WorldWideScience

Sample records for esseslased marsivad taas

  1. Applied Materials taas investorite huviorbiidis / Erlend Zirk

    Index Scriptorium Estoniae

    Zirk, Erlend

    2006-01-01

    Ilmunud ka: Delovõje Vedomosti 29. nov. lk. 33. Protsessorite tootmisseadmete tootja Applied Materials on pärast 2000. aasta börsikrahhi taas investorite huviorbiiti jõudmas. Diagramm: Applied Materialsi aktsia

  2. TLÜ rektor Rein Raud valiti taas UNICA juhatusse / Maiki Voore

    Index Scriptorium Estoniae

    Voore, Maiki, 1983-

    2009-01-01

    Tallinna Ülikooli rektor Rein Raud valiti taas UNICA (Network of Universities from the Capitals of Europe) uue juhatuse liikmeks. UNICA rektorite 2010. aasta seminar otsustati korraldada Tallinna Ülikoolis

  3. Koread hakkavad taas perekondi kokku lubama / Igor Taro

    Index Scriptorium Estoniae

    Taro, Igor

    2007-01-01

    Kahe Korea võimud leppisid kokku, et lähikuudel avaneb jälle võimalus taasühineda peredel, kes jäid Korea sõja tagajärjel aastakümneteks kahele poole piiri. Põhja- ja Lõuna-Korea vahelise konflikti lühiülevaade

  4. Anomalous electronic structure and magnetoresistance in TaAs2.

    Science.gov (United States)

    Luo, Yongkang; McDonald, R D; Rosa, P F S; Scott, B; Wakeham, N; Ghimire, N J; Bauer, E D; Thompson, J D; Ronning, F

    2016-06-07

    The change in resistance of a material in a magnetic field reflects its electronic state. In metals with weakly- or non-interacting electrons, the resistance typically increases upon the application of a magnetic field. In contrast, negative magnetoresistance may appear under some circumstances, e.g., in metals with anisotropic Fermi surfaces or with spin-disorder scattering and semimetals with Dirac or Weyl electronic structures. Here we show that the non-magnetic semimetal TaAs2 possesses a very large negative magnetoresistance, with an unknown scattering mechanism. Density functional calculations find that TaAs2 is a new topological semimetal [ℤ2 invariant (0;111)] without Dirac dispersion, demonstrating that a negative magnetoresistance in non-magnetic semimetals cannot be attributed uniquely to the Adler-Bell-Jackiw chiral anomaly of bulk Dirac/Weyl fermions.

  5. Kinnipeetava taasühiskonnastamine Eestis ja Rootsis : [bakalaureusetöö] / Signe Laanemäe ; Tartu Ülikool, õigusteaduskond ; juhendaja: Andres Parmas

    Index Scriptorium Estoniae

    Laanemäe, Signe

    2009-01-01

    Vabadusekaotuse olemusest, vangistuse arenguloost, taasühiskonnastamisega seoses esilekerkivatest põhiprobleemidest Eestis ja Rootsis, uutest meetmetest seoses kinnipeetava taasühiskonnastamisega Rootsis

  6. Endine KGB-lane pürib taas Narvas volikokku / Toomas Kümmel

    Index Scriptorium Estoniae

    Kümmel, Toomas

    2002-01-01

    KGB-mineviku varjamise pärast Keskerakonnast välja visatud Valdek Lans (Vadim Tomilov) astus taas erakonda ja kandideerib kohalikel valimistel. Kommenteerib Narva linnavolikogu esinaine Elsa Suikanen

  7. 20 CFR 665.330 - Are the NAFTA-TAA program requirements for rapid response also required activities?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are the NAFTA-TAA program requirements for... WORKFORCE INVESTMENT ACT Rapid Response Activities § 665.330 Are the NAFTA-TAA program requirements for... WIA are made available to workers who, under the NAFTA Implementation Act (Public Law 103-182), are...

  8. TAA Polyepitope DNA-Based Vaccines: A Potential Tool for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Roberto Bei

    2010-01-01

    Full Text Available DNA-based cancer vaccines represent an attractive strategy for inducing immunity to tumor associated antigens (TAAs in cancer patients. The demonstration that the delivery of a recombinant plasmid encoding epitopes can lead to epitope production, processing, and presentation to CD8+ T-lymphocytes, and the advantage of using a single DNA construct encoding multiple epitopes of one or more TAAs to elicit a broad spectrum of cytotoxic T-lymphocytes has encouraged the development of a variety of strategies aimed at increasing immunogenicity of TAA polyepitope DNA-based vaccines. The polyepitope DNA-based cancer vaccine approach can (a circumvent the variability of peptide presentation by tumor cells, (b allow the introduction in the plasmid construct of multiple immunogenic epitopes including heteroclitic epitope versions, and (c permit to enroll patients with different major histocompatibility complex (MHC haplotypes. This review will discuss the rationale for using the TAA polyepitope DNA-based vaccination strategy and recent results corroborating the usefulness of DNA encoding polyepitope vaccines as a potential tool for cancer therapy.

  9. Fabrication and testing of TAA bonded carbon electrodes in primary fuel cells. Technical progress report No. 1, March 1978-May 1978

    Energy Technology Data Exchange (ETDEWEB)

    None

    1978-06-15

    Metallated tetraazannulene (TAA) compounds were prepared and their electrochemical behavior determined as paraffin pellets inserted in a rotating disk electrode. Cobalt TAA, which had been heat treated at 600/sup 0/C for one hour, was observed to be the most active compared to iron, manganese and nickel TAAs and to nickel chloro-, dichloro- and nitro- TAA analogues. Cobalt TAA was shown to be as active on a weight percent basis as platinum in catalyzing the oxygen dissolution reaction in oxygen saturated concentrated phosphoric acid at room temperature. Cobalt TAA has been functionalized via a Mannich reaction and will be bonded directly to bromoacylated Vulcan XC-72. The activity and the stability of this bonded electrode material will be determined in the next quarter.

  10. Fabrication and testing of TAA bonded carbon electrodes in primary fuel cells. Technical progress report No. 2, June 1978 - September 1978

    Energy Technology Data Exchange (ETDEWEB)

    None

    1978-10-13

    Cobalt dibenzotetraazannulene (CoTAA) has been covalently linked via an acyl ligand to carbon (Vulcan XC-72). This bonded-CoTAA has been shown, in rotating disk electrode tests, to have catalytic activity equal to platinum on a weight percent basis for the oxygen dissolution reaction at room temperature in concentrated phosphoric acid. Bonded-CoTAA has been shown to be stable in 150/sup 0/C concentrated phosphoric acid. Performance of bonded-CoTAA as a cathode in a primary fuel cell will be determined in the next quarter.

  11. High-pressure phases of Weyl semimetals NbP, NbAs, TaP, and TaAs

    Science.gov (United States)

    Guo, ZhaoPeng; Lu, PengChao; Chen, Tong; Wu, JueFei; Sun, Jian; Xing, DingYu

    2018-03-01

    In this study, we used the crystal structure search method and first-principles calculations to systematically explore the highpressure phase diagrams of the TaAs family (NbP, NbAs, TaP, and TaAs). Our calculation results show that NbAs and TaAs have similar phase diagrams, the same structural phase transition sequence I41 md→ P6¯ m2→ P21/ c→ Pm3¯ m, and slightly different transition pressures. The phase transition sequence of NbP and TaP differs somewhat from that of NbAs and TaAs, in which new structures emerge, such as the Cmcm structure in NbP and the Pmmn structure in TaP. Interestingly, we found that in the electronic structure of the high-pressure phase P6¯ m2-NbAs, there are coexistingWeyl points and triple degenerate points, similar to those found in high-pressure P6¯ m2-TaAs.

  12. Crystal growth and transport properties of Weyl semimetal TaAs

    Science.gov (United States)

    Sankar, Raman; Peramaiyan, G.; Panneer Muthuselvam, I.; Xu, Suyang; Zahid Hasan, M.; Chou, F. C.

    2018-01-01

    We report the single crystal growth and transport properties of a Weyl semimetal TaAs. Unsaturated large magnetoresistance of about 22 100% at 2 K and 9 T is observed. From the Hall measurement, carrier concentrations n  =  4.608  ×  1024 m‑3 and p  =  3.099  ×  1024 m‑3, and mobilities µ p   =  2.502 m2 V‑1 s‑1 and µ n   =  16.785 m2 V‑1 s‑1 at 2 K are extracted. The de Haas–van Alphen oscillations at 2 K and 9 T suggest the presence of a Fermi surface, and the quantum electronic parameters such as effective cyclotron mass and Dingle temperature were obtained using Lifshitz–Kosevich fitting. Temperature dependent resistivity measurements at different static magnetic fields suggest the formation of an insulating gap in the Weyl semimetal TaAs. An angle-resolved photoemission spectroscopy study reveals Fermi arc surface states with different shaped features such as a long elliptical contour around each \\overline{Y} point, a bowtie-shaped contour around each \\overline{X} point, and a crescent-shaped feature near the midpoint of each \\overline{Γ }{{\\text{--}}}\\overline{X}(\\overline{Y}) line.

  13. Observation of the Chiral-Anomaly-Induced Negative Magnetoresistance in 3D Weyl Semimetal TaAs

    Directory of Open Access Journals (Sweden)

    Xiaochun Huang

    2015-08-01

    Full Text Available Weyl semimetal is the three-dimensional analog of graphene. According to quantum field theory, the appearance of Weyl points near the Fermi level will cause novel transport phenomena related to chiral anomaly. In the present paper, we report the experimental evidence for the long-anticipated negative magnetoresistance generated by the chiral anomaly in a newly predicted time-reversal-invariant Weyl semimetal material TaAs. Clear Shubnikov de Haas (SdH oscillations have been detected starting from a very weak magnetic field. Analysis of the SdH peaks gives the Berry phase accumulated along the cyclotron orbits as π, indicating the existence of Weyl points.

  14. Oksanenile taas preemia

    Index Scriptorium Estoniae

    2010-01-01

    Sofi Oksaneni romaan "Puhastus" pälvis Euroopa Raamatu auhinna (European Book Prize), tunnustati ka itaallast Roberto Savianot essee "Kaunitar ja koletis" eest ("La bellezza e l'inferno. Scritti 2004-2009")

  15. "Linn" taas Theatrumis

    Index Scriptorium Estoniae

    2009-01-01

    Theatrumis võib veel mõned korrad oktoobris vaadata sel aastal nii parima lavastaja (Lembit Peterson) kui ka meesnäitleja (Marius Peterson) kategoorias teatripreemia pälvinud lavastust - Jevgeni Griškovetsi "Linna"

  16. Eesti disain taas Pariisis

    Index Scriptorium Estoniae

    2007-01-01

    Eesti Disainerite Liit esitleb septembris 2007 oma kollektsiooni Pariisi sisustusmessi Maison&Object disainisektsioonis NOW! Stendi kujundus on Anneli Lobjalt. Osalejatest nimetatud: Annike Laigo, Merike Rehepapp, Jaanus Orgusaar, Jan Graps, Ken Ruut, Jaakko Matsalu, Eva-Liisa Kriis, Liisa Kallam, Liisa Tomasberg, Tarmo Luisk, Monika Järg, Keret Altpere, Elna Kaasik, Tõnis Vellama ja Ilona Gurjanova

  17. Taas joonistamisest / Merike Trubert

    Index Scriptorium Estoniae

    Trubert, Merike

    2011-01-01

    Tartu Kõrgema Kunstikooli joonistamise õppejõud Merike Trubert probleemidest kunstikõrgkoolides joonistamise õpetamisel, joonistamisõpetuse vajalikkusest üldhariduses, joonistamisest kui iseseisvast kunstiliigist, joonistamise populariseerimisest maailmas, pikemalt ürituste programmist "Big Draw" Suurbritannias

  18. Eesti joonisfilm taas edukas

    Index Scriptorium Estoniae

    2003-01-01

    Riia I rahvusvahelisel animafilmide festivalil võitis "Kontsert porgandipirukale" parima animafilmi auhinna. Grand prix'i sai inglase Ignacio Ferreresi film "How to Cope With a Death". Žüriisse kuulus ka Rein Raamat

  19. CD4+ T cells play a critical role in the generation of primary and memory antitumor immune responses elicited by SA-4-1BBL and TAA-based vaccines in mouse tumor models.

    Science.gov (United States)

    Sharma, Rajesh K; Yolcu, Esma S; Srivastava, Abhishek K; Shirwan, Haval

    2013-01-01

    The role of CD4(+) T cells in the generation of therapeutic primary and memory immune responses in cancer diverse immunotherapy settings remains ambiguous. We herein investigated this issue using two vaccine formulations containing a novel costimulatory molecule, SA-4-1BBL, as adjuvant and HPV E7 or survivin (SVN) as tumor associated antigens (TAAs) in two mouse transplantable tumor models; the TC-1 cervical cancer expressing xenogeneic HPV E7 and 3LL lung carcinoma overexpressing autologous SVN. Single vaccination with optimized SA-4-1BBL/TAA formulations resulted in the eradication of 6-day established TC-1 and 3LL tumors in >70% of mice in both models. The in vivo depletion of CD4(+) T cells one day before tumor challenge resulted in compromised vaccine efficacy in both TC-1 (25%) and 3LL (12.5%) tumor models. In marked contrast, depletion of CD4(+) T cells 5 days post-tumor challenge and one day prior to vaccination did not significantly alter the therapeutic efficacy of these vaccines. However, long-term immunological memory was compromised in the 3LL, but not in TC-1 model as a significant number (85.7%) of tumor free-mice succumbed to tumor growth when rechallenged with 3LL cells 60 days after the initial tumor inoculation. Collectively, these results demonstrate the indispensable role CD4(+) T cells play in the generation of therapeutic primary immune responses elicited by SA-4-1BBL/TAA-based vaccines irrespective of the nature of TAAs and establish the importance of CD4(+) T cells for long-term immune memory against 3LL tumor expressing self-antigen SVN, but not TC-1 expressing xenogeneic viral antigen E7.

  20. Mononuclear Amido and Binuclear Imido Zirconium Complexes Supported by Dibenzotetraaza[14]annulene Ligands. X-ray Structure of [(Me(4)taa)Zr(&mgr;-NR)(2)Zr(NHR)(2)] (R = Bu(t) or 2,6-C(6)H(3)Me(2)).

    Science.gov (United States)

    Nikonov, Georgii I.; Blake, Alexander J.; Mountford, Philip

    1997-03-12

    Reaction of 2 equiv of Li[NH-2,6-C(6)H(3)R(2)] with [(Me(4)taa)ZrCl(2)] (Me(4)taaH(2) = tetramethyldibenzotetraaza[14]annulene) gives the bis(amido) derivatives [(Me(4)taa)Zr(NH-2,6-C(6)H(3)R(2))(2)] [R = Pr(i) (1) and Me (2)]. Addition of Me(4)taaH(2) to [Zr(N-2,6-C(6)H(3)Pr(i)(2))(NH-2,6-C(6)H(3)Pr(i)(2))(2)(py)(2)] also affords 1. The reaction of 2 equiv of aryl or alkyl amines H(2)NR with the bis(alkyl) complex [(Me(4)taa)Zr(CH(2)SiMe(3))(2)] is the most versatile method for preparing [(Me(4)taa)Zr(NHR)(2)] (R = 2,6-C(6)H(3)Pr(i)(2), 2,6-C(6)H(3)Me(2), Ph, or Bu(t)). Reaction of 1 equiv of Me(4)taaH(2) with the binuclear complexes [(Bu(t)NH)(2)Zr(&mgr;-NBu(t))(2)Zr(NHBu(t))(2)] or [(py)(HN-2,6-C(6)H(3)Me(2))(2)Zr(&mgr;-N-2,6-C(6)H(3)Me(2))(2)Zr(NH-2,6-C(6)H(3)Me(2))(2)(py)] gives the asymmetrically substituted derivatives [(Me(4)taa)Zr(&mgr;-NR)(2)Zr(NHR)(2)] [R = Bu(t) (6) or 2,6-C(6)H(3)Me(2) (8)], which have been crystallographically characterized.

  1. Avaliação fisiológica e comportamental de cães utilizados em terapia assistida por animais (TAA

    Directory of Open Access Journals (Sweden)

    K.C.M. Yamamoto

    2012-06-01

    Full Text Available Realizou-se a observação comportamental de nove cães terapeutas (oito da raça Labrador Retriever e um Golden Retriever, dosaram-se cortisol sérico e salivar, aferiram-se a temperatura retal, a pressão arterial sistólica e as frequências cardíaca e respiratória nos seguintes momentos: M0 (média de três avaliações do cão em repouso e em M1, M2 e M3 (imediatamente antes, imediatamente após e decorridas 24h das atividades de terapia assistida por animais - TAA, respectivamente. Não houve diferença significativa quanto às características estudadas (P>0,05, exceto pela temperatura, que foi mais elevada em M1 e M2 do que em M0 (P=0,009. A avaliação comportamental, realizada de maneira descritiva, não apresentou alteração negativa. Houve diferença significativa quanto à concentração de cortisol sérico entre os momentos M1 e M3 (P=0,071, e não ocorreu diferença da concentração do cortisol salivar entre os quatro momentos (P=0,746. As alterações observadas foram atribuídas à contenção e à manipulação dos animais e não desencadearam desconforto físico ou estresse dignos de nota em cães.

  2. Tarbekunsti- ja Disainimuuseum taas avatud

    Index Scriptorium Estoniae

    2005-01-01

    2. VI avati rekonstrueeritud muuseumihoone. Rekonstrueerimisprojekti autorid: Arhitektuuriagentuuri arhitekt Inga Raukas, sisearhitekt Monika Löve. Ehitustööd: Rihti Projekt. Avatud nahakunstinäitus "Järjehoidja" (kuraator Airi Ligi, kujundaja Siiri Nõva, näha saab ka nahakunsti üliõpilaste töid; filmiprogramm: Maya Yonesho "Üks uks", "Ecce libri" Pille Kivihallist, Tiina Piisangust ja Maarja Unduskist) ja rahvusvaheline köitekunstinäitus "Scripta manent III. Maailma parim asi", kujundaja Lennart Mänd

  3. Ufo on taas maandunud! / Urmas Oja

    Index Scriptorium Estoniae

    Oja, Urmas, 1981-2012

    2005-01-01

    1970. aastatel soome arhitekti Matti Suuroneni projekteeritud lendavat taldrikut meenutavast plastikust tulevikumajast Futoro, millest üks toodi 1995. a. Halinga keskuse juurde Pärnumaal ja praegu asub Tallinna lähedal. Maja valmistati Soome plasttoodete tehases Polykem. Soomlaste ufomajade ehitamise teostamata plaanist. 8 ill

  4. Linnahalli saatus taas savijalgadel / Andres Eilart

    Index Scriptorium Estoniae

    Eilart, Andres

    2009-01-01

    Tallinnas viibis Tallinna Linnahalli ja selle ümbruse arendamisest huvituva Tallinn Entertainment LLC esindaja arhitekt Jack Weinand, kes kinnitas, et linnahalli väljanägemises ei tule muutusi. Tallinna ja Tallinn Entertainment LLC vahel sõlmitud eellepingust

  5. Serbia liigub taas Euroopa Liidu poole

    Index Scriptorium Estoniae

    2007-01-01

    Euroopa Liit kutsub Serbia jätkama kõnelusi riigi pürgimiseks ühenduse liikmeks, tõuke kõneluste jätkamiseks andis Haagi peasüüdistaja ja Serbia senise tugeva kritiseerija Carla Del Ponte rahulolu Belgradi pingutustega Balkani sõjakurjategijate väljaandmisel

  6. Eestis toodetakse taas võimendeid

    Index Scriptorium Estoniae

    2002-01-01

    Tallinnas Lavintoni laboris valmisid esimesed seeriatootmiseks mõeldud originaalse disainiga lampvõimendid. Toodet müüakse USAs Audese kaubamärgi all ja Eesti turule jõuab ta sügisel (www.audes.ee)

  7. Aeg taas Hiina investeerida / Romet Kreek

    Index Scriptorium Estoniae

    Kreek, Romet, 1972-

    2008-01-01

    Jim Rogers leiab, et Hiina ettevõtete aktsiad on tasemel, kust tasub neid jälle ostma hakata. Diagramm: USA aktsiaturul kaubeldud Hiina indeksaktsia FXI on asunud üles rühkima. Vt. samas: USA börsil on Hiina aktsiaid Eesti investoritel lihtne osta-müüa; Taust

  8. Von Trappi lapsed taas koos / Triin Thalheim

    Index Scriptorium Estoniae

    Thalheim, Triin, 1982-

    2005-01-01

    Muusikali "Helisev muusika" filmiversiooni esilinastumisest on möödas 40 aastat. Kokkuvõtlikult sellest, mis on saanud filmis osalenud näitlejatest. Režissöör Robert Wise : Ameerika Ühendriigid

  9. Hillary murrab taas uudistesse, minestamisega / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2005-01-01

    USA senaator Hillary Clinton esines New Yorgi osariigi Buffalo-lähedase väikelinna kaubanduskoja korraldatud üritusel. Viimasel ajal on senaator pälvinud tähelepanu võttes sõna abordi- ja usuteemal. Vt. samas: Hillary soovib endale konservatiivsemat imagot

  10. Kas taas osa terviku asemel? / Birute Klaas

    Index Scriptorium Estoniae

    Klaas, Birute, 1957-

    2003-01-01

    Tartu Ülikooli filosoofiateaduskonna dekaani Birute Klaasi mõttearendus tulenevalt peaminister Juhan Partsi intervjuust 19. 12. 2003. a. Eesti Päevalehele, kus muu hulgas puudutati ka haridusstrateegia probleeme. B. Klaas põhjendab ka humanitaarhariduse andmise järjepidevuse tähtsust

  11. Pärnus taas kuldne svingiajastu

    Index Scriptorium Estoniae

    2008-01-01

    19. ja 26. dets. esinevad Pärnus Café Grandis Pärnu linnaorkestri muusikutest koosnev bigbänd Swingkompanii G7 ja Airi Allvee, kõlavad Glenn Milleri, Duke Ellingtoni, RAimond Valgre jt lood (arranzheeringud on Olev Söödilt)

  12. Palmse supelmaja taas kasutusel / Anneliis Aunapuu

    Index Scriptorium Estoniae

    Aunapuu, Anneliis

    1998-01-01

    Lahemaa Rahvuspark rentis poolelioleva supelmaja perekond Ong'ile, kes ehituse lõpetas, hoone sisustas ja avas kohvik-restorani 'Freifrau Isabella'. Sisekujundus autor Leila Pärtelpoeg nimetab sisekujundust palladiaanlikuks. Tänu AEL ja Tartu Kunstikooliga sõlmitud lepingule sai supelmaja kõrgetasemelise maalritöö. Maalingud eesruumis ئ Eve Erman. Sepisvalgustid ئ Ülo Sepp. Pika-laua-saalis oleva von Pahlenite vapi valmistas Andres Sapar. Inkrusteeritud puhvetkapi taastas Urmas Ong.

  13. Manifest toob klassika taas kinoekraanile / Andri Maimets

    Index Scriptorium Estoniae

    Maimets, Andri, 1979-

    2007-01-01

    2.-9. veebr. on kinos "Sõprus" ja 11.-15. veebr. Tartu Sadamateatris 5. kultusfilmide festival Manifest, seekord USA filmid ja teemaks sõnavabadus. Esilinastub ka Urmas E. Liivi dokumentaalfilm "Tervitusi Nõukogude Eestist!"

  14. Inglismaal jagati taas D&AD auhindu

    Index Scriptorium Estoniae

    2008-01-01

    Keskkonnakujunduse kategoorias tõsteti 2007. a. esile: Heathrow Terminal 5 klubi (arhitektid Chris Bagot, Oliver Salway, disainerid Joe Ferry, Emma Lally, Monique van der Hurk, Hillary Clark jt.), Lohringi metroojaam Bohumis (Rübsamen & Partner, kunstnikud Eva-Maria Joeressen, Klaus Kessner), kauplus Freitag Zürichis (arhitektid Harald Echsle, Annette Spillmann, disainerid Daniel ja Markus Freitag)

  15. Tantsupäev toob taas auhinnad

    Index Scriptorium Estoniae

    2008-01-01

    Philip Morrise kaasaegse tantsu auhinnale kandideerivad aasta tegija kategoorias int.act.union ja Taavet Jansen teosega "Algorytm", Oksana Titova teosega "Hamlet", Renate Valme teosega "Idula" ning Mairika Plakso ja Margus Toomla teosega "The Story of M. & M. Part II". Laureaadid kuulutatakse välja vahetult enne rahvusvahelist tantsupäeva

  16. Pinochet taas trellide taga / Kalev Vilgats

    Index Scriptorium Estoniae

    Vilgats, Kalev

    2005-01-01

    Santiagos vahistati Tšiili endine diktaator Augusto Pinochet, keda süüdistatakse maksupettuses ja passide võltsimises seoses salajaste pangaarvetega, millel on hoiustatud miljoneid dollareid valenimede all USA-s ja teistes riikides

  17. Preparation of polypeptides comprising multiple TAA peptides.

    Science.gov (United States)

    Ni, Bing; Jia, Zhengcai; Wu, Yuzhang

    2014-01-01

    Polypeptides consisting of multiple tumor-associated antigen epitopes (multiepitope peptides) are commonly used as therapeutic peptide cancer vaccines in experimental studies and clinical trials. These methods include polypeptides composed of multiple major histocompatibility complex (MHC) class I-restricted cytotoxic T cell (CTL) epitopes and those containing multiple CTL epitopes and one T helper (Th) epitope. This chapter describes a complete set of methods for preparing multiepitope peptides and branched multiple antigen peptides (MAPs), including sequence design, peptide synthesis, purification, preservation, and the preparation of polypeptide solutions.

  18. Intiimsed pilgud (taas)avastatud ruumile

    Index Scriptorium Estoniae

    1998-01-01

    Eesti ja inglise kunstnike feministlik ühisprojekt "Private Views" 1. juunist Rotermanni soolalaos. Kuraatorid Mare Tralla, Pam Skelton. Näituse eesmärk - jälgida ruumikogemuse vahendamist eesti ja inglise kunstis. Keskmes naise koht ja suhe ruumiga 90ndate Euroopas. Kasutatud fotot, videot, arvutikunsti. Osalejad toodud - Eestist Anu Juurak, Eve Kiiler, Mari Koort, Ene-Liis Semper, Kiwa, Liina Siib, Annika Tonts, F.F.F.F., Mare Tralla

  19. Aeg vaadata taas Citigroupi / Peeter Teder

    Index Scriptorium Estoniae

    Teder, Peeter

    2006-01-01

    Vaatamata USA ühe suurima panga Citigroup kasumi kasvule on ettevõttel siiski pärast Enroni ja WorldComi skandaale raskusi investorite leidmisega. Diagramm: Citigroupi aktsia on vaid paar korda käinud 50 dollari tasemest kõrgemal. Vt. samas: Kasvuvõimega pank

  20. Areen jagab taas aastapreemiaid : nominendid selgunud!

    Index Scriptorium Estoniae

    2005-01-01

    Eesti Ekspressi kultuurilisa Areeni aastapreemia nominentide seas ansambel Röövel Ööbik (kontserdid, album "Supersymmetry"), Andres Mustonen (vanamuusika; jazz-viiuldaja), räppar Chalice (album "Süsteemsüsteem"), helilooja Tõnis Kaumann (lasteooper "Napoleon"), maalikunstnik Evald Okas, vitraažikunstnik Kai Kaljo, arhitektuuriajaloolane Karin Hallas-Murula, disainer Tarmo Luisk, fotograafid Mark Raidpere ja Tiit Lepp, Alver Trummal Arhitektid, disainibüroo Labor jt.

