva V.; Guo, Lida; Tourkova, Irina L. [Department of Pathology, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Blair, Harry C. [Department of Pathology, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Veteran' s Affairs Medical Center, Pittsburgh, PA 15243 (United States)

    2009-04-15

    The effects of estrogen on osteoclast survival and differentiation were studied using CD14-selected mononuclear osteoclast precursors from peripheral blood. Estradiol at {approx} 1 nM reduced RANKL-dependent osteoclast differentiation by 40-50%. Osteoclast differentiation was suppressed 14 days after addition of RANKL even when estradiol was withdrawn after 18 h. In CD14+ cells apoptosis was rare and was not augmented by RANKL or by 17-{beta}-estradiol. Estrogen receptor-{alpha} (ER{alpha}) expression was strongly down-regulated by RANKL, whether or not estradiol was present. Mature human osteoclasts thus cannot respond to estrogen via ER{alpha}. However, ER{alpha} was present in CD14+ osteoclast progenitors, and a scaffolding protein, BCAR1, which binds ER{alpha} in the presence of estrogen, was abundant. Immunoprecipitation showed rapid ({approx} 5 min) estrogen-dependent formation of ER{alpha}-BCAR1 complexes, which were increased by RANKL co-treatment. The RANKL-signaling intermediate Traf6, which regulates NF-{kappa}B activity, precipitated with this complex. Reduction of NF-{kappa}B nuclear localization occurred within 30 min of RANKL stimulation, and estradiol inhibited the phosphorylation of I{kappa}B in response to RANKL. Inhibition by estradiol was abolished by siRNA knockdown of BCAR1. We conclude that estrogen directly, but only partially, curtails human osteoclast formation. This effect requires BCAR1 and involves a non-genomic interaction with ER{alpha}.

  9. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  10. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  11. Induction of osteoblast differentiation by selective activation of kinase-mediated actions of the estrogen receptor.

    Science.gov (United States)

    Kousteni, Stavroula; Almeida, Maria; Han, Li; Bellido, Teresita; Jilka, Robert L; Manolagas, Stavros C

    2007-02-01

    Estrogens control gene transcription by cis or trans interactions of the estrogen receptor (ER) with target DNA or via the activation of cytoplasmic kinases. We report that selective activation of kinase-mediated actions of the ER with 4-estren-3alpha,17beta-diol (estren) or an estradiol-dendrimer conjugate, each a synthetic compound that stimulates kinase-mediated ER actions 1,000 to 10,000 times more potently than direct DNA interactions, induced osteoblastic differentiation in established cell lines of uncommitted osteoblast precursors and primary cultures of osteoblast progenitors by stimulating Wnt and BMP-2 signaling in a kinase-dependent manner. In sharp contrast, 17beta-estradiol (E(2)) suppressed BMP-2-induced osteoblast progenitor commitment and differentiation. Consistent with the in vitro findings, estren, but not E(2), stimulated Wnt/beta-catenin-mediated transcription in T-cell factor-lacZ transgenic mice. Moreover, E(2) stimulated BMP signaling in mice in which ERalpha lacks DNA binding activity and classical estrogen response element-mediated transcription (ERalpha(NERKI/-)) but not in wild-type controls. This evidence reveals for the first time the existence of a large signalosome in which inputs from the ER, kinases, bone morphogenetic proteins, and Wnt signaling converge to induce differentiation of osteoblast precursors. ER can either induce it or repress it, depending on whether the activating ligand (and presumably the resulting conformation of the receptor protein) precludes or accommodates ERE-mediated transcription.

  12. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  13. Role of estrogen receptor-α on food demand elasticity.

    Science.gov (United States)

    Minervini, Vanessa; Rowland, Neil E; Robertson, Kimberly L; Foster, Thomas C

    2015-05-01

    Estrogens have been shown to have an inhibitory effect on food intake under free-feeding conditions, yet the effects of estrogens on food-maintained operant responding have been studied to a much lesser extent and, thus, are not well understood. Therefore, the purpose of the present experiment was to use a behavioral economics paradigm to assess differences in demand elasticity between mice with knockout of the estrogen receptor subtype α, knockout of subtype β, and their wild type controls. The mice responded in a closed economy, and the price of food was increased by increasing the fixed-ratio response requirement every four sessions. Overall, we found that mice with the knockout of receptor subtype α had the most elastic demand functions. Therefore, under these conditions, estrogens increased food seeking via activation of the receptor subtype α. The results were inconsistent with those reported by previous studies that employed free-feeding conditions. © Society for the Experimental Analysis of Behavior.

  14. Comparison of short-term estrogenicity tests for identification of hormone-disrupting chemicals

    DEFF Research Database (Denmark)

    Andersen, H R; Andersson, A M; Arnold, S F

    1999-01-01

    induced a strong estrogenic response in all test systems. Colchicine caused cytotoxicity only. Bisphenol A induced an estrogenic response in all assays. The results obtained for the remaining test compounds--tamoxifen, ICI 182.780, testosterone, bisphenol A dimethacrylate, 4-n-octylphenol, 4-n...

  15. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  16. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  17. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  18. RNA Regulation of Estrogen

    Science.gov (United States)

    2010-08-01

    Berglund, Rodger Voelker, Paul Barber and Julien Diegel 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING...estrogen  receptors  [reviewed  in  (3,  4)],  also   functions   by  interacting  directly  with  RNA  to  alter  RNA...Mog myelin oligodendrocyte glycoprotein 6.06 207115_x_at mbtd1 mbt domain containing 1 6.06 208004_at Prol1 proline rich, lacrimal 1 6.06 205247_at

  19. Regional differences in the prostate of the neonatally estrogenized mouse

    International Nuclear Information System (INIS)

    Pylkkaenen, L.S.; Santti, R.; Newbold, R.; McLachlan, J.A.

    1991-01-01

    Neonatal estrogenization of the mouse with diethylstilbestrol resulted in time-of-exposure and dose-dependent inhibition of the growth of the prostatic lobes observed at the age of 2 mon. The critical time was the days 1-6 of postnatal life. In neonatally estrogenized (neoDES) mice, responses to 5 alpha-dihydrotestosterone in terms of nuclear 3H-thymidine labelling were altered concomitantly with the inhibition of growth and were in accordance with changes in the relative volumes of epithelium, glandular lumina, and interacinar stroma. Secondary estrogen treatment of neoDES mice with 17 beta-estradiol did not increase 3H-thymidine labelling in the prostate of control or neoDES mice. However, it induced squamous epithelial metaplasia in periurethral collecting ducts and proximal parts of coagulating glands of neoDES animals. In control mice only slight epithelial hyperplasia could be observed after similar treatment. Estrogen receptors, located immunocytochemically in nuclei of stromal cell, corresponded with the sites of increased estrogen sensitivity, observed as metaplastic transformation. When the neoDES animals aged, epithelial hyperplasia and dysplasia could be observed at distinct prostatic sites, ie, the periurethral collecting ducts and the coagulating glands and periurethral glands, and stromal inflammation become more extensive. Almost identical location of the epithelial changes and the altered estrogen response is suggestive of causal relationship

  20. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  1. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  2. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  4. Antibody Probes to Estrogen Receptor-Alpha Transcript-Specific Upstream Peptides: Alternate ER-Alpha Promoter Use and Breast Cancer Etiology/Outcome

    National Research Council Canada - National Science Library

    Pentecost, Brian

    2002-01-01

    Positive Estrogen Receptor alpha (ER) status correlates with a reduced incidence of breast cancer recurrence in the first years after resection of tumors, and predicts a favorable response to adjuvant anti-estrogens...

  5. A transcriptionally active estrogen receptor mutant is a novel type of dominant negative inhibitor of estrogen action.

    Science.gov (United States)

    McInerney, E M; Ince, B A; Shapiro, D J; Katzenellenbogen, B S

    1996-12-01

    We have characterized a human estrogen receptor (ER) mutant, V364E, which has a single amino acid substitution in its hormone-binding domain. This ER mutant is fully active or even superactive at saturating levels of estradiol (10(-8) M E2) yet has the capacity to act as a strong dominant negative inhibitor of the wild type ER. In transient transfection assays using ER-negative Chinese hamster ovary (CHO) cells and two different estrogen response element (ERE)-containing promoter reporter genes, V364E treated with 10(-8) M E2 exhibited approximately 250% and 100% of the activity of the wild type ER with these two promoter contexts, respectively. Despite the high activity of V364E when present alone in cells, coexpression of both V364E and wild type ER causes a significant decrease in overall ER-mediated transcriptional activity. On the TATA promoter, where V364E was more inhibitory, estrogen-stimulated activity was reduced by approximately 50% at a 1:1 ratio of mutant to wild type ER expression vector, and at a 10:1 ratio, 75% of ER activity was inhibited. V364E was expressed at lower levels than wild type ER and has a approximately 40-fold lower affinity for E2 compared with wild type ER. In promoter interference assays, V364E exhibited a strict dependence upon E2 for binding to an ERE. Surprisingly, even when V364E was unable to bind to ERE DNA (i.e. either at low E2 concentration or by mutation of its DNA-binding domain), this mutant retained full dominant negative activity. This highly active ER mutant is, thus, able to repress ER-mediated transcription when the mutant and wild type ER are present together in cells, even without DNA binding. Since competition for ERE binding and the formation of inactive heterodimers cannot fully account for the dominant negative activity of V364E, it is probable that altered interactions with proteins important in ER-mediated transcription play a key role in the repression of transcription by V364E. The properties and probable

  6. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  7. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  8. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  9. Estrogen/ERα signaling axis participates in osteoblast maturation via upregulating chromosomal and mitochondrial complex gene expressions

    Science.gov (United States)

    Lin, Pei-I; Tai, Yu-Ting; Chan, Wing P.; Lin, Yi-Ling; Liao, Mei-Hsiu; Chen, Ruei-Ming

    2018-01-01

    Estrogen deficiency usually leads to bone loss and osteoporosis in postmenopausal women. Osteoblasts play crucial roles in bone formation. However, osteoblast functions are influenced by mitochondrial bioenergetic conditions. In this study, we investigated the roles of the estrogen and estrogen receptor alpha (ERα) axis in mitochondrial energy metabolism and subsequent osteoblast mineralization. Exposure of rat calvarial osteoblasts to estradiol caused substantial improvements in alkaline phosphatase activities and cell calcification. In parallel, treatment of human osteoblast-like U2OS cells, derived from a female osteosarcoma patient, with estradiol specifically augmented ERα levels. Sequentially, estradiol stimulated translocation of ERα to nuclei in human osteoblasts and induced expressions of genomic respiratory chain complex NDUFA10, UQCRC1, cytochrome c oxidase (COX)8A, COX6A2, COX8C, COX6C, COX6B2, COX412, and ATP12A genes. Concurrently, estradiol stimulated translocation of ERα to mitochondria from the cytoplasm. A bioinformatic search found the existence of four estrogen response elements in the 5’-promoter region of the mitochondrial cox i gene. Interestingly, estradiol induced COX I mRNA and protein expressions in human osteoblasts or rat calvarial osteoblasts. Knocking-down ERα translation concurrently downregulated estradiol-induced COX I mRNA expression. Consequently, exposure to estradiol led to successive increases in the mitochondrial membrane potential, the mitochondrial enzyme activity, and cellular adenosine triphosphate levels. Taken together, this study showed the roles of the estradiol/ERα signaling axis in improving osteoblast maturation through upregulating the mitochondrial bioenergetic system due to induction of definite chromosomal and mitochondrial complex gene expressions. Our results provide novel insights elucidating the roles of the estrogen/ERα alliance in regulating bone formation. PMID:29416685

  10. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  11. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  12. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  13. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  14. Estrogen and gastrointestinal malignancy.

    LENUS (Irish Health Repository)

    Hogan, A M

    2012-02-01

    The concept that E2 exerts an effect on the gastrointestinal tract is not new and its actions on intestinal mucosa have been investigated for at least three decades. An attempt to consolidate results of these investigations generates more questions than answers, thus suggesting that many unexplored avenues remain and that the full capabilities of this steroid hormone are far from understood. Evidence of its role in esophageal, gastric and gallbladder cancers is confusing and often equivocal. The most compelling evidence regards the protective role conferred by estrogen (or perhaps ERbeta) against the development and proliferation of colon cancer. Not only has the effect been described but also many mechanisms of action have been explored. It is likely that, along with surgery, chemotherapy and radiotherapy, hormonal manipulation will play an integral role in colon cancer management in the very near future.

  15. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  16. Oleocanthal Modulates Estradiol-Induced Gene Expression Involving Estrogen Receptor α.

    Science.gov (United States)

    Keiler, Annekathrin Martina; Djiogue, Sefirin; Ehrhardt, Tino; Zierau, Oliver; Skaltsounis, Leandros; Halabalaki, Maria; Vollmer, Günter

    2015-09-01

    Oleocanthal is a bioactive compound from olive oil. It has attracted considerable attention as it is anti-inflammatory, antiproliferative, and has been shown to possess neuroprotective properties in vitro and in vivo. Delineated from its polyphenolic structure, the aim of this study was to characterize oleocanthal towards estrogenic properties. This might contribute to partly explain the beneficial effects described for the Mediterranean diet. Estrogenic properties of oleocanthal were assessed by different methods: a) stimulation of reporter gene activity in MVLN or RNDA cells either expressing estrogen receptor α or β, b) stimulation of luciferase reporter gene activity in U2OS osteosarcoma cells expressing estrogen receptor α or β, and c) elucidation of the impact on estradiol-induced gene expression in U2OS cells transduced with both estrogen receptors. Depending on the cell line origin, oleocanthal inhibited luciferase activity (MVLN, U2OS-estrogen receptor β) or weakly induced reporter gene activity at 10 µM in U2OS-estrogen receptor α cells. However, oleocanthal inhibited stimulation of luciferase activity by estradiol from both estrogen receptors. Oleocanthal, if given alone, did not stimulate gene expression in U2OS cells, but it significantly modulated the response of estradiol. Oleocanthal enhanced the effect of estradiol on the regulation of those genes, which are believed to be regulated through heterodimeric estrogen receptors. As the estrogenic response pattern of oleocanthal is rather unique, we compared the results obtained with oleacein. Oleocanthal binds to both estrogen receptors inducing estradiol-agonistic or antiagonistic effects depending on the cell line. Regarding regulation of gene expression in U2OS-estrogen receptor α/β cells, oleocanthal and oleacein enhanced estradiol-mediated regulation of heterodimer-regulated genes. Georg Thieme Verlag KG Stuttgart · New York.

  17. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. The in vivo estrogenic and in vitro anti-estrogenic activity of permethrin and bifenthrin.