  1. Meediareklaam taas kasvutrendis / Külli Esko

    Index Scriptorium Estoniae

    Esko, Külli

    2006-01-01

    TNS Emori reklaamipanuste monitooringu AdEx andmetel oli meediareklaamituru käive käesoleva aasta esimeses kvartalis 279 miljonit krooni, kasv võrreldes eelmise aastaga 17%. Diagramm: Meediatüüpide reklaamimahud

  2. Moostes taas mõtte- ja kunstitalgud

    Index Scriptorium Estoniae

    2002-01-01

    17. ja 18. VIII lõpetatakse Moostes teised "Postsovkhozi" mõtte- ja keskkonnakunsti talgud "Kihid". Organiseerijad Evelyn Müürsepp ja Maia Möller. Moostes nädal aega elanud ja loonud kunstnikud. Seminari kavast, esinejatest, filmiprogrammist

  3. Pärnu filmifestival taas ETVs

    Index Scriptorium Estoniae

    2007-01-01

    XXI Rahvusvaheline Pärnu filmifestival : Eesti Televisioon näitab 8.-14.07. eriprogrammi, kuhu on valitud filmid "Minu surm, mitte sinu" (Saksamaa-India 2006), "Valgevene õppetund" (Poola-Valgevene 2006), "Beslan - õigus elada" (Venemaa 2006), "Esimene rahu õppetund" (Iisrael 2006), "Õnne vaenlased" (Taani-Afganistan 2006), "Mu tütar on terrorist" (Norra 2006) ja "Lugu kehast" (Iisrael 2006)

  4. Saksamaa teatrilavadel taas 1920. aastad / Erkki Otsman

    Index Scriptorium Estoniae

    Otsman, Erkki, 1966-

    2006-01-01

    Berliinis ja Hamburgis nähtud kabaree-etendustest : Bertolt Brechti "Kolmekrossiooper" Berliini uues teater-kontserdisaalis Admiralspalast (lavastaja Klaus Maria Brandauer), Max Raabe ja Palast Orchesteri kontsertetendus "Palast Revue" Hamburgi Thalia teatris, Georgette Dee kontsert Brechti lauludest

  5. Ericsson käratas taas negatiivse uudise / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Ericsson teatas käibe vähenemisest varasema prognoosi alumisse äärde tänu dollarile ja poliitilistele riskidele, mispeale kukkus aktsia hind nelja aasta madalaimale tasemele. Diagramm: Aktsia hind. Tabel: Novembris Ericssoni aktsiale antud soovitused

  6. Kosovo probleemid taas ummikseisus / Jüri Piirisild

    Index Scriptorium Estoniae

    Piirisild, Jüri

    2007-01-01

    Kosovo iseseisvumist lükkab edasi Venemaa vastuseis, kes on ÜRO-s selle küsimuse puhul ähvardanud kasutada oma vetoõigust. Ühelt poolt on see Venemaa võimalus lüüa kiilu lääneriikide vahele, kuid teisalt tooks ka Kosovo iseseisvumine Venemaale kasu

  7. Taas teadmusühiskonna infopoliitikast / Silvi Metsar

    Index Scriptorium Estoniae

    Metsar, Silvi

    2004-01-01

    RRis toimunud II infopoliitika foorumil "Riiklik infopoliitika - müüt või tegelikkus" arutleti, kas Eestis on infoühiskond, milline on riiklik infopoliitika jne. Teiste seas osalesid Anu Toots, Tiiu Valm, Peeter Tulviste, Jaak Aaviksoo, Raul Malmstein

  8. Härra Buffett jagas taas suuniseid / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2008-01-01

    Warren Buffet rääkis Berkshire Hathaway aktsionäride koosolekul majandusest ja investeerimisvõimalustest. Diagramm: Berkshire'i aktsia hind. Lisa: 200 miljardi dollari ettevõte. Kommenteerib Tarvo Vaarmets

  9. Konkurentsivõimelisimaks ettevõtteks valiti taas Hansapank

    Index Scriptorium Estoniae

    2006-01-01

    Ettevõtluse Arendamise Sihtasutuse (EAS) korraldatud konkursil valiti Eesti kõige konkurentsivõimelisemaks ettevõtteks Hansapank, ettevõtluse auhinna võitis Vertex Estonia. Lisa: Ja võitjad on...

  10. Kaks hõbekeelset kannelt helisemas taas ... / Liina Saarlo

    Index Scriptorium Estoniae

    Saarlo, Liina, 1974-

    2012-01-01

    Eesti regilaulukogude "Vana Kannel" 9. ja 10. osa ilmumise puhul vaadatakse tagasi sarja ilmumise ajalukku - Jakob Hurda esimestest kogudest ja nende koostamispõhimõtetest alates, visandatakse ka tulevikuplaane

  11. "Keisri hull" pürib taas filmiks

    Index Scriptorium Estoniae

    2008-01-01

    Eesti Filmi Sihtasutus otsustas anda arendustoetust mängufilmidele "Keisri hull" (režissöör Peeter Simm, arendaja Lege Artis Film), "Rahad ette" (režissöör Jaak Kilmi, arendaja Eetriüksus), "Öölendurid" (režissöör Peeter Urbla, arendaja Exitfilm)

  12. Rakvere teatrinoored triumfeerisid taas / Aarne Mäe, Marina Loshtshina

    Index Scriptorium Estoniae

    Mäe, Aarne, 1967-

    2007-01-01

    Saaremaal 16. korda peetud miniteatripäevadel sai Grand prix' Rakvere Gümnaasiumi Teatriansambli näitetrupp Pühapäeval kell 4. Žürii otsust kommenteerivad Velvo Väli, Urmas Lennuk ja Vallo Kirs. Publikupreemia, žürii huumoripreemia sai Rakvere Linnanoorte Näitetrupp Daniil Harmsi looga "Juhtumisi". Ka teistest "Jää jumalaga puberteet!" festivali võitjatest

  13. Reaalsuse taasärkamise aasta / Mart Laar

    Index Scriptorium Estoniae

    Laar, Mart, 1960-

    2008-01-01

    Ilmunud ka: Eesti Eest = Za Estoniju : Izdanije objedinenija "Sojuz Otetshestva i Res Publica" 18. dets. 2008, lk. 4. Isamaa ja Res Publica Liidu panusest Eesti majanduskriisist väljatulekuks. Venemaa agressioon Gruusia vastu võib tähendada ajaloo tagasitulekut ka Eestile

  14. Piccolo tõi Soomest taas grand prix'

    Index Scriptorium Estoniae

    2009-01-01

    Tänavuse Lappeenrantas toimunud rahvusvahelise suupillifestivali võistumängimisel osalesid suupilliklubi Piccolo orkester, kvartett ja noored solistid. Grand prix' ehk suure võidukarika pälvis Piccolo suupillikvartett koosseisus Ilmar Tõnisson, Andrus Haugas, Andres Kokk ja Elmar Trink. Noorte kategooria võitjaks tunnistati Martin Merevits, kolmandad kohad saavutasid Janek Sildvee bluusi- ja Eduard Einmann diatoonilise suupilli kategoorias

  15. Koju tagasi taas võidupärjaga / Veronika Nagel

    Index Scriptorium Estoniae

    Nagel, Veronika, 1975-

    2000-01-01

    17.-19. novembrini 2000.a. toimus Austrias 17. rahvusvaheline F. Schuberti nimeline koorikonkurss, millele oli välja valitud osa võtma seitse koori. TPÜ naiskoor dirigent Linda Kardna juhatamisel võitis naiskooride kategoorias II preemia ja põhisponsori eripreemia

  16. Estconil jagati taas Stalkereid / Jüri Kallas

    Index Scriptorium Estoniae

    Kallas, Jüri

    2006-01-01

    Ulmeauhind Stalker 2006 - tõlkeromaan: Lukjanenko, Sergei. Peegelduste labürint / tõlkinud Tanel Rõigas; antoloogia või tõlkekogu: Arvi Nikkarevi koostatud antoloogia "Aphra"; tõlkejutt: Vance, Jack. Puukoi; algupärane raamat: Hargla, Indrek. French ja Koulu; algupärane jutt: Belials, Veiko. Wereke, wereke, ega sa wesi...

  17. Eclectica, Eclectica - taas kord kunst ja muusika / Mart Niineste

    Index Scriptorium Estoniae

    Niineste, Mart, 1983-

    2009-01-01

    1.-6. septembrini Tartus toimuvast avangardkultuuri festivalist "Eclectica 2009". Y- galeriis Sandra Jõgeva kureeritud näitusel "New Age" on välja pandud Teet Raudsepa ja Liisi Eelmaa videodokumentalistikat ning Kristin Kalamehe ja inglise kunstniku Josephine Woodi videoinstallatsioone. Festivali raames toimuvatest kontsertidest. Esitletakse Vladimir Kozlovi dokumentaalfilmi "Rokkmonoloog" vene muusikust Juri Morozovist

  18. Botswana vahetas presidenti taas valimisteta ja rahumeelselt / Allan Espenberg

    Index Scriptorium Estoniae

    Espenberg, Allan

    2008-01-01

    Botswana demokraatia eripäraks on, et ametisolev president astub vabatahtlikult ja ennetähtaegselt ametist tagasi ning loovutab koha määratud järeltulijale. Aprilli alguses pani 69-aastane president Festus Mogae ameti maha ja uueks riigipeaks vannutati senine asepresident Ian Khama

  19. Uudised : Otsman taas Riias show'l. Rokkstaarist ministriks

    Index Scriptorium Estoniae

    2007-01-01

    Drag-kabareeartist Erkki Otsman esineb detsembris Riias "Sapnu Fabrikas" toimuval jõulu-show'l. Austraalia rokkansambli Midnight Oil endine laulja Peter Garrett nimetati valitsuse keskkonnaministriks

  20. 9. II avati taas von Krahli Akna galerii

    Index Scriptorium Estoniae

    2004-01-01

    Näitusel "Mute - a Register of Dreams" on vaadata Aine Phillipsi (Iirimaa), Avangardi, Diane Dwyer & Tillamook Cheddari (USA), Evelin Urmi, Kiwa, Lee Adamsi (Inglismaa), Marcello Mercado (Saksamaa), Miguel Rodriguez Sepulveda (Mehhiko) ja Renato Meneghetti (Itaalia) töid

  1. Fraternitas Tartuensise taasärkamine / Kalle Kask

    Index Scriptorium Estoniae

    Kask, Kalle, 1965-

    1992-01-01

    Grupil üliõpilastel eesotsas artikli autoriga tekkis plaan luua korporatsioon Viridia looduskaitse edendamiseks, korp. Ugala taastajad andsid nõu taastada pigem mõni endine korporatsioon, valik langes Fraternitas Tartuensisele, avaliku tegutsemise alguseks sai 29. aprill 1989

  2. Eesti film jõudis taas nimekale festivalile / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2008-01-01

    Karlovy Vary filmifestivalil esilinastub Rene Vilbre noortefilm "Mina olin siin", mille aluseks on Sass Henno romaan "Mina olin siin. Esimene arest", stsenaariumi kirjutas Ilmar Raag. Film võistleb võistlusprogrammis "East of the West". Esitlema sõidavad R. Vilbre, R. Sildos, R. Kaljujärv, T. Tuisk

  3. "Mozarti usku" tipp-pianist taas ERSO ees / Kersti Inno

    Index Scriptorium Estoniae

    Inno, Kersti, 1954-

    2009-01-01

    Kalle Randalu ja Eesti Riiliku Sümfooniaorkestri kontserdist 20. novembril Estonia kontserdisaalis, esitusel W. A. Mozarti "Klaverikontsert nr 22", "Kuus saksa tantsu" ning Beethoveni "Kaheksas sümfoonia"

  4. Facilitating Social Collaboration in Mobile Cloud-Based Learning: A Teamwork as A Service (TaaS) Approach

    Science.gov (United States)

    Sun, Geng; Shen, Jun

    2014-01-01

    Mobile learning is an emerging trend that brings many advantages to distributed learners, enabling them to achieve collaborative learning, in which the virtual teams are usually built to engage multiple learners working together towards the same pedagogical goals in online courses. However, the socio-technical mechanisms to enhance teamwork…

  5. Muusikamaailm : Soome Rahvusooperile peadirigent. "Turandotil" uus lõpp. Sada aastat sümfooniat. Festivalid taas ja taas / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2002-01-01

    Soome Rahvusooperi peadirigendiks saab Muhai Tang. Luciano Berio kirjutas "Turandotile" uue lõpu. Gustav Mahleri III sümfoonia maailmaesiettekandest möödub sada aastat. Euroopas toimuvatest muusikafestivalidest

  6. Taas tublisid Melbourne´i noori : Kylie Mikkor / Sirje Jõgi

    Index Scriptorium Estoniae

    Jõgi, Sirje

    2006-01-01

    fotol Melbourne´i Eesti Maja esimehe Arnold ja Asta Mikkori poja Kuno tütar Kylie Mikkor, kes lõpetas edukalt ülikooli ja sai Bachelor of Engineering (Aerospace Engineering) with honours 1st class ja Bachelor of Business (Business Administration) with distinction

  7. Mr Bean külvab taas segadust - sedapuhku Prantsusmaal puhates / Triin Tael

    Index Scriptorium Estoniae

    Tael, Triin

    2007-01-01

    Koomik Rowan Atkinsoni loodud ja kehastatud Mr Beani tegelaskujust seoses filmi "Mr Beani puhkus" esilinastumisega. Lisaks fakte "Mr Beani lood on jõudnud 250 riiki" ja "Menukoomik vajus musta masendusse"

  8. Eesti päästjad taas Indoneesias / Avo Kiik ; interv. Kalev Vilgats

    Index Scriptorium Estoniae

    Kiik, Avo

    2005-01-01

    Eesti päästemeeskonna logistikarühm EST-LOG sõitis Indoneesiasse missioonile, mille ülesandeks on kindlustada logistiline tugi katastroofijärgsete rahvusvaheliste taastustööde koordineerijatele ja korraldajatele ÜRO välilaagris

  9. Homme kell 15 on väliskunsti muuseumis taas "Laupäevaakadeemia" sarja loeng

    Index Scriptorium Estoniae

    2004-01-01

    Näituse "Balti rokokoo: Läänemeremaade XVIII sajandi fajanss" kuraator Kersti Kuldna räägib fajansist kui materjalist, kaubandus- ja kunstisidemetest Läänemere ääres ning rokokooajastu kommetest ja olustikust, mis peegelduvad XVIII sajandil valmistatud fajanssesemetes

  10. Eesti hobuse päritolu on taas päevakorral / Ingrid Randlaht

    Index Scriptorium Estoniae

    Randlaht, Ingrid

    2013-01-01

    Hobuse ilmumisest Soome aladele ja soome hobuse päritolust. Soome teadlaste Auli Bläuer'i ja Juha Kantanen'i eestvedamisel uuritakse FINN ARCH programmi raames varaste koduloomade ajalugu Soomes DNA-analüüside põhjal. Eesti hobuse päritolu uurimise hetkeseisust

  11. Pikad missioonid teevad taas USA sõdureid depressiivseks / Evelyn Kaldoja

    Index Scriptorium Estoniae

    Kaldoja, Evelyn, 1980-

    2008-01-01

    Ilmunud ka: Postimees : na russkom jazõke 28. juuli lk. 10. Ajakirja Time andmetel kasutas 2007. aasta sügisel antidepressante või unerohtu 12 protsenti Iraagis ja 17 protsenti Afganistanis teenivatest ameerika sõduritest. Depressiooni põhjustest. Vt. samas: Iraagi sõja Forrest Gump; Eesti missioonisõduri olukord on leebem. Intervjuu Eesti sõjaväepsühholoogi leitnant Merle Parmakuga

  12. TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development

    Czech Academy of Sciences Publication Activity Database

    Stepanova, A.N.; Robertson-Hoyt, J.; Yun, J.; Benavente, L.M.; Xie, D.Y.; Doležal, Karel; Schlereth, A.; Jürgens, G.; Alonso, J.M.

    2008-01-01

    Roč. 133, č. 1 (2008), s. 177-191 ISSN 0092-8674 Institutional research plan: CEZ:AV0Z50380511 Keywords : CELLBIO * SIGNALING * DEVBIO Subject RIV: CE - Biochemistry Impact factor: 31.253, year: 2008

  13. Sõnarevolutsiooni kangelased tulevad klubina taas kokku / Ragne Jõerand ; kommenteerinud Heinz Valk

    Index Scriptorium Estoniae

    Jõerand, Ragne, 1970-

    2014-01-01

    Rahvarinde muuseumi juhataja Helen Lausma-Saare üleskutsel luuakse muuseumi juurde Rahvarinde klubi, mille eesmärgiks on koguda materjale, anda edasi infot ja kirjutada artikleid Rahvarinde tegevusest

  14. Al-Quran ontology based on knowledge themes | Ta'a | Journal of ...

    African Journals Online (AJOL)

    Islamic knowledge is gathered through the understanding the Al-Quran. It requires ontology which can capture the knowledge and present it in a machine readable structured. However, current ontology approaches is irrelevant and inaccuracy in producing true concepts of Al-Quran knowledge, because it used traditional ...

  15. Kuidas alliansid taas edukaks muuta / Mitchell P Koza, Arie Y Lewin

    Index Scriptorium Estoniae

    Koza, Mitchell P

    2002-01-01

    Alliansside strateegiast lähtuvalt jagunevad need kasutus- (exploitation) ja uurimisallianssideks (exploration alliances). Autorid kirjeldavad 3 liiki strateegilisi alliansse - ärilised, õppimis- ja hübriidalliansid ning nende põhimõttelisi erinevusi

  16. Pärnu aktinäitus kompab taas sündsuse piire / Kati Murutar

    Index Scriptorium Estoniae

    Murutar, Kati, 1967-

    2001-01-01

    Uue Kunsti Muuseumis avatud rahvusvaheline näitus "Mees ja naine" käsitleb sel aastal ka lastevahelise armastuse teemat. Eksponeeritud eesti, leedu, prantsuse, ameerika, tšehhi kunstnike tööd (Witkin, Saudek, Jean Cocteau; Aivar Kurvits jt.)

  17. Eesti tolkiniaana nimepaabel sai taas täiendust / Aleks Lange

    Index Scriptorium Estoniae

    Lange, Aleks

    2007-01-01

    Arvustus: Tolkien, John Ronald Reuel. Lõpetamata lood : Numenor ja Keskmaa / koostanud ja redigeerinud Christopher Tolkien ; tõlkinud Ove Hillep, Kristina Uluots, Sach [p.o. Sash] Uusjärv. [Tallinn] : Tiritamm, 2006

  18. Põhja-Korea viibutas taas lõuna poole sõjarusikat / Hendrik Vosman

    Index Scriptorium Estoniae

    Vosman, Hendrik

    2010-01-01

    Põhja-Korea rannikul toimusid suurtükiplahvatused, Lõuna-Korea teatel oli tõenäoliselt tegemist põhjakorealaste õppusega. Hiina hoiatas, et riigid hoiduksid ilma tema loata sõjalisest tegevusest Hiina majandusvetes. Lõuna-Korea ja USA alustavad mereväemanöövreid

  19. Pakistan tõestas taas nõrkust terroristide ohjeldamisel / Oliver Tiks

    Index Scriptorium Estoniae

    Tiks, Oliver

    2009-01-01

    Pakistanis toimus sisside verine terrorirünnak politseiakadeemia vastu, mis analüütikute hinnagul oli sõnumiks USA presidendile Barack Obamale, kes on seadnud Pakistani kesksele kohale võitluseks AL-Qaeda terroristidega. Kaart: Pakistani rünnak

  20. Ühendriigid otsivad NATOs taas liitlast / Jamie Patrick Shea ; interv. Kadri Liik

    Index Scriptorium Estoniae

    Shea, Jamie Patrick

    2004-01-01

    NATO asepeasekretäri asetäitja räägib alliansi kaitseplaneerimisest, rahukaitsest, arengust, tegevusest Afganistanis, rollist Iraagis, võitlusest terrorismiga, koostööst USA-ga. Lisa: Jamie Patrick Shea

  1. Piiriäärne lava valmistub taas esietenduseks / Margus Haav

    Index Scriptorium Estoniae

    Haav, Margus, 1969-

    2008-01-01

    Lõuna-Eestis Lilli külas algaval Nava lava festivalil tuuakse publiku ette Nava talu peremehe Jaak Kõdari näidend "Jukra", lavastaja Silvia Soro. Üht kandvat rolli mängib näitleja Lembit Eelmäe

  2. Samba maksed peatati, siis jälle maksti ja lõpetati taas / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Kuigi Eesti kaitseministeerium pidas 2009. aasta sügisel Tšehhi klaasifirmale Sans Souci tehtavatest maksetest kinni 5,3 miljonit krooni, vähendati pärast läbirääkimisi klaasifirmaga aasta lõpuks summat 3,7 miljoni kroonini

  3. Tartus näeb taas armastust / Kaisa Karu ja Egle Loo

    Index Scriptorium Estoniae

    Karu, Kaisa

    2010-01-01

    Tartus toimuva filmifestivali tARTuFF filmidest tutvustavalt: Aleksi Salmenperä "Paha pere" (Soome 2010), Lone Scherfigi "Haridus" (Inglise 2009), Deepa Mehta "Maapealne taevas" (Kanada 2008), Yojiro Takita "Lahkumised" (Jaapan 2008), Max Mayeri "Adam" (USA 2009)

  4. Ruumipilt 08 : Eesti Sisearhitektide Liidu preemiad taas jagatud ning kataloog laual! / Mihkel Karu

    Index Scriptorium Estoniae

    Karu, Mihkel, 1983-

    2009-01-01

    Eesti Sisearhitektide Liidu aastapreemia 2008 konkursist, mille põhjal koostati aastaraamat "Ruumipilt 08". Ühiskondliku interjööri preemia - Jan Graps, Ken-Kristjan Ruut (Starmani teenindusbüroo), söögikoha preemia - Toomas Korb (restoran Chedi), ajaloolise interjööri preemia - Pille Lausmäe, Kerli Lepp (restoran La Bottega), esemepreemia - Janno Roos, Andres Labi (riidenagi "Uluk"), näitusepreemia - Inga Raukas, Oliver Soomets, Eva-Maria Gramakovski, Tuuli Aule ("Iseolemise tahe. 90 aastat Eesti Vabariiki")

  5. Estonia ballett üle seitsme aasta taas Pärnus / Silja Joon

    Index Scriptorium Estoniae

    Joon, Silja, 1966-

    2010-01-01

    Rahvusooperi Estonia balleti kunstiline juht Toomas Edur Estonia balletitrupist ja 20. veebruaril toimuvast kolmest lühiballetist koosnevast balletiõhtust Pärnu kontserdimajas. Esitatakse Bohuslav Martinu "Enne öö saabumist" (koreograaf Nils Christe), Arnold Schönbergi "Pelléas ja Mélisande" (koreograaf Tiit Härm), Robert Schumanni "Teine sümfoonia" (koreograaf Uwe Scholz)

  6. Toetust kaotav Sarkozy võib varsti taas abielluda / Hendrik Vosman

    Index Scriptorium Estoniae

    Vosman, Hendrik

    2008-01-01

    Ilmunud ka: Postimees : na russkom jazõke 8. jaan. 2008, lk. 7. Prantsusmaa presidendi Nicolas Sarkozy kavatsusest abielluda itaallannast laulja ja endise modelli Carla Bruniga. Rahva vähenevast usaldusest presidendi suhtes. Lisa: Nicolas Sarkozy naised

  7. Pop nädal : Pink muutis taas imagot. Billboard 200 TOP 20 / Karolina Põder

    Index Scriptorium Estoniae

    Põder, Karolina

    2002-01-01

    Ameerika popstaarist Pink (Alecia Moorist). Crazy Town'i uuest albumist "Darkhorse". Hard Rock Club' üritusest Biker's Pubis Tallinnas 5. okt.. Impaled Nazarene HR STAR üritusel Nõmme kultuurimajas 25. okt.. Saksa popkuulsuse Alphaville saabumisest Riiga Krasdtmala festivalile 4. oktoobril

  8. 1. mail toimub taas Valge Roosi ball / Ingrid Rüütel ; intervjueerinud Gerli Ramler

    Index Scriptorium Estoniae

    Rüütel, Ingrid, 1935-

    2006-01-01

    Kaitseliidu eestvedamisel 1926. aastal alguse saanud Valge Roosi balli korraldajate eesmärgiks on heategevuse kaudu tuua üksteisele lähemale militaarstruktuure ja tsiviilühiskonda, väärtustada perekonda. Valge Roosi Fond

  9. Veeprojektid lähevad taas töösse / Karin Kroon

    Index Scriptorium Estoniae

    Kroon, Karin

    2007-01-01

    Ilmunud ka: Oma Saar, 17. okt. 2007, lk. 4; Meie Maa, 17. okt. 2007, lk. 4; Valgamaalane, 18. okt. 2007, lk. 2; Nädaline, 18. okt. 2007, lk. 4; Vooremaa, 18. okt. 2007, lk. 2; Võrumaa Teataja, 18. okt. 2007, lk. 2; Severnoje Poberezhje, 18. okt. 2007, lk. 2; Hiiu Leht, 19. okt. 2007, lk. 2; Põhjarannik, 19. okt. 2007, lk. 2. Keskkonnaministeeriumi veeosakonna projektide büroo juhataja esitab ministeeriumi lahendused EL Ühtekuuluvusfondi abiga veemajanduse korrastamisprojektide lõpuleviimiseks. Ajal. Oma Saar ka tabelid: 1. 2000-2006 projektide lisaraha jagumine; Hangete kallinemise katmine 2008. aastal

  10. Lõhestunud Küpros otsib taas ühte keelt / Loria Markides

    Index Scriptorium Estoniae

    Markides, Loria

    2006-01-01

    Küprose president Tassos Papadopoulos ja ÜRO peasekretär Kofi Annan kinnitasid veebruari lõpus Pariisis plaanid, kuidas ette valmistada tulemusrikkad läbirääkimised lõhestunud saareriigi rahuks

  11. Põhja-Korea lubas taas jätta tuumaplaanid / Jürgen Tamme

    Index Scriptorium Estoniae

    Tamme, Jürgen

    2007-01-01

    Pekingis toimunud kuuepoolsete desarmeerimiskõneluste tulemusena on Põhja-Korea nõus andma ülevaate riigi tuumarajatistest ning alustama nende likvideerimist. 14. juulil suleti Yongbyoni tuumakeskuse reaktor. Lisa: Tuumavaidlus

  12. Google tegemas taas võimsat kvartalit / Fredy-Edwin Esse

    Index Scriptorium Estoniae

    Esse, Fredy-Edwin

    2011-01-01

    Nii Google'i kasum kui ka käive on prognooside kohaselt järsult tõusnud, prognoositakse 6,3 mld. dollari suuruse käibe juures kasumiks 8,14 dollarit aktsia kohta. Autor panustaks oma raha Google'isse vaid lühiajaliselt

  13. Näidendivõistlusel triumfeeris taas kord Martin Algus / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2009-01-01

    Eesti Teatri Agentuuri näidendivõistlusel sai esikoha Martin Algus näidendiga "Postmodernsed leibkonnad", teise koha Siim Nurliku kirjatükk "Kas ma olen nüüd elus" ja kolmanda koha Loone Otsa töö "Libuhunt"

  14. Viljandlased näevad taas kuulsa baltisaksa kunstniku maale / Mari Vallikivi

    Index Scriptorium Estoniae

    Vallikivi, Mari

    2009-01-01

    Carl Alexander von Winkleri tööde näitusest Viljandi maagümnaasiumis ja Kondase keskuses, millega tähistatakse 100 aasta möödumist esimesest C. A. Winkleri näitusest ja ühtlasi kunstielu algusest Viljandis

  15. James Wertsi ja SaxEsti ühiskontsert. "Valge gospel" asub taas tuurile

    Index Scriptorium Estoniae

    2007-01-01

    Ameerika laulja ja kitarristi James Wertsi ning saksofonikvarteti SaxEst kontserdituurist Eestis algusega 1. dets. Haljala rahvamajast. Kontserdituurist "Valge gospel" alates 11. dets. kuues Eestimaa kirikus (viimane kontsert 20. dets. Tallinna Linnahallis)

  16. Nafta hinna tõus kukutab taas lennufirmade aktsiaid / Annika Matson

    Index Scriptorium Estoniae

    Matson, Annika, 1976-

    2004-01-01

    USA kaubabörsil rekordilisele tasemele tõusnud nafta hind viis lennukompaniide aktsiad langusse. Prognooside kohaselt võib jätkuv nafta hinnatõus hakata pidurdama maailma majanduskasvu. Diagrammid: Suurima löögi on nafta hinna tõusust saanud USA lennufirmade aktsiad

  17. Uus Ukraina : ELi kandidaat või taas Venemaa lähivälismaa? / Aili Ribulis

    Index Scriptorium Estoniae

    Ribulis, Aili

    2005-01-01

    Välispoliitika ekspert Aili Ribulis leiab, et suhtumises postrevolutsioonilisse Ukrainasse võiks Euroopa Liit võtta eeskuju NATO-st ja pakkuda konkreetseid tulevikuperspektiive. Euroopa Liidu naabruspoliitika

  18. Cani kunagine laulja Tallinnas. Led Zeppelin koguneb taas? Ian Brown müüb oma maja liiga kallilt

    Index Scriptorium Estoniae

    2002-01-01

    Damo Suzuki ja tema uue ansambli Damo Suzuki Network esinemisest Von Krahli Teatri baaris 21.oktoobril. Led Zeppelini plaanist korraldada järgmisel aastal kontserttuur mööda USAd. Ansambli Stone Roses kunagise solisti Ian Browni suvemaja müügist Põhja-Walesis Llithfaenis

  19. Muusikamaailm : Pierre Boulezi juubel. "Musik der Zeit" Kölnis. Hollandlastel taas uusooper. Tenor Carlo Cossutta surnud / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2000-01-01

    P. Boulezi 75. sünnipäevale pühendatud üritustest Londoni Barbican Centeris. 28.-30. jaan. Kölnis toimuvast uue muusika festivalist. 22. jaan. esietendus Amsterdamis G. Jansseni uusooper "Hier". C. Cossutta lauljategevusest

  20. Muusikamaailm : Baltimaad taas Saksamaal. Nädalavahetus promenaadikontsertidel. Kurt Blaukopf surnud. Emmy Destinni keskus Ţehhimaale / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    1999-01-01

    Münsterlandi muusikafestivalist Saksamaal (14.-29.08), mis on pühendatud Baltimaadele. Londoni Albert Hallis toimuvast festivalist. K. Blaukopfi elust ja tegevusest. E. Destinni (1878-1930) mälestuseks rajatakse Tšehhimaale rahvusvaheline ooperikeskus. Laulja tegevusest

  1. Muusikamaailm : Weimari Riigikapell 400. Korngoldi mälestuspäevad Brnos. Ooperietendus taas Indias. Uusooperid laval Euroopas / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2002-01-01

    Weimari Riigikapell tähistab oma 400. aastapäeva. Brnos tähistatakse mitmete muusikasündmustega helilooja Erich Wolfgang Korngoldi mälestuspäevasid. New Delhi Siri Forti auditooriumis kõlab üle hulga aja ooper. Euroopa eri linnades toimuvatest ooperite uusalvastustest

  2. Iraagi sõja valede kiuste rühib Tony Blair taas valimisvõidule / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2005-01-01

    Sõda Iraagis on tõusnud Suurbritannia parlamendivalimiste kampaanias põhiteemaks. Viimase küsitluse andmeid parteide toetuse kohta. Lisad: Salaettekanded tulid avalikuks; Valimisprogrammil pole tähtsust

  3. ÜRO rahuvalvajatel lasub taas laste ahistamise süüdistus / Oliver Tiks, Hendrik Vosman

    Index Scriptorium Estoniae

    Tiks, Oliver

    2008-01-01

    Ilmunud ka: Postimees : na russkom jazõke 28. mai 2008, lk. 5. Briti heategevusorganisatsiooni Save the Children raport avalikustas, et maailma kriisipiirkondades on lapsed sattunud neid turvama saadetud ÜRO rahuvalvajate ja abitöötajate seksuaalse kuritarvitamise ohvriks. Lisa: Seksiskandaalid

  4. Kui Eesti 1991. aastal taas iseseisvaks sai = Als Estland 1991 seine Unabhängigkeit Wiedererlangte / Henning von Wistinghausen

    Index Scriptorium Estoniae

    Wistinghausen, Henning von

    2007-01-01

    Eesti taasiseseisvumise perioodil oli Henning von Wistinghausen Saksamaa Liitvabariigi peakonsul Leningradis. Tema mälestused Tallinnas veedetud 19. augustist 1991, kohtumisest Rein Müllersoniga, järgnenud pöördelistest sündmustest Venemaal ja Balti riikide taasiseseisvumisest. Wistinghauseni määramisest Saksamaa saadikuks Eestis

  5. El Nino külvab taas surma, üleujutusi ja põudu / Arko Olesk

    Index Scriptorium Estoniae

    Olesk, Arko, 1981-

    2002-01-01

    El Nino on loodusnähtus, mille puhul Vaikse ookeani idaosa vesi ja õhk soojenevad, see muudab tuulte ja vihmade tavapärast liikumist ja põhjustab torme ja põudu. Lisaks tabel: Ilma hävitustöö maailmas

  6. "Matkalla jo jutellaan, mitähän mielenkiintoista taas saa kuulla" : Äänikirjalukupiiri Vaasan kaupunginkirjastossa

    OpenAIRE

    Airaksinen, Virpi

    2017-01-01

    Tutkimuksen tavoitteena oli selvittää kvalitatiivisten menetelmien avulla lukupiiriläisten kokemuksellisuutta. Opinnäytetyössäni painotettiin äänikirjojen lukemisen kokemuksellisuutta. Vertailututkimuksessa käytettiin perinteisempää, painettuja teoksia lukevaa kirjallisuuspiiriä. Tutkimusongelmaan pyrittiin hakemaan vastauksia seuraavien kysymysten kautta: miksi halutaan kuulua lukupiirin, mitä luetaan, millaisista aiheista keskustellaan, kuinka lukupiirissä lukeminen eroaa yksinlukemisesta, ...

  7. Pärast Eesti Raudtee ostmist kaalub riik sellest osa taas müüa / Hindrek Riikoja

    Index Scriptorium Estoniae

    Riikoja, Hindrek

    2006-01-01

    Läbirääkimistest BRS-iga raudteefirma 66% aktsiate tagasiostmiseks. Peaminister Andrus Ansipi hinnangul oleks mõistlik pärast tagasiostu teedevõrk vedudest eraldada ning vedude osa müüki panna

  8. Üks õnneliku lõpuga eksirännak : 1939. aasta eesti muusika salvestised taas Eestis / Ilvi Rauna

    Index Scriptorium Estoniae

    Rauna, Ilvi

    2008-01-01

    Taani Kuningriigi kingitusest Eestile - 151 heliplaatide metallist originaalmatriisi Riigi Ringhäälingus 1939. aastal salvestatud Eesti muusikaga. Eelloost, helisalvestamise ettevalmistamisest 1937. aastast, finantseerimisest, salvesatud teostest, matritside saatusest

  9. Airi Liimets: "Teistmoodi mõeldes võiks taas otsast alata" / Airi Liimets ; intervjueerinud Ia Remmel

    Index Scriptorium Estoniae

    Liimets, Airi, 1959-

    2009-01-01

    Eesti Muusika- ja Teatriakadeemia koolimuusika instituudi ning filosoofilise ja pedagoogilise antropoloogia keskuse juhataja, kasvatusfilosoofia ja kasvatusteaduse professori Airi Liimetsaga tema koostatud ja toimetatud, TLÜ kirjastuse poolt välja antud raamatust "Muusikalise kontegelikkuse ühendused identiteedi ja diferentsiga"

  10. Muusikamaailm : Philadelphiasse tuleb Eschenbach. Menotti taas Washingtonis. Monteverdi festival Pariisis. Esietendused New Yorgis ja Milanos / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2001-01-01

    C. Eschenbach määrati PO järgmiseks peadirigendiks aastast 2003, dirigendi senisest tegevusest. G.C.Menotti lavastab Washingtoni Ooperis oma ooperit "Konsul". Pariisi Champs Elysees' teatris toimuvast Monteverdi ooperite festivalist. Esietendustest ئ Busoni "Doktor Faust" New Yorgi Metropolitan Operas ja Bellini "La sonnambula" Milano La Scalas

  11. Taliban lükkas pantvangide surmamise tähtaega taas edasi / Jürgen Tamme

    Index Scriptorium Estoniae

    Tamme, Jürgen

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke, 24. juuli 2007, lk. 5. Talibani võitlejad lükkasid Ghazni provintsist 19. juulil pantvangi võetud 23 lõunakorealase saatuse üle otsustamise edasi 24. juulini, nõudes pantvangide vabastamise eest 23 mässulise vabastamist ning 200 Lõuna-Korea sõjaväeinseneri ja meediku lahkumist riigist

  12. Muusikamaailm : Euroopa kultuurilinnad 2002. Monserrat Caballe taas laval. Murray Perahia Beethooveniga. Kurt Sanderling lõpetab tegevuse / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2002-01-01

    Euroopa kultuurilinnades 2002 ئ Salamancas ja Brügges toimuvatest muusikasündmustest. Monserrat Caballe tegi comebacki ooperilavale. PianistMurray Perahia kavandab kõigi Beethooveni klaverikontsertide ettekande. 89aastane Kurt Sanderling otsustas lõpetada tegevdirigendi karjääri

  13. Kolm tundi päevas jõusaalis ja dieet : nii voolis Harrison Ford end taas Indiana Jonesiks / Triin Tael

    Index Scriptorium Estoniae

    Tael, Triin

    2008-01-01

    Steven Spielbergi neljas Indiana Jones'i film Harrison Fordiga nimiosas "Indiana Jones ja kristallpealuu kuningriik" ("Indiana Jones and the Kingdom of the Crystal Skull") : Ameerika Ühendriigid 2008. Indiana Jonesi tähestik

  14. Muusikamaailm : Schleswig-Holsteini festival 2001. Peter Sellars lavastab Bachi kantaate. Taas uus Soome ooper. Henze festival Londonis. Uus film Maria Callasest / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2001-01-01

    Schleswig-Holsteini suvisest muusikafestivalist 7.VII-2.IX 2001. a. New Yorgis tuli esiettekandele P. Sellarsi lavastatud etendus Bachi kantaatidest. Uue muusika festivalil "Musica Nova" Helsingis tuli esiettekandele T. Länsiö ooper "Sulka". H. W. Henze 75. juubelit tähistatakse Londonis festivaliga "Voices". F.Zeffirelli lavastab filmi M. Callasest

  15. Uudised : Georg Ots 80. "Pärt in Profile" Londonis. Kaljuste taas esile tõstetud. Paavo Järvi eesti muusikaga La Scalas / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2000-01-01

    G. Otsa 80. sünniaastapäeva tähistamisest G. Otsa nim. Tallinna Muusikakoolis ئ avati G. Otsa muuseum. 28.-31. märtsini Londonis toimuvast muusikafestivalist "Pärt in Profile", kus tutvustatakse A. Pärdi jt. eesti heliloojate loomingut. T. Kaljuste on Edison Classical Music Awards 2000 nominentide seas koorimuusika kategoorias kahel korral. P. Järvi juhatas 28. veebr. Milano La Scala orkestrit, kavas A. Pärdi "Cantus in memoriam Benjamin Britten", dirigendi tegemistest märtsis

  16. Uudised : Kuressaare ooperipäevad on taas tulekul. Eri Klas lõpetas Hollandis hooaja. Elton John ja kondiga karbonaad. Tantsuetendus Oistrahhi festivalil

    Index Scriptorium Estoniae

    2001-01-01

    26.-29. juulini toimuvatest Kuressaare ooperipäevadest. E. Klas lõpetas hooaja Hollandi Raadio SO ees kontserdiga 6. juulil Amsterdamis. E. John annab heategevusliku kontserdi Itaalias, millega tähistatakse ELi poolt pandud veisekarbonaadi keelustamise lõppu. Pärnu muusikafestivalil esitatakse 14. juulil tantsuetendus E.-S. Tüüri muusikale

  17. Muusikamaailm. Magnus Lindbergi festivali jätk. Jonas Forsell taas ooperijuhiks. Marcello Panni uus ooper. György Kurtagile Sonningi preemia. Peter Gradenwitz lahkunud / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2002-01-01

    Soome helilooja Magnus Lindbergi mitmeid teoseid esitatakse Inglismaal. Rootsi heliloojast Jonas Forsellist sai jaanuaris Kopenhaageni trupi Den Anden Opera kunstiline juht. Firenzes tuli esiettekandele Marcello Panni uus ooper "The Banquet ئ Talking about Love". Helilooja György Kurtag pälvis Taani 2003.a. Leonie Sonningi muusikapreemia. 91aastasena suri muusikateadlane Peter Gradenwitz

  18. Muusikamaailm : Rostropovitsh Berliini müüri juures. Philadelphia Curtis Institute ئ 75. Lahti Linnaorkester Jaapanis ja USAs. Domingo taas Washingtonis / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    1999-01-01

    Berliini müüri langemise 10. aastapäevale pühendatud kontserdist 9. nov. Berliinis. Ameerika muusikakõrgkoolist Philadelphia Curtis Institute. Lahti Linnaorkestri kontserdireisist Jaapanisse ja USAsse. P. Domingo on sügishooajal esinenud erinevates Ameerika ooperiteatrites

  19. Jakob von Uexküll : tuleb hakata taas koos oma planeediga elama / Jakob von Uexküll ; interv. Andris Feldmanis

    Index Scriptorium Estoniae

    Uexküll, Jakob von

    2007-01-01

    Jakob von Uexküll vastab küsimustele, mis puudutavad postkapitalismi, kapitalismi vajakajäämisi, praegust kapitalismi, postkapitalismi n.-ö. filosoofilist süsteemi, samuti kohtumist president Toomas Hendrik Ilvesega. J. von Uexküll esitles Eesti presidendile Maailma Tuleviku Nõukogu (World Future Council) projekti

  20. Muusika. Täna taas Brahms ja Stravinski. Jaanuarilõpp Tüüri muusikaga. Paavo Järvi Jaapanis. "Baltic Voices I". Muusikaajakiri tuleb

    Index Scriptorium Estoniae

    2002-01-01

    Estonia kontserdisaalis on kavas teine kontsert ERSO sarjast "Brahms ja Stravinski". 25.I Cardiffis ja 26.I Swanseas jõuab maailmaesiettekandele Tüüri Kontsert marimbale ja orkestrile "Ardor". Jaanuarikuu veedab Paavo Järvi külalisdirigendina Jaapanis. 20.I alustab Eesti Filharmoonia Kammerkoor Tallinnas Mustpeade Majas uut kontserdisarja Läänemere maade kooriloomingust "Baltic Voices I". Eesti Muusikateaduse Seltsi koosolekul tutvustati uue muusikaajakirja ideed. Rahvusraamatukogus esineb peruu kvartett Cuarteto NuevAmerica

  1. Texas, Rosie ja Helga KitKat Clubist : endised varieteestaarid Ülle Toming, Reet Paavel ja Laine Mägi astuvad taas lavale / Ülle Toming, Reet Paavel, Laine Mägi ; interv. Verni Leivak

    Index Scriptorium Estoniae

    Toming, Ülle, 1955-

    2003-01-01

    Vanalinnastuudio muusikal "Cabaret". Intervjuu omaaegsete varieteetähtedega: Laine Mägi, Ülle Toming ja Reet Paavel moodustavad muusikalis "Cabaret" osa koorist, kel tuleb üle hulga aja laulda, tantsida ja näidelda väga erinevates rollides. Lisaks nende tutvustus "Kolm graatsiat"

  2. Muusika : Virtuoosid taas tulemas. Tüüri muusika balletiks. Kaljuste Norras ja Belgias. Neeme Järvi viib Peterburi "Joonase lähetamise". Peep Lassmann jätkab rektorina. Eesti heliloojate kogumikplaat

    Index Scriptorium Estoniae

    2002-01-01

    Vladimir Spivakov ja Moskva Virtuoosid esinevad Tallinnas Estonia kontserdisaalis 15. IV. Tüüri muusikat kasutatakse Heinz Spoerli balletis "...der Sonne leuchten ist ihr Kleid". Tõnu Kaljuste tegemistest Norras ja Belgias. Neeme Järvi viib Peterburi "Joonase lähetamise". Peep Lassmann jätkab rektorina kuni aastani 2007.Eesti Raadio esitles eesti heliloomingu kogumik plaate. "Klassikaraadio" sai seitsmeaastaseks

  3. Paikse Euroopa Liidu kodaniku perekonna taasühinemise õigus : [magistritöö] / Veronika Kaska ; Tartu Ülikool, õigusteaduskond ; juhendajad: Aare Reenumägi, Carri Ginter

    Index Scriptorium Estoniae

    Kaska, Veronika, 1981-

    2013-01-01

    Immigratsioonipoliitika eesmärkidest ja õiguslikust raamistikust, kodakondsuse eesmärkidest ja ja selle õiguslikust regulatsioonist, Euroopa Kohtu praktikast ja selle mõjust Eesti välismaalaste õigusele

  4. Muusika : Jätkub Estonia solistide plaadisari. EOÜ käis orelimatkal. Aastapremia Pärnu Kontserdibüroole. TAM avab kevade Rakveres. Vanemuises taas klassikaline ballett / Eha Ristimets

    Index Scriptorium Estoniae

    Ristimets, Eha

    2002-01-01

    Estonia talveaias esitleti omaaegse soprani Paula Padriku CD-d "Unustamatu Paula Padrik". Eesti Orelisõprade Ühing korraldas väljasõidu Viljandi- ja Tartumaade orelite juurde. Kultuuri aastapreemia - 15 000 krooni sai Pärnu Kontserdibüroo. Tehnikaülikooli Akadeemilise Meeskoori kevadkontsertidega alustatakse tänavu Rakveres. 14.IV esietenduvad Vanemuises kaks ühevaatuselist balletti "Chopiniana" ja "Quiteria pulm"

  5. Arendaja näitab jõudu. 85 hektarit maad ajas taas tülli Jõelähtme vallajuhid / Koit Brinkmann ; kommenteerinud Art Kuum, Andrus Umboja

    Index Scriptorium Estoniae

    Brinkmann, Koit

    2011-01-01

    10 aastat tagasi omandas Jõelähtme Arendusgrupp soodsalt Jõelähtme vallas mereäärse kinnistu, kuid pidi suurema osa ostusummast tasuma alles 2011. aastal. Nüüd sõlmis firma vallaga kokkuleppe, mille suhtes on Reformierakonda kuuluv vallavanem ning IRL-i liikmest vallavolikogu esimees eri meelt. Vt. ka Koit Brinkmanni art. Art Kuum: Laheranna lepingu tingimusi pole muudetud. Äripäev, 26. mai, lk. 8 ja Sulev Valneri art. Äripäev rikkus head ajakirjandustava. Äripäev, 12. aug., lk. 10

  6. Outcome of endovascular repair for intact and ruptured thoracic aortic aneurysms.

    Science.gov (United States)

    Hellgren, Tina; Wanhainen, Anders; Steuer, Johnny; Mani, Kevin

    2017-07-01

    The objective of this study was to assess long-term outcome after thoracic endovascular aortic repair (TEVAR) for thoracic aortic aneurysm (TAA). All patients who underwent TEVAR for TAA at Uppsala University Hospital from December 1999 to December 2014 were included. Characteristics of the patients and outcome data were collected from medical records, national population registry, and cause of death registry. Perioperative survival was analyzed with the χ 2 test, and 5-year survival was estimated with Kaplan-Meier analysis. Predictors of long-term survival were assessed with Cox regression. There were 77 patients included in the study, 49 with intact TAAs (iTAAs) and 28 with ruptured TAAs (rTAAs). Mean follow-up was 83.7 months for iTAA patients and 82.0 months for rTAA patients (P = .853). Mean age was 71.5 years for iTAA patients and 74.8 years for rTAA patients (P = .04). Survival after iTAA repair was 95.9% at 30 days, 91.8% at 90 days, and 62.5% at 5 years. After rTAA repair, survival was 71.4% at 30 days and decreased to 57.1% at 90 days (P < .01), with most deaths after 30 days being related to the aortic event. The 3-year survival rate after rTAA repair was 27.8%, and only one rTAA patient with 5 years of follow-up remained alive. Six aorta-related deaths occurred after 90 days (three iTAA patients, three rTAA patients); five were due to rupture of nontreated aortic segments. The 5-year reintervention rate was 13.2% for iTAA patients and 17.9% for rTAA patients (P = .682). All reinterventions occurred within 14 months of TEVAR. The age-adjusted hazard ratio for long-term mortality was 4.4 after rTAA repair compared with iTAA repair. TEVAR for iTAA was associated with low perioperative mortality and acceptable 5-year survival at 62.5%. Results were more pessimistic after rTAA repair, however, for which two-thirds of the patients were deceased at 3-year follow-up. Improved selection of patients is necessary to identify patients who are

  7. Exon: CBRC-OANA-01-1230 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available tttttcgtttcttttccctccccctccttcttttccctcttcatcctcttcctcTTTCTTTCATTTCCCTCCTTCCCTCCCctccttcttttcttttccctcttctcctcctctcc...aaattcttttcttttccctccttccctcctcctccttttctttccctcctctccttcccctccttctTCCCTTTTCCAATCGGCCAATCGATCAGtggtatttattgagcaacttactgtgtgcggagcactgtactaa ... ...CBRC-OANA-01-1230 ATGccttccttcttccttcttttccccttcccctccccttcttcttttccctcctcccctccttcttcccgtcttttccgcctcccctcc...ttcttttctttgccctcctcccctccttcttcctttcttttcccttttcccctccccttctttttttcttttccctcctccccccttcttcctttctttttcccctcc...cctcctctccccaccttttcttttccctcctctccccccttttcttttcccccctcccctcctccttctccttttgcctcctcccctcccctccttcttttcttttcc

  8. Curative role of lactulose, L-carnitine, alpha-lipoic acid and ...

    African Journals Online (AJOL)

    Purpose: To determine whether a combination L-carnitine and α-lipoic acid (ALA) can alleviate the toxic effects of thioacetamide (TAA) via their potent antioxidant and free radical-scavenging activities. Methods: Rats were injected with TAA for 3 days to induce acute hepatic failure. TAA induced rats were treated with each of ...

  9. Dislocated Workers. An Early Look at the NAFTA Transitional Adjustment Assistance Program. Report to the Chairman, Employment, Housing and Aviation Subcommittee, Committee on Government Operations, House of Representatives.

    Science.gov (United States)

    General Accounting Office, Washington, DC. Health, Education, and Human Services Div.

    The General Accounting Office reviewed the Department of Labor's (DOL) implementation of the North American Free Trade Agreement Transitional Adjustment Assistance (NAFTA-TAA) program to see whether the DOL had corrected the shortcomings of the original Trade Adjustment Assistance (TAA) program. (An earlier study had shown that the TAA program had…

  10. PPARα ligands activate antioxidant enzymes and suppress hepatic fibrosis in rats

    International Nuclear Information System (INIS)

    Toyama, Tetsuya; Nakamura, Hideki; Harano, Yuichi; Yamauchi, Norihito; Morita, Atsuhiro; Kirishima, Toshihiko; Minami, Masahito; Itoh, Yoshito; Okanoue, Takeshi

    2004-01-01

    Oxidative stress is a major pathogenetic factor in hepatic fibrosis. Peroxisome proliferator-activated receptor α (PPARα) is a nuclear receptor which is known to affect oxidative stress and PPARα ligands may have rescue effects on hepatic fibrosis. We tested this hypothesis using rat thioacetamide (TAA) models of liver cirrhosis. Rats were given intraperitoneal injection of TAA and treated with a diet containing one of the two PPARα ligands, Wy-14,643 (WY) or fenofibrate. WY treatment dramatically reduced hepatic fibrosis and also prevented the inhibition catalase of mRNA expression caused by TAA. Correspondingly, catalase activity increased in the TAA + WY group but decreased in the control TAA group. The antifibrotic action of fenofibrate in the TAA model was comparable with that of WY. PPARα ligands have an antifibrotic action in the rat TAA model of liver cirrhosis, probably due to an antioxidant effect of enhanced catalase expression and activity in the liver

  11. Coaxially Aligned Polyaniline Nanofibers Doped with 3-Thiopheneacetic Acid through Interfacial Polymerization

    Directory of Open Access Journals (Sweden)

    Lixia Zhang

    2011-01-01

    Full Text Available Coaxially aligned polyaniline (PANI nanofibers doped with 3-thiopheneacetic acid (TAA were chemically synthesized by the interfacial polymerization of aniline in the presence of TAA, using iron (III chloride hexahydrate (FeCl3·6H2O as the oxidant. The morphology, crystallinity, room temperature conductivity, and coaxial alignment of the PANI-TAA nanofibers were highly dependent on the organic solvent used for the interfacial polymerization, the oxidant, and also the molar ratio of the aniline to TAA. Hexane, diethyl ether, dichloromethane, chloroform, and acetone were used as the organic solvents, and chloroform proved to be the best solvent for the formation of PANI-TAA nanofibers. The redox potential of the oxidant is the key to controlling the morphology and diameter of the PANI-TAA nanofibers. The use of FeCl3 as the oxidant leads to the formation of thin (∼50 nm PANI-TAA nanofibers, which increased in length, crystallinity, conductivity, and coaxial alignment as the molar ratio of TAA to aniline was increased from 0.1 : 1 to 1 : 1. By comparison, only granular PANI was obtained when ammonium persulfate (APS, which has a higher redox potential, was used as the oxidant. The doping function of TAA in the PANI-TAA nanofibers was confirmed by means of FTIR and UV-Visible spectroscopy.

  12. Cloud infrastructure for providing tools as a service: quality attributes and potential solutions

    DEFF Research Database (Denmark)

    Chauhan, Muhammad Aufeef; Ali Babar, Muhammad

    2012-01-01

    Cloud computing is being increasingly adopted in various domains for providing on-demand infrastructure and Software as a service (SaaS) by leveraging the utility computing model and virtualization technologies. One of the domains, where cloud computing is expected to gain huge traction is Global...... projects. Through an extensive review of the relevant literature on GSD and Cloud Computing, we have identified a set of quality attributes and potential architectural solutions for a cloud-based infrastructure that can provide TaaS to GSD teams. This paper outlines the promised benefits of TaaS to GSD...... efficiently and cost-effectively. Moreover, variations in tools available/used by different GSD team members can also pose challenges. We assert that providing Tools as a Service (TaaS) to GSD teams through a cloud-based infrastructure can be a promising solution to address the tools related challenges in GSD...

  13. Does Trade Adjustment Assistance Make a Difference?

    OpenAIRE

    Kara M. Reynolds; John S. Palatucci

    2008-01-01

    Background: The U.S. Trade Adjustment Assistance (TAA) program provides workers who have lost their jobs due to increased trade with income support and training, job search, and relocation benefits. This paper uses the most recent data collected by the Department of Labor on TAA beneficiaries to provide one of the first evaluations of the effectiveness of the Trade Adjustment Assistance program. Using propensity score matching techniques, we find that the TAA program is of dubious value in te...

  14. Means on scattered compacta

    Czech Academy of Sciences Publication Activity Database

    Banakh, T.; Bonnet, R.; Kubiś, Wieslaw

    2014-01-01

    Roč. 2, č. 1 (2014), s. 5-10 ISSN 2299-3231 R&D Projects: GA ČR(CZ) GAP201/12/0290 Institutional support: RVO:67985840 Keywords : scattered compact space * mean operation Subject RIV: BA - General Mathematics http://www.degruyter.com/view/j/taa.2014.2.issue-1/taa-2014-0002/taa-2014-0002. xml

  15. Tumor-associated antigens identified by mRNA expression profiling induce protective anti-tumor immunity

    DEFF Research Database (Denmark)

    Mathiassen, Søren; Lauemøller, S L; Ruhwald, Morten

    2001-01-01

    Defined tumor-associated antigens (TAA) are attractive targets for anti-tumor immunotherapy. Here, we describe a novel genome-wide approach to identify multiple TAA from any given tumor. A panel of transplantable thymomas was established from an inbred p53-/- mouse strain. The resulting tumors we...... imprints, which may be used to identify patient-specific arrays of TAA. This may enable a multi-epitope based immunotherapy with improved prospects of clinical tumor rejection....

  16. Trimeric autotransporter adhesins in members of the Burkholderia cepacia complex: a multifunctional family of proteins implicated in virulence

    Directory of Open Access Journals (Sweden)

    Arsénio Mendes Fialho

    2011-12-01

    Full Text Available Trimeric autotransporter adhesins (TAAs are multimeric surface proteins, involved in various biological traits of pathogenic Gram-negative bacteria including adherence, biofilm formation, invasion, survival within eukaryotic cells, serum resistance and cytotoxicity. TAAs have a modular architecture composed by a conserved membrane-anchored C-terminal domain and a variable number of stalk and head domains. In this study, a bioinformatic approach has been used to analyze the distribution and architecture of TAAs among Burkholderia cepacia complex (Bcc genomes. Fifteen genomes were probed revealing a total of 74 encoding sequences. Compared with other bacterial species, the Bcc genomes contain a disproportionately large number of TAAs (two genes to up to 8 genes, such as in B.cenocepacia. Phylogenetic analysis showed that the TAAs grouped into at least eight distinct clusters. TAAs with serine-rich repeats are clearly well separated from others, thereby representing a different evolutionary lineage. Comparative gene mapping across Bcc genomes reveals that TAA genes are inserted within conserved synteny blocks. We further focused our analysis on the epidemic strain B. cenocepacia J2315 in which 7 TAAs were annotated. Among these, 3 TAA-encoding genes (BCAM019, BCAM0223 and BCAM0224 are organized into a cluster and are candidates for multifunctional virulence factors. Here we review the current insights into the functional role of BCAM0224 as a model locus.

  17. Neeger : [luuletused] / Langston Hughes ; tõlk. Jüri Talvet

    Index Scriptorium Estoniae

    Hughes, Langston

    2008-01-01

    Sisu: Neeger ; Valged varjud ; Kolm laulu lintshimisest : Siluett ; Põgenemine ; Lintshimislaul ; Las Ameerikast taas saab Ameerika ; Kuubid ; Ku Klux. Elu- ja loomeloolisi andmeid autori kohta lk. 514-515

  18. Kohanemine kriminaalse identiteediga resotsialiseerimist raskendava tegurina : [magistritöö] / Elen Heidok ; Tartu Ülikool, õigusteaduskond ; juhendaja: Silvia Kaugia

    Index Scriptorium Estoniae

    Heidok, Elen

    2014-01-01

    Sotsialiseerumise mõistest ja olulisematest agentidest, kultuurist ja subkultuurist sotsialiseerumise sisuna, kinnipeetavate taasühiskonnastamisest, Viru ja Tartu vanglates läbiviidud empiirilisest uurimusest

  19. 75 FR 12288 - American Recovery and Reinvestment Act of 2009; Notice of Availability of Funds and Solicitation...

    Science.gov (United States)

    2010-03-15

    ... Associations, National Labor Union Organizations, other Labor Union Affiliates, Non-profit Organizations and National Associations with connections to the Trade Adjustment Assistance for Workers (TAA) program or TAA..., National Labor Union Organizations, other Labor Union Affiliates, Non-profit Organizations and National...

  20. The right to just administrative action in the context of suspending ...

    African Journals Online (AJOL)

    For the decision to be taken in a lawful manner, the senior SARS official must at least be authorised to exercise the discretion in terms of the TAA and comply with the procedures and conditions stated in section 164(3) of the TAA. For the decision to be considered reasonable, the decision must be, at the minimum, rational ...