    Science.gov (United States)

    Brander, Susanne M; He, Guochun; Smalling, Kelly L; Denison, Michael S; Cherr, Gary N

    2012-12-01

    Pyrethroids are highly toxic to fish at parts per billion or parts per trillion concentrations. Their intended mechanism is prolonged sodium channel opening, but recent studies reveal that pyrethroids such as permethrin and bifenthrin also have endocrine activity. Additionally, metabolites may have greater endocrine activity than parent compounds. The authors evaluated the in vivo concentration-dependent ability of bifenthrin and permethrin to induce choriogenin (an estrogen-responsive protein) in Menidia beryllina, a fish species known to reside in pyrethroid-contaminated aquatic habitats. The authors then compared the in vivo response with an in vitro assay--chemical activated luciferase gene expression (CALUX). Juvenile M. beryllina exposed to bifenthrin (1, 10, 100 ng/L), permethrin (0.1, 1, 10 µg/L), and ethinylestradiol (1, 10, 50 ng/L) had significantly higher ng/mL choriogenin (Chg) measured in whole body homogenate than controls. Though Chg expression in fish exposed to ethinylestradiol (EE2) exhibited a traditional sigmoidal concentration response, curves fit to Chg expressed in fish exposed to pyrethroids suggest a unimodal response, decreasing slightly as concentration increases. Whereas the in vivo response indicated that bifenthrin and permethrin or their metabolites act as estrogen agonists, the CALUX assay demonstrated estrogen antagonism by the pyrethroids. The results, supported by evidence from previous studies, suggest that bifenthrin and permethrin, or their metabolites, appear to act as estrogen receptor (ER) agonists in vivo, and that the unmetabolized pyrethroids, particularly bifenthrin, act as an ER antagonists in cultured mammalian cells. Copyright © 2012 SETAC.

  19. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  20. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  1. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  2. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  3. TIP48/Reptin and H2A.Z requirement for initiating chromatin remodeling in estrogen-activated transcription.

    Directory of Open Access Journals (Sweden)

    Mathieu Dalvai

    2013-04-01

    Full Text Available Histone variants, including histone H2A.Z, are incorporated into specific genomic sites and participate in transcription regulation. The role of H2A.Z at these sites remains poorly characterized. Our study investigates changes in the chromatin environment at the Cyclin D1 gene (CCND1 during transcriptional initiation in response to estradiol in estrogen receptor positive mammary tumour cells. We show that H2A.Z is present at the transcription start-site and downstream enhancer sequences of CCND1 when the gene is poorly transcribed. Stimulation of CCND1 expression required release of H2A.Z concomitantly from both these DNA elements. The AAA+ family members TIP48/reptin and the histone variant H2A.Z are required to remodel the chromatin environment at CCND1 as a prerequisite for binding of the estrogen receptor (ERα in the presence of hormone. TIP48 promotes acetylation and exchange of H2A.Z, which triggers a dissociation of the CCND1 3' enhancer from the promoter, thereby releasing a repressive intragenic loop. This release then enables the estrogen receptor to bind to the CCND1 promoter. Our findings provide new insight into the priming of chromatin required for transcription factor access to their target sequence. Dynamic release of gene loops could be a rapid means to remodel chromatin and to stimulate transcription in response to hormones.

  4. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  5. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  6. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  7. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  8. The in vivo estrogenic and in vitro anti-estrogenic activity of permethrin and bifenthrin

    OpenAIRE

    Brander, Susanne M.; He, Guochun; Smalling, Kelly L.; Denison, Michael S.; Cherr, Gary N.

    2012-01-01

    Pyrethroids are highly toxic to fish at parts per billion or parts per trillion concentrations. Their intended mechanism is prolonged sodium channel opening, but recent studies reveal that pyrethroids such as permethrin and bifenthrin also have endocrine activity. Additionally, metabolites may have greater endocrine activity than parent compounds. We evaluated the in vivo concentration-dependent ability of bifenthrin and permethrin to induce choriogenin (an estrogen-responsive protein) in Men...

  9. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  10. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  11. Intratumoral estrogen production and actions in luminal A type invasive lobular and ductal carcinomas.

    Science.gov (United States)

    Takagi, Mayu; Miki, Yasuhiro; Miyashita, Minoru; Hata, Shuko; Yoda, Tomomi; Hirakawa, Hisashi; Sagara, Yasuaki; Rai, Yoshiaki; Ohi, Yasuyo; Tamaki, Kentaro; Ishida, Takanori; Suzuki, Takashi; Ouchi, Noriaki; Sasano, Hironobu

    2016-02-01

    The great majority of invasive lobular carcinoma (ILC) is estrogen-dependent luminal A type carcinoma but the details of estrogen actions and its intratumoral metabolism have not been well studied compared to invasive ductal carcinoma (IDC). We first immunolocalized estrogen-related enzymes including estrogen sulfotransferase (EST), estrogen sulfatase (STS), 17β-hydroxysteroid dehydrogenase (HSD) 1/2, and aromatase. We then evaluated the tissue concentrations of estrogens in ILC and IDC and subsequently estrogen-responsive gene profiles in these tumors in order to explore the possible differences and/or similarity of intratumoral estrogen environment of these two breast cancer subtypes. The status of STS and 17βHSD1 was significantly lower in ILCs than IDCs (p = 0.022 and p < 0.0001), but that of EST and 17βHSD2 vice versa (p < 0.0001 and p = 0.0106). In ILCs, tissue concentrations of estrone and estradiol were lower than those in IDCs (p = 0.0709 and 0.069). In addition, the great majority of estrogen response genes tended to be lower in ILCs. Among those genes above, FOXP1 was significantly higher in ILCs than in IDCs (p = 0.002). FOXP1 expression was reported to be significantly higher in relapse-free IDC patients treated with tamoxifen. Therefore, tamoxifen may be considered an option of endocrine therapy for luminal A type ILC patients. This is the first study to demonstrate the detailed and comprehensive status of intratumoral production and metabolism of estrogens and the status of estrogen response genes in luminal A-like ILC with comparison to those in luminal A-like IDCs.

  12. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

    Science.gov (United States)

    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J

    2016-03-01

    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  13. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  14. Estrogen induction of telomerase activity through regulation of the mitogen-activated protein kinase (MAPK dependent pathway in human endometrial cancer cells.

    Directory of Open Access Journals (Sweden)

    Chunxiao Zhou

    Full Text Available Given that prolonged exposure to estrogen and increased telomerase activity are associated with endometrial carcinogenesis, our objective was to evaluate the interaction between the MAPK pathway and estrogen induction of telomerase activity in endometrial cancer cells. Estradiol (E2 induced telomerase activity and hTERT mRNA expression in the estrogen receptor (ER-α positive, Ishikawa endometrial cancer cell line. UO126, a highly selective inhibitor of MEK1/MEK2, inhibited telomerase activity and hTERT mRNA expression induced by E2. Similar results were also found after transfection with ERK 1/2-specific siRNA. Treatment with E2 resulted in rapid phosphorylation of p44/42 MAPK and increased MAPK activity which was abolished by UO126. The hTERT promoter contains two estrogen response elements (EREs, and luciferase assays demonstrate that these EREs are activated by E2. Exposure to UO126 or ERK 1/2-specific siRNA in combination with E2 counteracted the stimulatory effect of E2 on luciferase activity from these EREs. These findings suggest that E2-induction of telomerase activity is mediated via the MAPK pathway in human endometrial cancer cells.

  15. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  16. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  17. Urinary estrogen metabolites and self-reported infertility in women infected with Schistosoma haematobium.

    Directory of Open Access Journals (Sweden)

    Júlio Santos

    Full Text Available BACKGROUND: Schistosomiasis is a neglected tropical disease, endemic in 76 countries, that afflicts more than 240 million people. The impact of schistosomiasis on infertility may be underestimated according to recent literature. Extracts of Schistosoma haematobium include estrogen-like metabolites termed catechol-estrogens that down regulate estrogen receptors alpha and beta in estrogen responsive cells. In addition, schistosome derived catechol-estrogens induce genotoxicity that result in estrogen-DNA adducts. These catechol estrogens and the catechol-estrogen-DNA adducts can be isolated from sera of people infected with S. haematobium. The aim of this study was to study infertility in females infected with S. haematobium and its association with the presence of schistosome-derived catechol-estrogens. METHODOLOGY/PRINCIPAL FINDINGS: A cross-sectional study was undertaken of female residents of a region in Bengo province, Angola, endemic for schistosomiasis haematobia. Ninety-three women and girls, aged from two (parents interviewed to 94 years were interviewed on present and previous urinary, urogenital and gynecological symptoms and complaints. Urine was collected from the participants for egg-based parasitological assessment of schistosome infection, and for liquid chromatography diode array detection electron spray ionization mass spectrometry (LC/UV-DAD/ESI-MSn to investigate estrogen metabolites in the urine. Novel estrogen-like metabolites, potentially of schistosome origin, were detected in the urine of participants who were positive for eggs of S. haematobium, but not detected in urines negative for S. haematobium eggs. The catechol-estrogens/ DNA adducts were significantly associated with schistosomiasis (OR 3.35; 95% CI 2.32-4.84; P≤0.001. In addition, presence of these metabolites was positively associated with infertility (OR 4.33; 95% CI 1.13-16.70; P≤0.05. CONCLUSIONS/SIGNIFICANCE: Estrogen metabolites occur widely in diverse

  18. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  19. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  20. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  1. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  2. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  4. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  5. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  6. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  7. Studies on the mechanism of functional cooperativity between progesterone and estrogen receptors.

    Science.gov (United States)

    Bradshaw, M S; Tsai, S Y; Leng, X H; Dobson, A D; Conneely, O M; O'Malley, B W; Tsai, M J

    1991-09-05

    Steroid response elements (SREs) cooperate with many different cis-acting elements including NF-1 sites, CACCC boxes, and other SREs to induce target gene expression (Schule, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332, 87-90; Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395). Induction of gene expression can be additive or synergistic with respect to the level of activation by either transactivators. Two mechanisms have been proposed for how synergism occurs: 1) cooperative binding of transcriptional activators to DNA or 2) simultaneous interaction of individually bound activators with a common target protein. We have shown previously that cooperative binding of receptors is important for synergism between two progesterone response elements (PREs). Here we showed that an estrogen response element (ERE) and a PRE can also functionally cooperate and this synergism between an ERE and a PRE is not contributed by cooperative DNA binding. Furthermore, we have demonstrated that the activation domains of the progesterone receptor (PR) (C1Act) are required for synergism between two PREs and sufficient for confirming cooperative binding. However these two activation domains of PR are not sufficient for synergism between an ERE and a PRE. Additional regions within the NH2-terminal and COOH-terminal domains are also required for synergistic interaction between two heterologous SREs.

  8. ERE environment- and cell type-specific transcriptional effects of estrogen in normal endometrial cells.

    Science.gov (United States)

    Lascombe, I; Sallot, M; Vuillermoz, C; Weisz, A; Adessi, G L; Jouvenot, M

    1998-04-30

    Our previous results have suggested a repression of E2 (17beta-estradiol) effect on the c-fos gene of cultured guinea-pig endometrial cells. To investigate this repression, the expression of three human c-fos gene recombinants, pFC1-BL (-2250/+41), pFC2-BL (-1400/+41) and pFC2E (-1300/-1050 and -230/+41), known to be E2-responsive in Hela cells, was studied in stromal (SC) and glandular epithelial cells (GEC). In both cellular types, pFC1-BL was not induced by E2, even in the presence of growth factors or co-transfected estrogen receptor. The pattern of pFC2-BL and pFC2E expression was strikingly different and depended on the cellular type: pFC2-BL and pFC2E induction was restricted to the glandular epithelial cells and did not occur in the SCs. We argue for a repression of E2 action which is dependent on the estrogen-responsive cis-acting element (ERE) environment and also cell type-specific involving DNA/protein and/or protein/protein interactions with cellular type-specific factors.

  9. Mixture interactions of xenoestrogens with endogenous estrogens.

    Science.gov (United States)

    There is growing concern of exposure to fish, wildlife, and humans to water sources contaminated with estrogens and the potential impact on reproductive health. These environmental estrogens originate from various sources including concentrated animal feedlot operations (CAFO), m...

  10. DNA and chromosome breaks induced by 123I-estrogen in CHO cells

    International Nuclear Information System (INIS)

    Schwartz, J.L.

    1997-01-01

    The effects of the Auger electron-emitting isotope I-123, covalently bound to estrogen, on DNA single- and double-strand breakage and on chromosome breakage was determined in estrogen positive Chinese hamster ovary (CHO-ER) cells. Exposure to the 123 I-estrogen induced both single- and double-strand breaks with a ratio of single- to double-strand breaks of 2.2. The corresponding ratio with 60 Co gamma rays was 15.6. The dose-response was biphasic suggesting that either receptor sites are saturated at high does, or that there is a nonrandom distribution of breaks induced by the 123 I-estrogen. The 123 I-estrogen treatment induced chromosome aberrations with an efficiency of about 1 aberration for each 1,000 disintegrations per cell. This corresponds to the mean lethal dose of 123 I-estrogen for these cells suggesting that the lethal event induced by the Auger electron emitter bound to estrogen is a chromosome aberration. Most of the chromosome-type aberrations were dicentrics and rings, suggesting that 123 I-estrogen-induced chromosome breaks are rejoined. The F-ratio, the ratio of dicentrics to centric rings, was 5.8 ± 1.7, which is similar to that seen with high LET radiations. Their results suggest that I-123 bound to estrogen is an efficient clastogenic agent, that the cytotoxic damage produced by I-123 bound to estrogen is very like high LET-induced damage, and the I-123 in the estrogen-receptor-DNA complex is probably in close proximity to the sugar-phosphate backbone of the DNA

  11. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  12. Immune-Specific Expression and Estrogenic Regulation of the Four Estrogen Receptor Isoforms in Female Rainbow Trout (Oncorhynchus mykiss

    Directory of Open Access Journals (Sweden)

    Ayako Casanova-Nakayama

    2018-03-01

    Full Text Available Genomic actions of estrogens in vertebrates are exerted via two intracellular estrogen receptor (ER subtypes, ERα and ERβ, which show cell- and tissue-specific expression profiles. Mammalian immune cells express ERs and are responsive to estrogens. More recently, evidence became available that ERs are also present in the immune organs and cells of teleost fish, suggesting that the immunomodulatory function of estrogens has been conserved throughout vertebrate evolution. For a better understanding of the sensitivity and the responsiveness of the fish immune system to estrogens, more insight is needed on the abundance of ERs in the fish immune system, the cellular ratios of the ER subtypes, and their autoregulation by estrogens. Consequently, the aims of the present study were (i to determine the absolute mRNA copy numbers of the four ER isoforms in the immune organs and cells of rainbow trout, Oncorhynchus mykiss, and to compare them to the hepatic ER numbers; (ii to analyse the ER mRNA isoform ratios in the immune system; and, (iii finally, to examine the alterations of immune ER mRNA expression levels in sexually immature trout exposed to 17β-estradiol (E2, as well as the alterations of immune ER mRNA expression levels in sexually mature trout during the reproductive cycle. All four ER isoforms were present in immune organs—head kidney, spleen-and immune cells from head kidney and blood of rainbow trout, but their mRNA levels were substantially lower than in the liver. The ER isoform ratios were tissue- and cell-specific, both within the immune system, but also between the immune system and the liver. Short-term administration of E2 to juvenile female trout altered the ER mRNA levels in the liver, but the ERs of the immune organs and cells were not responsive. Changes of ER gene transcript numbers in immune organs and cells occurred during the reproductive cycle of mature female trout, but the changes in the immune ER profiles differed

  13. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  14. Estrogenic and pregnancy interceptory effects of Achyranthes ...