  1. Shared genetic risk factors of intracranial, abdominal, and thoracic aneurysms

    NARCIS (Netherlands)

    van 't Hof, Femke N G; Ruigrok, Ynte M; Lee, Cue Hyunkyu; Ripke, Stephan; Anderson, Graig; de Andrade, Mariza; Baas, Annette F; Blankensteijn, Jan D; Böttinger, Erwin P; Bown, Matthew J; Broderick, Joseph; Bijlenga, Philippe; Carrell, David S; Crawford, Dana C; Crosslin, David R; Ebeling, Christian; Eriksson, Johan G; Fornage, Myriam; Foroud, Tatiana; von Und Zu Fraunberg, Mikael; Friedrich, Christoph M; Gaál, Emília I; Gottesman, Omri; Guo, Dong-Chuan; Harrison, Seamus C; Hernesniemi, Juha; Hofman, Albert; Inoue, Ituro; Jääskeläinen, Juha E; Jones, Gregory T; Kiemeney, Lambertus A L M; Kivisaari, Riku; Ko, Nerissa; Koskinen, Seppo; Kubo, Michiaki; Kullo, Iftikhar J; Kuivaniemi, Helena; Kurki, Mitja I; Laakso, Aki; Lai, Dongbing; Leal, Suzanne M; Lehto, Hanna; LeMaire, Scott A; Low, Siew-Kee; Malinowski, Jennifer; McCarty, Catherine A; Milewicz, Dianna M; Mosley, Thomas H; Nakamura, Yusuke; Nakaoka, Hirofumi; Niemelä, Mika; Pacheco, Jennifer; Peissig, Peggy L; Pera, Joanna; Rasmussen-Torvik, Laura; Ritchie, Marylyn D; Rivadeneira, Fernando; van Rij, Andre M; Santos-Cortez, Regie Lyn P; Saratzis, Athanasios; Slowik, Agnieszka; Takahashi, Atsushi; Tromp, Gerard; Uitterlinden, André G; Verma, Shefali S; Vermeulen, Sita H; Wang, Gao T; Han, Buhm; Rinkel, Gabriël J E; de Bakker, Paul I W

    2016-01-01

    Background--Intracranial aneurysms (IAs), abdominal aortic aneurysms (AAAs), and thoracic aortic aneurysms (TAAs) all have a familial predisposition. Given that aneurysm types are known to co-occur, we hypothesized that there may be shared genetic risk factors for IAs, AAAs, and TAAs. Methods and

  2. Shared Genetic Risk Factors of Intracranial, Abdominal, and Thoracic Aneurysms

    NARCIS (Netherlands)

    van 't Hof, Femke N G; Ruigrok, Ynte M; Lee, Cue Hyunkyu; Ripke, Stephan; Anderson, Graig; de Andrade, Mariza; Baas, Annette F; Blankensteijn, Jan D; Böttinger, Erwin P; Bown, Matthew J; Broderick, Joseph; Bijlenga, Philippe; Carrell, David S; Crawford, Dana C; Crosslin, David R; Ebeling, Christian; Eriksson, Johan G; Fornage, Myriam; Foroud, Tatiana; von Und Zu Fraunberg, Mikael; Friedrich, Christoph M; Gaál, Emília I; Gottesman, Omri; Guo, Dong-Chuan; Harrison, Seamus C; Hernesniemi, Juha; Hofman, Albert; Inoue, Ituro; Jääskeläinen, Juha E; Jones, Gregory T; Kiemeney, Lambertus A L M; Kivisaari, Riku; Ko, Nerissa; Koskinen, Seppo; Kubo, Michiaki; Kullo, Iftikhar J; Kuivaniemi, Helena; Kurki, Mitja I; Laakso, Aki; Lai, Dongbing; Leal, Suzanne M; Lehto, Hanna; LeMaire, Scott A; Low, Siew-Kee; Malinowski, Jennifer; McCarty, Catherine A; Milewicz, Dianna M; Mosley, Thomas H; Nakamura, Yusuke; Nakaoka, Hirofumi; Niemelä, Mika; Pacheco, Jennifer; Peissig, Peggy L; Pera, Joanna; Rasmussen-Torvik, Laura; Ritchie, Marylyn D; Rivadeneira, Fernando; van Rij, Andre M; Santos-Cortez, Regie Lyn P; Saratzis, Athanasios; Slowik, Agnieszka; Takahashi, Atsushi; Tromp, Gerard; Uitterlinden, André G; Verma, Shefali S; Vermeulen, Sita H; Wang, Gao T; Han, Buhm; Rinkel, Gabriël J E; de Bakker, Paul I W

    2016-01-01

    BACKGROUND: Intracranial aneurysms (IAs), abdominal aortic aneurysms (AAAs), and thoracic aortic aneurysms (TAAs) all have a familial predisposition. Given that aneurysm types are known to co-occur, we hypothesized that there may be shared genetic risk factors for IAs, AAAs, and TAAs. METHODS AND

  3. Caffeine intake decreases oxidative stress and inflammatory biomarkers in experimental liver diseases induced by thioacetamide: Biochemical and histological study.

    Science.gov (United States)

    Amer, Mona G; Mazen, Nehad F; Mohamed, Ahmed M

    2017-03-01

    Liver disease remains a significant global health problem. Increased caffeine consumption has been associated with a lower prevalence of chronic liver disease. This study aimed to investigate the modifying effects of caffeine on liver injury induced by thioacetamide (TAA) administration in male rats and the possible underlying mechanisms. Forty adult male rats were equally classified into four groups: control group, received only tap water; caffeine-treated group, received caffeine (37.5 mg/kg per day); TAA-treated group, received intraperitoneal (i.p.) TAA (200 mg/kg b.w.) twice a week; and caffeine + TAA-treated group, received combined TAA and caffeine in the same previous doses. After eight weeks of treatment, blood samples were collected for biochemical analysis and liver specimens were prepared for histological and immunohistochemical studies and for assessment of oxidative stress. TAA induced liver toxicity with elevated liver enzymes and histological alterations, fatty changes, apoptosis, and fibrosis evidenced by increased immunohistochemical reaction to matrix metalloproteinase-9 (MMP-9) and collagen type IV in hepatocytes. Also, the levels of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) in serum were significantly elevated. Co-treatment with caffeine and TAA restored normal liver structure and function. Caffeine provided an anti-fibrogenic, anti-inflammatory, and antioxidant effect that was associated with recovery of hepatic histological and functional alterations from TAA-induced hepatotoxicity.

  4. Hepatoprotective activity of n-hexane and ethyl acetate fractions of ...

    African Journals Online (AJOL)

    Blood samples were collected 24hrs after TAA administration to assess the liver function of the rats (ALT, AST, ALP and Albumin levels). Results revealed a significant increase in the serum levels of ALP, AST and ALT, as well as a significant decrease in the serum Albumin levels due to TAA induced liver damage.

  5. Tee Kilkennysse läheb läbi... Liivalaia / William Elliott ; tõlk. Marek Laane

    Index Scriptorium Estoniae

    Elliott, William

    2005-01-01

    Suurbritannia diplomaat rõhutab vajadust tunda hästi olukorda selles riigis, mida hakatakse rajama või taas üles ehitama. Ta esitab kolm teesi, mida peaks silmas pidama riigi taasülesehitusel. Nn. riskiriikidega diplomaatiliste sidemete säilitamise tähtsusest. Lisa: Rumalaid diplomaatilistest suhetest loobumisi

  6. 76 FR 70761 - Weather Shield Manufacturing, Inc. Corporate Office, Medford, WI; Notice of Negative...

    Science.gov (United States)

    2011-11-15

    ... Department's practice, certifications typically cover workers separated on or after the impact date, as... expanded certification requirements for TAA under the TAA program as amended by the Trade and Globalization... Trade and Globalization Adjustment Assistance Act of 2009 requirements. Under the 2009 amendments, the...

  7. Ascorbic Acid Retention in Shredded Iceberg Lettuce as Affected by Minimal Processing

    OpenAIRE

    Barry-Ryan, Catherine; O'Beirne, David

    1998-01-01

    The effects of slicing method, packaging atmosphere and storage temperature were determined on total ascorbic acid (TAA) content of modified atmosphere packaged shredded lettuce. TAA was extracted from the lettuce samples and levels were monitored using either titration with 2,6-dichlorophenolindophenol solution or an assay kit. Slicing affected (p manual slicing > machine slicing. Flushing with 100% nitrogen increased retention (~...

  8. Combined surgical and catheter-based treatment of extensive thoracic aortic aneurysm and aortic valve stenosis

    DEFF Research Database (Denmark)

    De Backer, Ole; Lönn, Lars; Søndergaard, Lars

    2015-01-01

    valve stenosis (AS) who are considered at high risk for surgical aortic valve replacement. In this report, we describe the combined surgical and catheter-based treatment of an extensive TAA and AS. To our knowledge, this is the first report of hybrid TAA repair combined with TAVR....

  9. Tumor-associated antigens identified by mRNA expression profiling induce protective anti-tumor immunity

    DEFF Research Database (Denmark)

    Mathiassen, S; Lauemøller, S L; Ruhwald, M

    2001-01-01

    Defined tumor-associated antigens (TAA) are attractive targets for anti-tumor immunotherapy. Here, we describe a novel genome-wide approach to identify multiple TAA from any given tumor. A panel of transplantable thymomas was established from an inbred p53-/- mouse strain. The resulting tumors were...

  10. Vector prime/protein boost vaccine that overcomes defects acquired during aging and cancer

    DEFF Research Database (Denmark)

    Tang, Y.; Akbulut, H.; Maynard, J.

    2006-01-01

    decrement of negative regulatory CD4CD25FOXP3-T cells in the tumor tissue of 18-mo-old mice. These results suggest that the Ad-sig-TAA/ecdCD40L vector prime-TAA/ecdCD40L protein boost vaccine platform may be valuable in reducing postsurgery recurrence in a variety of epithelial neoplasms....

  11. 77 FR 77217 - Fiscal Year 2012 Annual Report to Congress on the Trade Adjustment Assistance for Firms Program

    Science.gov (United States)

    2012-12-31

    ... Workers and TAA for Community Colleges, which are both administered by DOL, and TAA for Farmers, which is...--Firms Certified for TAAF Service vs. Manufacturing: FY 2012 Percentage of Percentage of Total number of... productivity vertically introduces additional degrees of error as it represents the average of averages.\\18...

  12. Effect of coriander on thioacetamide-induced hepatotoxicity in rats.

    Science.gov (United States)

    Moustafa, Abdel Halim A; Ali, Ehab Mostafa M; Moselhey, Said S; Tousson, Ehab; El-Said, Karim S

    2014-08-01

    Thioacetamide (TAA) is a potent hepatotoxin that causes centrilobulal necrosis and nephrotoxic damage following acute administration. Prolonged exposure to TAA can result in bile duct proliferation and liver cirrhosis histologically similar to that caused due to viral hepatitis infection. Coriander in food increases the antioxidant content, acting as a natural antioxidant and inhibiting undesirable oxidation processes. The present study investigated the antioxidant activity of Coriandrum sativum on TAA-induced hepatotoxicity in the male rats. Phenolic content and antioxidant activity were evaluated in the coriander leaves and seeds. Forty-eight adult male rats were divided into four groups. Group I (control), group II (TAA injected rats), group III (TAA injected rats fed coriander leaves) and group IV (TAA injected rats fed coriander seeds). The results revealed that serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) activities were significantly increased in the groups II, III and IV as compared to the normal control. Oxidative stress in the group II was manifested by a significant rise in nitric oxide (NO), thiobarbituric acid reactive substance (TBARS) levels and myloperoxidase (MPO) activities in the liver tissues as compared with the control group. Rats fed with coriander leaves and seeds showed a decrease in the serum ALT, AST and ALP activities and in the liver NO and TBARS levels as compared to the group II. Histopathological study revealed that coriander feeding attenuated TAA-induced hepatotoxicity in the rats. In conclusion, coriander leaves attenuate hepatotoxicity induced by TAA more than that of seeds due to the higher content of phenolic compounds and antioxidants in the leaves of coriander. Liver of rats intoxicated with TAA exhibited advanced CIRRHOSIS: in the form of macronodular and micronodular structure surrounded by fibrous tissue. Treatment with coriander leaves and seeds helps in improving

  13. Can the TLR-4-Mediated Signaling Pathway Be “A Key Inflammatory Promoter for Sporadic TAA”?

    Directory of Open Access Journals (Sweden)

    Giovanni Ruvolo

    2014-01-01

    Full Text Available Thoracic aorta shows with advancing age various changes and a progressive deterioration in structure and function. As a result, vascular remodeling (VR and medial degeneration (MD occur as pathological entities responsible principally for the sporadic TAA onset. Little is known about their genetic, molecular, and cellular mechanisms. Recent evidence is proposing the strong role of a chronic immune/inflammatory process in their evocation and progression. Thus, we evaluated the potential role of Toll like receptor- (TLR- 4-mediated signaling pathway and its polymorphisms in sporadic TAA. Genetic, immunohistochemical, and biochemical analyses were assessed. Interestingly, the rs4986790 TLR4 polymorphism confers a higher susceptibility for sporadic TAA (OR=14.4, P=0.0008 and it represents, together with rs1799752 ACE, rs3918242 MMP-9, and rs2285053 MMP-2 SNPs, an independent sporadic TAA risk factor. In consistency with these data, a significant association was observed between their combined risk genotype and sporadic TAA. Cases bearing this risk genotype showed higher systemic inflammatory mediator levels, significant inflammatory/immune infiltrate, a typical MD phenotype, lower telomere length, and positive correlations with histopatological abnormalities, hypertension, smoking, and ageing. Thus, TLR4 pathway should seem to have a key role in sporadic TAA. It might represent a potential useful tool for preventing and monitoring sporadic TAA and developing personalized treatments.

  14. Gamma-glutamyltranspeptidase (GGT) in experimental liver cirrhosis induced by thioacetamide: a biochemical and enzymehistochemical study.

    Science.gov (United States)

    Kretzschmar, M; Machnik, G; Oesterle, D; Zimmermann, T; Klinger, W

    1991-01-01

    Micro- and macronodular experimental cirrhosis-like liver lesion was induced in female rats by administration of 0.03% thioacetamide (TAA) in drinking water for 3 or 6 months. The activity of gamma-glutamyltranspeptidase (GGT) and the distribution pattern of this enzyme within the liver structure were investigated 14 d after withdrawal of TAA in comparison to neonatal and adult normal liver. GGT activity was extremely high at birth. Chronic TAA administration led to a strong increase in hepatic GGT activity in dependence on duration of TAA administration in comparison to adult controls. In accordance to these results we observed by enzyme-histochemistry a small to moderate hepatocellular GGT activity after 3 months of TAA treatment. GGT activity was also demonstrable in epithelia of proliferated ductuli biliferi of single enlarged portal tracts. After 6 months of TAA administration the hepatocellular GGT activity was moderate to strong. It was demonstrable both in parenchymal (preneo-plastic) nodules and in cholangiocellular/cholangioductular proliferates. A GGT activity of mesenchymal cells was not demonstrable. We conclude that the increased hepatic GGT activity after chronic TAA administration can be correlated with the process of development of preneoplastic nodules. A relation between increased GGT activity and the process of cirrhogenesis does not seem to be probable in this animal cirrhosis model.

  15. A chemically modified [alpha]-amylase with a molten-globule state has entropically driven enhanced thermal stability

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, Khawar Sohail; Poljak, Anne; De Francisci, Davide; Guerriero, Gea; Pilak, Oliver; Burg, Dominic; Raftery, Mark J.; Parkin, Don M.; Trewhella, Jill; Cavicchioli, Ricardo (Sydney); (New South)

    2010-11-15

    The thermostability properties of TAA were investigated by chemically modifying carboxyl groups on the surface of the enzyme with AMEs. The TAA{sub MOD} exhibited a 200% improvement in starch-hydrolyzing productivity at 60 C. By studying the kinetic, thermodynamic and biophysical properties, we found that TAA{sub MOD} had formed a thermostable, MG state, in which the unfolding of the tertiary structure preceded that of the secondary structure by at least 20 C. The X-ray crystal structure of TAA{sub MOD} revealed no new permanent interactions (electrostatic or other) resulting from the modification. By deriving thermodynamic activation parameters of TAA{sub MOD}, we rationalised that thermostabilisation have been caused by a decrease in the entropy of the transition state, rather than being enthalpically driven. Far-UV CD shows that the origin of decreased entropy may have arisen from a higher helical content of TAA{sub MOD}. This study provides new insight into the intriguing properties of an MG state resulting from the chemical modification of TAA.

  16. Subsidence of total ankle component associated with deterioration of an ankle scale in non-inflammatory arthritis but not in rheumatoid arthritis.

    Science.gov (United States)

    Iwata, Takahiro; Ito, Hiromu; Furu, Moritoshi; Ishikawa, Masahiro; Azukizawa, Masayuki; Yoshitomi, Hiroyuki; Fujii, Takayuki; Akiyama, Haruhiko; Matsuda, Shuichi

    2017-05-01

    Modern three-component total ankle arthroplasty (TAA) has favorable clinical results and survival rates. However, radiographic deterioration and worsening of clinical symptoms may occur in patients with rheumatoid arthritis (RA) or non-inflammatory arthritis (NA). The associations between outcomes and clinical and radiological factors are not clear. We compared midterm clinical and radiographic outcomes after TAA between patients with RA and those with NA. Twenty-six TAAs were performed using a three-component prosthesis, the FINE Total Ankle System during the study period. Fourteen TAAs with 11 RA patients undergoing primary TAA were compared with twelve TAAs with 12 NA patients. Clinical and radiographic outcomes were evaluated before and after operation, and at the final follow-up. The Japanese Society for Surgery of the Foot (JSSF) scale improved significantly following TAA in both groups (p = 0.0039 and 0.0156, respectively). Tibial subsidence, talar subsidence and age were significantly associated with postoperative JSSF score only in the NA group (p = 0.0027, 0.0017 and p subsidence was an independent predictor of a worse JSSF score in the NA group (F = 10.3). The final clinical outcome was negatively influenced by talar subsidence in patients with NA, but not in those with RA.

  17. CD8+ T-cell responses to tumor-associated antigens correlate with superior relapse-free survival after allo-SCT.

    Science.gov (United States)

    Kapp, M; Stevanović, S; Fick, K; Tan, S M; Loeffler, J; Opitz, A; Tonn, T; Stuhler, G; Einsele, H; Grigoleit, G U

    2009-03-01

    The GVL effect following allo-SCT is one of the most prominent examples showing the ability of the immune system to eliminate malignant hematological diseases. Tumor-associated Ags (TAA), for instance WT1 and proteinase-3, have been proposed as targets for T cells to establish a GVL effect. Here, we examined an additional TAA (MUC1) as a possible T-cell target of GVL-related immune responses. We have defined new peptide epitopes from the MUC1 Ag to broaden patients' screening and to expand the repertoire of immunologic monitoring as well as for therapeutic approaches in the future. Twenty-eight patients after allo-SCT have been screened for T-cell responses toward TAA (proteinase-3, WT1, MUC1). We could detect a significant relationship between relapse and the absence of a TAA-specific T-cell response, whereby only 2/13 (15%) patients with TAA-specific CTL relapsed, in contrast to 9/15 (60%) patients without TAA-specific CTL responses (P<0.05). In conclusion, CD8(+) T-cell responses directed to TAA might contribute to the GVL effect. These observations highlight both the importance and the potential of immunotherapeutic approaches after allo-SCT.

  18. Celecoxib ameliorates portal hypertension of the cirrhotic rats through the dual inhibitory effects on the intrahepatic fibrosis and angiogenesis.

    Science.gov (United States)

    Gao, Jin-Hang; Wen, Shi-Lei; Yang, Wen-Juan; Lu, Yao-Yao; Tong, Huan; Huang, Zhi-Yin; Liu, Zhang-Xu; Tang, Cheng-Wei

    2013-01-01

    Increased intra-hepatic resistance to portal blood flow is the primary factor leading to portal hypertension in cirrhosis. Up-regulated expression of cyclooxygenase-2 (COX-2) in the cirrhotic liver might be a potential target to ameliorate portal hypertension. To verify the effect of celecoxib, a selective inhibitor of COX-2, on portal hypertension and the mechanisms behind it. Cirrhotic liver model of rat was established by peritoneal injection of thiacetamide (TAA). 36 rats were randomly assigned to control, TAA and TAA+celecoxib groups. Portal pressures were measured by introduction of catheters into portal vein. Hepatic fibrosis was assessed by the visible hepatic fibrotic areas and mRNAs for collagen III and α-SMA. The neovasculature was determined by hepatic vascular areas, vascular casts and CD31 expression. Expressions of COX-2, vascular endothelial growth factor (VEGF), VEGF receptor-2 (VEGFR-2) and related signal molecules were quantitated. Compared with TAA group, the portal pressure in TAA+celecoxib group was significantly decreased by 17.8%, pportal venules. The data of fibrotic areas, CD31expression, mRNA levels of α-SMA and collagen III in TAA+celecoxib group were much lower than those in TAA group, pprotein levels of VEGF, VEGFR-2 and COX-2 induced by TAA was significantly inhibited after celecoxib treatment. The expressions of prostaglandin E2 (PGE2), phosphorylated extracellular signal-regulated kinase (p-ERK), hypoxia-inducible factor-1α (HIF-1α), and c-fos were also down-regulated after celecoxib treatment. Long term administration of celecoxib can efficiently ameliorate portal hypertension in TAA rat model by its dual inhibitory effects on the intrahepatic fibrosis and angiogenesis. The anti-angiogenesis effect afforded by celecoxib may attribute to its modulation on VEGF/VEGFR-2 through the down-regulation of integrated signal pathways involving PGE2- HIF-1α- VEGF and p-ERK- c-fos- VEGFR-2.

  19. Candidate Gene Resequencing in a Large Bicuspid Aortic Valve-Associated Thoracic Aortic Aneurysm Cohort: SMAD6 as an Important Contributor.

    Science.gov (United States)

    Gillis, Elisabeth; Kumar, Ajay A; Luyckx, Ilse; Preuss, Christoph; Cannaerts, Elyssa; van de Beek, Gerarda; Wieschendorf, Björn; Alaerts, Maaike; Bolar, Nikhita; Vandeweyer, Geert; Meester, Josephina; Wünnemann, Florian; Gould, Russell A; Zhurayev, Rustam; Zerbino, Dmytro; Mohamed, Salah A; Mital, Seema; Mertens, Luc; Björck, Hanna M; Franco-Cereceda, Anders; McCallion, Andrew S; Van Laer, Lut; Verhagen, Judith M A; van de Laar, Ingrid M B H; Wessels, Marja W; Messas, Emmanuel; Goudot, Guillaume; Nemcikova, Michaela; Krebsova, Alice; Kempers, Marlies; Salemink, Simone; Duijnhouwer, Toon; Jeunemaitre, Xavier; Albuisson, Juliette; Eriksson, Per; Andelfinger, Gregor; Dietz, Harry C; Verstraeten, Aline; Loeys, Bart L

    2017-01-01

    Bicuspid aortic valve (BAV) is the most common congenital heart defect. Although many BAV patients remain asymptomatic, at least 20% develop thoracic aortic aneurysm (TAA). Historically, BAV-related TAA was considered as a hemodynamic consequence of the valve defect. Multiple lines of evidence currently suggest that genetic determinants contribute to the pathogenesis of both BAV and TAA in affected individuals. Despite high heritability, only very few genes have been linked to BAV or BAV/TAA, such as NOTCH1, SMAD6 , and MAT2A . Moreover, they only explain a minority of patients. Other candidate genes have been suggested based on the presence of BAV in knockout mouse models (e.g., GATA5, NOS3 ) or in syndromic (e.g., TGFBR1/2, TGFB2/3 ) or non-syndromic (e.g., ACTA2 ) TAA forms. We hypothesized that rare genetic variants in these genes may be enriched in patients presenting with both BAV and TAA. We performed targeted resequencing of 22 candidate genes using Haloplex target enrichment in a strictly defined BAV/TAA cohort ( n = 441; BAV in addition to an aortic root or ascendens diameter ≥ 4.0 cm in adults, or a Z-score ≥ 3 in children) and in a collection of healthy controls with normal echocardiographic evaluation ( n = 183). After additional burden analysis against the Exome Aggregation Consortium database, the strongest candidate susceptibility gene was SMAD6 ( p = 0.002), with 2.5% ( n = 11) of BAV/TAA patients harboring causal variants, including two nonsense, one in-frame deletion and two frameshift mutations. All six missense mutations were located in the functionally important MH1 and MH2 domains. In conclusion, we report a significant contribution of SMAD6 mutations to the etiology of the BAV/TAA phenotype.

  20. Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

    Science.gov (United States)

    Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

    2017-07-01

    We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  1. Management of Talar Component Subsidence.

    Science.gov (United States)

    Li, Shu-Yuan; Myerson, Mark S

    2017-06-01

    Component subsidence has been found to be the top complication that leads to failure of the total ankle arthroplasty (TAA). The cause of subsidence formation is unclear, and is multifactorial. Talar subsidence is more frequently met than tibial subsidence, and the subsequent big bone loss is demanding to handle. As a revision treatment option, neither a revision TAA nor a salvage ankle and/or hindfoot arthrodesis procedure is easy to perform or can obtain a definite outcome. The Salto XT can be used to treat most of the TAA systems available for use in the United States with acceptable short-term outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Identification of HLA-A2-restricted CTL epitopes of a novel tumour-associated antigen, KIF20A, overexpressed in pancreatic cancer

    OpenAIRE

    Imai, K; Hirata, S; Irie, A; Senju, S; Ikuta, Y; Yokomine, K; Harao, M; Inoue, M; Tomita, Y; Tsunoda, T; Nakagawa, H; Nakamura, Y; Baba, H; Nishimura, Y

    2010-01-01

    Background: Identification of tumour-associated antigens (TAAs) that induce cytotoxic T lymphocytes (CTLs) specific to cancer cells is critical for the development of anticancer immunotherapy. In this study, we aimed at identifying a novel TAA of pancreatic cancer for immunotherapy. Methods: On the basis of the genome-wide cDNA microarray analysis, we focused on KIF20A (also known as RAB6KIFL/MKlp2) as a candidate TAA in pancreatic cancer cells. The HLA-A2 (A*02:01)-restricted CTL epitopes of...

  3. 77 FR 48550 - Sears Holdings Management Corporation, A Division of Sears Holdings Corporation, Hoffman Estates...

    Science.gov (United States)

    2012-08-14

    ... negative determination regarding workers' eligibility to apply for Trade Adjustment Assistance (TAA... reconsideration of the negative determination regarding workers' eligibility to apply for Trade Adjustment... competitive services. The request for reconsideration alleges that the worker group does not perform marketing...

  4. Sakala arhitekt Raine Karp : uus aeg nõuab teistsuguseid karpe / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2006-01-01

    Raine Karbi elust ja loomingust, mõtteid Sakala keskuse projekteerimisest, ehitamisest ja ümberehitamisest. Karin Hallas-Murula kommentaar "Tõstis paekivi taas ausse" ja Ivi Eenmaa kommentaar "Teadis raamatukogust hämmastavalt palju"

  5. Eestis on juba ammu oma Ericsson / Romet Kreek

    Index Scriptorium Estoniae

    Kreek, Romet, 1972-

    2003-01-01

    Ericsson ostis 1929. a. osaluse Tartu telefonitehases. 1993. aastal avati taas ametlik esindus, mille baasil loodi tütarfirma Ericsson Eesti AS. Vt. samas: Ericssoni kontsern tegeleb olelusvõitlusega

  6. Uudiseid maailmast / Ivo Heinloo

    Index Scriptorium Estoniae

    Heinloo, Ivo

    2012-01-01

    Lühisõnumid: Taas jagati Grammysid. Lahkus Whitney Houston. Suri Etta James. Esperanza Spalding jätkab tähelendu. Album Esbjörn Svenssoni mälestuseks. Madonna maailmatuur hõlmab nelja kontinenti

  7. Loomalikud vaimud naasevad / Matthew Bishop

    Index Scriptorium Estoniae

    Bishop, Matthew

    2005-01-01

    Autori hinnangul läheneb maailma ettevõtluses investeerimisbuum ja ettevõtted hakkavad taas riske võtma. Diagramm: Ettevõtete kasumid ja äriinvesteeringud. Vt. samas: Sajandi kohtuprotsess? (Enroni kohtuprotsessist)

  8. Yoga tõuseb tuhast: hoidke alt India, USA ja Araabia Ühendemiraadid ! / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2010-01-01

    2008. a. pankrotistunud tarkvarafirma Yoga IB kavatseb taas naasta infotehnoloogia turule. Firma poolt väljatöötatud tarkvaralahenduste abil on võimalik ruumides kontrollida kliimatingimusi, valgustust, liikumist ja turvasüsteeme

  9. Autoantibodies to Tumor-Associated Antigens in Epithelial Ovarian Carcinoma

    Directory of Open Access Journals (Sweden)

    Benjamin Piura

    2009-01-01

    Full Text Available This review will focus on recent knowledge related to circulating autoantibodies (AAbs to tumor-associated antigens (TAAs in epithelial ovarian carcinoma. So far, the following TAAs have been identified to elicit circulating AAbs in epithelial ovarian carcinoma: p53, homeobox proteins (HOXA7, HOXB7, heat shock proteins (HSP-27, HSP-90, cathepsin D, cancer-testis antigens (NY-ESO-1/LAGE-1, MUC1, GIPC-1, IL-8, Ep-CAM, and S100A7. Since AAbs to TAAs have been identified in the circulation of patients with early-stage cancer, it has been speculated that the assessment of a panel of AAbs specific for epithelial ovarian carcinoma TAAs might hold great potential as a novel tool for early diagnosis of epithelial ovarian carcinoma.