    African Journals Online (AJOL)

    ... the dose of 200 mg/kg body weight also exhibited estrogenic activity. Histological studies of the uterus were carried out to confirm this estrogenic activity. Keywords: Achyranthes aspera; antifertility; anti-implantation; estrogenic; uterotropic. The African Journal of Traditional, Complementary and Alternative Medicines Vol.

  15. Removal of steroid estrogens from wastewater using granular activated carbon: comparison between virgin and reactivated carbon.

    Science.gov (United States)

    Rowsell, Victoria Francesca; Pang, Dawn Sok Cheng; Tsafou, Foteini; Voulvoulis, Nikolaos

    2009-04-01

    This research was set up in response to new European legislation to identify cost-effective treatment for removal of steroid estrogens from effluent. This study aimed to compare estrogen removal of two types of granular activated carbon: virgin (F400) and reactivated (C401) carbon. Rapid, small-scale column tests were conducted with a total bed volume of 24.9 cm3 over three columns, and analysis was carried out using high-performance liquid chromatography. Results demonstrated that C401 performed more efficiently with greater than or equal to 81% estrogen removal in wastewater compared to F400 which produced greater than or equal to 65% estrogen removal. Estrogen removal can be affected by competitive adsorption from natural organic matter present in wastewater. In addition, the physical properties of each carbon had the potential to influence adsorption differently, thus resulting in the observed varied adsorption capability of the two carbons.

  16. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  17. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  18. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  19. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  20. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  1. Vaginal estrogen: a dual-edged sword in postoperative healing of the vaginal wall.

    Science.gov (United States)

    Ripperda, Christopher M; Maldonado, Pedro Antonio; Acevedo, Jesus F; Keller, Patrick W; Akgul, Yucel; Shelton, John M; Word, Ruth Ann

    2017-07-01

    Reconstructive surgery for pelvic organ prolapse is plagued with high failure rates possibly due to impaired healing or regeneration of the vaginal wall. Here, we tested the hypothesis that postoperative administration of local estrogen, direct injection of mesenchymal stem cells (MSCs), or both lead to improved wound healing of the injured vagina in a menopausal rat model. Ovariectomized rats underwent surgical injury to the posterior vaginal wall and were randomized to treatment with placebo (n = 41), estrogen cream (n = 47), direct injection of MSCs (n = 39), or both (n = 43). MSCs did not survive after injection and had no appreciable effects on healing of the vaginal wall. Acute postoperative administration of vaginal estrogen altered the response of the vaginal wall to injury with decreased stiffness, decreased collagen content, and decreased expression of transcripts for matrix components in the stromal compartment. Conversely, vaginal estrogen resulted in marked proliferation of the epithelial layer and increased expression of genes related to epithelial barrier function and protease inhibition. Transcripts for genes involved in chronic inflammation and adaptive immunity were also down-regulated in the estrogenized epithelium. Collectively, these data indicate that, in contrast to the reported positive effects of preoperative estrogen on the uninjured vagina, acute administration of postoperative vaginal estrogen has adverse effects on the early phase of healing of the stromal layer. In contrast, postoperative estrogen plays a positive role in healing of the vaginal epithelium after injury.

  2. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  3. Detecting estrogenic activity in water samples withestrogen-sensitive yeast cells using spectrophotometry and fluorescencemicroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wozei, E.; Holman, H-Y.N.; Hermanowicz, S.W.; Borglin S.

    2006-03-15

    Environmental estrogens are environmental contaminants that can mimic the biological activities of the female hormone estrogen in the endocrine system, i.e. they act as endocrine disrupters. Several substances are reported to have estrogen-like activity or estrogenic activity. These include steroid hormones, synthetic estrogens (xenoestrogens), environmental pollutants and phytoestrogens (plant estrogens). Using the chromogenic substrate ortho-nitrophenyl-{beta}-D-galactopyranoside (ONPG) we show that an estrogen-sensitive yeast strain RMY/ER-ERE, with human estrogen receptor (hER{alpha}) gene and the lacZ gene which encodes the enzyme {beta}-galactosidase, is able to detect estrogenic activity in water samples over a wide range of spiked concentrations of the hormonal estrogen 17{beta}-estradiol (E2). Ortho-nitrophenol (ONP), the yellow product of this assay can be detected using spectrophotometry but requires cell lysis to release the enzyme and allow product formation. We improved this aspect in a fluorogenic assay by using fluorescein di-{beta}-D-galactopyranoside (FDG) as a substrate. The product was visualized using fluorescence microscopy without the need to kill, fix or lyse the cells. We show that in live yeast cells, the uptake of E2 and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximum enzyme-catalyzed fluorescent product formation evident after about 30 minutes of exposure to E2. The fluorogenic assay was applied to a selection of estrogenic compounds and the Synchrotron-based Fourier transform infrared (SR-FTIR) spectra of the cells obtained to better understand the yeast whole cell response to the compounds. The fluorogenic assay is most sensitive to E2, but the SR-FTIR spectra suggest that the cells respond to all the estrogenic compounds tested even when no fluorescent response was detected. These findings are promising and may shorten the duration of environmental water screening and monitoring regimes using

  4. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  5. Assessment of the potential activity of major dietary compounds as selective estrogen receptor modulators in two distinct cell models for proliferation and differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Lecomte, Sylvain; Lelong, Marie; Bourgine, Gaëlle [Institut de Recherche en Santé-Environnement-Travail (IRSET), Inserm UMR 1085, Team Transcription, Environment and Cancer, University of Rennes 1, 9 Avenue du Pr Léon Bernard, 35000 Rennes (France); Efstathiou, Theo [Laboratoire Nutrinov, Technopole Atalante Champeaux, 8 rue Jules Maillard de la Gournerie, 35012 Rennes Cedex (France); Saligaut, Christian [Institut de Recherche en Santé-Environnement-Travail (IRSET), Inserm UMR 1085, Team Transcription, Environment and Cancer, University of Rennes 1, 9 Avenue du Pr Léon Bernard, 35000 Rennes (France); Pakdel, Farzad, E-mail: farzad.pakdel@univ-rennes1.fr [Institut de Recherche en Santé-Environnement-Travail (IRSET), Inserm UMR 1085, Team Transcription, Environment and Cancer, University of Rennes 1, 9 Avenue du Pr Léon Bernard, 35000 Rennes (France)

    2017-06-15

    Estrogen receptors (ERs) α and β are distributed in most tissues of women and men. ERs are bound by estradiol (E2), a natural hormone, and mediate the pleiotropic and tissue-specific effects of E2, such as proliferation of breast epithelial cells or protection and differentiation of neuronal cells. Numerous environmental molecules, called endocrine disrupting compounds, also interact with ERs. Phytoestrogens belong to this large family and are considered potent therapeutic molecules that act through their selective estrogen receptor modulator (SERM) activity. Using breast cancer cell lines as a model of estrogen-dependent proliferation and a stably ER-expressing PC12 cell line as a model of neuronal differentiating cells, we studied the SERM activity of major dietary compounds, such as apigenin, liquiritigenin, daidzein, genistein, coumestrol, resveratrol and zearalenone. The ability of these compounds to induce ER-transactivation and breast cancer cell proliferation and enhance Nerve Growth Factor (NGF) -induced neuritogenesis was assessed. Surprisingly, although all compounds were able to activate the ER through an estrogen responsive element reporter gene, they showed differential activity toward proliferation or differentiation. Apigenin and resveratrol showed a partial or no proliferative effect on breast cancer cells but fully contributed to the neuritogenesis effect of NGF. However, daidzein and zearalenone showed full effects on cellular proliferation but did not induce cellular differentiation. In summary, our results suggest that the therapeutic potential of phytoestrogens can diverge depending on the molecule and the phenotype considered. Hence, apigenin and resveratrol might be used in the development of therapeutics for breast cancer and brain diseases. - Highlights: • SERM activity of dietary compounds on proliferation and differentiation is studied. • All the dietary compounds tested transactivate estrogen receptors. • Apigenin and

  6. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  7. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  8. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  9. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  11. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  12. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  13. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  14. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  15. Small leucine zipper protein functions as a negative regulator of estrogen receptor α in breast cancer.

    Directory of Open Access Journals (Sweden)

    Juyeon Jeong

    Full Text Available The nuclear transcription factor estrogen receptor α (ERα plays a critical role in breast cancer progression. ERα acts as an important growth stimulatory protein in breast cancer and the expression level of ERα is tightly related to the prognosis and treatment of patients. Small leucine zipper protein (sLZIP functions as a transcriptional cofactor by binding to various nuclear receptors, including glucocorticoid receptor, androgen receptor, and peroxisome proliferator-activated receptor γ. However, the role of sLZIP in the regulation of ERα and its involvement in breast cancer progression is unknown. We found that sLZIP binds to ERα and represses the transcriptional activity of ERα in ERα-positive breast cancer cells. sLZIP also suppressed the expression of ERα target genes. sLZIP disrupted the binding of ERα to the estrogen response element of the target gene promoter, resulting in suppression of cell proliferation. sLZIP is a novel co-repressor of ERα, and plays a negative role in ERα-mediated cell proliferation in breast cancer.

  16. Mal-Development of the Penis and Loss of Fertility in Male Rats Treated Neonatally with Female Contraceptive 17α-Ethinyl Estradiol: A Dose-Response Study and a Comparative Study with a Known Estrogenic Teratogen Diethylstilbestrol

    Science.gov (United States)

    Mathews, Ensa; Braden, Tim D.; Williams, Carol S.; Williams, John W.; Bolden-Tiller, Olga; Goyal, Hari O.

    2009-01-01

    The objectives of this study were to find a minimal dose of 17α-ethinyl estradiol (EE) that is detrimental to the developing penis and fertility and to compare estrogenic effects between EE and diethylstilbestrol (DES). Neonatal rats received EE at 10 ng (1 μg/kg), 100 ng, 1 μg, or 10 μg per pup on alternate days from postnatal days 1 to 11 (dose-response study) or received EE or DES at 100 ng per pup daily from postnatal days 1 to 6 (comparative study). Effects of EE were dose dependent, with ≥ 100-ng dose inducing significant (p penis was malformed, characterized by underdeveloped os penis and accumulation of fat cells. Fertility was 0% in the ≥ 1-μg groups, in contrast to 60% in the 100-ng group and 100% in the 10-ng and control groups. Animals treated with ≥ 10 ng had significant reductions in the weight of bulbospongious muscle, testis, seminal vesicle, epididymal fat pad, and in epididymal sperm numbers. A comparison of EE and DES effects showed similar reductions in penile weight and length and the weight of bulbospongiosus muscle, testis, seminal vesicle, epididymis, and epididymal fat pad in both adolescent and adult rats. While 5/6 control males sired, only 1/6 in the EE group and 0/6 in the DES group sired. Hence, neonatal exposure to EE at 10 ng (environmentally relevant dose) adversely affects male reproductive organs. A dose ten times higher than this leads to permanently mal-developed penis and infertility. Furthermore, EE and DES exposures show similar level of toxicity to male reproductive organs. PMID:19729556

  17. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  18. Temporal profile of estrogen-dependent gene expression in LHRH-producing GT1-7 cells.

    Science.gov (United States)

    Varju, Patricia; Chang, Ken C; Hrabovszky, Erik; Merchenthaler, István; Liposits, Zsolt

    2009-02-01

    The long-term cellular effects of estrogens are mediated by nuclear estrogen receptors which act as transcription factors to regulate gene expression. Hypothalamic targets of estrogen action include luteinizing hormone-releasing hormone-secreting neurons controlling reproduction in vertebrates. Microarray analysis and qRT-PCR studies were performed on GT1-7, immortalized LHRH neurons after 17beta-estradiol treatment to reveal the nature of estrogen-regulated genes and the time course of changes in their expression profile. More than 1000 transcripts showed robust responses to estrogen treatment and the majority of responding genes were up-regulated. Early-responding genes showed altered expression 0.5-2h after estrogen exposure, whereas late-responding genes changed after 24-48h treatment. Up-regulated genes encoded transcription factors, molecules involved in cellular movement, cell death, immune response, neurotransmitter and neuropeptide receptors, ion channels and transporters. The 17beta-estradiol modulation of 12 genes - representing characteristic gene clusters - has been confirmed by qRT-PCR. Our studies highlighted diverse gene networks, cell regulatory mechanisms and metabolic pathways through which estrogen may alter gene expression in immortalized LHRH neurons. The findings also support the notion that genomic effects of estrogen targeting in vivo directly the LHRH neuronal network of mammals play an important role in the central feedback regulation of the reproductive axis by estrogen.

  19. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  20. Central estrogenic pathways protect against the depressant action of acute nicotine on reflex tachycardia in female rats

    International Nuclear Information System (INIS)

    El-Mas, Mahmoud M.; Fouda, Mohamed A.; El-gowilly, Sahar M.; Saad, Evan I.

    2012-01-01

    We have previously shown that acute exposure of male rats to nicotine preferentially attenuates baroreceptor-mediated control of reflex tachycardia in contrast to no effect on reflex bradycardia. Here, we investigated whether female rats are as sensitive as their male counterparts to the baroreflex depressant effect of nicotine and whether this interaction is modulated by estrogen. Baroreflex curves relating reflex chronotropic responses evoked by i.v. doses (1–16 μg/kg) of phenylephrine (PE) or sodium nitroprusside (SNP), were constructed in conscious freely moving proestrus, ovariectomized (OVX), and estrogen (50 μg/kg/day s.c., 5 days)-replaced OVX (OVXE 2 ) rats. Slopes of the curves were taken as a measure of baroreflex sensitivity (BRS PE and BRS SNP ). Nicotine (100 μg/kg i.v.) reduced BRS SNP in OVX rats but not in proestrus or OVXE 2 rats. The attenuation of reflex tachycardia by nicotine was also evident in diestrus rats, which exhibited plasma estrogen levels similar to those of OVX rats. BRS PE was not affected by nicotine in all rat preparations. Experiments were then extended to determine whether central estrogenic receptors modulate the nicotine–BRS SNP interaction. Intracisteral (i.c.) treatment of OVX rats with estrogen sulfate (0.2 μg/rat) abolished the BRS SNP attenuating effect of i.v. nicotine. This protective effect of estrogen disappeared when OVX rats were pretreated with i.c. ICI 182,780 (50 μg/rat, selective estrogen receptor antagonist). Together, these findings suggest that central neural pools of estrogen receptors underlie the protection offered by E 2 against nicotine-induced baroreceptor dysfunction in female rats. -- Highlights: ► Estrogen protects against the depressant effect of nicotine on reflex tachycardia. ► The baroreflex response and estrogen status affect the nicotine–BRS interaction. ► The protection offered by estrogen is mediated via central estrogen receptors.

  1. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  2. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  3. Twenty years of the G protein-coupled estrogen receptor GPER: Historical and personal perspectives.

    Science.gov (United States)

    Barton, Matthias; Filardo, Edward J; Lolait, Stephen J; Thomas, Peter; Maggiolini, Marcello; Prossnitz, Eric R

    2018-02-01

    Estrogens play a critical role in many aspects of physiology, particularly female reproductive function, but also in pathophysiology, and are associated with protection from numerous diseases in premenopausal women. Steroids and the effects of estrogen have been known for ∼90 years, with the first evidence for a receptor for estrogen presented ∼50 years ago. The original ancestral steroid receptor, extending back into evolution more than 500 million years, was likely an estrogen receptor, whereas G protein-coupled receptors (GPCRs) trace their origins back into history more than one billion years. The classical estrogen receptors (ERα and ERβ) are ligand-activated transcription factors that confer estrogen sensitivity upon many genes. It was soon apparent that these, or novel receptors may also be responsible for the "rapid"/"non-genomic" membrane-associated effects of estrogen. The identification of an orphan GPCR (GPR30, published in 1996) opened a new field of research with the description in 2000 that GPR30 expression is required for rapid estrogen signaling. In 2005-2006, the field was greatly stimulated by two studies that described the binding of estrogen to GPR30-expressing cell membranes, followed by the identification of a GPR30-selective agonist (that lacked binding and activity towards ERα and ERβ). Renamed GPER (G protein-coupled estrogen receptor) by IUPHAR in 2007, the total number of articles in PubMed related to this receptor recently surpassed 1000. In this article, the authors present personal perspectives on how they became involved in the discovery and/or advancement of GPER research. These areas include non-genomic effects on vascular tone, receptor cloning, molecular and cellular biology, signal transduction mechanisms and pharmacology of GPER, highlighting the roles of GPER and GPER-selective compounds in diseases such as obesity, diabetes, and cancer and the obligatory role of GPER in propagating cardiovascular aging, arterial

  4. Estrogen and Breast Cancer

    National Research Council Canada - National Science Library

    Russo, Jose

    2004-01-01

    .... MCFlOF cells is ER-alpha negative, although, they ER-beta positive that could indicate that the response of the cells to growth and form colonies in agar methocel could be mediated by this receptor...

  5. The combined effects of pituitary gonadotropin and estrogen on the ovarian response of rats to /sup 125/I-LH uptake

    Energy Technology Data Exchange (ETDEWEB)

    Hosomichi, T; Yoshida, H; Ichinohe, K [Wakayama Medical Coll. (Japan)

    1974-12-01

    It discussed the effect of estradiol on the ovarian response of mature rats and hypophysectomized mature rats to /sup 125/I-LH uptake and the combined effects of FSH and estradiol. The constant concentration on the change of blood concentration with time was maintained in about one hour when given with the intravenous infusion of /sup 125/I-LH prepared for radioimmunoassay. Moreover, increased uptake of /sup 125/I-LH was noted especially in ovaries, livers, kidneys and thyroid glands, and by giving estradiol the uptake was increased to a level which was about twice the normal. Of hypophysectomized rats, the uptake was increased to a level which was about four times the normal in the group of rats which were given estradiol for eight days and also in the group of rats which were given FSH for four days. The effect with four-day-estradiol administration following four-day-FSH administration was to increase to a level which was about six times the group which was given each single administration. These experimental results are apparently due to the effects of FSH and estradiol on follicles and thus follicles are ready for LH uptake.

  6. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  7. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  8. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  9. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  10. Estrogen receptor-a in the medial amygdala prevents stress-induced elevations in blood pressure in females

    Science.gov (United States)

    Psychological stress contributes to the development of hypertension in humans. The ovarian hormone, estrogen, has been shown to prevent stress-induced pressor responses in females by unknown mechanisms. Here, we showed that the antihypertensive effects of estrogen during stress were blunted in femal...

  11. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Juanjuan, E-mail: jwu32@emory.edu [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Williams, Devin [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Walter, Grant A. [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Thompson, Winston E. [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Sidell, Neil [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States)

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  12. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  13. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  14. [Roles of G protein-coupled estrogen receptor in the male reproductive system].

    Science.gov (United States)

    Chen, Kai-hong; Zhang, Xian; Jiang, Xue-wu

    2016-02-01

    The G protein-coupled estrogen receptor (GPER), also known as G protein-coupled receptor 30 (GPR30), was identified in the recent years as a functional membrane receptor different from the classical nuclear estrogen receptors. This receptor is widely expressed in the cortex, cerebellum, hippocampus, heart, lung, liver, skeletal muscle, and the urogenital system. It is responsible for the mediation of nongenomic effects associated with estrogen and its derivatives, participating in the physiological activities of the body. The present study reviews the molecular structure, subcellular localization, signaling pathways, distribution, and function of GPER in the male reproductive system.

  15. Mitochondria: Target organelles for estrogen action

    Directory of Open Access Journals (Sweden)

    Małgorzata Chmielewska

    2017-06-01

    Full Text Available Estrogens belong to a group of sex hormones, which have been shown to act in multidirectional way. Estrogenic effects are mediated by two types of intracellular receptors: estrogen receptor 1 (ESR1 and estrogen receptor 2 (ESR2. There are two basic mechanisms of estrogen action: 1 classical-genomic, in which the ligand-receptor complex acts as a transcriptional factor and 2 a nongenomic one, which is still not fully understood, but has been seen to lead to distinct biological effects, depending on tissue and ligand type. It is postulated that nongenomic effects may be associated with membrane signaling and the presence of classical nuclear receptors within the cell membrane. Estrogens act in a multidirectional way also within cell organelles. It is assumed that there is a mechanism which manages the migration of ESR into the mitochondrial membrane, wherein the exogenous estrogen affect the morphology of mitochondria. Estrogen, through its receptor, can directly modulate mitochondrial gene expression. Moreover, by regulating the level of reactive oxygen species, estrogens affect the biology of mitochondria. The considerations presented in this paper indicate the pleiotropic effects of estrogens, which represent a multidirectional pathway of signal transduction.

  16. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  17. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  18. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  19. Estrogen Treatment in Multiple Sclerosis

    OpenAIRE

    Gold, Stefan M; Voskuhl, Rhonda R

    2009-01-01

    Currently available treatments for multiple sclerosis reduce inflammatory lesions on MRI and decrease clinical relapses but have limited effects on disability. Novel treatment options that target both the inflammatory as well as the neurodegenerative component of the disease are therefore needed. A growing body of evidence from basic science and clinical studies supports the therapeutic potential of estrogens in MS. Mechanisms of action include both immunomodulatory and directly neuroprotecti...

  20. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  1. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  2. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  3. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  4. The estrogen-injected female mouse: new insight into the etiology of PCOS

    Directory of Open Access Journals (Sweden)

    Freeh Steven M

    2009-05-01

    Full Text Available Abstract Background Female mice and rats injected with estrogen perinatally become anovulatory and develop follicular cysts. The current consensus is that this adverse response to estrogen involves the hypothalamus and occurs because of an estrogen-induced alteration in the GnRH delivery system. Whether or not this is true has yet to be firmly established. The present study examined an alternate possibility in which anovulation and cyst development occurs through an estrogen-induced disruption in the immune system, achieved through the intermediation of the thymus gland. Methods, Results and Conclusion A putative role for the thymus in estrogen-induced anovulation and follicular cyst formation (a model of PCOS was examined in female mice by removing the gland prior to estrogen injection. Whereas all intact, female mice injected with 20 ug estrogen at 5–7 days of age had ovaries with follicular cysts, no cysts were observed in animals in which thymectomy at 3 days of age preceded estrogen injection. In fact, after restoring immune function by thymocyte replacement, the majority of thymectomized, estrogen-injected mice had ovaries with corpora lutea. Thus, when estrogen is unable to act on the thymus, ovulation occurs and follicular cysts do not develop. This implicates the thymus in the cysts' genesis and discounts the role of the hypothalamus. Subsequent research established that the disease is transferable by lymphocyte infusion. Transfer took place between 100-day-old estrogen-injected and 15-day-old naïve mice only when recipients were thymectomized at 3 days of age. Thus, a prerequisite for cyst formation is the absence of regulatory T cells. Their absence in donor mice was judged to be the result of an estrogen-induced increase in the thymus' vascular permeability, causing de facto circumvention of the final stages of regulatory T cell development. The human thymus has a similar vulnerability to steroid action during the fetal stage. We

  5. Comparison of six different sewage treatment processes-Reduction of estrogenic substances and effects on gene expression in exposed male fish

    International Nuclear Information System (INIS)

    Gunnarsson, L.; Adolfsson-Erici, M.; Bjoerlenius, B.; Rutgersson, C.; Foerlin, L.; Larsson, D.G.J.

    2009-01-01

    Treated sewage effluents often contain a mixture of estrogenic compounds in low concentrations. The total combined activity of these, however, may be sufficiently high to affect the reproduction of aquatic vertebrates. The introduction of advanced treatment technologies has been suggested as a way to remove micro-contaminants, including estrogenic substances. In this study, one municipal influent was treated with six different processes in parallel on a semi-large scale in order to assess their potential to reduce substances that could contribute to estrogenic effects in male fish. The effluent from a conventional, activated sludge treatment line was compared to a similarly treated effluent with a final sand-filtering step. The addition of ozonation (15 g O 3 /m 3 ), a moving bed biofilm reactor (MBBR) or both in combination was also evaluated. There was also a separate treatment line that was based on a membrane bioreactor. A small battery of hepatic estrogen-responsive genes was measured in the exposed fish using quantitative PCR. Concentrations of steroid estrogens and estrogenic phenols in the effluents were measured by GC-ECNI-MS. The ozonated effluents were the only tested effluents for which all measured biological effects in exposed fish were removed. Chemical data suggested that the MBBR technology was equally effective in removing the analyzed estrogens; however, elevated expression of estrogen-responsive genes suggested that some estrogenic substances were still present in the effluent. The membrane bioreactor removed most of the measured estrogens and it reduced the induction of the estrogen-responsive genes. However, fish exposed to this effluent had significantly enlarged livers. Given that the same influent was treated in parallel with a broad set of technologies and that the chemical analyses were combined with an in vivo assessment of estrogenic responses, this study provides valuable input into the assessment of advanced treatment processes for

  6. Distinct Effects of Estrogen on Mouse Maternal Behavior: The Contribution of Estrogen Synthesis in the Brain

    Science.gov (United States)

    Murakami, Gen

    2016-01-01

    Estrogen surge following progesterone withdrawal at parturition plays an important role in initiating maternal behavior in various rodent species. Systemic estrogen treatment shortens the latency to onset of maternal behavior in nulliparous female rats that have not experienced parturition. In contrast, nulliparous laboratory mice show rapid onset of maternal behavior without estrogen treatment, and the role of estrogen still remains unclear. Here the effect of systemic estrogen treatment (for 2 h, 1 day, 3 days, and 7 days) after progesterone withdrawal was examined on maternal behavior of C57BL/6 mice. This estrogen regimen led to different effects on nursing, pup retrieval, and nest building behaviors. Latency to nursing was shortened by estrogen treatment within 2 h. Moreover, pup retrieval and nest building were decreased. mRNA expression was also investigated for estrogen receptor α (ERα) and for genes involved in regulating maternal behavior, specifically, the oxytocin receptor (OTR) and vasopressin receptor in the medial amygdala (MeA) and medial preoptic area (MPOA). Estrogen treatment led to decreased ERα mRNA in both regions. Although OTR mRNA was increased in the MeA, OTR and vasopressin receptor mRNA were reduced in the MPOA, showing region-dependent transcription regulation. To determine the mechanisms for the actions of estrogen treatment, the contribution of estrogen synthesis in the brain was examined. Blockade of estrogen synthesis in the brain by systemic letrozole treatment in ovariectomized mice interfered with pup retrieval and nest building but not nursing behavior, indicating different contributions of estrogen synthesis to maternal behavior. Furthermore, letrozole treatment led to an increase in ERα mRNA in the MeA but not in the MPOA, suggesting that involvement of estrogen synthesis is brain region dependent. Altogether, these results suggest that region-dependent estrogen synthesis leads to differential transcriptional activation due

  7. Estrogen Effects after a Crush Muscle Injury and Acute Exposure to Hypobaric Hypoxia

    Science.gov (United States)

    2015-03-01

    inflammatory response to tissue injury. For example, in a rat trauma -hemorrhage model, estrogen attenuated splenic macrophage interleukin (IL)-6 and...strategy. For example, survival rate after combat trauma is now 91–99% [5]. Therefore, aeromedical evacuation is critical to the health and recovery... trauma -hemorrhage. J Cell Physiol. 2008; 214(3):662-672. 7. Miller AP, Feng W, Xing D, Weathington NM, Blalock JE, et al. Estrogen modulates

  8. hebp3, a novel member of the heme-binding protein gene family, is expressed in the medaka meninges with higher abundance in females due to a direct stimulating action of ovarian estrogens.

    Science.gov (United States)

    Nakasone, Kiyoshi; Nagahama, Yoshitaka; Okubo, Kataaki

    2013-02-01

    The brains of teleost fish exhibit remarkable sexual plasticity throughout their life span. To dissect the molecular basis for the development and reversal of sex differences in the teleost brain, we screened for genes differentially expressed between sexes in the brain of medaka (Oryzias latipes). One of the genes identified in the screen as being preferentially expressed in females was found to be a new member of the heme-binding protein gene family that includes hebp1 and hebp2 and was designated here as hebp3. The medaka hebp3 is expressed in the meninges with higher abundance in females, whereas there is no expression within the brain parenchyma. This female-biased expression of hebp3 is not attributable to the direct action of sex chromosome genes but results from the transient and reversible action of estrogens derived from the ovary. Moreover, estrogens directly activate the transcription of hebp3 via a palindromic estrogen-responsive element in the hebp3 promoter. Taken together, our findings demonstrate that hebp3 is a novel transcriptional target of estrogens, with female-biased expression in the meninges. The definite but reversible sexual dimorphism of the meningeal hebp3 expression may contribute to the development and reversal of sex differences in the teleost brain.

  9. Estrogenic activity, estrogens, and calcium in runoff post-layer litter application from rainfall simulated events

    Science.gov (United States)

    Estrogens in runoff from fields fertilized with animal wastes have been implicated as endocrine disruptors of fish in recipient surface waters. The goal of this study was to measure estrogenic activity in runoff post-application of animal waste with the greatest potential for estrogenic activity - ...

  10. CERAPP: Collaborative Estrogen Receptor Activity Prediction Project

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data from a large-scale modeling project called CERAPP (Collaborative Estrogen Receptor Activity Prediction Project) demonstrating using predictive computational...

  11. Estrogens and Cognition: Friends or Foes?

    Science.gov (United States)

    Korol, Donna L.; Pisani, Samantha L.