  10. Kui palju ühte plaati osta / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-

    2009-01-01

    Plaaditööstuse tegemistest rockmuusikaga heliplaatide uute versioonide väljaandmisel. Uutest väljalasetest: ansambli The Beatles plaadikataloogi taasüllitamisest firma Apple/EMI poolt, Frank Zappa, ansambli Loits jt. ansamblite loomingu taasilmumisest

  11. Res Publica meelitab valla- ja linnajuhte / Henrik Roonemaa

    Index Scriptorium Estoniae

    Roonemaa, Henrik

    2001-01-01

    Valitsusliidu regionaalpoliitikas pettunud 30 omavalitsusjuhti on astunud ühenduse Res Publica liikmeks, lootes selle põhjal tekkiva partei abil kohaliku ja riigivõimu taas omavahel suhtlema panna. Vt. samas Res Publica liikmetest omavalitsusjuhid

  12. Uusika Muudised

    Index Scriptorium Estoniae

    2004-01-01

    BBC kokkuvõttest Inglismaa raadiojaamade enimmängitavatest artistidest ; USA muusikaajakirja Blender avaldatud halvimate poplaulude pingereast ; Ansambli Cure uuest ilmuvast heliplaadist ; Ansambli Spice Girls taasühinemisplaanidest

  13. Adamkus, Kirkilas take Lithuania's energy case to East European partners

    Index Scriptorium Estoniae

    2008-01-01

    Euroopa tuumaenergia foorumil esinedes palusid Leedu peaminister Gediminas Kirkilas ja president Valdas Adamkus EL-i partneritel taas kaaluda Ignalina tuumajaama lahtiolekuaja pikendamist. Hispaania ja Tšehhi esindaja ning Jose Manuel Barroso arvamused

  14. Latinistid loovad digitaalset raamistikku

    Index Scriptorium Estoniae

    2015-01-01

    Tartu Ülikooli teadlaste osalemisest töös "Res publica litteraria (1500-1800) taasühendamine: digitaalne raamistik Euroopa intellektuaalajaloo uurimiseks". Vestlusest Tartu Ülikooli klassikalise filoloogia professori Kristi Viidinguga

  15. Orson Wellesi klassika uuesti kinodes

    Index Scriptorium Estoniae

    1999-01-01

    Taastatud pildi ja helireaga jõudsid Suurbritannias taas kinodesse "Kodanik Kane" ("Citizen Kane") : Ameerika Ühendriigid 1941 ja "Kurjuse puudutus" ("The Touch of Evil") : Ameerika Ühendriigid 1958

  16. Rahvusvahelise Tööorganisatsiooni konventsioonide ratifitseerimisest Eestis : [bakalaureusetöö] / Merle Muda ; Tartu Ülikool, õigusteaduskond ; juhendaja: Inge-Maret Orgo

    Index Scriptorium Estoniae

    Muda, Merle, 1972-

    1994-01-01

    Rahvusvahelise Tööorganisatsiooni (ILO) ajalooline areng, struktuur, aktid; ülevaade Eesti Vabariigi poolt enne 1940. a. ratifitseeritud ILO konventsioonidest; EV seadusandluse vastavusest pärast ILO-ga taasühinemist

  17. The influence of thyroid autoimmunity on embryo quality in women undergoing assisted reproductive technology.

    Science.gov (United States)

    Andrisani, A; Sabbadin, C; Marin, L; Ragazzi, E; Dessole, F; Armanini, D; Donà, G; Bordin, L; Ambrosini, G

    2018-02-20

    The influence of thyroid autoimmunity in assisted reproductive technology (ART) outcome in euthyroid women is still controversial. In this study, we retrospectively evaluated embryo quality in 123 euthyroid women undergoing ART with or without thyroid autoantibodies (TAA). Embryo quality was assessed in 119 embryos of 29 infertile patients with TAA and in 394 embryos of 94 infertile patients without TAA. Our results showed not statistically significant differences in age, body mass index, anti-Müllerian hormone, follicle stimulating hormone, free triiodothyronine, and free thyroxine levels between cases and controls. Thyroid stimulating hormone was within the normal range, but significantly higher in TAA patients compared with the controls (2.4 ± 0.8 vs. 2 ± 0.9 mIU/L, respectively, p women with at least one autoantibody (p women undergoing ART even when thyroid function is normal.

  18. Emast lahutamine rikub šimpansi elu

    Index Scriptorium Estoniae

    2014-01-01

    Emory ülikooli primatoloogid ja loomapsühholoogid eesotsas Stephen Rossiga uurisid kuidas sulanduvad emast võõrutatud ja inimeste poolt üleskasvatatud, kuid taas oma liigikaaslaste sekka sattunud šimpansside

  19. Transfusion-associated anaphylaxis during anaesthesia and surgery--a retrospective study

    DEFF Research Database (Denmark)

    Lindsted, G; Larsen, R; Krøigaard, M

    2014-01-01

    at the Danish Anaesthesia Allergy Centre (DAAC). Based on the outcome of this investigation, the patients were classified as DAAC positive (confirmed hypersensitivity to identified agent, n = 112), or DAAC negative (no confirmed hypersensitivity, n = 133). Data on case history, details of blood transfusion...... and results of laboratory and clinical investigations were collected. TAA cases were identified according to the recommendations of the International Society of Blood Transfusion (ISBT). RESULTS: Ten possible TAA cases (30% of all transfused patients) were identified, all DAAC negative. The frequency......BACKGROUND AND OBJECTIVES: Transfusion-associated anaphylaxis (TAA) is a severe adverse reaction reported to occur in 1:9000-90 000 transfusions. According to the Danish Registration of Transfusion Risks (DART), the frequency is 1:300 000 transfusions, which suggests insufficient reporting of TAA...

  20. Nord-Stream-Antrag stösst auf Ablehnung

    Index Scriptorium Estoniae

    2012-01-01

    Nord Stream küsib Eestilt taas uuringuluba. 2007 ei rahuldanud vabariigi valitsus Nord Stream AG uurimisloa taotlust. Andrus Ansip ja Mart Laar on seisukohal, et tuleks jääda kord tehtud otsuse juurde

  1. Home stretch for Ilves

    Index Scriptorium Estoniae

    2011-01-01

    Suure tõenäosusega saab uueks presidendiks taas praegune riigipea Toomas Hendrik Ilves, sest teda on lubanud toetada Isamaa ja Res Publica Liit, Reformierakond ja Sotsiaaldemokraatlik Erakond, mis annab talle Riigikogu poolthäälte enamuse

  2. Tantsib arusaadavaist asjust

    Index Scriptorium Estoniae

    2006-01-01

    11. augustil näeb Augusti Tantsu Festivalil Kanuti gildi saalis taas Kaja Kanni sooloetendust "There are Laika dogs living in Estonia", mille eest pärjati ZUGA ühendatud tantsijate liige Philip Morrise aasta tegija preemiaga

  3. Bicuspid Aortic Valve and Thoracic Aortic Aneurysm: Three Patient Populations, Two Disease Phenotypes, and One Shared Genotype

    Directory of Open Access Journals (Sweden)

    Robert B. Hinton

    2012-01-01

    Full Text Available Bicuspid aortic valve (BAV and thoracic aortic aneurysm (TAA are two discrete cardiovascular phenotypes characterized by latent progressive disease states. There is a clear association between BAV and TAA; however the nature and extent of this relationship is unclear. There are both distinct and overlapping developmental pathways that have been established to contribute to the formation of the aortic valve and the aortic root, and the mature anatomy of these different tissue types is intimately intertwined. Likewise, human genetics studies have established apparently separate and common contributions to these clinical phenotypes, suggesting complex inheritance and a shared genetic basis and translating 3 patient populations, namely, BAV, TAA, or both, into a common but diverse etiology. A better understanding of the BAV-TAA association will provide an opportunity to leverage molecular information to modify clinical care through more sophisticated diagnostic testing, improved counseling, and ultimately new pharmacologic therapies.

  4. Villu võitlus / Villu Reiljan ; interv. Britt Thomson

    Index Scriptorium Estoniae

    Reiljan, Villu, 1953-

    2006-01-01

    Rahvaliidu esimees eelseisvatest presidendivalimistest, Rahvaliidu ja Keskerakonna presidendikandidaadi Arnold Rüütli võimalustest valimised taas võita, poliitikast Eestis ning meedia kriitilisest hoiakust tema suhtes

  5. Villu võitlus / Villu Reiljan ; interv. Britt Thomson

    Index Scriptorium Estoniae

    Reiljan, Villu

    2006-01-01

    Eestimaa Rahvaliidu esimees eelseisvatest presidendivalimistest, Rahvaliidu ja Keskerakonna presidendikandidaadi Arnold Rüütli võimalustest valimised taas võita, poliitikast Eestis ning meedia kriitilisest hoiakust tema suhtes

  6. Kaevandajate aktsiad hoos / Romet Kreek

    Index Scriptorium Estoniae

    Kreek, Romet, 1972-

    2009-01-01

    Maailma suured kaevandusgigandid leidsid taas üksmeele, kuna Rio Tinto leidis, et parem on ühendada jõud rivaaliga BHP Billiton ja lükkas tagasi suurinvesteeringu Hiina suurima alumiiniumitootjaga

  7. Tipp-pankur, kelle aastapalk on 1 dollar / Eric Dash

    Index Scriptorium Estoniae

    Dash, Eric

    2010-01-01

    Citigroupi juhi Vikram Panditi aastapalk on 1 dollar, seda seni, kuni pank on taas kindlalt kasumis. Tükk tüki haaval nülib ta maha ettevõtte liigseid harusid, tugevdab panga bilanssi, stabiliseerides finantse

  8. Ilves secures vote to continue in post / Karoliina Raudsepp

    Index Scriptorium Estoniae

    Raudsepp, Karoliina

    2011-01-01

    Eesti presidendiks valiti taas Toomas Hendrik Ilves. Teine presidendikandidaat Indrek Tarand sai 25 häält. Presidendivalimiste päeval toimus Toompeal presidendi otsevalimise pooldajate meeleavaldus. Väljavõte presidendi kõnest

  9. Ilves: toetades Kreekat, nõudkem rohkem toetusi Euroopast / Jaanus Piirsalu

    Index Scriptorium Estoniae

    Piirsalu, Jaanus, 1973-

    2011-01-01

    President Toomas Hendrik Ilvese kõnest Riigikogus enne teistkordseks ametiajaks vande andmist. Autor peab tõenäoliseks, et viie aasta pärast valib presidendi taas Riigikogu asemel valijameeste kogu

  10. Uudiseid maailmast / Ivo Heinloo

    Index Scriptorium Estoniae

    Heinloo, Ivo

    2012-01-01

    Lühisõnumeid muusikamaailmast: Pat Metheny Group tuleb taas kokku. Musta muusika auhinnad Suurbritannias. Bob Marley muusika kui õppevahend inglise keele omandamiseks. Ted Curson 1935-2012. In memoriam David S. Ware. In memoriam Terry Callier

  11. Moldova kommunistist president üritab kannapööret sooritada / Marje Aksli

    Index Scriptorium Estoniae

    Aksli, Marje

    2004-01-01

    Moldova president Vladimir Voronin lubab presidendivalimiste eel, et Moldova kommunistlikust parteist saab euroopalik vasakpoolne partei, tema sõnul on partei peamised prioriteedid integreerumine Euroopaga, riigi taasühendamine ning reformide edendamine. Lisa: President oma kaarte veel ei ava

  12. Rolexi tantsuauhinna nominent näitab oma lavastust

    Index Scriptorium Estoniae

    2005-01-01

    R. Valme tantsulavastust "Mesta" saab taas näha 26. nov. Kanuti Gildi saalis. R. Valme valiti hiljuti 25 noore koreograafist nominendi hulka prestiizhikas projektis Rolex Mentor & Protégé Arts Initiative

  13. ISSUE PAPER: What Do Test Scores in Texas Tell Us?

    National Research Council Canada - National Science Library

    Klein, Stephen

    2000-01-01

    ...) about possible unintended consequences of these programs. We conducted several analyses to examine the issue of whether TAAS scores can be trusted to provide an accurate index of student skills and abilities...

  14. Trade Adjustment Assistance for Firms: Economic, Program, and Policy Issues

    National Research Council Canada - National Science Library

    Hornbeck, J. F

    2007-01-01

    .... This report focuses on the trade adjustment assistance (TAA) program for firms, which provides technical assistance to help them develop strategies to remain competitive in the changing international economy...

  15. Anto Raukas: "Fosforiit - kas Virumaa õnn või õnnetus?" / intervjueerinud Raivo Raigna

    Index Scriptorium Estoniae

    Raukas, Anto, 1935-

    2011-01-01

    Fosforiidi kaevandamise plaanid on Eestis taas päevakorda tõusnud. Intervjuu akadeemik Anto Raukasega. Eesti fosforiidivarudest, varasematest kaevandamistest, seotud ohtudest. Keskkonnaminister Keit Pentuse selgitused fosforiidikaevandamise võimalikkuse kohta Eestis

  16. Minister Palo püüab reklaamiga halli passi omanikke / Aleksei Günter, Aleksei Ivanov, Andrei Babin

    Index Scriptorium Estoniae

    Günter, Aleksei, 1979-

    2008-01-01

    Valitsus alustas mittekodanikele suunatud reklaamikampaaniat "Erinevad inimesed - üks rahvas". Vt. samas: Kai Kalamees. Sünnijärgse kodakondsuse idee põrus riigikogus taas; Kampaania; Kommenteerivad Paul-Eerik Rummo ja Evelyn Sepp

  17. Mõtteid kriisist ja arhitektuurist = Thoughts about the crisis and architecture / Vilen Künnapu

    Index Scriptorium Estoniae

    Künnapu, Vilen, 1948-

    2010-01-01

    Inimeste elulaadi muutumisest seoses majanduskriisi ja suurte muutustega maailmas, arhitektuurist kriisi ajal ja pärast seda, kus ehitised hakkavad suhtlema koha energeetikaga, sisenedes taas kõiksusega seotud geomeetrilisse süsteemi

  18. Afganistan jääb USA sõduriteta terrori alla / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2011-01-01

    Afganistanis on sagenenud Talibani korraldatud enesetapurünnakud, surma on saanud president Hamid Karzai vend ja mitu mõjukat nõunikku. Autori sõnul on mitu võimalust, et Afganistanis puhkeb taas kodusõda

  19. Stephen Hawking ja tema kuulsad kihlveod / Andi Hektor

    Index Scriptorium Estoniae

    Hektor, Andi, 1975-

    2010-01-01

    Ratastooli aheldatud füüsikaikoon Hawking armastab sõlmida kihlvedusid. Viimane kihlvedu, mis puudutab gravitatsioonilainete ja inflatsiooni olemasolu, on taas päevakorda tõusnud, sest eelmisel aastal alustas mõõtmisi Plancki satelliit

  20. Riik võib BRS-ile Eesti Raudtee hinnas järeleandmisi teha / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2006-01-01

    Majandus- ja kommunikatsiooniministri nõuniku Heido Vitsuri sõnul tuleks riigil rahumeelse lahenduse saavutamiseks BRS-iga taas läbirääkimiste laua taha istuda. Peaminister Andrus Ansipi, Keskerakonna seisukoht

  1. Nation may reinstate mandatory military service / Monika Hanley

    Index Scriptorium Estoniae

    Hanley, Monika

    2009-01-01

    Eelarve kärpimine on viinud Läti kaitsekulutused kriitilise piirini, mistõttu arutletakse võimaluse üle asendada täisprofessionaalne kaitsevägi taas kohustusliku ajateenistusega kokkuhoiu eesmärgil

  2. Võõraviha tõukab äärmuslasi keelama / Liisi Poll

    Index Scriptorium Estoniae

    Poll, Liisi, 1980-

    2007-01-01

    Saksa valitsusse kuuluv Sotsiaaldemokraatlik Partei arutab hiljuti Saksimaal toimunud hindude ja Lääne-Saksamaal toimunud aafriklaste ründamise taustal taas paremäärmusliku Saksamaa Natsionaaldemokraatliku Partei keelamist. Lisa: Põlualune NPD

  3. Development of bacterial cell-based system for intracellular ...

    African Journals Online (AJOL)

    Yomi

    2012-04-03

    ::gfp and fumC::gfp were constructed and ... and standardized method can alone provide an adequate measure, resulting from the .... forward primer of each promoter and downstream GFP primer (50. GGG TAA GCT TTC CGT ...

  4. Hans Lepp : ainult tänu kodueestlastele on Eesti olemas / Hans Lepp ; interv. Kalev Vilgats

    Index Scriptorium Estoniae

    Lepp, Hans, 1950-

    2007-01-01

    Rootsi instituudi praegune kultuurinõunik Hans Lepp töötas esimese kultuuriatasheena taas avatud Rootsi suursaatkonnas. Töötamisest Rootsi instituudis, riigi välispoliitikast, suhetest Venemaaga, aprillisündmustest jm

  5. Uudiseid maailmast / Nele-Eva Steinfeld

    Index Scriptorium Estoniae

    Steinfeld, Nele-Eva

    2013-01-01

    Lühisõnumeid muusikamaailmast: Van Cliburn. Wolfgang Sawallisch. Marie-Claire Alain. New Yorgi Metropolitan Opera uudiseid. Mihhail Pletnjov taas laval. Frankfurdi raadio sümfooniaorkestri uus peadirigent. Jāzeps Vītols 150.

  6. Põhja-Korea leppe hinnaks on energia / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Põhja-Korea andis lubaduse seisata 60 päeva jooksul oma olulisim tuumareaktor ja avada taas uksed rahvusvahelistele inspektoritele, kui saab vastutasuks rasket kütteõli. Lisa: Pyongyuang saab vastutasuks. Kaart: Põhja-Korea tuumarajatised

  7. Secret agent's death is under re-investigation / Rokas M. Tracevskis

    Index Scriptorium Estoniae

    Tracevskis, Rokas M.

    2010-01-01

    Leedus hakatakse taas uurima kahtlastel asjaoludel Valgevenes hukkunud julgeolekuteenistuse ohvitseri Vytautas Pociunase surma, mis võib olla seotud Ameerika Ühendriikide poolt Valgevene opositsioonile eraldatud toetussummade kadumise uurimisega. EL-i saadiku Leonidas Donskise arvamus

  8. Peaminister sekkus hariduspoliitikasse / Raivo Juurak

    Index Scriptorium Estoniae

    Juurak, Raivo, 1949-

    2001-01-01

    Peaminister Mart Laar külastas Eesti Noorte Huvikeskust TELO, mille tegevus lõpetatakse esialgsete plaanide järgi 20.06.2001. Peaminister palus aselinnapea Liisa Pakostal TELO loodusringid taas tööle panna

  9. Pre-Clinical Studies of Dendritic Cell-Tumor Cell Fusion Vaccines to Treat Breast Cancer

    National Research Council Canada - National Science Library

    Akporiaye, Emmanuel

    2002-01-01

    ...+ T-helper cells, CD8+ cytotoxic T lymphocytes (CTLs), NK and NKT cells (1,2). Because DC have the capacity to take up various types of molecules, the cells can be loaded with tumor-associated antigens (TAAs...

  10. Minister proposes re-introducing ETV commercials / Kairi Kurm

    Index Scriptorium Estoniae

    Kurm, Kairi

    2005-01-01

    Kultuuriminister Raivo Palmaru tegi ettepaneku hakata ETV-s taas reklaami näitama, millest saadud tuludega suurendada telekanali eelarvet. Kanal 2 ja TV3 juhtide arvates mõjutaks see meediaturu stabiilsust ning oleks ebaaus konkurents

  11. Vectors for Treatment of Metastatic Breast Cancer

    National Research Council Canada - National Science Library

    Deisseroth, Albert B

    2005-01-01

    The objective is to design, build and study vectors which would be able to break tolerance to breast cancer associated TAA and be used to suppress the recurrence of metastatic breast cancer following surgical resection...

  12. Vectors for Treatment of Metastatic Breast Cancer

    National Research Council Canada - National Science Library

    Deisseroth, Albert

    2004-01-01

    The objective is to design, build and study vectors which would be able to break tolerance to breast cancer associated TAA and be used to suppress the recurrence of metastatic breast cancer following surgical resection...

  13. Name them and remember : Commemorating communism's victims / Edward Lucas

    Index Scriptorium Estoniae

    Lucas, Edward

    2007-01-01

    Kommunismiohvrite mälestamisest. Autor viitab ka president Toomas Hendrik Ilvese ettepanekule rajada memoriaal Eesti kommunismiohvritele. T.H. Ilves kõneles sellest taas seoses 1944. a. septembris Eestit valitsenud Otto Tiefi valitsuse liikmete mälestamisega

  14. Parimad investorid peavad üles leidma homsed võitjad / Ivan Larsen

    Index Scriptorium Estoniae

    Larsen, Ivan

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti 17. okt. lk. 33. Maailma aktsiaturgudel toimuvad võnked on taas loomas uusi võimalusi investeerimiseks. Tabel: Viis suurimat investeeringut moodustavad üle viiendiku fondiportfellist

  15. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Hajime [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Pathogenetic Veterinary Science, United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Ogawa, Takashi; Wang, Liyun [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Pathogenetic Veterinary Science, United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Yoshida, Toshinori [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Shibutani, Makoto, E-mail: mshibuta@cc.tuat.ac.jp [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan)

    2014-11-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc{sup +} foci as well as nuclear and cytoplasmic p21{sup Cip1+} foci in Yy1{sup −} or GST-P{sup +} foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5{sup −} foci was increased in Yy1{sup −} foci in proportion to the TAA dose. Yy1{sup −}/GST-P{sup +} foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1{sup +}/GST-P{sup +} foci, while cleaved caspase-3{sup +} cells were unchanged between Yy1{sup –}/GST-P{sup +} and Yy1{sup +}/GST-P{sup +} foci. In the case of Wdr45b, most GST-P{sup +} foci were Wdr45b{sup –} and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted

  16. Ascorbic acid accumulates as a defense response to Turnip mosaic virus in resistant Brassica rapa cultivars.

    Science.gov (United States)

    Fujiwara, Ayaka; Togawa, Satoko; Hikawa, Takahiro; Matsuura, Hideyuki; Masuta, Chikara; Inukai, Tsuyoshi

    2016-07-01

    We initially observed that Brassica rapa cultivars containing the Turnip mosaic virus (TuMV) resistance gene, Rnt1-1, accumulated a high level of endogenous ascorbic acid (AS) and dehydroascobic acid (DHA) when infected with TuMV. We here hypothesized a possible contribution of an elevated level of AS+DHA (TAA) to the Rnt1-1-mediated resistance, and conducted a series of experiments using B. rapa and Arabidopsis plants. The application of l-galactose (the key substrate in AS synthesis) to a susceptible cultivar could increase the TAA level ~2-fold, and simultaneously lead to some degree of enhanced viral resistance. To confirm some positive correlation between TAA levels and viral resistance, we analyzed two Arabidopsis knockout mutants (ao and vtc1) in the AS pathways; the TAA levels were significantly increased and decreased in ao and vtc1 plants, respectively. While the ao plants showed enhanced resistance to TuMV, vtc1 plants were more susceptible than the control, supporting our hypothesis. When we analyzed the expression profiles of the genes involved in the AS pathways upon TuMV infection, we found that the observed TAA increase was mainly brought about by the reduction of AS oxidation and activation of AS recycling. We then investigated the secondary signals that regulate endogenous TAA levels in response to viral infection, and found that jasmonic acid (JA) might play an important role in TAA accumulation. In conclusion, we reason that the elevated TAA accumulation in B. rapa plants would be at least partly mediated by the JA-dependent signaling pathway and may significantly contribute to viral resistance. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Improved Langmuir−Blodgett titanate films via in situ exfoliation study and optimization of deposition parameters

    NARCIS (Netherlands)

    Yuan, H.; Lubbers, R.; Besselink, R.; Nijland, Maarten; ten Elshof, Johan E.

    2014-01-01

    The exfoliation and deposition of large (10–100 μm) Ti0.87O2 and small (0.1–1 μm) Ti0.91O2 nanosheets from lepidocrocite-type protonated titanates was investigated for getting high quality films. Exfoliation was carried out with different tetra-alkyl ammonium ions (TAA+) and varying TAA+/H+ ratios,

  18. Test-Retest Reliability and Concurrent Validity of a Single Tri-Axial Accelerometer-Based Gait Analysis in Older Adults with Normal Cognition

    Science.gov (United States)

    Byun, Seonjeong; Han, Ji Won; Kim, Tae Hui; Kim, Ki Woong

    2016-01-01

    Objective We investigated the concurrent validity and test-retest reliability of spatio-temporal gait parameters measured with a single tri-axial accelerometer (TAA), determined the optimal number of steps required for obtaining acceptable levels of reliability, and compared the validity and reliability of the estimated gait parameters across the three reference axes of the TAA. Methods A total of 82 cognitively normal elderly participants walked around a 40-m long round walkway twice wearing a TAA at their center of body mass. Gait parameters such as cadence, gait velocity, step time, step length, step time variability, and step time asymmetry were estimated from the low pass-filtered signal of the TAA. The test-retest reliability and concurrent validity with the GAITRite® system were evaluated for the estimated gait parameters. Results Gait parameters using signals from the vertical axis showed excellent reliability for all gait parameters; the intraclass correlation coefficient (ICC) was 0.79–0.90. A minimum of 26 steps and 14 steps were needed to achieve excellent reliability in step time variability and step time asymmetry, respectively. A strong level of agreement was seen for the basic gait parameters between the TAA and GAITRiteⓇ (ICC = 0.91–0.96). Conclusions The measurement of gait parameters of elderly individuals with normal cognition using a TAA placed on the body’s center of mass was reliable and showed superiority over the GAITRiteⓇ with regard to gait variability and asymmetry. The TAA system was a valid tool for measuring basic gait parameters. Considering its wearability and low price, the TAA system may be a promising alternative to the pressure sensor walkway system for measuring gait parameters. PMID:27427965

  19. Test-Retest Reliability and Concurrent Validity of a Single Tri-Axial Accelerometer-Based Gait Analysis in Older Adults with Normal Cognition.

    Directory of Open Access Journals (Sweden)

    Seonjeong Byun

    Full Text Available We investigated the concurrent validity and test-retest reliability of spatio-temporal gait parameters measured with a single tri-axial accelerometer (TAA, determined the optimal number of steps required for obtaining acceptable levels of reliability, and compared the validity and reliability of the estimated gait parameters across the three reference axes of the TAA.A total of 82 cognitively normal elderly participants walked around a 40-m long round walkway twice wearing a TAA at their center of body mass. Gait parameters such as cadence, gait velocity, step time, step length, step time variability, and step time asymmetry were estimated from the low pass-filtered signal of the TAA. The test-retest reliability and concurrent validity with the GAITRite® system were evaluated for the estimated gait parameters.Gait parameters using signals from the vertical axis showed excellent reliability for all gait parameters; the intraclass correlation coefficient (ICC was 0.79-0.90. A minimum of 26 steps and 14 steps were needed to achieve excellent reliability in step time variability and step time asymmetry, respectively. A strong level of agreement was seen for the basic gait parameters between the TAA and GAITRiteⓇ (ICC = 0.91-0.96.The measurement of gait parameters of elderly individuals with normal cognition using a TAA placed on the body's center of mass was reliable and showed superiority over the GAITRiteⓇ with regard to gait variability and asymmetry. The TAA system was a valid tool for measuring basic gait parameters. Considering its wearability and low price, the TAA system may be a promising alternative to the pressure sensor walkway system for measuring gait parameters.

  20. Test-Retest Reliability and Concurrent Validity of a Single Tri-Axial Accelerometer-Based Gait Analysis in Older Adults with Normal Cognition.

    Science.gov (United States)

    Byun, Seonjeong; Han, Ji Won; Kim, Tae Hui; Kim, Ki Woong

    2016-01-01

    We investigated the concurrent validity and test-retest reliability of spatio-temporal gait parameters measured with a single tri-axial accelerometer (TAA), determined the optimal number of steps required for obtaining acceptable levels of reliability, and compared the validity and reliability of the estimated gait parameters across the three reference axes of the TAA. A total of 82 cognitively normal elderly participants walked around a 40-m long round walkway twice wearing a TAA at their center of body mass. Gait parameters such as cadence, gait velocity, step time, step length, step time variability, and step time asymmetry were estimated from the low pass-filtered signal of the TAA. The test-retest reliability and concurrent validity with the GAITRite® system were evaluated for the estimated gait parameters. Gait parameters using signals from the vertical axis showed excellent reliability for all gait parameters; the intraclass correlation coefficient (ICC) was 0.79-0.90. A minimum of 26 steps and 14 steps were needed to achieve excellent reliability in step time variability and step time asymmetry, respectively. A strong level of agreement was seen for the basic gait parameters between the TAA and GAITRiteⓇ (ICC = 0.91-0.96). The measurement of gait parameters of elderly individuals with normal cognition using a TAA placed on the body's center of mass was reliable and showed superiority over the GAITRiteⓇ with regard to gait variability and asymmetry. The TAA system was a valid tool for measuring basic gait parameters. Considering its wearability and low price, the TAA system may be a promising alternative to the pressure sensor walkway system for measuring gait parameters.

  1. GARLIC AMELIORATES THE HEPATOTOXIC EFFECT INDUCED BY THIOACETAMIDE IN FEMALE RATS

    International Nuclear Information System (INIS)

    OSMAN, H.F.; TAHA, M.S.