    2015-01-01

    Estrogens are becoming well known for their robust enhancement on cognition particularly for learning and memory that relies upon functioning of the hippocampus and related neural systems. What is also emerging is that estrogen modulation of cognition is not uniform, at times enhancing yet at other times impairing learning. This review explores the bidirectional effects of estrogens on learning from a multiple memory systems view, focusing on the hippocampus and striatum, whereby modulation by estrogens sorts according to task attributes and neural systems engaged during cognition. We highlight our findings that show the ability to solve hippocampus-sensitive tasks typically improves under relatively high estrogen status while the ability to solve striatum-sensitive tasks degrades with estrogen exposures. Though constrained by dose and timing of exposure, these opposing enhancements and impairments of cognition can be observed following treatments with different estrogenic compounds including the hormone estradiol, the isoflavone genistein found in soybeans, and agonists that are selective for specific estrogen receptors, suggesting that activation of a single receptor type is sufficient to produce the observed shifts in learning strategies. Using this multi-dimensional framework will allow us to extend our thinking of the relationship between estrogens and cognition to other brain regions and cognitive functions. PMID:26149525

  12. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  13. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  14. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  15. Assessment of cellular estrogenic activity based on estrogen receptor-mediated reduction of soluble-form catechol-O-methyltransferase (COMT expression in an ELISA-based system.

    Directory of Open Access Journals (Sweden)

    Philip Wing-Lok Ho

    Full Text Available Xenoestrogens are either natural or synthetic compounds that mimic the effects of endogenous estrogen. These compounds, such as bisphenol-A (BPA, and phthalates, are commonly found in plastic wares. Exposure to these compounds poses major risk to human health because of the potential to cause endocrine disruption. There is huge demand for a wide range of chemicals to be assessed for such potential for the sake of public health. Classical in vivo assays for endocrine disruption are comprehensive but time-consuming and require sacrifice of experimental animals. Simple preliminary in vitro screening assays can reduce the time and expense involved. We previously demonstrated that catechol-O-methyltransferase (COMT is transcriptionally regulated by estrogen via estrogen receptor (ER. Therefore, detecting corresponding changes of COMT expression in estrogen-responsive cells may be a useful method to estimate estrogenic effects of various compounds. We developed a novel cell-based ELISA to evaluate cellular response to estrogenicity by reduction of soluble-COMT expression in ER-positive MCF-7 cells exposed to estrogenic compounds. In contrast to various existing methods that only detect bioactivity, this method elucidates direct physiological effect in a living cell in response to a compound. We validated our assay using three well-characterized estrogenic plasticizers - BPA, benzyl butyl phthalate (BBP, and di-n-butyl phthalate (DBP. Cells were exposed to either these plasticizers or 17β-estradiol (E2 in estrogen-depleted medium with or without an ER-antagonist, ICI 182,780, and COMT expression assayed. Exposure to each of these plasticizers (10(-9-10(-7M dose-dependently reduced COMT expression (p<0.05, which was blocked by ICI 182,780. Reduction of COMT expression was readily detectable in cells exposed to picomolar level of E2, comparable to other in vitro assays of similar sensitivity. To satisfy the demand for in vitro assays targeting different

  16. The effects of the botanical estrogen, isoliquiritigenin on delayed spatial alternation.

    Science.gov (United States)

    Kundu, Payel; Neese, Steven L; Bandara, Suren; Monaikul, Supida; Helferich, William G; Doerge, Daniel R; Khan, Ikhlas A; Schantz, Susan L

    Age-related declines in cognitive function can impair working memory, reduce speed of processing, and alter attentional resources. In particular, menopausal women may show an acceleration in the rate of cognitive decline as well as an increased vulnerability to brain diseases as estrogens may play a neuroprotective and neurotrophic role in the brain. To treat menopausal symptoms, many women turn to botanical estrogens that are promoted as a safe and natural alternative to traditional hormone replacement therapy. However, the majority of these compounds have not been systematically evaluated for efficacy and safety. The current study investigated the efficacy of the commercially available botanical estrogenic compound isoliquiritigenin (ISL) to alter performance on an operant working memory task, delayed spatial alternation (DSA). ISL is a compound found in licorice root that has been shown to have a wide range of effects on different biological systems, including estrogenic properties. This botanical is currently being used in over the counter dietary supplements. Middle-aged (12-month old) Long-Evans female rats were ovariectomized and orally dosed with either 0 mg, 6 mg, 12 mg or 24 mg of ISL 60 min before testing on the DSA task. The DSA task required the rat to alternate its responses between two retractable levers in order to earn food rewards. Random delays of 0, 3, 6, 9 or 18 s were imposed between opportunities to press. ISL treatment failed to alter DSA performance. Previous work from our research group has found that estrogenic compounds, including 17β-estradiol and the botanical estrogen genistein impair performance on the DSA task. The goal of our botanical estrogens research is to find compounds that offer some of the beneficial effects of estrogen supplementation, without the harmful effects. This work suggests that ISL may not carry the cognitive risks associated with most other estrogenic compounds tested to date. Copyright © 2018

  17. Novel drugs that target the estrogen-related receptor alpha: their therapeutic potential in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    May, Felicity EB, E-mail: F.E.B.May@ncl.ac.uk [Northern Institute for Cancer Research and Department of Pathology, Faculty of Medical Sciences, University of Newcastle upon Tyne, Newcastle upon Tyne (United Kingdom)

    2014-05-23

    The incidence of breast cancer continues to rise: 1.7 million women were diagnosed with and 521,000 women died from breast cancer in 2012. This review considers first current treatment options: surgery; radiotherapy; and systemic endocrine, anti-biological, and cytotoxic therapies. Clinical management includes prevention, early detection by screening, treatment with curative intent, management of chronic disease, and palliative control of advanced breast cancer. Next, the potential of novel drugs that target DNA repair, growth factor dependence, intracellular and intercellular signal transduction, and cell cycle are considered. Estrogen-related receptor alpha has attracted attention as a therapeutic target in triple-negative breast cancers with de novo resistance to, and in breast cancers with acquired resistance to, endocrine therapies such as antiestrogens and aromatase inhibitors. Estrogen-related receptor alpha is an orphan receptor and transcription factor. Its activity is regulated by coregulator proteins and posttranslational modification. It is an energy sensor that controls adaptation to energy demand and may facilitate glycolytic metabolism and mitochondrial oxidative respiration in breast cancer cells. Estrogen-related receptor alpha increases breast cancer cell migration, proliferation, and tumor development. It is expressed at high levels in estrogen receptor-negative tumors, and is proposed to activate estrogen-responsive genes in endocrine-resistant tumors. The structures and functions of the ligand-binding domains of estrogen receptor alpha and estrogen-related receptor alpha, their ability to bind estrogens, phytoestrogens, and synthetic ligands, and the effects of ligand agonists, antagonists, and inverse agonists on biological activity, are evaluated. Synthetic ligands of estrogen-related receptor alpha have activity in preclinical models of metabolic disorders, diabetes, osteoporosis, and oncology. The clinical settings in which these novel

  18. Novel drugs that target the estrogen-related receptor alpha: their therapeutic potential in breast cancer

    International Nuclear Information System (INIS)

    May, Felicity EB

    2014-01-01

    The incidence of breast cancer continues to rise: 1.7 million women were diagnosed with and 521,000 women died from breast cancer in 2012. This review considers first current treatment options: surgery; radiotherapy; and systemic endocrine, anti-biological, and cytotoxic therapies. Clinical management includes prevention, early detection by screening, treatment with curative intent, management of chronic disease, and palliative control of advanced breast cancer. Next, the potential of novel drugs that target DNA repair, growth factor dependence, intracellular and intercellular signal transduction, and cell cycle are considered. Estrogen-related receptor alpha has attracted attention as a therapeutic target in triple-negative breast cancers with de novo resistance to, and in breast cancers with acquired resistance to, endocrine therapies such as antiestrogens and aromatase inhibitors. Estrogen-related receptor alpha is an orphan receptor and transcription factor. Its activity is regulated by coregulator proteins and posttranslational modification. It is an energy sensor that controls adaptation to energy demand and may facilitate glycolytic metabolism and mitochondrial oxidative respiration in breast cancer cells. Estrogen-related receptor alpha increases breast cancer cell migration, proliferation, and tumor development. It is expressed at high levels in estrogen receptor-negative tumors, and is proposed to activate estrogen-responsive genes in endocrine-resistant tumors. The structures and functions of the ligand-binding domains of estrogen receptor alpha and estrogen-related receptor alpha, their ability to bind estrogens, phytoestrogens, and synthetic ligands, and the effects of ligand agonists, antagonists, and inverse agonists on biological activity, are evaluated. Synthetic ligands of estrogen-related receptor alpha have activity in preclinical models of metabolic disorders, diabetes, osteoporosis, and oncology. The clinical settings in which these novel

  19. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  20. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  1. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  2. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  3. Effects of advanced treatments of wastewater effluents on estrogenic and reproductive health impacts in fish.

    Science.gov (United States)

    Filby, Amy L; Shears, Janice A; Drage, Briane E; Churchley, John H; Tyler, Charles R

    2010-06-01

    Whether the implementation of additional treatments for the removal of estrogens from wastewater treatment works (WwTWs) effluents will eliminate their feminizing effects in exposed wildlife has yet to be established, and this information is crucial for future decisions on investment into WwTWs. Here, granular activated carbon (GAC), ozone (O(3)), and chlorine dioxide (ClO(2)) were investigated for their effectiveness in reducing steroidal estrogen levels in a WwTW effluent and assessments made on the associated estrogenic and reproductive responses in fathead minnows (Pimephales promelas) exposed for 21 days. All treatments reduced the estrogenicity of the standard-treated (STD) effluent, but with different efficacies; ranging between 70-100% for total estrogenicity and 53-100% for individual steroid estrogens. In fish exposed to the GAC- and ClO(2)- (but not O(3)-) treated effluents, there was no induction of plasma vitellogenin (VTG) or reduction in the weight of the fatpad, a secondary sex character in males, as occurred for fish exposed to STD effluent. This finding suggests likely benefits of employing these treatment processes for the reproductive health in wild fish populations living in rivers receiving WwTW discharges. Exposure of pair-breeding minnows to the GAC-treated effluent, however, resulted in a similar inhibition of egg production to that occurring for exposure to the STD effluent (34-40%). These data, together with a lack of effect on egg production of the estrogen, ethinylestradiol (10 ng/L), alone, suggest that chemical/physical properties of the effluents rather than their estrogenicity were responsible for the reproductive effect and that these factor(s) were not remediated for through GAC treatment. Collectively, our findings illustrate the importance of assessing integrative biological responses, rather than biomarkers alone, in the assessment and improvement of WwTW technologies for the protection of wild fish populations.

  4. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  5. Impact of Estrogens and Estrogen Receptor Alpha (ESR1) in Brain Lipid Metabolism.

    Science.gov (United States)

    Morselli, Eugenia; de Souza Santos, Roberta; Gao, Su; Ávalos, Yenniffer; Criollo, Alfredo; Palmer, Biff F; Clegg, Deborah J

    2018-03-06

    Estrogens and their receptors play key roles in regulating body weight, energy expenditure, and metabolic homeostasis. It is known that lack of estrogens promotes increased food intake and induces the expansion of adipose tissues, for which much is known. An area of estrogenic research that has received less attention is the role of estrogens and their receptors in influencing intermediary lipid metabolism in organs such as the brain. In this review, we highlight the actions of estrogens and their receptors in regulating their impact on modulating fatty acid content, utilization, and oxidation through their direct impact on intracellular signaling cascades within the central nervous system.

  6. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  7. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  8. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  9. Estrogen-mediated hemangioma-derived stem cells through estrogen receptor-α for infantile hemangioma

    Directory of Open Access Journals (Sweden)

    Zhang L

    2017-07-01

    Full Text Available Ling Zhang,1 Hai Wei Wu,1 Weien Yuan,2 Jia Wei Zheng1 1Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Center for Specialty Strategy Research of Shanghai Jiao Tong University China Hospital Development Institute, 2School of Pharmacy, Shanghai Jiao Tong University, Shanghai, People’s Republic of China Background: Infantile hemangiomas (IHs are the most common benign vascular tumor of infancy. They occur more frequently in female infants. The cause of hemangioma is currently unknown; however, current studies suggested the importance of estrogen (E2 signaling in hemangioma proliferation. Methods: Hemangioma-derived stem cells (HemSCs were cultured with estrogen for 48–72 h; the cell viability and proliferation were evaluated with the messenger RNA (mRNA and protein expression levels of fibroblast growth factor 2 (FGF2, vascular endothelial growth factor-A (VEGF-A and estrogen receptor-α (ER-α, by application of several in vitro assays, such as methyl thiazolyl tetrazolium (MTT, reverse transcriptase–polymerase chain reaction (RT-PCR, real-time PCR, enzyme-linked immunosorbent assay (ELISA and Western blotting. Also, the cell population’s response to external estrogen was investigated by in vivo experiments. HemSCs and human umbilical vein endothelial cells (HUVECs were mixed and injected subcutaneously into 20 flank of BALB/c-nu mice, which were randomly divided into 5 groups based on different E2 treatment doses (0, 0.01, 0.1 and 1 mg, respectively, 0.1 mg dimethyl sulfoxide (DMSO as control. Each group of mice were treated intramuscularly every week, then 2 and 4 weeks later, the subcutaneous implants were harvested and evaluated the tumor tissues with microvessel density (MVD assay and immunohistochemistry. Results: The study demonstrated that application of E2 increased the expression of FGF2, VEGF-A, and ER-α in HemSCs with the optimal concentration from 10−9 to 10−5 M. Two

  10. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  11. The role of local estrogen therapy in the management of pelvic floor disorders.

    Science.gov (United States)

    Tzur, T; Yohai, D; Weintraub, A Y

    2016-04-01

    Pelvic floor disorders are common and bothersome problems that include a variety of conditions. These conditions greatly affect the performance of daily activities and social function such as work, traveling, physical exercise, sleep and sexual function. Aging is a well-known factor affecting the pelvic floor and lower urinary tract anatomy and function. It is clear that the pelvic organs and their surrounding muscular and connective tissue support are estrogen-responsive. Treatment of pelvic floor disorders requires significant health-care resources and their impact is likely to increase in the near future. This literature review aims to provide an overview of both research and clinical aspects of the pathophysiology of urogenital estrogen deficiency and the role of local estrogen therapy as part of the management strategy of different pelvic floor disorders. The safety and risk concerns regarding the use of local estrogen therapy are addressed as well.

  12. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  13. Toxicity and Estrogenic Endocrine Disrupting Activity of Phthalates and Their Mixtures

    Directory of Open Access Journals (Sweden)

    Xueping Chen

    2014-03-01

    Full Text Available Phthalates, widely used in flexible plastics and consumer products, have become ubiquitous contaminants worldwide. This study evaluated the acute toxicity and estrogenic endocrine disrupting activity of butyl benzyl phthalate (BBP, di(n-butyl phthalate (DBP, bis(2-ethylhexyl phthalate (DEHP, diisodecyl phthalate (DIDP, diisononyl phthalate (DINP, di-n-octyl phthalate (DNOP and their mixtures. Using a 72 h zebrafish embryo toxicity test, the LC50 values of BBP, DBP and a mixture of the six phthalates were found to be 0.72, 0.63 and 0.50 ppm, respectively. The other four phthalates did not cause more than 50% exposed embryo mortality even at their highest soluble concentrations. The typical toxicity symptoms caused by phthalates were death, tail curvature, necrosis, cardio edema and no touch response. Using an estrogen-responsive ChgH-EGFP transgenic medaka (Oryzias melastigma eleutheroembryos based 24 h test, BBP demonstrated estrogenic activity, DBP, DEHP, DINP and the mixture of the six phthalates exhibited enhanced-estrogenic activity and DIDP and DNOP showed no enhanced- or anti-estrogenic activity. These findings highlighted the developmental toxicity of BBP and DBP, and the estrogenic endocrine disrupting activity of BBP, DBP, DEHP and DINP on intact organisms, indicating that the widespread use of these phthalates may cause potential health risks to human beings.

  14. Estrogen induces glomerulosclerosis in analbuminemic rats

    NARCIS (Netherlands)

    Joles, JA; van Goor, H; Koomans, HA

    Progression of chronic renal disease: is usually more rapid in males, both In humans and in experimental animals. Estrogen-replacement studies indicate that this may be related to the beneficial effects of estrogen on the lipoprotein profile. However, in hyperlipidemic analbuminemic rats (NAR),

  15. Quantum chemical studies of estrogenic compounds

    Science.gov (United States)

    Quantum chemical methods are potent tools to provide information on the chemical structure and electronic properties of organic molecules. Modern computational chemistry methods have provided a great deal of insight into the binding of estrogenic compounds to estrogenic receptors (ER), an important ...

  16. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  18. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  19. Labeled estrogens as mammary tumor probes

    International Nuclear Information System (INIS)

    Feenstra, A.

    1981-01-01

    In this thesis estrogens labeled with a gamma or positron emitting nuclide, called estrogen-receptor binding radiopharmaceuticals are investigated as mammary tumour probes. The requirements for estrogen-receptor binding radiopharmaceuticals are formulated and the literature on estrogens labeled for this purpose is reviewed. The potential of mercury-197/197m and of carbon-11 as label for estrogen-receptor binding radiopharmaceuticals is investigated. The synthesis of 197 Hg-labeled 4-mercury-estradiol and 2-mercury-estradiol and their properties in vitro and in vivo are described. It appears that though basically carbon-11 labeled compounds are very promising as mammary tumour probes, their achievable specific activity has to be increased. (Auth.)

  20. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  1. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  2. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  3. Role of estrogen replacement therapy in memory enhancement and the prevention of neuronal loss associated with Alzheimer's disease.

    Science.gov (United States)

    Simpkins, J W; Green, P S; Gridley, K E; Singh, M; de Fiebre, N C; Rajakumar, G

    1997-09-22

    Recent evidence supports a role for estrogens in both normal neural development and neuronal maintenance throughout life. Women spend 25-33% of their life in an estrogen-deprived state and retrospective studies have shown an inverse correlation between dose and duration of estrogen replacement therapy (ERT) and incidence of Alzheimer's disease (AD), suggesting a role for estrogen in the prevention and/or treatment of neurodegenerative diseases. To explore these observations further, an animal model was developed using ovariectomy (OVX) and ovariectomy with estradiol replacement (E2) in female Sprague-Dawley rats to mimic postmenopausal changes. Using an active-avoidance paradigm and a spatial memory task, the effects of estrogen deprivation were tested on memory-related behaviors. OVX caused a decline in avoidance behavior, and estrogen replacement normalized the response. In the Morris water task of spatial memory, OVX animals showed normal spatial learning but were deficient in spatial memory, an effect that was prevented by estrogen treatment. Together these data indicate that OVX in rats results in an estrogen-reversible impairment of learning/memory behavior. Because a plethora of information has been generated that links decline in memory-related behavior to dysfunction of cholinergic neurons, the effects of estrogens on cholinergic neurons were tested. We demonstrated that OVX causes a decrease in high affinity choline uptake and choline acetyltransferase activity in the hippocampus and frontal cortex; ERT reverses this effect. Further, we showed that estrogens promote the expression of mRNA for brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF), 2 neurotrophic substances that have been shown to ameliorate the effects of age and injury on cholinergic neurons. Tissue culture models were used to evaluate whether estrogen treatment increases the survival of neurons when exposed to a variety of insults. 17-beta-Estradiol (beta-E2) protects

  4. Palmitoylation regulates 17β-estradiol-induced estrogen receptor-α degradation and transcriptional activity.

    Science.gov (United States)

    La Rosa, Piergiorgio; Pesiri, Valeria; Leclercq, Guy; Marino, Maria; Acconcia, Filippo

    2012-05-01

    The estrogen receptor-α (ERα) is a transcription factor that regulates gene expression through the binding to its cognate hormone 17β-estradiol (E2). ERα transcriptional activity is regulated by E2-evoked 26S proteasome-mediated ERα degradation and ERα serine (S) residue 118 phosphorylation. Furthermore, ERα mediates fast cell responses to E2 through the activation of signaling cascades such as the MAPK/ERK and phosphoinositide-3-kinase/v-akt murine thymoma viral oncogene homolog 1 pathways. These E2 rapid effects require a population of the ERα located at the cell plasma membrane through palmitoylation, a dynamic enzymatic modification mediated by palmitoyl-acyl-transferases. However, whether membrane-initiated and transcriptional ERα activities integrate in a unique picture or represent parallel pathways still remains to be firmly clarified. Hence, we evaluated here the impact of ERα palmitoylation on E2-induced ERα degradation and S118 phosphorylation. The lack of palmitoylation renders ERα more susceptible to E2-dependent degradation, blocks ERα S118 phosphorylation and prevents E2-induced ERα estrogen-responsive element-containing promoter occupancy. Consequently, ERα transcriptional activity is prevented and the receptor addressed to the nuclear matrix subnuclear compartment. These data uncover a circuitry in which receptor palmitoylation links E2-dependent ERα degradation, S118 phosphorylation, and transcriptional activity in a unique molecular mechanism. We propose that rapid E2-dependent signaling could be considered as a prerequisite for ERα transcriptional activity and suggest an integrated model of ERα intracellular signaling where E2-dependent early extranuclear effects control late receptor-dependent nuclear actions.

  5. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  6. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  7. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Gene Activation by Antiestrogens Used in Breast Cancer Therapy Via the Interaction of Estrogen Receptor and AP-1

    National Research Council Canada - National Science Library

    Kushner, Peter

    1999-01-01

    .... We examined the role of ER transactivation functions (AF-1 and AF-2) in these responses. Estrogen activation requires ER transactivation functions, and may be obtained with the isolated ER alpha ligand binding domain...

  9. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  10. Long-term exposure to estrogen enhances chemotherapeutic efficacy potentially through epigenetic mechanism in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Yu-Wei Chang

    Full Text Available Chemotherapy is the most common clinical option for treatment of breast cancer. However, the efficacy of chemotherapy depends on the age of breast cancer patients. Breast tissues are estrogen responsive and the levels of ovarian estrogen vary among the breast cancer patients primarily between pre- and post-menopausal age. Whether this age-dependent variation in estrogen levels influences the chemotherapeutic efficacy in breast cancer patients is not known. Therefore, the objective of this study was to evaluate the effects of natural estrogen 17 beta-estradiol (E2 on the efficacy of chemotherapeutic drugs in breast cancer cells. Estrogen responsive MCF-7 and T47D breast cancer cells were long-term exposed to 100 pg/ml estrogen, and using these cells the efficacy of chemotherapeutic drugs doxorubicin and cisplatin were determined. The result of cell viability and cell cycle analysis revealed increased sensitivities of doxorubicin and cisplatin in estrogen-exposed MCF-7 and T47D cells as compared to their respective control cells. Gene expression analysis of cell cycle, anti-apoptosis, DNA repair, and drug transporter genes further confirmed the increased efficacy of chemotherapeutic drugs in estrogen-exposed cells at molecular level. To further understand the role of epigenetic mechanism in enhanced chemotherapeutic efficacy by estrogen, cells were pre-treated with epigenetic drugs, 5-aza-2-deoxycytidine and Trichostatin A prior to doxorubicin and cisplatin treatments. The 5-aza-2 deoxycytidine pre-treatment significantly decreased the estrogen-induced efficacy of doxorubicin and cisplatin, suggesting the role of estrogen-induced hypermethylation in enhanced sensitivity of these drugs in estrogen-exposed cells. In summary, the results of this study revealed that sensitivity to chemotherapy depends on the levels of estrogen in breast cancer cells. Findings of this study will have clinical implications in selecting the chemotherapy strategies for

  11. Performance of the flow cytometric E-screen assay in screening estrogenicity of pure compounds and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Vanparys, Caroline, E-mail: caroline.vanparys@ua.ac.be [Laboratory of Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Antwerp (Belgium); Depiereux, Sophie; Nadzialek, Stephanie [Research Unit in Organismal Biology (URBO), University of Namur (FUNDP), Namur (Belgium); Robbens, Johan; Blust, Ronny [Laboratory of Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Antwerp (Belgium); Kestemont, Patrick [Research Unit in Organismal Biology (URBO), University of Namur (FUNDP), Namur (Belgium); De Coen, Wim [Laboratory of Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Antwerp (Belgium); European Chemicals Agency (ECHA), Helsinki (Finland)

    2010-09-15

    In vitro estrogenicity screens are believed to provide a first prioritization step in hazard characterization of endocrine disrupting chemicals. When applied to complex environmental matrices or mixture samples, they have been indicated valuable in estimating the overall estrogen-mimicking load. In this study, the performance of an adapted format of the classical E-screen or MCF-7 cell proliferation assay was profoundly evaluated to rank pure compounds as well as influents and effluents of sewage treatment plants (STPs) according to estrogenic activity. In this adapted format, flow cytometric cell cycle analysis was used to allow evaluation of the MCF-7 cell proliferative effects after only 24 h of exposure. With an average EC{sub 50} value of 2 pM and CV of 22%, this assay appears as a sensitive and reproducible system for evaluation of estrogenic activity. Moreover, estrogenic responses of 17 pure compounds corresponded well, qualitatively and quantitatively, with other in vitro and in vivo estrogenicity screens, such as the classical E-screen (R{sup 2} = 0.98), the estrogen receptor (ER) binding (R{sup 2} = 0.84) and the ER transcription activation assay (R{sup 2} = 0.87). To evaluate the applicability of this assay for complex samples, influents and effluents of 10 STPs covering different treatment processes, were compared and ranked according to estrogenic removal efficiencies. Activated sludge treatment with phosphorus and nitrogen removal appeared most effective in eliminating estrogenic activity, followed by activated sludge, lagoon and filter bed. This is well in agreement with previous findings based on chemical analysis or biological activity screens. Moreover, ER blocking experiments indicated that cell proliferative responses were mainly ER mediated, illustrating that the complexity of the end point, cell proliferation, compared to other ER screens, does not hamper the interpretation of the results. Therefore, this study, among other E-screen studies

  12. Performance of the flow cytometric E-screen assay in screening estrogenicity of pure compounds and environmental samples

    International Nuclear Information System (INIS)

    Vanparys, Caroline; Depiereux, Sophie; Nadzialek, Stephanie; Robbens, Johan; Blust, Ronny; Kestemont, Patrick; De Coen, Wim

    2010-01-01

    In vitro estrogenicity screens are believed to provide a first prioritization step in hazard characterization of endocrine disrupting chemicals. When applied to complex environmental matrices or mixture samples, they have been indicated valuable in estimating the overall estrogen-mimicking load. In this study, the performance of an adapted format of the classical E-screen or MCF-7 cell proliferation assay was profoundly evaluated to rank pure compounds as well as influents and effluents of sewage treatment plants (STPs) according to estrogenic activity. In this adapted format, flow cytometric cell cycle analysis was used to allow evaluation of the MCF-7 cell proliferative effects after only 24 h of exposure. With an average EC 50 value of 2 pM and CV of 22%, this assay appears as a sensitive and reproducible system for evaluation of estrogenic activity. Moreover, estrogenic responses of 17 pure compounds corresponded well, qualitatively and quantitatively, with other in vitro and in vivo estrogenicity screens, such as the classical E-screen (R 2 = 0.98), the estrogen receptor (ER) binding (R 2 = 0.84) and the ER transcription activation assay (R 2 = 0.87). To evaluate the applicability of this assay for complex samples, influents and effluents of 10 STPs covering different treatment processes, were compared and ranked according to estrogenic removal efficiencies. Activated sludge treatment with phosphorus and nitrogen removal appeared most effective in eliminating estrogenic activity, followed by activated sludge, lagoon and filter bed. This is well in agreement with previous findings based on chemical analysis or biological activity screens. Moreover, ER blocking experiments indicated that cell proliferative responses were mainly ER mediated, illustrating that the complexity of the end point, cell proliferation, compared to other ER screens, does not hamper the interpretation of the results. Therefore, this study, among other E-screen studies, supports the use of

  13. Human glutathione S-transferase P1-1 functions as an estrogen receptor α signaling modulator

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiyuan [Department of Biological Science, Sookmyung Women’s University, Seoul (Korea, Republic of); An, Byoung Ha [Department of Food and Nutrition, College of Life Science, Sookmyung Women’s University, Seoul (Korea, Republic of); Kim, Min Jung; Park, Jong Hoon [Department of Biological Science, Sookmyung Women’s University, Seoul (Korea, Republic of); Kang, Young Sook [Department of Pharmacy, College of Pharmacy, Sookmyung Women’s University, Seoul (Korea, Republic of); Chang, Minsun, E-mail: minsunchang@sm.ac.kr [Department of Medical and Pharmaceutical Science, College of Science, Sookmyung Women’s University, Seoul (Korea, Republic of)

    2014-09-26

    Highlights: • GSTP induces the classical ERα signaling event. • The functional GSTP is a prerequisite for GSTP-induced ERα transcription activity. • The expression of RIP140, a transcription cofactor, was inhibited by GSTP protein. • We propose the novel non-enzymatic role of GSTP. - Abstract: Estrogen receptor α (ERα) plays a crucial role in estrogen-mediated signaling pathways and exerts its action as a nuclear transcription factor. Binding of the ligand-activated ERα to the estrogen response element (ERE) is a central part of ERα-associated signal transduction pathways and its aberrant modulation is associated with many disease conditions. Human glutathione S-transferase P1-1 (GSTP) functions as an enzyme in conjugation reactions in drug metabolism and as a regulator of kinase signaling pathways. It is overexpressed in tumors following chemotherapy and has been associated with a poor prognosis in breast cancer. In this study, a novel regulatory function of GSTP has been proposed in which GSTP modulates ERE-mediated ERα signaling events. Ectopic expression of GSTP was able to induce the ERα and ERE-mediated transcriptional activities in ERα-positive but GSTP-negative MCF7 human breast cancer cells. This inductive effect of GSTP on the ERE-transcription activity was diminished when the cells express a mutated form of the enzyme or are treated with a GSTP-specific chemical inhibitor. It was found that GSTP inhibited the expression of the receptor interacting protein 140 (RIP140), a negative regulator of ERα transcription, at both mRNA and protein levels. Our study suggests a novel non-enzymatic role of GSTP which plays a significant role in regulating the classical ERα signaling pathways via modification of transcription cofactors such as RIP140.

  14. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  16. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  17. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  18. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  19. Expression and functional roles of G-protein-coupled estrogen receptor (GPER) in human eosinophils.