    2008-01-01

    The purpose of this study was to investigate the pretreatment effect of garlic on hepatotoxicity and oxidative stress induced by thioacetamide (TAA) in female albino rats.Sixty female adult albino rats were assigned equally into four groups; control group: animals without treatment, group ?: rats given daily oral dose of 250 mg/ kg garlic for 28 days, group ??: rats injected intraperitonealy by thioacetamide 20 mg ? kg for two weeks and group III: rats given 250 mg / kg garlic orally for 28 day followed by intrapertoneal injection of 20 mg / kg thioacetamide for two weeks. Liver enzymes were evaluated by measurements of AST, ALT and alkaline phosphatase and also trace elements (Cu and Zn) were estimated. Superoxide dismutase, glutathione peroxidase, malondialdehyde and thyroid hormones (T3 and T4) were assessed. Also, histological studies on liver and stomach were carried out. The results indicated that treatment with garlic significantly decreased liver enzymes (AST, ALT and ALP). Cu showed high significant increase in groups treated with garlic and also garlic + TAA, while Zn was increased significantly in TAA group. Superoxide dismutase (SOD) was increased significantly in group I while TAA decreased it significantly. Glutathione peroxidase was decreased significantly in group II while its level in group IV reached near the control value. Similarly, malondialdehyde was decreased significantly in garlic group and garlic ameliorated the thioacetamide effect in garlic + TAA group. The treatment with TAA led to significant increase in T3 and significant decrease in T4 hormones. Garlic ameliorated T3 level to reach the control level. Histologically, pre-treatment with garlic induced a prophylactic activity against the thioacetamide in liver and stomach tissues.According to the obtained results, it could be conclude that garlic treatment may act as antioxidant or pro-oxidant in TAA treated animals besides decreasing the TAA toxic effects on liver enzymes, liver and

  2. Tumor-associated antigens identified by mRNA expression profiling induce protective anti-tumor immunity

    DEFF Research Database (Denmark)

    Mathiassen, S; Lauemøller, S L; Ruhwald, M

    2001-01-01

    to identify TAA, mice were immunized with mixtures of peptides representing putative cytotoxic T cell epitopes derived from one of the gene products. Indeed, such immunized mice were partially protected against subsequent tumor challenge. Despite being immunized with bona fide self antigens, no clinical signs...... imprints, which may be used to identify patient-specific arrays of TAA. This may enable a multi-epitope based immunotherapy with improved prospects of clinical tumor rejection....

  3. Poika on suruissansa (2/4 F)

    OpenAIRE

    2011-01-01

    Laulun sanat: Poika on suruissansa, kun on jäänyt kullastansa; kiertää piirin ympäri ja ottaa uuden taas, kiertää piirin ympäri ja ottaa uuden taas! Hih-hei, ja pili-pam-pam-pam, pili-pam-pam-pam, pili-pam-pam-pam! Hih-hei, ja pili-pam-pam-pam! Kiertää piirin ympäri ja

  4. Simultaneous determination of triamcinolone acetonide and oxymetazoline hydrochloride in nasal spray formulations by HPLC.

    Science.gov (United States)

    Sudsakorn, Sirimas; Kaplan, Leonard; Williams, David A

    2006-03-18

    A high-performance liquid chromatography (HPLC) method with UV detection at 232 nm was developed and validated for the simultaneous determination of triamcinolone acetonide (TAA) and oxymetazoline hydrochloride (OXY) in nasal spray formulations. The chromatographic system consisted of a micro Bondapak CN column (150 mm x 3.9 mm), 5 microm particle size with a mobile phase composition of acetonitrile:ammonium acetate (pH 5.0, 20mM) (10:90, v/v) at a flow rate of 1.0 mL/min. Calibration curves were linear for both TAA and OXY in the concentration range of 2.5-25.0 microg/mL. The limit of detection and quantitation were 0.29 and 0.88 microg/mL for OXY and 0.24 and 0.73 microg/mL for TAA. The described method was further applied to the analysis and stability studies of two nasal spray formulations I and II prepared from TAA and OXY commercial nasal spray products. The stability of OXY and TAA in the commercial products and the nasal formulations I and II were analyzed after 30 days at room temperature and 30 days at 40 degrees C/60% relative humidity. The results of the stability study showed that OXY and TAA in the commercial nasal spray products and the nasal formulations I and II were stable at 20-25 degrees C (room temperature) but TAA was unstable at 40 degrees C/60% relative humidity. TAA exhibited more than 10% loss at 14 days in both the nasal formulations and in the commercial products. OXY showed increased degradation at 40 degrees C/60% relative humidity but <10%.

  5. Identification of Human Factors Concerns in Joint Strike Fighter and Training Recommendations

    Science.gov (United States)

    2008-09-01

    a framework to consider the relations in the cockpit because, as he notes, the tendency with modern cockpit design is to prioritize the automated...be considered from the conceptual design phases to the end of the life cycle of the products. But it is not planned and implemented by the users...study is based on 11 accidents, all of which had issues related to “Technologically Advanced Aircraft” (TAA). Their definition of TAA is: a. IFR

  6. Community Participation Tourism Management Model of Tapee Plain Community

    OpenAIRE

    W. Srisuwan; S. Chantachan; P. Thidpad

    2011-01-01

    Problem statement: Cultural tourism plays an important role in the economy system of Thailand. This study, therefore, aims to investigate the following: (1) The tourism conditions in the community of Taa-Pee River Basin and also; (2) The possible guideline of organizing the cultural tourism, by all means, seeking active cooperation among the Taa-Pee River Basin community people who subsist or have been subject to the river basin and the surrounding conditions. Approach: Th...

  7. Naphthalene bisimides asymmetrically and symmetrically N-substituted with triarylamine--comparison of spectroscopic, electrochemical, electronic and self-assembly properties.

    Science.gov (United States)

    Rybakiewicz, Renata; Zapala, Joanna; Djurado, David; Nowakowski, Robert; Toman, Petr; Pfleger, Jiri; Verilhac, Jean-Marie; Zagorska, Malgorzata; Pron, Adam

    2013-02-07

    Two semiconducting naphthalene bisimides were comparatively studied: NBI-(TAA)(2), symmetrically N-substituted with triaryl amine and asymmetric NBI-TAA-Oc with triaryl amine and octyl N-substituents. Both compounds show very similar spectroscopic and redox properties but differ in their supramolecular organization. As evidenced by STM, in monolayers on HOPG they form ordered 2D structures, however of different packing patterns. NBI-(TAA)(2) does not form ordered 3D structures, yielding amorphous thin films whereas films of NBI-TAA-Oc are highly crystalline. DFT calculations predict the ionization potential (IP) of 5.22 eV and 5.18 eV for NBI-TAA-Oc and NBI-(TAA)(2), respectively, as well as the electron affinity values (EA) of -3.25 eV and -3.22 eV. These results are consistent with the cyclic voltammetry data which yield similar values of IP (5.20 eV and 5.19 eV) and somehow different values of EA (-3.80 eV and -3.83 eV). As judged from these data, both semiconductors should exhibit ambipolar behavior. Indeed, NBI-TAA-Oc is ambipolar, showing hole and electron mobilities of 4.5 × 10(-5) cm(2)/(V s) and of 2.6 × 10(-4) cm(2)/(V s), respectively, in the field effect transistor configuration. NBI-(TAA)(2) is not ambipolar and yields field effect only in the p-channel configuration. This different behavior is rationalized on the basis of structural factors.

  8. Preliminary Computational Hemodynamics Study of Double Aortic Aneurysms under Multistage Surgical Procedures: An Idealised Model Study

    Directory of Open Access Journals (Sweden)

    Yosuke Otsuki

    2013-01-01

    Full Text Available Double aortic aneurysm (DAA falls under the category of multiple aortic aneurysms. Repair is generally done through staged surgery due to low invasiveness. In this approach, one aneurysm is cured per operation. Therefore, two operations are required for DAA. However, post-first-surgery rupture cases have been reported. Although the problems involved with managing staged surgery have been discussed for more than 30 years, investigation from a hemodynamic perspective has not been attempted. Hence, this is the first computational fluid dynamics approach to the DAA problem. Three idealized geometries were prepared: presurgery, thoracic aortic aneurysm (TAA cured, and abdominal aortic aneurysm (AAA cured. By applying identical boundary conditions for flow rate and pressure, the Navier-Stokes equation and continuity equations were solved under the Newtonian fluid assumption. Average pressure in TAA was increased by AAA repair. On the other hand, average pressure in AAA was decreased after TAA repair. Average wall shear stress was decreased at the peak in post-first-surgery models. However, the wave profile of TAA average wall shear stress was changed in the late systole phase after AAA repair. Since the average wall shear stress in the post-first-surgery models decreased and pressure at TAA after AAA repair increased, the TAA might be treated first to prevent rupture.

  9. Abnormal secretion or extracellular matrix incorporation of fibrillin by dermal fibroblasts from patients with thoracic aortic aneurysms

    Energy Technology Data Exchange (ETDEWEB)

    Milewicz, D.; Cao, S.; Cosselli, J. [Univ. of Texas Medical School, Houston, TX (United States)

    1994-09-01

    Abnormal synthesis, secretion, and extracellular matrix incorporation of fibrillin is observed in the majority of fibroblast cell strains obtained from individuals with the Marfan syndrome (>85%). These fibrillin protein abnormalities are due to mutations in the FBN1 gene. We have screened fibroblast cell strains from patients with thoracic aortic aneurysms (TAA) without skeletal or ocular features of the Marfan syndrome for defects in fibrillin synthesis or processing. Dermal fibroblasts obtained from biopsies were pulse labeled with [{sup 35}S]cysteine for 30 minutes and then chased for 0, 4, and 20 hours. The media, cell lysate and extracellular matrix were harvested separately, then analyzed by SDS-PAGE. We selected fibroblasts from 17 TAA patients to study based on the development of a TAA at a young age or a family history of TAAs. Cells from 3 patients synthesized and secreted fibrillin normally, but did not incorporate the fibrillin in the extracellular matrix. None of the cell strains were found to have diminished synthesis of fibrillin when compared with control cells. We were unable to detect abnormalities in the synthesis, secretion, or matrix incorporation of fibrillin by cells from 9 of the 17 patients. These results indicate that fibrillin protein defects are found in a significant number of patients with TAAs who are young or have a family history of TAAs. Analysis of the FBN1 gene for mutations in these patients with fibrillin protein defects will determine if the observed protein abnormalities are the result of FBN1 gene mutations.

  10. Endovascular Treatment of Late Thoracic Aortic Aneurysms after Surgical Repair of Congenital Aortic Coarctation in Childhood

    Science.gov (United States)

    Juszkat, Robert; Perek, Bartlomiej; Zabicki, Bartosz; Trojnarska, Olga; Jemielity, Marek; Staniszewski, Ryszard; Smoczyk, Wiesław; Pukacki, Fryderyk

    2013-01-01

    Background In some patients, local surgery-related complications are diagnosed many years after surgery for aortic coarctation. The purposes of this study were: (1) to systematically evaluate asymptomatic adults after Dacron patch repair in childhood, (2) to estimate the formation rate of secondary thoracic aortic aneurysms (TAAs) and (3) to assess outcomes after intravascular treatment for TAAs. Methods This study involved 37 asymptomatic patients (26 female and 11 male) who underwent surgical repair of aortic coarctation in the childhood. After they had reached adolescence, patients with secondary TAAs were referred to endovascular repair. Results Follow-up studies revealed TAA in seven cases (19%) (including six with the gothic type of the aortic arch) and mild recoarctation in other six (16%). Six of the TAA patients were treated with stentgrafts, but one refused to undergo an endovascular procedure. In three cases, stengrafts covered the left subclavian artery (LSA), in another the graft was implanted distally to the LSA. In two individuals, elective hybrid procedures were performed with surgical bypass to the supraaortic arteries followed by stengraft implantation. All subjects survived the secondary procedures. One patient developed type Ia endoleak after stentgraft implantation that was eventually treated with a debranching procedure. Conclusions The long-term course of clinically asymptomatic patients after coarctation patch repair is not uncommonly complicated by formation of TAAs (particularly in individuals with the gothic pattern of the aortic arch) that can be treated effectively with stentgrafts. However, in some patients hybrid procedures may be necessary. PMID:24386233

  11. Structural and thermal properties of carboxylic acid functionalized polythiophenes

    Directory of Open Access Journals (Sweden)

    Ariane de França Mescoloto

    2014-01-01

    Full Text Available Polythiophenes functionalized with polar groups at the end of side-chain have emerged as an alternative method to obtain good compatibility between this class of conjugated polymers and electron acceptor compounds. The aim is to prevent phase segregation and to improve the efficiency of the polythiophene technological devices. However, homopolymers synthesized from thiophene rings with high polar groups at the end of the side-chain, such as hydroxyl and carboxylic acid groups, are poorly soluble in common volatile organic solvents. We report on a systematic preparation of copolymers of 3-hexylthiophene (HT and thiophene-3-acetic acid (TAA, using different feed ratios. The chemical structures of the copolymers were confirmed by FTIR and ¹H-NMR. The TAA content in these copolymers were 33, 38 and 54 mol %. HPSEC results did not show any remarkable correlation with TAA contents in the copolymers. In contrast, the thermal analyses showed a decrease in the thermal stability and an increase in rigidity of their backbones, for the copolymers with high amounts of TAA. The solubility and optical property of copolymers were also related to the TAA contents. Thus, the properties of these copolymers can be modulated by a simple control of feed ratio of TAA in the copolymerization.

  12. Amino Acid Profiles in Term and Preterm Human Milk through Lactation: A Systematic Review

    Science.gov (United States)

    Zhang, Zhiying; Adelman, Alicia S.; Rai, Deshanie; Boettcher, Julia; Lőnnerdal, Bo

    2013-01-01

    Amino acid profile is a key aspect of human milk (HM) protein quality. We report a systematic review of total amino acid (TAA) and free amino acid (FAA) profiles, in term and preterm HM derived from 13 and 19 countries, respectively. Of the 83 studies that were critically reviewed, 26 studies with 3774 subjects were summarized for TAA profiles, while 22 studies with 4747 subjects were reviewed for FAA. Effects of gestational age, lactation stage, and geographical region were analyzed by Analysis of Variance. Data on total nitrogen (TN) and TAA composition revealed general inter-study consistency, whereas FAA concentrations varied among studies. TN and all TAA declined in the first two months of lactation and then remained relatively unchanged. In contrast, the FAA glutamic acid and glutamine increased, peaked around three to six months, and then declined. Some significant differences were observed for TAA and FAA, based on gestational age and region. Most regional TAA and FAA data were derived from Asia and Europe, while information from Africa was scant. This systematic review represents a useful evaluation of the amino acid composition of human milk, which is valuable for the assessment of protein quality of breast milk substitutes. PMID:24288022

  13. Characterization of CD8+ T-Cell Responses in the Peripheral Blood and Skin Injection Sites of Melanoma Patients Treated with mRNA Electroporated Autologous Dendritic Cells (TriMixDC-MEL

    Directory of Open Access Journals (Sweden)

    Daphné Benteyn

    2013-01-01

    Full Text Available Treatment of melanoma patients with mRNA electroporated dendritic cells (TriMixDC-MEL stimulates T-cell responses against the presented tumor-associated antigens (TAAs. In the current clinical trials, melanoma patients with systemic metastases are treated, requiring priming and/or expansion of preexisting TAA-specific T cells that are able to migrate to both the skin and internal organs. We monitored the presence of TAA-specific CD8+ T cells infiltrating the skin at sites of intradermal TriMixDC-MEL injection (SKILs and within the circulation of melanoma patients treated in two clinical trials. In 10 out of fourteen (71% patients screened, CD8+ T cells recognizing any of the four TAA presented by TriMixDC-MEL cellular vaccine were found in both compartments. In total, 30 TAA-specific T-cell responses were detected among the SKILs and 29 among peripheral blood T cells, of which 24 in common. A detailed characterization of the antigen specificity of CD8+ T-cell populations in four patients indicates that the majority of the epitopes detected were only recognized by CD8+ T cells derived from either skin biopsies or peripheral blood, indicating that some compartmentalization occurs after TriMix-DC therapy. To conclude, functional TAA-specific CD8+ T cells distribute both to the skin and peripheral blood of patients after TriMixDC-MEL therapy.

  14. Indirect and direct effects of salinity on the quantity and quality of total amino acids in Ulva ohnoi (Chlorophyta).

    Science.gov (United States)

    Angell, Alex R; Mata, Leonardo; de Nys, Rocky; Paul, Nicholas A

    2015-06-01

    Salinity can affect the quantity and quality of total amino acids (TAAs) in seaweeds indirectly by altering growth rates and thereby diluting or concentrating the amino acid content of the biomass, or directly by altering the synthesis of specific amino acids and osmolytes. This study attempted to partition the indirect and direct effects of salinity on the quantity and quality of TAAs in the green seaweed Ulva ohnoi by culturing it under a range of salinities without nutrient limitation. Both the quantity and quality of TAAs varied across the salinity treatments. Quantity was most strongly related to the growth rate of the seaweed and was highest in the slowest growing seaweed. In contrast, the quality of TAAs (individual amino acids as a proportion of total content) was most strongly related to salinity for all amino acids, although this varied substantially among individual amino acids. Increases in salinity were positively correlated with the proportion of proline (46% increase), tyrosine (36% increase), and histidine (26% increase), whereas there was a negative correlation with alanine (29% decrease). The proportion of methionine, with strong links to the synthesis of the osmolyte dimethylsulfoniopropionate, did not correlate linearly with salinity and instead was moderately higher at the optimal salinities for growth. These results show that salinity simultaneously affects the quantity and quality of TAAs in seaweed through both indirect and direct mechanisms, with growth rates playing the overarching role in determining the quantity of TAAs. © 2015 Phycological Society of America.

  15. Evaluation of Postprandial Total Antioxidant Activity in Normal and Overweight Individuals

    Directory of Open Access Journals (Sweden)

    Fatma Arslan

    2016-09-01

    Full Text Available Aim: Postprandial changes acutely alter some mechanisms in body. There are many studies showing blood oxidative status changes after food intake, and supplementation. The aim of the present study was to evaluate the effects of a standardized meal on serum total antioxidant activity (TAA in normal weight and overweight individuals. Material and Method: Fourteen normal weight and twelve overweight individuals were given a standardized meal in the morning after an overnight fast. Serum TAA, glucose, total cholesterol, HDL cholesterol, LDL cholesterol, and triglyceride concentrations were measured at baseline, 3rd hour, and 6th hour after the meal in both groups.Results: In both normal and overweight groups, the difference between baseline and 3rd hour was significant for TAA. The TAA of the overweight group was also significantly lower than the TAA of the normal weight group at 3rd hour. However, there was no significant correlation between lipid parameters and TAA levels. Discussion: The present study shows that postprandial oxidative damage occurs more prominently in overweight individuals than in normal weight individuals. Postprandial changes acutely induce oxidative stress and impair the natural antioxidant defense mechanism. It should be noted that consuming foods with antioxidants in order to avoid various diseases and complications is useful, particularly in obese subjects.

  16. Endovascular treatment of late thoracic aortic aneurysms after surgical repair of congenital aortic coarctation in childhood.

    Directory of Open Access Journals (Sweden)

    Robert Juszkat

    Full Text Available BACKGROUND: In some patients, local surgery-related complications are diagnosed many years after surgery for aortic coarctation. The purposes of this study were: (1 to systematically evaluate asymptomatic adults after Dacron patch repair in childhood, (2 to estimate the formation rate of secondary thoracic aortic aneurysms (TAAs and (3 to assess outcomes after intravascular treatment for TAAs. METHODS: This study involved 37 asymptomatic patients (26 female and 11 male who underwent surgical repair of aortic coarctation in the childhood. After they had reached adolescence, patients with secondary TAAs were referred to endovascular repair. RESULTS: Follow-up studies revealed TAA in seven cases (19% (including six with the gothic type of the aortic arch and mild recoarctation in other six (16%. Six of the TAA patients were treated with stentgrafts, but one refused to undergo an endovascular procedure. In three cases, stengrafts covered the left subclavian artery (LSA, in another the graft was implanted distally to the LSA. In two individuals, elective hybrid procedures were performed with surgical bypass to the supraaortic arteries followed by stengraft implantation. All subjects survived the secondary procedures. One patient developed type Ia endoleak after stentgraft implantation that was eventually treated with a debranching procedure. CONCLUSIONS: The long-term course of clinically asymptomatic patients after coarctation patch repair is not uncommonly complicated by formation of TAAs (particularly in individuals with the gothic pattern of the aortic arch that can be treated effectively with stentgrafts. However, in some patients hybrid procedures may be necessary.

  17. Ipomoea aquatica Extract Shows Protective Action Against Thioacetamide-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    A. Hamid A. Hadi

    2012-05-01

    Full Text Available In the Indian system of traditional medicine (Ayurveda it is recommended to consume Ipomoea aquatica to mitigate disorders like jaundice. In this study, the protective effects of ethanol extract of I. aquatica against liver damage were evaluated in thioacetamide (TAA-induced chronic hepatotoxicity in rats. There was no sign of toxicity in the acute toxicity study, in which Sprague-Dawley (SD rats were orally fed with I. aquatica (250 and 500 mg/kg for two months along with administration of TAA (i.p injection 200 mg/kg three times a week for two months. The results showed that the treatment of I. aquatica significantly lowered the TAA-induced serum levels of hepatic enzyme markers (ALP, ALT, AST, protein, albumin, bilirubin and prothrombin time. The hepatic content of activities and expressions SOD and CAT that were reduced by TAA were brought back to control levels by the plant extract supplement. Meanwhile, the rise in MDA level in the TAA receiving groups also were significantly reduced by I. aquatica treatment. Histopathology of hepatic tissues by H&E and Masson trichrome stains displayed that I. aquatica has reduced the incidence of liver lesions, including hepatic cells cloudy swelling, infiltration, hepatic necrosis, and fibrous connective tissue proliferation induced by TAA in rats. Therefore, the results of this study show that the protective effect of I. aquatica in TAA-induced liver damage might be contributed to its modulation on detoxification enzymes and its antioxidant and free radical scavenger effects. Moreover, it confirms a scientific basis for the traditional use of I. aquatica for the treatment of liver disorders.

  18. Attenuating Effect of Ginkgo biloba Leaves Extract on Liver Fibrosis Induced by Thioacetamide in Mice

    Science.gov (United States)

    Al-Attar, Atef M.

    2012-01-01

    The purpose of this study is to investigate the effect of Ginkgo biloba leaves extract on experimental liver fibrosis induced by thioacetamide (TAA) in male albino mice. The experimental mice were divided into four groups. The mice of the first group were served as control. The experimental animals of the second group were given 150 mg/kg body weight of TAA by intraperitoneal injection, twice weekly, for 9 weeks. The mice of the third group were exposed to TAA and supplemented with G. biloba leaves extract. The animals of the fourth group were supplemented with G. biloba leaves extract. The levels of plasma alanine aminotransferase, aspartate aminotransferase, gamma-glutamyl transferase, alkaline phosphatase, triglycerides, cholesterol, and low-density lipoprotein cholesterol were statistically increased while the levels of plasma total protein, albumin, glucose, and high-density lipoprotein cholesterol were significantly decreased. The levels of liver superoxide dismutase, glutathione, glycogen and total protein were notably declined, whereas the level of total lipid was increased in mice of the second group. Furthermore, microscopic examination of liver sections from mice treated with TAA showed an abnormal morphology characterized by nodular transformations in liver parenchyma which surrounded by fibrous septa. Administration of G. biloba leaves extract reduced extent and development of fibrous septa, liver cells change, and biochemical alterations in mice exposed to TAA. This study showed that G. biloba leaves extract has a potential activity against TAA-induced liver fibrosis and suggested that the chemical constituents of G. biloba are effective in modulation of oxidative stress induced by TAA. PMID:23091357

  19. Search for genetic factors in bicuspid aortic valve disease: ACTA2 mutations do not play a major role.

    Science.gov (United States)

    Tortora, Giada; Wischmeijer, Anita; Berretta, Paolo; Alfonsi, Jacopo; Di Marco, Luca; Barbieri, Andrea; Marconi, Caterina; Isidori, Federica; Rossi, Cesare; Leone, Ornella; Di Bartolomeo, Roberto; Seri, Marco; Pacini, Davide

    2017-11-01

    Mutations in ACTA2 have been reported as a cause of familiar thoracic aortic aneurysm (TAA) with associated bicuspid aortic valve (BAV) in some individuals. Our aim is to investigate the role of ACTA2 mutations in BAV associated with TAA in 20 patients. We recruited 20 patients who underwent surgery for BAV and TAA; clinical genetic evaluation and ACTA2 mutation analysis were performed on each patient, along with next-generation sequencing analysis of BAV-related genes. Available first-degree relatives were enrolled and evaluated with echocardiography and clinical genetic examination. No mutations were found in ACTA2 or in BAV-related genes in our probands nor any common clinical signs possibly related to their heart disease. One-third of probands did not have any cardiovascular risk factor. Surgery was required at a young age (mean age 47.2 years) and at relatively small ascending aortic diameters (mean size 49.7 mm). In 77 first-degree relatives, 1 new diagnosis of TAA requiring surgery was made and 8 previous BAV/TAA diagnoses (9/77 = 11.7%) were confirmed. The phenotype BAV ± TAA segregated in 25% of our families. Although based on a small cohort, our results seemed to justify the conclusion that ACTA2 did not play a significant role in the pathogenesis of BAV aortopathy. The underlying genetic factors of this condition remain elusive and both large association studies and exome or genome sequencing could represent promising tools to unravel its pathogenesis. Aortic resection of TAA at elective surgery in these patients should be recommended as well as echocardiography in their first-degree relatives. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

  20. Celecoxib ameliorates portal hypertension of the cirrhotic rats through the dual inhibitory effects on the intrahepatic fibrosis and angiogenesis.

    Directory of Open Access Journals (Sweden)

    Jin-Hang Gao

    Full Text Available BACKGROUND: Increased intra-hepatic resistance to portal blood flow is the primary factor leading to portal hypertension in cirrhosis. Up-regulated expression of cyclooxygenase-2 (COX-2 in the cirrhotic liver might be a potential target to ameliorate portal hypertension. OBJECTIVE: To verify the effect of celecoxib, a selective inhibitor of COX-2, on portal hypertension and the mechanisms behind it. METHODS: Cirrhotic liver model of rat was established by peritoneal injection of thiacetamide (TAA. 36 rats were randomly assigned to control, TAA and TAA+celecoxib groups. Portal pressures were measured by introduction of catheters into portal vein. Hepatic fibrosis was assessed by the visible hepatic fibrotic areas and mRNAs for collagen III and α-SMA. The neovasculature was determined by hepatic vascular areas, vascular casts and CD31 expression. Expressions of COX-2, vascular endothelial growth factor (VEGF, VEGF receptor-2 (VEGFR-2 and related signal molecules were quantitated. RESULTS: Compared with TAA group, the portal pressure in TAA+celecoxib group was significantly decreased by 17.8%, p<0.01. Celecoxib treatment greatly reduced the tortuous hepatic portal venules. The data of fibrotic areas, CD31expression, mRNA levels of α-SMA and collagen III in TAA+celecoxib group were much lower than those in TAA group, p<0.01. Furthermore, the up-regulation of hepatic mRNA and protein levels of VEGF, VEGFR-2 and COX-2 induced by TAA was significantly inhibited after celecoxib treatment. The expressions of prostaglandin E2 (PGE2, phosphorylated extracellular signal-regulated kinase (p-ERK, hypoxia-inducible factor-1α (HIF-1α, and c-fos were also down-regulated after celecoxib treatment. CONCLUSIONS: Long term administration of celecoxib can efficiently ameliorate portal hypertension in TAA rat model by its dual inhibitory effects on the intrahepatic fibrosis and angiogenesis. The anti-angiogenesis effect afforded by celecoxib may attribute to its

  1. The Critical Role of Thioacetamide Concentration in the Formation of ZnO/ZnS Heterostructures by Sol-Gel Process

    Directory of Open Access Journals (Sweden)

    Eloísa Berbel Manaia

    2018-01-01

    Full Text Available ZnO/ZnS heterostructures have emerged as an attractive approach for tailoring the properties of particles comprising these semiconductors. They can be synthesized using low temperature sol-gel routes. The present work yields insight into the mechanisms involved in the formation of ZnO/ZnS nanostructures. ZnO colloidal suspensions, prepared by hydrolysis and condensation of a Zn acetate precursor solution, were allowed to react with an ethanolic thioacetamide solution (TAA as sulfur source. The reactions were monitored in situ by Small Angle X-ray Scattering (SAXS and UV-vis spectroscopy, and the final colloidal suspensions were characterized by High Resolution Transmission Electron Microscopy (HRTEM. The powders extracted at the end of the reactions were analyzed by X-ray Absorption spectroscopy (XAS and X-ray diffraction (XRD. Depending on TAA concentration, different nanostructures were revealed. ZnO and ZnS phases were mainly obtained at low and high TAA concentrations, respectively. At intermediate TAA concentrations, we evidenced the formation of ZnO/ZnS heterostructures. ZnS formation could take place via direct crystal growth involving Zn ions remaining in solution and S ions provided by TAA and/or chemical conversion of ZnO to ZnS. The combination of all the characterization techniques was crucial to elucidate the reaction steps and the nature of the final products.

  2. Classification of 27 Tumor-Associated Antigens by Histochemical Analysis of 36 Freshly Resected Lung Cancer Tissues

    Directory of Open Access Journals (Sweden)

    Gene Kurosawa

    2016-11-01

    Full Text Available In previous studies, we identified 29 tumor-associated antigens (TAAs and isolated 488 human monoclonal antibodies (mAbs that specifically bind to one of the 29 TAAs. In the present study, we performed histochemical analysis of 36 freshly resected lung cancer tissues by using 60 mAbs against 27 TAAs. Comparison of the staining patterns of tumor cells, bronchial epithelial cells, and normal pulmonary alveolus cells and interalveolar septum allowed us to determine the type and location of cells that express target molecules, as well as the degree of expression. The patterns were classified into 7 categories. While multiple Abs were used against certain TAAs, the differences observed among them should be derived from differences in the binding activity and/or the epitope. Thus, such data indicate the versatility of respective clones as anti-cancer drugs. Although the information obtained was limited to the lung and bronchial tube, bronchial epithelial cells represent normal growing cells, and therefore, the data are informative. The results indicate that 9 of the 27 TAAs are suitable targets for therapeutic Abs. These 9 Ags include EGFR, HER2, TfR, and integrin α6β4. Based on our findings, a pharmaceutical company has started to develop anti-cancer drugs by using Abs to TfR and integrin α6β4. HGFR, PTP-LAR, CD147, CDCP1, and integrin αvβ3 are also appropriate targets for therapeutic purposes.

  3. A study on the Regenerative Effect of Platelets Rich Plasma on Experimentally Induced Hepatic Damage In Albino Rats.

    Science.gov (United States)

    Shoeib, Heba Mamdoh; Keshk, Walaa Arafa; Foda, Abdallah Mahmoud; Abo El Noeman, Saad El-Deen Abd Elfatah

    2018-02-14

    Hepatic fibrosis is a worldwide health problem with significant morbidity and mortality. Currently, there is no effective therapy for hepatic fibrosis. So that the present study was aimed to evaluate the possible regenerative effect of Platelet-rich plasma (PRP) against thioacetamide (TAA) induced hepatic damage. Eighty albino rats were included; 40 were used for PRP preparation and 40 were randomly divided into four groups. Group I (control group); group II (PRP control); group III (TAA- intoxicated in a dose of 200 mg ∕ kg body weight/twice weekly for 7 weeks, intra-peritoneal and group IV (TAA-intoxicated+ PRP treated). Macrophage inflammatory protein-1α (MIP-1α) and cyclic adenosine monophosphate (cAMP) were immunoassayed in addition to peroxinitrite level, NADPH-quinine oxido-reductase-1 (NQO1) enzyme activity and liver function. PRP treatment showed significant improvement in hepatic function, decreased MIP-1α and peroxinitrite level. Meanwhile, significant increase in NQO1 enzyme activity and cAMP level were observed. The histopathological results confirmed the laboratory results with improvement of hepatic architecture except for some inflammatory cellular infiltrates. PRP has the ability to protect against TAA-induced liver damage possibly by improving redox status, liver histopathological architecture, disruption of the inflammatory and fibrotic response induced by TAA.

  4. The Critical Role of Thioacetamide Concentration in the Formation of ZnO/ZnS Heterostructures by Sol-Gel Process.

    Science.gov (United States)

    Berbel Manaia, Eloísa; Kiatkoski Kaminski, Renata Cristina; Caetano, Bruno Leonardo; Magnani, Marina; Meneau, Florian; Rochet, Amélie; Santilli, Celso Valentim; Briois, Valérie; Bourgaux, Claudie; Chiavacci, Leila Aparecida

    2018-01-23

    ZnO/ZnS heterostructures have emerged as an attractive approach for tailoring the properties of particles comprising these semiconductors. They can be synthesized using low temperature sol-gel routes. The present work yields insight into the mechanisms involved in the formation of ZnO/ZnS nanostructures. ZnO colloidal suspensions, prepared by hydrolysis and condensation of a Zn acetate precursor solution, were allowed to react with an ethanolic thioacetamide solution (TAA) as sulfur source. The reactions were monitored in situ by Small Angle X-ray Scattering (SAXS) and UV-vis spectroscopy, and the final colloidal suspensions were characterized by High Resolution Transmission Electron Microscopy (HRTEM). The powders extracted at the end of the reactions were analyzed by X-ray Absorption spectroscopy (XAS) and X-ray diffraction (XRD). Depending on TAA concentration, different nanostructures were revealed. ZnO and ZnS phases were mainly obtained at low and high TAA concentrations, respectively. At intermediate TAA concentrations, we evidenced the formation of ZnO/ZnS heterostructures. ZnS formation could take place via direct crystal growth involving Zn ions remaining in solution and S ions provided by TAA and/or chemical conversion of ZnO to ZnS. The combination of all the characterization techniques was crucial to elucidate the reaction steps and the nature of the final products.

  5. Androgen ablation augments human HLA2.1-restricted T cell responses to PSA self-antigen in transgenic mice.

    Science.gov (United States)

    Arredouani, Mohamed S; Tseng-Rogenski, Stephanie S; Hollenbeck, Brent K; Escara-Wilke, June; Leander, Karen R; Defeo-Jones, Deborah; Hwang, Clara; Sanda, Martin G

    2010-06-15

    In recent years, there has been an increasing interest in targeting human prostate tumor-associated antigens (TAAs) for prostate cancer immunotherapy as an alternative to other therapeutic modalities. However, immunologic tolerance to TAA poses a significant obstacle to effective, TAA-targeted immunotherapy. We sought to investigate whether androgen deprivation would result in circumventing immune tolerance to prostate TAA by impacting CD8 cell responses. To this end, we generated a transgenic mouse that expresses the human prostate-specific antigen (PSA) specifically in the prostate, and crossed it to the HLA-A2.1 transgenic mouse to evaluate how androgen deprivation affects human HLA A2.1-resticted T cell responses following immunization of PSA-expressing mice by vaccinia-PSA (PROSTVAC). Our PSA transgenic mouse showed restricted expression of PSA in the prostate and detectable circulating PSA levels. Additionally, PSA expression was androgen-dependent with reduced PSA expression in the prostate within 1 week of castration, and undetectable PSA by day 42 after castration as evaluated by ELISA. Castration of the PSA/A2.1 hybrid mouse prior to immunization with a PSA-expressing recombinant vaccinia virus resulted in a significant augmentation of PSA-specific cytotoxic lymphocytes. This humanized hybrid mouse model provides a well-defined system to gain additional insight into the mechanisms of immune tolerance to PSA and to test novel strategies aiming at circumventing immune tolerance to PSA and other TAA for targeted prostate cancer immunotherapy.

  6. Phenolic Content and Antioxidant Activity during the Development of 'Brookfield' and 'Mishima' Apples.

    Science.gov (United States)

    Stanger, Mayara C; Steffens, Cristiano A; Soethe, Cristina; Moreira, Marcelo A; do Amarante, Cassandro V T

    2017-05-03

    The aim of this study was to characterize the changes in the contents of total (TPC) and individual (IPC) phenolic compounds, the total antioxidant activity (TAA) in the peel and pulp, and total anthocyanins (TAN) in the peel during the development of the fruits of 'Brookfield' and 'Mishima' apple trees. 'Brookfield' apples were harvested from the 49th to the 138th days after full bloom (DAFB) and 'Mishima' apples from the 45th to the 172th DAFB. In the pulp, the IPC, TPC, and TAA rapidly reduced at 75 and 79 DAFB for the 'Brookfield' and 'Mishima' apples, respectively, and then remained constant until commercial maturity. In the peel of 'Brookfield' apples there was a reduction in the TPC and TAA at 79 DAFB. The quercetin 3-galactoside, epicatechin, and procyanidin B2 contents reduced up to 107 DAFB with a subsequent increase in the values at commercial maturity. In the peel of 'Mishima' apples there was a reduction in the TPC, TAA, epicatechin, and procyanidin B1 and B2 contents at 130 DAFB, with a subsequent increase until commercial maturity. The TAN content in the peel increased during the 2 and 4 weeks prior to commercial maturity for 'Brookfield' and 'Mishima' apples, respectively. In the pulp and peel of both cultivars there was a reduction in the IPC, TPC, and TAA as the development proceeded. On nearing commercial maturity, there was an increase in the contents of quercetin 3-galactoside, epicatechin, procyanidin B2, and TAN in the peel for both cultivars.

  7. Effect of different sulphur precursors on morphology and band-gap on the formation of Cu{sub 2}ZnSnS{sub 4} (CZTS) particles with microwave irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Patro, Bharati; Vijaylakshmi, S., E-mail: vlakshmi@iitb.ac.in [Centre for Research in Nanotechnology and Sciences, Indian Institute of Technology Bombay (India); Sharma, Pratibha [Department of Energy Sciences and Engineering, Indian Institute of Technology Bombay (India)

    2016-05-23

    Cu{sub 2}ZnSnS{sub 4} (CZTS) is a promising semiconductor material for ecological cost effective thin film Photovoltaic (PV) devices. As it contains earth abundant and non-toxic elements, it has the advantages over commercially available CIGS and CdTe thin film PV devices. In the present work, the pure phase Cu{sub 2}ZnSnS{sub 4} particles were successfully synthesised with microwave irradiation. The morphology and phase study was carried out for the samples prepared with two different sulphur precursors viz. thiourea and thioacetamide (TAA). CZTS particles with thiourea as sulphur precursor are more crystalline than CZTS particles with TAA. The band gap of 1.654 eV and 1.713 eV were calculated for the samples prepared with thiourea and TAA respectively.

  8. Integrating Immune Checkpoint Blockade with Anti-Neo/Mutated Antigens Reactivity to Increase the Clinical Outcome of Immunotherapy

    Directory of Open Access Journals (Sweden)

    Giorgio Parmiani

    2015-05-01

    Full Text Available Antibodies to immune checkpoints have entered the clinical arena and have been shown to provide a clinical benefit for metastatic melanoma and, possibly, for other tumors as well. In this review paper we summarize this therapeutic activity and underline the functional mechanisms that may be involved. Among them, we discuss the so far neglected role of tumor-associated antigens (TAAs deriving from tumor somatic mutations and summarize the results of recent trials showing the immunogenic strength of such TAAs which can be specifically targeted by T cells activated by immune checkpoint antibodies. Finally we discuss new immunotherapy approaches that involve the combination of self/shared- or neo-TAAs-based vaccines and immune checkpoint blockade antibodies, to increase the clinical response of metastatic melanoma patients.

  9. An adenoviral cancer vaccine co-encoding a tumor associated antigen together with secreted 4-1BBL leads to delayed tumor progression

    DEFF Research Database (Denmark)

    Ragonnaud, Emeline; Andersson, Anne-Marie C; Pedersen, Anders Elm

    2016-01-01

    with the previous reports of increased anti-cancer efficacy using systemically delivered 4-1BB agonists, we incorporated a secreted version of 4-1BBL (Fc-4-1BBL) in our vaccine and co-expressed it with the Ii linked to TAA. In tumor bearing mice, this vaccine initially delayed tumor growth and slightly increased......Previous studies have shown promising results when using an agonistic anti-4-1BB antibody treatment against established tumors. While this is promising, this type of treatment can induce severe side effects. Therefore, we decided to incorporate the membrane form of 4-1BB ligand (4-1BBL......) in a replicative deficient adenovirus vaccine expressing the invariant chain (Ii) adjuvant fused to a tumor associated antigen (TAA). The Ii adjuvant increases and prolongs TAA specific CD8+ T cells as previously shown and local expression of 4-1BBL was chosen to avoid the toxicity associated with systemic...

  10. Structure, vibrations, and hydrogen bond parameters of dibenzotetraaza[14]annulene

    Science.gov (United States)

    Gawinkowski, S.; Eilmes, J.; Waluk, J.

    2010-07-01

    Geometry and vibrational structure of dibenzo[ b, i][1,4,8,11]tetraaza[14]annulene (TAA) have been studied using infrared and Raman spectroscopy combined with quantum-chemical calculations. The assignments were proposed for 106 out of the total of 108 TAA vibrations, based on comparison of the theoretical predictions with the experimental data obtained for the parent molecule and its isotopomer in which the NH protons were replaced by deuterons. Reassignments were suggesteded for the NH stretching and out-of-plane vibrations. The values of the parameters of the intramolecular NH⋯N hydrogen bonds were analysed in comparison with the corresponding data for porphyrin and porphycene, molecules with the same structural motif, a cavity composed of four nitrogen atoms and two inner protons. Both experiment and calculations suggest that the molecule of TAA is not planar and is present in a trans tautomeric form, with the protons located on the opposite nitrogen atoms.

  11. Comparison of amino acid digestibility of feed ingredients in broilers, laying hens and caecectomised roosters.

    Science.gov (United States)

    Adedokun, S A; Utterback, P; Parsons, C M; Adeola, O; Lilburn, M S; Applegate, T J

    2009-05-01

    1. This study determined the effect of bird type (broilers, laying hens, or caecectomised roosters) on amino acid digestibility of feedstuffs from 5 plant sources and one animal source. 2. The standardised amino acid digestibility (SAAD) were obtained by correcting apparent ileal amino acid digestibility (AIAAD) values for basal ileal endogenous amino acid (EAA) flow obtained by feeding a N-free diet (NFD) to broilers and laying hens or from fasted EAA flow from caecectomised roosters. 3. The apparent total amino acid (TAA) digestibilities did not differ between broilers and roosters for three of the 6 feed ingredients. 4. Broilers had higher apparent total amino acid (TAA) digestibility than laying hens and roosters when fed on the maize diet (canola meal, maize, and soybean meal). 5. The apparent TAA digestibilities were similar across bird types for the dark distillers' dried grain with solubles, but the apparent lysine digestibility was much lower in the caecectomised roosters (15%) than the broilers (49%) and laying hens (43%). 6. The standardised TAA digestibility values in roosters were higher than in broilers for three of the 6 feed ingredients (canola meal, soybean meal, or meat and bone meal). 7. There were no differences between broilers and roosters, however, in the standardised TAA digestibility values for maize, dark and light DDGS. 8. The standardised TAA digestibility values for laying hens were lower for maize, higher for meat and bone meal, but no different for the remaining ingredients when compared with broilers. 9. The results from this study showed that both the apparent and standardised amino acid digestibility values in caecectomised roosters, laying hens, and broilers ingredients are similar for some, but not all, feed ingredients. 10. Nutritionists should, therefore, be cautious about using digestibility coefficients obtained by different methodologies as values may differ.

  12. Preventive and curative effect of methanolic extract of Gardenia gummifera Linn. f. on thioacetamide induced oxidative stress in rats

    Directory of Open Access Journals (Sweden)

    SP Prabha

    2012-04-01

    Full Text Available Objective: To evaluate the antioxidant and antihepatotoxic effect of methanolic extract of Gardenia gummifera Linn. f. root (MEGG on thioacetamide (TAA induced oxidative stress in male Wistar rats. Methods: In the preventive study, rats were administered with 125 and 250 mg/ kg of MEGG for 9 days prior to TAA administration (100 mg/kg s.c.. In post-treatment groups, rats were treated with MEGG at doses of 125 and 250 mg/kg, 2, 24 and 48 h after TAA intoxication. Silymarin was used as a standard drug control (100 mg/kg. Hepatotoxicity was assessed by quantifying the serum levels of aspartate aminotransferase (AST, alanine aminotransferase (ALT, alkaline phosphatase (ALP and lactate dehydrogenase (LDH. The antioxidant potential of MEGG was evaluated by the estimation of catalase (CAT, glutathione peroxidase (GPx, glutathione reductase (GR, glutathione-S-transferase (GST, reduced glutathione (GSH and lipid peroxidation [thiobarbituric acid reactive substances (TBARS] in hepatic and renal tissues. Histopathological changes were also evaluated. Results: MEGG significantly (P曑0.05 prevented the elevation of serum AST, ALT, ALP, LDH and tissue malondialdehyde levels in both experimental groups, when compared to the TAA alone treated groups. The rats receiving TAA plus MEGG exhibited significant (P曑0.05 increases in hepatic and renal antioxidant activities including GSH, GST, GR, GPx and CAT levels. Quantification of histopathological changes also supported the dose dependent protective effects of MEGG. Conclusions: These observations suggest that MEGG has dose dependent hepatoprotective and antioxidant effect against TAA induced oxidative stress.

  13. Induced pluripotent stem cells: Challenges and opportunities for cancer immunotherapy

    Directory of Open Access Journals (Sweden)

    Patty eSachamitr

    2014-04-01

    Full Text Available Despite recent advances in cancer treatment over the past 30 years, therapeutic options remain limited and do not always offer a cure for malignancy. Given that tumour associated antigens (TAA are, by definition, self-proteins, the need to productively engage autoreactive T cells remains at the heart of strategies for cancer immunotherapy. These have traditionally focussed on the administration of autologous monocyte-derived dendritic cells (moDC pulsed with TAA, or the ex vivo expansion and adoptive transfer of tumour infiltrating lymphocytes (TIL as a source of TAA-specific cytotoxic T cells (CTL. Although such approaches have shown some efficacy, success has been limited by the poor capacity of moDC to cross-present exogenous TAA to the CD8+ T cell repertoire and the potential for exhaustion of CTL expanded ex vivo. Recent advances in induced pluripotency offer opportunities to generate patient-specific stem cell lines with the potential to differentiate in vitro into cell types whose properties may help address these issues. Here we review recent success in the differentiation of NK cells from human induced pluripotent stem (iPS cells as well as minor subsets of DC with therapeutic potential, including CD141+XCR1+ DC, capable of cross-presenting TAA to naïve CD8+ T cells. Furthermore, we review recent progress in the use of TIL as the starting material for the derivation of iPSC lines, thereby capturing their antigen specificity in a self-renewing stem cell line, from which potentially unlimited numbers of naïve TAA-specific T cells may be differentiated, free of the risks of exhaustion.

  14. Increased serum bile acid concentration following low-dose chronic administration of thioacetamide in rats, as evidenced by metabolomic analysis

    International Nuclear Information System (INIS)

    Jeong, Eun Sook; Kim, Gabin; Shin, Ho Jung; Park, Se-Myo; Oh, Jung-Hwa; Kim, Yong-Bum; Moon, Kyoung-Sik; Choi, Hyung-Kyoon; Jeong, Jayoung; Shin, Jae-Gook; Kim, Dong Hyun

    2015-01-01

    A liquid chromatography/time-of-flight mass spectrometry (LC/TOF-MS)-based metabolomics approach was employed to identify endogenous metabolites as potential biomarkers for thioacetamide (TAA)-induced liver injury. TAA (10 and 30 mg/kg), a well-known hepatotoxic agent, was administered daily to male Sprague–Dawley (SD) rats for 28 days. We then conducted untargeted analyses of endogenous serum and liver metabolites. Partial least squares discriminant analysis (PLS-DA) was performed on serum and liver samples to evaluate metabolites associated with TAA-induced perturbation. TAA administration resulted in altered levels of bile acids, acyl carnitines, and phospholipids in serum and in the liver. We subsequently demonstrated and confirmed the occurrence of compromised bile acid homeostasis. TAA treatment significantly increased serum levels of conjugated bile acids in a dose-dependent manner, which correlated well with toxicity. However, hepatic levels of these metabolites were not substantially changed. Gene expression profiling showed that the hepatic mRNA levels of Ntcp, Bsep, and Oatp1b2 were significantly suppressed, whereas those of basolateral Mrp3 and Mrp4 were increased. Decreased levels of Ntcp, Oatp1b2, and Ostα proteins in the liver were confirmed by western blot analysis. These results suggest that serum bile acids might be increased due to the inhibition of bile acid enterohepatic circulation rather than increased endogenous bile acid synthesis. Moreover, serum bile acids are a good indicator of TAA-induced hepatotoxicity. - Highlights: • Endogenous metabolic profiles were assessed in rat after treatment of thioacetamide. • It significantly increased the levels of bile acids in serum but not in the liver. • Expression of the genes related to bile acid secretion and reuptake was decreased. • Increased serum bile acids result from block of enterohepatic circulation of bile acids.

  15. Increasing vaccine potency through exosome antigen targeting.

    Science.gov (United States)

    Hartman, Zachary C; Wei, Junping; Glass, Oliver K; Guo, Hongtao; Lei, Gangjun; Yang, Xiao-Yi; Osada, Takuya; Hobeika, Amy; Delcayre, Alain; Le Pecq, Jean-Bernard; Morse, Michael A; Clay, Timothy M; Lyerly, Herbert K

    2011-11-21

    While many tumor associated antigens (TAAs) have been identified in human cancers, efforts to develop efficient TAA "cancer vaccines" using classical vaccine approaches have been largely ineffective. Recently, a process to specifically target proteins to exosomes has been established which takes advantage of the ability of the factor V like C1C2 domain of lactadherin to specifically address proteins to exosomes. Using this approach, we hypothesized that TAAs could be targeted to exosomes to potentially increase their immunogenicity, as exosomes have been demonstrated to traffic to antigen presenting cells (APC). To investigate this possibility, we created adenoviral vectors expressing the extracellular domain (ECD) of two non-mutated TAAs often found in tumors of cancer patients, carcinoembryonic antigen (CEA) and HER2, and coupled them to the C1C2 domain of lactadherin. We found that these C1C2 fusion proteins had enhanced expression in exosomes in vitro. We saw significant improvement in antigen specific immune responses to each of these antigens in naïve and tolerant transgenic animal models and could further demonstrate significantly enhanced therapeutic anti-tumor effects in a human HER2+ transgenic animal model. These findings demonstrate that the mode of secretion and trafficking can influence the immunogenicity of different human TAAs, and may explain the lack of immunogenicity of non-mutated TAAs found in cancer patients. They suggest that exosomal targeting could enhance future anti-tumor vaccination protocols. This targeting exosome process could also be adapted for the development of more potent vaccines in some viral and parasitic diseases where the classical vaccine approach has demonstrated limitations. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Tree age, fruit size and storage conditions affect levels of ascorbic acid, total phenolic concentrations and total antioxidant activity of 'Kinnow' mandarin juice.

    Science.gov (United States)

    Khalid, Samina; Malik, Aman U; Khan, Ahmad S; Shahid, Muhammad; Shafique, Muhammad

    2016-03-15

    Bioactive compounds (ascorbic acid, total phenolics and total antioxidants) are important constituents of citrus fruit juice; however, information with regard to their concentrations and changes in relation to tree age and storage conditions is limited. 'Kinnow' (Citrus nobilis Lour × Citrus deliciosa Tenora) mandarin juice from fruit of three tree ages (6, 18 and 35 years old) and fruit sizes (large, medium and small) were examined for their bioactive compounds during 7 days under ambient storage conditions (20 ± 2 °C and 60-65% relative humidity (RH)) and during 60 days under cold storage (4 ± 1 °C and 75-80% RH) conditions. Under ambient conditions, a reduction in total phenolic concentrations (TPC) and in total antioxidant activity (TAA) was found for the juice from all tree ages and fruit sizes. Overall, fruit from 18-year-old trees had higher mean TPC (95.86 µg mL(-1) ) and TAA (93.68 mg L(-1) ), as compared to 6 and 35-year-old trees. Likewise, in cold storage, TAA decreased in all fruit size groups from 18 and 35-year-old trees. In all tree age and fruit size groups, TPC decreased initially during 15 days of cold storage and then increased gradually with increase in storage duration. Ascorbic acid concentrations showed an increasing trend in all fruit size groups from 35-year-old trees. Overall, during cold storage, fruit from 18-year-old trees maintained higher mean ascorbic acid (33.05 mg 100 mL(-1) ) concentrations, whereas fruit from 6-year-old trees had higher TAA (153.1 mg L(-1) ) and TPC (115.1 µg mL(-1) ). Large-sized fruit had higher ascorbic acid (32.08 mg 100 mL(-1) ) concentrations and TAA (157.5 mg L(-1) ). Fruit from 18-year-old trees maintained higher TPC and TAA under ambient storage conditions, whereas fruit from 6-year-old trees maintained higher TPC and TAA during cold storage. Small-sized fruit had higher TPC after ambient temperature storage, whereas large fruit size showed higher ascorbic acid concentrations and TAA after cold

  17. Is There Anything to Learn from a National Joint Registry?

    Science.gov (United States)

    Muir, Dawson

    2017-06-01

    National joint registries (NJRs) have been established in Northern Europe for over 20 years. Since then, many other countries have begun collecting and reporting national data for total ankle arthroplasty (TAA). With relatively small numbers implanted, a large variety of available designs, and with any long-term reports dominated by designer groups, TAA is ideally placed to benefit from large national or even pooled national registries. This article reviews the existing registry-based literature with respect to what is already known. The potential positives and down sides of registry data also are highlighted. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Soft chemistry routes to GeS2 nanoparticles

    Science.gov (United States)

    Courthéoux, Laurence; Mathiaud, Romain; Ribes, Michel; Pradel, Annie

    2018-04-01

    Spherical GeS2 particles are prepared by a low temperature liquid route with TEOG as germanium precursor and either H2S or thioacetamide (TAA) as sulfur precursors. The size and agglomeration of the particles change depending upon the temperature and nature of the solvent. Most synthesis lead to preparing amorphous GeS2. When the reaction kinetic is slowed down by using TAA at 25 °C, the obtained GeS2 product presents a larger order in the range of few Å as proven by Raman spectroscopy, even though it is still an amorphous compound as suggested by X-Ray diffraction and TEM experiments.

  19. A single bout of dynamic exercise enhances the expansion of MAGE-A4 and PRAME-specific cytotoxic T-cells from healthy adults.

    Science.gov (United States)

    LaVoy, Emily C P; Bollard, Catherine M; Hanley, Patrick J; Blaney, James W; O'Connor, Daniel P; Bosch, Jos A; Simpson, Richard J

    2015-01-01

    The ex vivo expansion of tumor-associated-antigen (TAA)- specific cytotoxic T-cells (CTLs) from healthy donors for adoptive transfer to cancer patients is now providing additional treatment options for patients. Many studies have shown that adoptive transfer of expanded CTLs can reduce the risk of relapse in cancer patients following hematopoietic stem cell transplantation (HSCT). However, the procedure can be limited by difficulties in priming and expanding sufficient numbers of TAA-specific-CTLs. Because acute dynamic exercise mobilizes large numbers of T-cells to peripheral blood, we hypothesized that a single bout of exercise would augment the ex vivo expansion of TAA-specific-CTLs.We therefore collected lymphocytes from blood donated by healthy adults at rest and after brief maximal dynamic exercise. TAA-specific CTLs were expanded using autologous monocyte-derived-dendritic cells pulsed with melanoma-associated antigen 4 (MAGE-A4), with preferentially expressed antigen in melanoma (PRAME), and with Wilms' tumor protein (WT-1). Post exercise, 84% of the participants had a greater number of CTLs specific for at least one of the three TAA.Cells expanded from post exercise blood yielded a greater number of MAGE-A4 and PRAME-specific-cells in 70% and 61% of participants, respectively. In the 'exercise-responsive' participants (defined as participants with at least a 10% increase in TAA-specific-CTLs post-exercise), MAGEA4- and PRAME-specific-CTLs increased 3.4-fold and 6.2- fold respectively. Moreover, expanded TAA-specific CTLs retained their antigen-specific cytotoxic activity. No phenotype differences were observed between expanded cells donated at rest and postexercise. We conclude that exercise can enhance the ex vivo expansion of TAA-specific-CTLs from healthy adults without compromising cytotoxic function. Hence, this study has implications for immunotherapy using adoptive T-cell transfer of donor-derived T-cells after allogeneic HSCT. Copyright © 2015

  20. Free Radicals: Emerging Challenge in Environmental Health Research in Childhood and Neonatal Disorders

    Directory of Open Access Journals (Sweden)

    B. Sharda

    2006-09-01

    Full Text Available Infants and children may undergo severe oxidative stress due to disease state, pre-existing nutritional status, frequent use of oxygen, and lower levels of antioxidant defenses. Antioxidant defenses, made up of intracellular and extra-cellular components, work synergistically to prevent oxidative damage. Total antioxidant activity (TAA was analyzed by method of ferric reducing antioxidant power assay (FRAP. Patients admitted in Pediatric Dept, RNT Medical College, Udaipur, India were selected for these studies. TAA level in neonates with hypoxic-ischemic-encephalopathy (HIE stage III and in poor outcome cases was significantly low. Erythrocyte SOD activity level was low in pre-term neonates. TAA level in severely malnourished children at the time of hospital admission was low. This low antioxidant level in severely malnourished children could be multi-factorial viz. low zinc, selenium, vitamin A and C deficiency, recurrent infections, elevated free iron and chronic starvation stage. Delayed recovery of oxidant injury may lead to delayed incomplete recovery at cellular level. In a study of 29 tuberculosis patients TAA level was found to be low in tubercular patients compared with control. TAA level decreased more in CNS tuberculosis compared with other system tuberculosis. In a study of nutritional tremor syndrome TAA, ascorbic acid and α-tocopherol levels were low during pre-tremor phase compared with tremor phase (ATS. Pre-term neonates have incompletely developed antioxidant defenses and are deficient in vitamin E, which is normally derived from maternal circulation at the end of 3rd trimester. Therefore, decreased TAA level in HIE with poor outcome indicates addition of antioxidants in therapeutic strategy. Since rise in TAA in antioxidant supplemented group of severely malnutrition children was higher with good outcome compared with nonsupplemented group it would be prudent to supplement antioxidant during nutritional management

  1. Total ankle arthroplasty: An imaging overview

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Da Rae; Choi, Yun Sun; Chun, Ka Young; Jung, Yoon Young; Kim, Jin Su; Young, Ki Won [Eulji Hospital, Eulji University, Seoul (Korea, Republic of); Potter, Hollis G.; Li, Angela E. [Dept. of Radiology and Imaging, Hospital for Special Surgery, New York (United States)

    2016-06-15

    With advances in implant technology, total ankle arthroplasty (TAA) has become an increasingly popular alternative to arthrodesis for the management of end-stage ankle arthritis. However, reports in the literature do not focus on the imaging features of TAA. Through a literature review, we demonstrate basic design features of the current ankle arthroplasty system, and the normal and abnormal postoperative imaging features associated with such devices. Pre- and postoperative evaluations of ankle arthroplasty mainly include radiography; in addition, computed tomography and magnetic resonance imaging provide further characterization of imaging abnormalities. Familiarization with multimodal imaging features of frequent procedural complications at various postoperative intervals is important in radiological practice.