    Science.gov (United States)

    Tamaki, Mami; Konno, Yasunori; Kobayashi, Yoshiki; Takeda, Masahide; Itoga, Masamichi; Moritoki, Yuki; Oyamada, Hajime; Kayaba, Hiroyuki; Chihara, Junichi; Ueki, Shigeharu

    2014-07-01

    Sexual dimorphism in asthma links the estrogen and allergic immune responses. The function of estrogen was classically believed to be mediated through its nuclear receptors, i.e., estrogen receptors (ERs). However, recent studies established the important roles of G-protein-coupled estrogen receptor (GPER/GPR30) as a novel membrane receptor for estrogen. To date, the role of GPER in allergic inflammation is poorly understood. The purpose of this study was to examine whether GPER might affect the functions of eosinophils, which play an important role in the pathogenesis of asthma. Here, we demonstrated that GPER was expressed in purified human peripheral blood eosinophils both at the mRNA and protein levels. Although GPER agonist G-1 did not induce eosinophil chemotaxis or chemokinesis, preincubation with G-1 enhanced eotaxin (CCL11)-directed eosinophil chemotaxis. G-1 inhibited eosinophil spontaneous apoptosis and caspase-3 activities. The anti-apoptotic effect was not affected by the cAMP-phospodiesterase inhibitor rolipram or phosphoinositide 3-kinase inhibitors. In contrast to resting eosinophils, G-1 induced apoptosis and increased caspase-3 activities when eosinophils were co-stimulated with IL-5. No effect of G-1 was observed on eosinophil degranulation in terms of release of eosinophil-derived neurotoxin (EDN). The current study indicates the functional capacities of GPER on human eosinophils and also provides the previously unrecognized mechanisms of interaction between estrogen and allergic inflammation. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Menopausal hormone therapy and risk of melanoma: Do estrogens and progestins have a different role?

    Science.gov (United States)

    Botteri, Edoardo; Støer, Nathalie C; Sakshaug, Solveig; Graff-Iversen, Sidsel; Vangen, Siri; Hofvind, Solveig; Ursin, Giske; Weiderpass, Elisabete

    2017-11-01

    The association between use of menopausal hormone therapy (HT) and occurrence of skin malignant melanoma (SMM) is controversial. We investigated the issue in a nationwide cohort of 684,696 Norwegian women, aged 45-79 years, followed from 2004 to 2008. The study was based on linkage between Norwegian population registries. Multivariable Poisson regression models were used to estimate the effect of HT use, different HT types, routes of administration and doses of estrogen and progestin on the risk of SMM. During the median follow-up of 4.8 years, 178,307 (26%) women used HT, and 1,476 incident SMM cases were identified. Current use of HT was associated with increased risk of SMM (rate ratios (RR) = 1.19; 95% confidence interval (CI) 1.03-1.37). Plain estrogen therapy was associated with an increased risk of SMM (RR 1.45; 95% CI 1.21-1.73), both for oral (RR 1.45; 95% CI 1.09-1.93) and vaginal (RR 1.44; 95% CI 1.14-1.84) formulations, while combined estrogen and progestin therapy (EPT) was not (RR 0.91; 95% CI 0.70-1.19). We performed a dose-response analysis of estrogen and progestin in women using tablets, and found that use of estrogens was associated with increased risk (RR 1.24; 95% CI 1.00-1.53 per 1 mg/day) and use of progestins with decreased risk (RR 0.71; 95% CI 0.57-0.89 per 10 mg/month) of SMM. In conclusion, estrogens were associated with increased risk of SMM, while combinations of estrogens and progestins were not. Our results suggest that estrogens and progestins might affect the risk of SMM in opposite ways. © 2017 UICC.

  1. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  2. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  3. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  4. Importance of the Sequence-Directed DNA Shape for Specific Binding Site Recognition by the Estrogen-Related Receptor

    Directory of Open Access Journals (Sweden)

    Kareem Mohideen-Abdul

    2017-06-01

    Full Text Available Most nuclear receptors (NRs bind DNA as dimers, either as hetero- or as homodimers on DNA sequences organized as two half-sites with specific orientation and spacing. The dimerization of NRs on their cognate response elements (REs involves specific protein–DNA and protein–protein interactions. The estrogen-related receptor (ERR belongs to the steroid hormone nuclear receptor (SHR family and shares strong similarity in its DNA-binding domain (DBD with that of the estrogen receptor (ER. In vitro, ERR binds with high affinity inverted repeat REs with a 3-bps spacing (IR3, but in vivo, it preferentially binds to single half-site REs extended at the 5′-end by 3 bp [estrogen-related response element (ERREs], thus explaining why ERR was often inferred as a purely monomeric receptor. Since its C-terminal ligand-binding domain is known to homodimerize with a strong dimer interface, we investigated the binding behavior of the isolated DBDs to different REs using electrophoretic migration, multi-angle static laser light scattering (MALLS, non-denaturing mass spectrometry, and nuclear magnetic resonance. In contrast to ER DBD, ERR DBD binds as a monomer to EREs (IR3, such as the tff1 ERE-IR3, but we identified a DNA sequence composed of an extended half-site embedded within an IR3 element (embedded ERRE/IR3, where stable dimer binding is observed. Using a series of chimera and mutant DNA sequences of ERREs and IR3 REs, we have found the key determinants for the binding of ERR DBD as a dimer. Our results suggest that the sequence-directed DNA shape is more important than the exact nucleotide sequence for the binding of ERR DBD to DNA as a dimer. Our work underlines the importance of the shape-driven DNA readout mechanisms based on minor groove recognition and electrostatic potential. These conclusions may apply not only to ERR but also to other members of the SHR family, such as androgen or glucocorticoid, for which a strong well-conserved half

  5. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  6. The regulation of MS-KIF18A expression and cross talk with estrogen receptor.

    Directory of Open Access Journals (Sweden)

    Margalit Zusev

    2009-07-01

    Full Text Available This study provides a novel view on the interactions between the MS-KIF18A, a kinesin protein, and estrogen receptor alpha (ERalpha which were studied in vivo and in vitro. Additionally, the regulation of MS-KIF18A expression by estrogen was investigated at the gene and protein levels. An association between recombinant proteins; ERalpha and MS-KIF18A was demonstrated in vitro in a pull down assay. Such interactions were proven also for endogenous proteins in MBA-15 cells were detected prominently in the cytoplasm and are up-regulated by estrogen. Additionally, an association between these proteins and the transcription factor NF-kappaB was identified. MS-KIF18A mRNA expression was measured in vivo in relation to age and estrogen level in mice and rats models. A decrease in MS-KIF18A mRNA level was measured in old and in OVX-estrogen depleted rats as compared to young animals. The low MS-KIF18A mRNA expression in OVX rats was restored by estrogen treatment. We studied the regulation of MS-KIF18A transcription by estrogen using the luciferase reporter gene and chromatin immuno-precipitation (ChIP assays. The luciferase reporter gene assay demonstrated an increase in MS-KIF18A promoter activity in response to 10(-8 M estrogen and 10(-7M ICI-182,780. Complimentary, the ChIP assay quantified the binding of ERalpha and pcJun to the MS-KIF18A promoter that was enhanced in cells treated by estrogen and ICI-182,780. In addition, cells treated by estrogen expressed higher levels of MS-KIF18A mRNA and protein and the protein turnover in MBA-15 cells was accelerated. Presented data demonstrated that ERalpha is a defined cargo of MS-KIF18A and added novel insight on the role of estrogen in regulation of MS-KIF18A expression both in vivo and in vitro.

  7. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  8. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  9. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  10. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  11. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  12. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  13. Impact of estrogenic compounds on DNA integrity in human spermatozoa: Evidence for cross-linking and redox cycling activities

    International Nuclear Information System (INIS)

    Bennetts, L.E.; De Iuliis, G.N.; Nixon, B.; Kime, M.; Zelski, K.; McVicar, C.M.; Lewis, S.E.; Aitken, R.J.

    2008-01-01

    A great deal of circumstantial evidence has linked DNA damage in human spermatozoa with adverse reproductive outcomes including reduced fertility and high rates of miscarriage. Although oxidative stress is thought to make a significant contribution to DNA damage in the male germ line, the factors responsible for creating this stress have not been elucidated. One group of compounds that are thought to be active in this context are the estrogens, either generated as a result of the endogenous metabolism of androgens within the male reproductive tract or gaining access to the latter as a consequence of environmental exposure. In this study, a wide variety of estrogenic compounds were assessed for their direct effects on human spermatozoa in vitro. DNA integrity was assessed using the Comet and TUNEL assays, lesion frequencies were quantified by QPCR using targets within the mitochondrial and nuclear (β-globin) genomes, DNA adducts were characterized by mass spectrometry and redox activity was monitored using dihydroethidium (DHE) as the probe. Of the estrogenic and estrogen analogue compounds evaluated, catechol estrogens, quercetin, diethylstilbestrol and pyrocatechol stimulated intense redox activity while genistein was only active at the highest doses tested. Other estrogens and estrogen analogues, such as 17β-estradiol, nonylphenol, bisphenol A and 2,3-dihydroxynaphthalene were inactive. Estrogen-induced redox activity was associated with a dramatic loss of motility and, in the case of 2-hydroxyestradiol, the induction of significant DNA fragmentation. Mass spectrometry also indicated that catechol estrogens were capable of forming dimers that can cross-link the densely packed DNA strands in sperm chromatin, impairing nuclear decondensation. These results highlight the potential importance of estrogenic compounds in creating oxidative stress and DNA damage in the male germ line and suggest that further exploration of these compounds in the aetiology of male

  14. Impact of estrogenic compounds on DNA integrity in human spermatozoa: Evidence for cross-linking and redox cycling activities

    Energy Technology Data Exchange (ETDEWEB)

    Bennetts, L.E.; De Iuliis, G.N.; Nixon, B.; Kime, M.; Zelski, K. [ARC Centre of Excellence in Biotechnology and Development and Discipline of Biological Sciences, University of Newcastle, NSW (Australia); McVicar, C.M.; Lewis, S.E. [Obstetrics and Gynaecology, Queen' s University, Belfast (United Kingdom); Aitken, R.J. [ARC Centre of Excellence in Biotechnology and Development and Discipline of Biological Sciences, University of Newcastle, NSW (Australia)], E-mail: jaitken@mail.newcastle.edu.au

    2008-05-10

    A great deal of circumstantial evidence has linked DNA damage in human spermatozoa with adverse reproductive outcomes including reduced fertility and high rates of miscarriage. Although oxidative stress is thought to make a significant contribution to DNA damage in the male germ line, the factors responsible for creating this stress have not been elucidated. One group of compounds that are thought to be active in this context are the estrogens, either generated as a result of the endogenous metabolism of androgens within the male reproductive tract or gaining access to the latter as a consequence of environmental exposure. In this study, a wide variety of estrogenic compounds were assessed for their direct effects on human spermatozoa in vitro. DNA integrity was assessed using the Comet and TUNEL assays, lesion frequencies were quantified by QPCR using targets within the mitochondrial and nuclear ({beta}-globin) genomes, DNA adducts were characterized by mass spectrometry and redox activity was monitored using dihydroethidium (DHE) as the probe. Of the estrogenic and estrogen analogue compounds evaluated, catechol estrogens, quercetin, diethylstilbestrol and pyrocatechol stimulated intense redox activity while genistein was only active at the highest doses tested. Other estrogens and estrogen analogues, such as 17{beta}-estradiol, nonylphenol, bisphenol A and 2,3-dihydroxynaphthalene were inactive. Estrogen-induced redox activity was associated with a dramatic loss of motility and, in the case of 2-hydroxyestradiol, the induction of significant DNA fragmentation. Mass spectrometry also indicated that catechol estrogens were capable of forming dimers that can cross-link the densely packed DNA strands in sperm chromatin, impairing nuclear decondensation. These results highlight the potential importance of estrogenic compounds in creating oxidative stress and DNA damage in the male germ line and suggest that further exploration of these compounds in the aetiology of

  15. Estrogen and Resveratrol Regulate Rac and Cdc42 Signaling to the Actin Cytoskeleton of Metastatic Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Nicolas G. Azios

    2007-02-01

    Full Text Available Estrogen and structurally related molecules play critical roles in breast cancer. We reported that resveratrol (50 µM, an estrogen-like phytosterol from grapes, acts in an antiestrogenic manner in breast cancer cells to reduce cell migration and to induce a global and sustained extension of actin structures called filopodia. Herein, we report that resveratrol-induced filopodia formation is time-dependent and concentration-dependent. In contrast to resveratrol at 50 µM, resveratrol at 5 µM acts in a manner similar to estrogen by increasing lamellipodia, as well as cell migration and invasion. Because Rho GTPases regulate the extension of actin structures, we investigated a role for Rac and Cdc42 in estrogen and resveratrol signaling. Our results demonstrate that 50 µM resveratrol decreases Rac and Cdc42 activity, whereas estrogen and 5 µM resveratrol increase Rac activity in breast cancer cells. MDA-MB-231 cells expressing dominant-negative Cdc42 or dominantnegative Rac retain filopodia response to 50 µM resveratrol. Lamellipodia response to 5 µM resveratrol, estrogen, or epidermal growth factor is inhibited in cells expressing dominant-negative Rac, indicating that Rac regulates estrogen and resveratrol (5 µM signaling to the actin cytoskeleton. These results indicate that signaling to the actin cytoskeleton by low and high concentrations of resveratrol may be differentially regulated by Rac and Cdc42.

  16. Two natural products, trans-phytol and (22E)-ergosta-6,9,22-triene-3β,5α,8α-triol, inhibit the biosynthesis of estrogen in human ovarian granulosa cells by aromatase (CYP19)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Jiajia [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Yuan, Yun [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang (China); Lu, Danfeng; Du, Baowen [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Xiong, Liang; Shi, Jiangong [State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Yang, Lijuan [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Liu, Wanli [MOE Key Laboratory of Protein Science, School of Life Sciences, Tsinghua University, Beijing 100084 (China); Yuan, Xiaohong [School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang (China); Zhang, Guolin, E-mail: zhanggl@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Chinese Academy of Sciences Sichuan Translational Medicine Research Hospital, Chengdu (China); Wang, Fei, E-mail: wangfei@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Chinese Academy of Sciences Sichuan Translational Medicine Research Hospital, Chengdu (China)

    2014-08-15

    Aromatase is the only enzyme in vertebrates to catalyze the biosynthesis of estrogens. Although inhibitors of aromatase have been developed for the treatment of estrogen-dependent breast cancer, the whole-body inhibition of aromatase causes severe adverse effects. Thus, tissue-selective aromatase inhibitors are important for the treatment of estrogen-dependent cancers. In this study, 63 natural products with diverse structures were examined for their effects on estrogen biosynthesis in human ovarian granulosa-like KGN cells. Two compounds—trans-phytol (SA-20) and (22E)-ergosta-6,9,22-triene-3β,5α,8α-triol (SA-48)—were found to potently inhibit estrogen biosynthesis (IC{sub 50}: 1 μM and 0.5 μM, respectively). Both compounds decreased aromatase mRNA and protein expression levels in KGN cells, but had no effect on the aromatase catalytic activity in aromatase-overexpressing HEK293A cells and recombinant expressed aromatase. The two compounds decreased the expression of aromatase promoter I.3/II. Neither compound affected intracellular cyclic AMP (cAMP) levels, but they inhibited the phosphorylation or protein expression of cAMP response element-binding protein (CREB). The effects of these two compounds on extracellular regulated kinase (ERK), c-Jun N-terminal kinase (JNK), p38 mitogen-activated protein kinases (MAPKs), and AKT/phosphoinositide 3-kinase (PI3K) pathway were examined. Inhibition of p38 MAPK could be the mechanism underpinning the actions of these compounds. Our results suggests that natural products structurally similar to SA-20 and SA-48 may be a new source of tissue-selective aromatase modulators, and that p38 MAPK is important in the basal control of aromatase in ovarian granulosa cells. SA-20 and SA-48 warrant further investigation as new pharmaceutical tools for the prevention and treatment of estrogen-dependent cancers. - Highlights: • Two natural products inhibited estrogen biosynthesis in human ovarian granulosa cells. • They

  17. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  18. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  19. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  20. Effects of currently used pesticides in assays for estrogenicity, androgenicity, and aromatase activity in vitro

    DEFF Research Database (Denmark)

    Andersen, Helle Raun; Vinggaard, Anne; Rasmussen, Thomas Høj

    2002-01-01

    , chlorpyrifos, deltamethrin, tolclofos-methyl, and tribenuron-methyl induced weak responses in one or both estrogenicity assays. Upon cotreatment with 17beta-estradiol, the response was potentiated by endosulfan in the proliferation assay and by pirimicarb, propamocarb, and daminozid in the ER transactivation...

  1. Estrogen regulation of microcephaly genes and evolution of brain sexual dimorphism in primates.

    Science.gov (United States)

    Shi, Lei; Lin, Qiang; Su, Bing

    2015-06-30

    Sexual dimorphism in brain size is common among primates, including humans, apes and some Old World monkeys. In these species, the brain size of males is generally larger than that of females. Curiously, this dimorphism has persisted over the course of primate evolution and human origin, but there is no explanation for the underlying genetic controls that have maintained this disparity in brain size. In the present study, we tested the effect of the female hormone (estradiol) on seven genes known to be related to brain size in both humans and nonhuman primates, and we identified half estrogen responsive elements (half EREs) in the promoter regions of four genes (MCPH1, ASPM, CDK5RAP2 and WDR62). Likewise, at sequence level, it appears that these half EREs are generally conserved across primates. Later testing via a reporter gene assay and cell-based endogenous expression measurement revealed that estradiol could significantly suppress the expression of the four affected genes involved in brain size. More intriguingly, when the half EREs were deleted from the promoters, the suppression effect disappeared, suggesting that the half EREs mediate the regulation of estradiol on the brain size genes. We next replicated these experiments using promoter sequences from chimpanzees and rhesus macaques, and observed a similar suppressive effect of estradiol on gene expression, suggesting that this mechanism is conserved among primate species that exhibit brain size dimorphism. Brain size dimorphism among certain primates, including humans, is likely regulated by estrogen through its sex-dependent suppression of brain size genes during development.

  2. Ept7 influences estrogen action in the pituitary gland and body weight of rats.

    Science.gov (United States)

    Kurz, Scott G; Dennison, Kirsten L; Samanas, Nyssa Becker; Hickman, Maureen Peters; Eckert, Quincy A; Walker, Tiffany L; Cupp, Andrea S; Shull, James D

    2014-06-01

    Estrogens control many aspects of pituitary gland biology, including regulation of lactotroph homeostasis and synthesis and secretion of prolactin. In rat models, these actions are strain specific and heritable, and multiple quantitative trait loci (QTL) have been mapped that impact the responsiveness of the lactotroph to estrogens. One such QTL, Ept7, was mapped to RNO7 in female progeny generated in an intercross between BN rats, in which the lactotroph population is insensitive to estrogens, and ACI rats, which develop lactotroph hyperplasia/adenoma and associated hyperprolactinemia in response to estrogen treatment. The primary objective of this study was to confirm the existence of Ept7 and to quantify the impact of this QTL on responsiveness of the pituitary gland of female and male rats to 17β-estradiol (E2) and diethylstilbestrol (DES), respectively. Secondary objectives were to determine if Ept7 influences the responsiveness of the male reproductive tract to DES and to identify other discernible phenotypes influenced by Ept7. To achieve these objectives, a congenic rat strain that harbors BN alleles across the Ept7 interval on the genetic background of the ACI strain was generated and characterized to define the effect of administered estrogens on the anterior pituitary gland and male reproductive tissues. Data presented herein indicate Ept7 exerts a marked effect on development of lactotroph hyperplasia in response to estrogen treatment, but does not affect atrophy of the male reproductive tissues in response to hormone treatment. Ept7 was also observed to exert gender specific effects on body weight in young adult rats.

  3. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  4. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  5. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  6. CITED2 modulates estrogen receptor transcriptional activity in breast cancer cells

    International Nuclear Information System (INIS)

    Lau, Wen Min; Doucet, Michele; Huang, David; Weber, Kristy L.; Kominsky, Scott L.

    2013-01-01

    Highlights: •The effects of elevated CITED2 on ER function in breast cancer cells are examined. •CITED2 enhances cell growth in the absence of estrogen and presence of tamoxifen. •CITED2 functions as a transcriptional co-activator of ER in breast cancer cells. -- Abstract: Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) is a member of the CITED family of non-DNA binding transcriptional co-activators of the p300/CBP-mediated transcription complex. Previously, we identified CITED2 as being overexpressed in human breast tumors relative to normal mammary epithelium. Upon further investigation within the estrogen receptor (ER)-positive subset of these breast tumor samples, we found that CITED2 mRNA expression was elevated in those associated with poor survival. In light of this observation, we investigated the effect of elevated CITED2 levels on ER function. While ectopic overexpression of CITED2 in three ER-positive breast cancer cell lines (MCF-7, T47D, and CAMA-1) did not alter cell proliferation in complete media, growth was markedly enhanced in the absence of exogenous estrogen. Correspondingly, cells overexpressing CITED2 demonstrated reduced sensitivity to the growth inhibitory effects of the selective estrogen receptor modulator, 4-hydroxytamoxifen. Subsequent studies revealed that basal ER transcriptional activity was elevated in CITED2-overexpressing cells and was further increased upon the addition of estrogen. Similarly, basal and estrogen-induced expression of the ER-regulated genes trefoil factor 1 (TFF1) and progesterone receptor (PGR) was higher in cells overexpressing CITED2. Concordant with this observation, ChIP analysis revealed higher basal levels of CITED2 localized to the TFF-1 and PGR promoters in cells with ectopic overexpression of CITED2, and these levels were elevated further in response to estrogen stimulation. Taken together, these data indicate that CITED2 functions as a transcriptional co

  7. Breast Cancer and Estrogen-Alone Update

    Science.gov (United States)

    ... Current Issue Past Issues Research News From NIH Breast Cancer and Estrogen-Alone Update Past Issues / Summer 2006 ... hormone therapy does not increase the risk of breast cancer in postmenopausal women, according to an updated analysis ...

  8. Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

    International Nuclear Information System (INIS)

    Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

    2009-01-01

    Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused by these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects

  9. Estrogens and progression of diabetic kidney damage.

    Science.gov (United States)

    Doublier, Sophie; Lupia, Enrico; Catanuto, Paola; Elliot, Sharon J

    2011-01-01

    It is generally accepted that estrogens affect and modulate the development and progression of chronic kidney diseases (CKD) not related to diabetes. Clinical studies have indeed demonstrated that the severity and rate of progression of renal damage tends to be greater among men, compared with women. Experimental studies also support the notion that female sex is protective and male sex permissive, for the development of CKD in non-diabetics, through the opposing actions of estrogens and testosterone. However, when we consider diabetes-induced kidney damage, in the setting of either type 1 or type 2 diabetes, the contribution of gender to the progression of renal disease is somewhat uncertain. Previous studies on the effects of estrogens in the pathogenesis of progressive kidney damage have primarily focused on mesangial cells. More recently, data on the effects of estrogens on podocytes, the cell type whose role may include initiation of progressive diabetic renal disease, became available. The aim of this review will be to summarize the main clinical and experimental data on the effects of estrogens on the progression of diabetes-induced kidney injury. In particular, we will highlight the possible biological effects of estrogens on podocytes, especially considering those critical for the pathogenesis of diabetic kidney damage.

  10. Cigarette Smoke and Estrogen Signaling in Human Airway Smooth Muscle

    Directory of Open Access Journals (Sweden)

    Venkatachalem Sathish

    2015-06-01

    Full Text Available Aims: Cigarette smoke (CS in active smokers and second-hand smoke exposure exacerbate respiratory disorders such as asthma and chronic bronchitis. While women are known to experience a more asthmatic response to CS than emphysema in men, there is limited information on the mechanisms of CS-induced airway dysfunction. We hypothesize that CS interferes with a normal (protective bronchodilatory role of estrogens, thus worsening airway contractility. Methods: We tested effects of cigarette smoke extract (CSE on 17β-estradiol (E2 signaling in enzymatically-dissociated bronchial airway smooth muscle (ASM obtained from lung samples of non-smoking female patients undergoing thoracic surgery. Results: In fura-2 loaded ASM cells, CSE increased intracellular calcium ([Ca2+]i responses to 10µM histamine. Acute exposure to physiological concentrations of E2 decreased [Ca2+]i responses. However, in 24h exposed CSE cells, although expression of estrogen receptors was increased, the effect of E2 on [Ca2+]i was blunted. Acute E2 exposure also decreased store-operated Ca2+ entry and inhibited stromal interaction molecule 1 (STIM1 phosphorylation: effects blunted by CSE. Acute exposure to E2 increased cAMP, but less so in 24h CSE-exposed cells. 24h CSE exposure increased S-nitrosylation of ERα. Furthermore, 24h CSE-exposed bronchial rings showed increased bronchoconstrictor agonist responses that were not reduced as effectively by E2 compared to non-CSE controls. Conclusion: These data suggest that CS induces dysregulation of estrogen signaling in ASM, which could contribute to increased airway contractility in women exposed to CS.

  11. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  12. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  13. "Doctor, are you trying to kill me?": ambivalence about the patient package insert for estrogen.

    Science.gov (United States)

    Watkins, Elizabeth Siegel

    2002-01-01

    In 1976, the U.S. Food and Drug Administration proposed new requirements for patient labeling for estrogens prescribed for menopausal and postmenopausal women. This paper explores the variety of responses to this proposal from women and their husbands, feminist and consumer activists, physicians, pharmacists, and pharmaceutical manufacturers, as represented in letters written to the FDA. The drug industry and the medical profession opposed patient labeling on the grounds of cost and a resentment of governmental intrusion. Feminists and consumer advocates were in favor of the idea, but the response from current estrogen users was mixed: most women wished to be better informed, but many expressed concern that estrogen would be removed from the market. This ambivalence suggests unresolved tensions regarding conceptions of female aging, the medical management of menopause and aging, informed consent in medicine, and governmental regulation of medical practice. The debate thus represents an important moment in the history of women's health care.

  14. Effects of Estrogen in Gender-dependent Fetal Programming of Adult Cardiovascular Dysfunction.

    Science.gov (United States)

    Chen, Zewen; Wang, Lei; Ke, Jun; Xiao, DaLiao

    2018-03-01

    Epidemiological studies and experimental studies have demonstrated that intrauterine adverse environment increases the risk of cardiovascular disease (CVD) in adulthood. However, whether an individual develops a cardiovascular dysfunctional phenotype may depend on genetic background, age, and sex. In this review, we summarize some of the recent experimental animal studies in the developmental programming of adult CVD with an emphasis on sex differences and the potential role of estrogen in mediating sexual dimorphism. Few epidemiological studies report the effect of sex on the developmental programming of CVD. However, numerous experimental animal studies have shown a sex difference in fetal programming of adult cardiovascular dysfunction. Most of the animal studies indicate that male offspring develop cardiovascular dysfunction and CVD in adulthood, whereas adult females appear to be protected. Estrogen is one of the key factors that contributes to the sex difference of adult CVD. Estrogen/its receptor (ER) may interact with the RAS system by changes of DNA methylation patterns at the target gene promoter, serve as an antioxidant to counteract the prenatal insults-induced heightened ROS, and function as an eNOS activator to increase vasodilation, resulting in the protection of female offspring from the development of hypertension and other CVDs. These studies suggest that estrogen/ER may contribute to sex differences in cardiovascular response to an adverse intrauterine environment and play a significant role in modulating the cardiovascular response in adulthood. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  15. Influence of testosterone on synaptic transmission in the rat medial vestibular nuclei: estrogenic and androgenic effects.

    Science.gov (United States)

    Grassi, S; Frondaroli, A; Di Mauro, M; Pettorossi, V E

    2010-12-15

    In brainstem slices of young male rat, we investigated the influence of the neuroactive steroid testosterone (T) on the synaptic responses by analyzing the field potential evoked in the medial vestibular nucleus (MVN) by vestibular afferent stimulation. T induced three distinct and independent long-term synaptic changes: fast long-lasting potentiation (fLP), slow long-lasting potentiation (sLP) and long-lasting depression (LD). The fLP was mediated by 17β-estradiol (E(2)) since it was abolished by blocking the estrogen receptors (ERs) or the enzyme converting T to E(2). Conversely, sLP and LD were mediated by 5α-dihydrotestosterone (DHT) since they were prevented by blocking the androgen receptors (ARs) or the enzyme converting T to DHT. Therefore, the synaptic effects of T were mediated by its androgenic or estrogenic metabolites. The pathways leading to estrogenic and androgenic conversion of T might be co-localized since, the occurrence of fLP under block of androgenic pathway, and that of sLP and LD under estrogenic block, were higher than those observed without blocks. In case of co-localization, the effect on synaptic transmission should depend on the prevailing enzymatic activity. We conclude that circulating and neuronal T can remarkably influence synaptic responses of the vestibular neurons in different and opposite ways, depending on its conversion to estrogenic or androgenic metabolites. Copyright © 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    Science.gov (United States)

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  18. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  19. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  20. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  1. Inhibition of Androgen-Independent Prostate Cancer by Estrogenic Compounds Is Associated with Increased Expression of Immune-Related Genes

    Directory of Open Access Journals (Sweden)

    Ilsa M. Coleman

    2006-10-01

    Full Text Available The clinical utility of estrogens for treating prostate cancer (CaP was established in the 1940s by Huggins. The classic model of the anti-CaP activity of estrogens postulates an indirect mechanism involving the suppression of androgen production. However, clinical, preclinical studies have shown that estrogens exert growth-inhibitory effects on CaP under low-androgen conditions, suggesting additional modes whereby estrogens affect CaP cells and/or the microenvironment. Here we have investigated the activity of 17β estradiol (E2 against androgen-independent CaP, identified molecular alterations in tumors exposed to E2. E2 treatment inhibited the growth of all four androgen-independent CaP xenografts studied (LuCaP 35V, LuCaP 23.1AI, LuCaP 49, LuCaP 58 in castrated male mice. The molecular basis of growth suppression was studied by cDNA microarray analysis, which indicated that multiple pathways are altered by E2 treatment. Of particular interest are changes in transcripts encoding proteins that mediate immune