  2. ACTION OF VITAMIN E ON EXPERIMENTAL SEVERE ACUTE LIVER FAILURE.

    Science.gov (United States)

    Miguel, Fabiano Moraes; Schemitt, Elizângela Gonçalves; Colares, Josieli Raskopf; Hartmann, Renata Minuzzo; Morgan-Martins, Maria Isabel; Marroni, Norma Possa

    2017-01-01

    Severe Acute Liver Failure (ALF) is a life-threatening clinical syndrome characterized by hepatocyte necrosis, loss of hepatic architecture, and impairment of liver functions. One of the main causes of ALF is hepatotoxicity from chemical agents, which damage hepatocytes and result in increase of reactive oxygen species. The vitamin E isoform is the one with the strongest biological antioxidant activity. To evaluate the antioxidant effect of vitamin E in this ALF model. We used 56 rats (mean weight of 300 g) divided into eight groups, four groups assessed at 24 hours and 4 assessed at 48 hours after induction: control group (CO); Vitamin E (Vit. E); Thioacetamide (TAA) and Thioacetamide + Vitamina E (TAA+Vit.E). Rats were submitted to injections of thioacetamide (400 mg/kg i.p.) at baseline and 8 hours later. Vitamin E (100 mg/kg ip) was administered 30 minutes after the second dose of thioacetamide. The 48-hour group rats received two additional doses of vitamin E (24h and 36h). At 24h or 48 hours after the administration of the first dose of TAA, rats were weighed and anesthetized and their blood sampled for evaluation of liver integrity through enzymes aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Liver tissue was sampled for assessment of lipid peroxidation (LPO) by the technique TBARS, antioxidant enzymes SOD, CAT, GPx and GST activity, levels of the NO 2 /NO 3 and histology by H&E in two times. The results were expressed as mean ± standard deviation and statistically analyzed by ANOVA followed by Student-Newman-Keuls, with P E, we observed a reduction in liver enzymes AST (U/L) (101.32±19.45 in 24 hours and 97.85±29.65 in 48 hours) related to the TAA group (469.56± 0.69 in 24 hours and 598.23±55.45 in 48 hours) and ALT (U/L) (76.59±8.56 in 24 hours and 68.47±6.49 in 48 hours) compared to the TAA group (312.21±10.23 in 24 hours and 359.15±17.58 in 48 hours). There was a reduction of LPO (nmol/mg Prot) in the TAA+Vit.E group (0

  3. Surgical treatment of thoraco-abdominal and low thoracic aneurysms of the aorta. One single center experience over ten years

    OpenAIRE

    El Arid, J.-M.; CREEMERS, Etienne; Limet, Raymond

    2006-01-01

    This work presents the results of surgery in thoraco-abdominal aortic aneurysms (TAA) and thoracic descending aortic aneurysms (TDA) in one single center between January 1rst, 1996 and December 31, 2005. It concerns open surgery in 42 and endovascular procedures in ten patients. Forty two patients (11 TDA and 31 TAA (4 type I, 12 type II, 6 type III and 9 type IV)) define the open surgery series. Twenty six patients were operated on elective basis and 16 patients in emergency condition. Surgi...

  4. Performance of Broiler Chickens Fed Low Protein, Limiting Amino Acid Supplemented Diets Formulated Either on Total or Standardized Ileal Digestible Amino Acid Basis

    Directory of Open Access Journals (Sweden)

    C. Basavanta Kumar

    2016-11-01

    Full Text Available The aim of present experiment was to investigate the effect of protein reduction in commercial broiler chicken rations with incorporation of de-oiled rice bran (DORB and supplementation of limiting amino acids (valine, isoleucine, and/or tryptophan with ration formulation either on total amino acid (TAA or standardized ileal digestible amino acids (SIDAA. The experimental design consisted of T1, TAA control; T2 and T3, 0.75% and 1.5% protein reduction by 3% and 6% DORB incorporation, respectively by replacing soybean meal with supplemental limiting amino acids to meet TAA requirement; T4, SIDAA control, T5 and T6, 0.75% and 1.5% protein reduction by DORB incorporation (3% and 6% with supplemental limiting amino acids on SIDAA basis. A total of 360 d-old fast growing broiler chicks (Vencobb-400 were divided into 36 homogenous groups of ten chicks each, and six dietary treatments described were allocated randomly with six replications. During 42 days trial, the feed intake was significantly (p<0.05 reduced by TAA factor compared to SIDAA factor and protein factor significantly (p<0.05 reduced the feed intake at 1.5% reduction compared to normal protein group. This was observed only during pre-starter phase but not thereafter. The cumulative body weight gain (BWG was significantly (p<0.05 reduced in TAA formulations with protein step-down of 1.5% (T3, 1,993 g compared to control (T1, 2,067 g, while under SIDAA formulations, BWG was not affected with protein reduction of 1.5% (T6, 2,076 g compared to T4 (2,129 g. The feed conversion ratio (FCR was significantly (p<0.05 reduced in both TAA and SIDAA formulations with 1.5% protein step-down (T3, 1.741; T6, 1.704 compared to respective controls (T1, 1.696; T4, 1.663. The SIDAA formulation revealed significantly (p<0.05 higher BWG (2,095 g and better FCR (1.684 compared to TAA formulation (2,028 g; 1.721. Intake of crude protein and all limiting amino acids (SID basis was higher in SIDAA group than TAA

  5. Untitled

    Indian Academy of Sciences (India)

    THE RESPIRATORY SYSTEM AND THE MODE OF. RESPIRATION OF THE WATER-EUG, SPA/AFA'O/DA, MA. A US 7/CUM FABR., WITH REMARKS ON THOSE OF. AVAEPA, ZA CCO 7 RAEP//AS AND AºA AWA TA'A. BY M. J. PRESSWALLA. AN ID. C. J. GEORGE. (From the Department of Biology, Wilson College, ...

  6. Ukraina Putini-näoline poliitika / Silver Meikar

    Index Scriptorium Estoniae

    Meikar, Silver, 1978-

    2010-01-01

    Riigikogu liikme sõnul on Ukrainast saanud taas presidentaalne riik, kus riigipeale lojaalne klikk kontrollib seadusandlikku, täidesaatvat ja ka kohtuvõimu. Paradoksaalselt on võimu koondumisel presidendi kätte ka kolm positiivset aspekti

  7. 78 FR 48466 - Hewlett Packard Company, Printing & Personal System Americas Division, Marketing Services...

    Science.gov (United States)

    2013-08-08

    ..., Printing & Personal System Americas Division, Marketing Services, Houston, Texas; Notice of Investigation Pursuant to Section 221 of the Trade Act of 1974, as amended, an investigation was initiated in response to a Trade Adjustment Assistance (TAA) petition filed on December 27, 2012 by the State of Texas on...

  8. Pariisi Tokyo palee taassünd / Merike Trubert

    Index Scriptorium Estoniae

    Trubert, Merike

    2002-01-01

    21. I avati Pariisis taas Tokyo palee, nüüdsest kaasaegse kunsti eksponeerimiseks. Kunstikriitikutest direktorid Nicolas Bourriaud ja Jérõme Sans on seadnud eesmärgiks avastada uusi talente. Pakuti vaadata Alexander Györfi filmi "Ballaad õnnelikest inimestest", mida reaalsuses ei eksisteeri jm

  9. Hepatoprotective Role of Ethanolic Extract of Vitex negundo in Thioacetamide-Induced Liver Fibrosis in Male Rats

    Directory of Open Access Journals (Sweden)

    Farkaad A. Kadir

    2013-01-01

    Full Text Available The hepatoprotective activity of ethanolic extract from the leaves of Vitex negundo (VN was conducted against thioacetamide- (TAA- induced hepatic injury in Sprague Dawley rats. The therapeutic effect of the extract was investigated on adult male rats. Rats were divided into seven groups: control, TAA, Silymarin (SY, and VN high dose and low dose groups. Rats were administered with VN extract at two different doses, 100 mg/kg and 300 mg/kg body weight. After 12 weeks, the rats administered with VN showed a significantly lower liver to body weight ratio. Their abnormal levels of biochemical parameters and liver malondialdehyde were restored closer to the normal levels and were comparable to the levels in animals treated with the standard drug, SY. Gross necropsy and histopathological examination further confirmed the results. Progression of liver fibrosis induced by TAA in rats was intervened by VN extract administration, and these effects were similar to those administered with SY. This is the first report on hepatoprotective effect of VN against TAA-induced liver fibrosis.

  10. A new bonded catalyst for safe lithium-thionyl chloride batteries

    Science.gov (United States)

    Walsh, F.; Hopewood, J.

    1982-08-01

    The goal of the research effort was to demonstrate that a new class of organometallic cathode catalysts, the TAAs, are stable in thionyl chloride and that they significantly improve the power performance of lithium-thionyl chloride primary batteries. A number of TAAs were evaluated and shown to be active catalysts. Included in this evaluation were TAAs which were covalently bonded to the supporting carbon electrode material; a covalently bonded catalyst has the potential advantage that it will not dissolve into the electrolyte and negatively affect anode performance. During the six month research program, the TAAS were shown to: significantly improve cathode performance in Li/SOCl2 cells; improve cathode capacity; improve cathode performance throughout long-term tests; and not affect anode performance. Further work is needed to develop data in cell studies on temperature range, shelf life, voltage delay effects, energy/power density as a function of rate, and factors affecting electrode capacity. Battery performance in stress tests to develop safety and cost data is also needed.

  11. 75 FR 41433 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-07-16

    ... Service (FAS) has certified a petition (No. 2010003) for trade adjustment assistance (TAA) for asparagus that was filed by the National Asparagus Council and accepted for review by USDA on May 3, 2010... of asparagus during January-December 2009 contributed importantly to a greater than 15-percent...

  12. Sotsiaaldemokraatia taassünd Eestis / Tony Blair ; tõlk. Marek Laane

    Index Scriptorium Estoniae

    Blair, Tony, 1953-

    2004-01-01

    Ilmunud ka: Molodjozh Estonii, 9. veebr. 2004, lk. 3, lüh. Suurbritannia peaminister tervitab Mõõdukate kongressi ja sotsiaaldemokraatide taasärkamist ning kirjeldab parteide ja riikide koostöövõimalusi ühises Euroopas

  13. 76 FR 5840 - The Basic Aluminum Castings Co., Cleveland, OH; Notice of Revised Determination on Reconsideration

    Science.gov (United States)

    2011-02-02

    ... regarding workers' eligibility to apply for Trade Adjustment Assistance (TAA) applicable to workers and... to the production of aluminum die castings. New information revealed that, during the period of investigation, imports of articles like or directly competitive aluminum die castings produced by the subject...

  14. 75 FR 62760 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-10-13

    ... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers... Service (FAS), certified a petition (No. 2011015) for trade adjustment assistance (TAA) for blueberries... average. This conforms to the eligibility requirements stipulated in Subtitle C of Title I of the Trade...

  15. 75 FR 41432 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-07-16

    ... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers... Service (FAS) has certified a petition (No. 2010005) for trade adjustment assistance (TAA) for shrimp that... stipulated in Subtitle C of Title I of the Trade Act of 2002 (Pub. L. 107-210). Individual shrimp producers...

  16. 75 FR 41431 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-07-16

    ... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers... Service (FAS) has denied a petition (No. 2010009) for trade adjustment assistance (TAA) for apples that... the Trade Act of 2002 (Pub. L. 107-210) states that petitions must demonstrate, using data for the...

  17. 75 FR 63437 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-10-15

    ... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers... Service (FAS) has denied a petition (No. 2011032) for trade adjustment assistance (TAA) for blueberries... qualify under the program, Subtitle C of Title I of the Trade Act of 2002 (Pub. L. 107-210) states that...

  18. 75 FR 62759 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-10-13

    ... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers... Service (FAS), denied a petition (No. 2011019) for trade adjustment assistance (TAA) for Tilapia filed... INFORMATION: To qualify under the program, Subtitle C of Title I of the Trade Act of 2002 (Pub. L. 107-210...

  19. 77 FR 6584 - Specialty Bar Products Company,a Subsidiary of Doncasters, Inc., Blairsville, PA; Notice of...

    Science.gov (United States)

    2012-02-08

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-80,511] Specialty Bar Products Company,a Subsidiary of Doncasters, Inc., Blairsville, PA; Notice of Affirmative Determination Regarding... Assistance (TAA) applicable to workers and former workers of Specialty Bar Products Company, a subsidiary of...

  20. Rahaga lennuhirmu vastu / Tõnis Erilaid

    Index Scriptorium Estoniae

    Erilaid, Tõnis, 1943-

    2006-01-01

    Odavlennufirma Ryanair juht Michael O'Leary müüb oma firma sajale lennusuunale miljon piletit hinnaga 25 naelsterlingit, innustades inglasi taas reisima. Ühtlasi on O'Leary esitanud Suurbritannia valitsusele ultimaatumi turvameetmete viimiseks leebemale tasemele. Vt. samas: Turvameetmed rumalusteni

  1. Eikuhugi viiv tee / Janar Ala

    Index Scriptorium Estoniae

    Ala, Janar, 1979-

    2009-01-01

    Tallinnfilmi 1979.a. mängufilmist "Hukkunud Alpinisti hotell" (režissöör Grigori Kromanov, operaator Jüri Sillart, kunstnik Tõnu Virve, kostüümikunstnik Slava Zaitsev, helilooja Sven Grünberg), mis värskelt restaureerituna taas kinoekraanile jõudis

  2. 76 FR 59170 - Hartford Financial Services, Inc., Corporate/EIT/CTO Database Management Division, Hartford, CT...

    Science.gov (United States)

    2011-09-23

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-80,341] Hartford Financial Services, Inc., Corporate/EIT/CTO Database Management Division, Hartford, CT; Notice of Negative... apply for Trade Adjustment Assistance (TAA) applicable to workers and former workers Hartford Financial...

  3. Via Baltica : Eesti tee Hansaliidust Euroopa Liitu? = Via Baltica : Viron tie Hansaliitosta Euroopan Unioniin? / Hannu Eerikäinen

    Index Scriptorium Estoniae

    Eerikäinen, Hannu

    2004-01-01

    Via Baltica moodustab Läänemere regioonis tähtsaima arengutelje, mis avab Põhja-Euroopale tee EL-ist väljaspool olevatesse riikidesse. Tallinnast saab taas tähtis vahendaja Põhja- ja Kesk-Euroopa vahel

  4. Bagatellid : maailm / Mirjam Tally

    Index Scriptorium Estoniae

    Tally, Mirjam, 1976-

    2008-01-01

    Bachi ja Mozarti uued ilmed. Hilary Hahnilt ja Mayuko Kamiolt uued plaadid. Lahkus tenor Giuseppe di Stefano. Henri Dutilleux pälvis Kuningliku Filharmooniaühingu kuldmedali. Inglismaa vanim spinett müügil. Guarneri hinnaline viiul helises taas

  5. Army Library Institute V: Product/Marketing/Service - Volume 2, Supplementary Data

    Science.gov (United States)

    1981-11-01

    28307 US Army Community Hospital, Fort Campbell, KY 42223 US Army Community Hospital, Fort Carson, CO 80913 US Array Conununity Hospital, Coco Solo...46. gj la Doal w/üniönT JB. a. Uadership lech Svc ± M- £. TOBLIC SEPTICES 13. Onaa/Taa/PR 24. SOI/Uaer Feedback Z5. General Reference 16

  6. 76 FR 2718 - Investigations Regarding Certifications of Eligibility To Apply for Worker Adjustment Assistance

    Science.gov (United States)

    2011-01-14

    .../10 75020 John Hancock Life Insurance Milwaukee, WI......... 12/21/10 12/17/10 Company (Company..., DC, this 30th day of December 2010. Michael W. Jaffe, Certifying Officer, Office of Trade Adjustment Assistance. ] Appendix--TAA Petitions Instituted Between 12/20/10 and 12/23/10 Date of Date of TA-W Subject...

  7. 76 FR 16450 - Management Resources Group, Inc., Including Workers in the States of Georgia and New York...

    Science.gov (United States)

    2011-03-23

    ... Connecticut Workforce Office representative filed a petition for Trade Adjustment Assistance (TAA) with the... employment related to the supply of asset reliability engineering consulting services. The worker group does... worker adjustment assistance under Section 222(a) of the Act, 19 U.S.C. 2272(a), the following criteria...

  8. 77 FR 31864 - Prospective Grant of Exclusive License: Development of PANVACTM

    Science.gov (United States)

    2012-05-30

    ... eukaryotic expression vectors and recombinant yeast vectors.'' DATES: Only written comments and/or... vaccine strategy. It is well established that the over-expression of these two (2) TAAs are associated..., will not be released under the Freedom of Information Act, 5 U.S.C. 552. Dated: May 23, 2012. Richard U...

  9. Kaug-Ida autoäri eripärast - sae kas või maastur pooleks / Jaanus Piirsalu

    Index Scriptorium Estoniae

    Piirsalu, Jaanus, 1973-

    2010-01-01

    2009. a. tõsteti Venemaal sisseveetavate kasutatud autode tollimakse. Nüüd saetakse Vladivostokki teel olevad kasutatud autod Jaapanis pooleks ja tuuakse üle piiri kui varuosad. Poolitatud autod keevitatakse Vladivostokis taas kokku. Kasutatud autode äri on Kaug-Idas vähenenud kümneid kordi

  10. Testing Algorithmic Skills in Traditional and Non-Traditional Programming Environments

    Science.gov (United States)

    Csernoch, Mária; Biró, Piroska; Máth, János; Abari, Kálmán

    2015-01-01

    The Testing Algorithmic and Application Skills (TAaAS) project was launched in the 2011/2012 academic year to test first year students of Informatics, focusing on their algorithmic skills in traditional and non-traditional programming environments, and on the transference of their knowledge of Informatics from secondary to tertiary education. The…

  11. Toxic effects of chronic low-dose exposure of thioacetamide on rats based on NMR metabolic profiling.

    Science.gov (United States)

    Wei, Dan-Dan; Wang, Jun-Song; Wang, Peng-Ran; Li, Ming-Hui; Yang, Ming-Hua; Kong, Ling-Yi

    2014-09-01

    Thioacetamide (TAA) is a well-known toxicant and its long term exposure could induce liver fibrosis and cirrhosis. A liver fibrosis rat model was established by consecutive injection of TAA solution for 7 weeks. Serum and urine samples were collected weekly for NMR based metabolomic study. Clinical biochemistry of serum samples revealed liver impairment and fibrosis. Histopathological inspections disclosed severe liver fibrosis and cirrhosis formation, and pathological changes in kidney by long-term TAA administration. Orthogonal partial least squares-discriminant analysis (OPLS-DA) was applied on serum and urine samples to excavate differential metabolites associated with TAA induced impairment and explore the time-dependent metabolic event associated with this xenobiotic perturbation. Integration of metabolomics results with serum biochemical revealed several potential biomarkers for liver fibrosis (2-hydroxybutyrate, 3-hydroxybutyrate and adipate in urine, and phenylalanine, N,N-dimethyl glycine, O-acetyl glycoprotein, N-acetyl glycoprotein and choline in serum). Pathway analysis revealed disturbed pathways concerning tricarboxylic acid (TCA) cycle, pyruvate metabolism, starch and sucrose metabolism, glycolysis or gluconeogenesis, degradation of ketone bodies, butanoate metabolism, and biosynthesis of BCAAs (valine, leucine and isoleucine) and AAAs (phenylalanine, tyrosine and tryptophan). This integrative study should help to develop a systematic understanding of liver fibrosis-related diseases and their metabolic events. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Eksperimente ja kilde kultuuriloost / Riina Mägi

    Index Scriptorium Estoniae

    Mägi, Riina, 1957-

    2008-01-01

    Theodor Lutsu 13. filmipäevad ja 10. lahtine lühifilmide konkurss Palamusel 15. augustil. Auhinnatud filmidest (anima-, dokumentaal-, mängu- ja ekperimentaalfilmid). Žüriisse kuulusid Helle Karis, Jaak Lõhmus, Erika Laansalu ja Tiina Säälik. Filmipäevade korraldajad olid taas Tiina Säälik ja Arne Tegelmann

  13. Laste kirjutamisoskus polegi nii kehv / Anne Uusen

    Index Scriptorium Estoniae

    Uusen, Anne

    2003-01-01

    Õpilaste kirjutamisoskust on kritiseeritud juba aastakümneid. Viimasel viiel aastal on diskussioon sel teemal taas kord teravnenud. Kuni selleni välja, et logopeedide väitel vajavat (logopeedilist) abi 40% õpilastest (Õpetajate Leht 27.04.2001)

  14. 75 FR 20394 - American Racing Equipment, LLC, Denver, CO; Notice of Negative Determination on Remand

    Science.gov (United States)

    2010-04-19

    ... for voluntary remand. On May 18, 2009, the Department implemented the Trade and Globalization... Department's policy that in order for petitioners to qualify for TAA as primary workers, they must be (1... engaged in the production of an article for the purposes of the Trade Act. The Department's policy is to...

  15. TRICOM vector based cancer vaccines.

    Science.gov (United States)

    Garnett, Charlie T; Greiner, John W; Tsang, Kwong-Yok; Kudo-Saito, Chie; Grosenbach, Douglas W; Chakraborty, Mala; Gulley, James L; Arlen, Philip M; Schlom, Jeffrey; Hodge, James W

    2006-01-01

    For the immune system to mount an effective antitumor T-cell response, an adequate number of T-cells specific for the antigens expressed by the malignancy must be activated [1]. Since most antigens expressed by tumors are "self"-antigens, tumor antigens often lack endogenous immunogenicity and thus do not sufficiently activate T-cells to levels that can mediate tumor eradication. In addition, virtually all solid tumor cells lack the costimulatory molecules necessary to activate tumor-specific T-cells. Approaches that stimulate immune responses to these tumor antigens have the potential to alter this poor responsiveness. This theory has promoted the use of active immunotherapy to generate immune responses against tumor-associated antigens (TAAs) for the treatment of cancer. As one such vaccine strategy, we have utilized poxviruses as delivery vehicles for TAAs in combination with T-cell costimulatory molecules. Initial studies have demonstrated that the insertion of costimulatory molecule trangenes into viral vectors, along with a TAA transgene, greatly enhances the immune response to the antigen. Using this approach, a TRIad of COstimulatory Molecules (TRICOM; B7-1, ICAM-1 and LFA-3) has been shown to enhance T-cell responses to TAAs to levels far greater than any one or two of the costimulatory molecules in combination. In this article, preclinical findings and recent clinical applications of TRICOM-based vaccines as a cancer immunotherapy are reviewed.

  16. Muusikamaailm : Gran Teatre del Liceu taassünd. Orkestrikonverents Tokyos ja vietnami helilooja Phan. Konkursid Kölnis ja Düsseldorfis. Suri fado-lauljatar Amalia Rodrigues / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    1999-01-01

    Barcelonas avas 7. okt. taas uksed Gran Teatre del Liceu, mis hävis tulekahjus 1994.a., teatri hooaja kavast, esinejatest. Jaapanis Tokyos toimunud Aasia maade orkestrikonverentsist. Kölni rahvusvahelise viiuldajate konkursi võitjatest, noorte muusikute nüüdismuusikaansamblite võistlusest Düsseldorfis. A.Rodrigues" lauljategevusest

  17. Mis jääb alles normatiivsest linnaehitusest? = What remains of normative urban constructions? / Endrik Mänd

    Index Scriptorium Estoniae

    Mänd, Endrik, 1972-

    2011-01-01

    16. ja 17. veebruaril 2010 toimunud Tallinna II linnafoorumi teemana kerkis üles Põhjaväilaga seonduv. Linnaliiklusest, soovist taas siduda mereäärsed alad ühtsesse linnakoesse, avaliku linnaruumi esteetilisest kvaliteedist, kiiruspõhimõttest lähtuvast transpordi planeerimisest, Põhjaväila projektist, valikutest transpordis, jalgsiliikujate olukorra parandamise võimalustest

  18. 75 FR 63437 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-10-15

    ... (No. 2011016) for trade adjustment assistance (TAA) for northeast multi-species fish filed under the... to demonstrate that an increase in imports of like or directly competitive articles, during the same... previous 3-year period. However, the import data provided for the same time period showed a 5.8-percent...

  19. Testing as a Service with HammerCloud

    CERN Document Server

    Medrano Llamas, Ramón; Elmsheuser, Johannes; Legger, Federica; Sciacca, Gianfranco; Sciabà, Andrea; van der Ster, Daniel

    2014-01-01

    HammerCloud was designed and born under the needs of the grid community to test the resources and automate operations from a user perspective. The recent developments in the IT space propose a shift to the software defined data centres, in which every layer of the infrastructure can be offered as a service. Testing and monitoring is an integral part of the development, validation and operations of big systems, like the grid. This area is not escaping the paradigm shift and we are starting to perceive as natural the Testing as a Service (TaaS) offerings, which allow testing any infrastructure service, such as the Infrastructure as a Service (IaaS) platforms being deployed in many grid sites, both from the functional and stressing perspectives. This work will review the recent developments in HammerCloud and its evolution to a TaaS conception, in particular its deployment on the Agile Infrastructure platform at CERN and the testing of many IaaS providers across Europe in the context of experiment requirements....

  20. 75 FR 71455 - The Jewelry Stream, Los Angeles, CA; Notice of Affirmation Determination Regarding Application...

    Science.gov (United States)

    2010-11-23

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,145] The Jewelry Stream, Los... Manufacturing, Inc. and The Jewelry Stream, Los Angeles, California. The termination notice was signed on August... identified in the Trade Adjustment Assistance (TAA) petition--M&L Manufacturing, Inc. and The Jewelry Stream...

  1. Pea valmistuvad parteid presidendivalimisteks

    Index Scriptorium Estoniae

    2005-01-01

    Eesti suuremate erakondade juhid oma parteide võimalikest presidendikandidaatidest 2006. aasta valimistel. Rahvaliidu juht Villu Reiljani sõnul on Rahvaliit valmis oma kunagist auesimeest Arnold Rüütlit presidendivalimistel taas toetama. Ilmunud ka Koit, 2005/Oct/13, lk. 2 ; Hiiu Leht, 2005/Oct/14, lk. 2

  2. Iisraeli turismielu Al-Aqsa intifada varjus / Kristel Karu-Kletter

    Index Scriptorium Estoniae

    Karu-Kletter, Kristel, 1971-

    2005-01-01

    2000. aastal alanud palestiinlaste teise ülestõusu tõttu vähenes Iisraeli külastavate turistide hulk 2001. aastal üle poole, kruiisiturism ja tsharterlennud Iisraeli lõppesid peaaegu täielikult, 2003. aastast on Iisraeli saabuvate turistide arv taas tõusuteel

  3. Tornimäe kaksiktornid Tallinnas. Konkursi "Aasta betoonehitis 2007" nominent / Meeli Truu, Juhan Idnurm, Jaan Port...[jt.

    Index Scriptorium Estoniae

    2008-01-01

    AS Nord Projekt; konstruktorid: Juhan Idnurm, Jaan Port, Kaido Kuusiku (Nord Projekt AS), Indrek Heinloo (E-Inseneribüroo OÜ), Matis Teeäär (Neoprojekt OÜ), Kaido Pärl (TAA-Konsult); ehitajad: Lemminkäinen Eesti AS, AS Merko Ehitus; betooni ja betoonelementide tarnijad: AS Rudus Eesti, AS Betoneks

  4. 77 FR 21586 - II-VI, Incorporated, Infrared Optics-Saxonburg Division, Saxonburg, PA; Notice of Affirmative...

    Science.gov (United States)

    2012-04-10

    ..., Infrared Optics--Saxonburg Division, Saxonburg, PA; Notice of Affirmative Determination Regarding... Assistance (TAA) applicable to workers and former workers of II-VI, Incorporated, Infrared Optics--Saxonburg...). The workers were engaged in employment related to the production of infrared and CO 2 laser optics...

  5. 77 FR 27081 - II-VI, Incorporated, Infrared Optics-Saxonburg Division, Saxonburg, Pennsylvania; Notice of...

    Science.gov (United States)

    2012-05-08

    ..., Infrared Optics--Saxonburg Division, Saxonburg, Pennsylvania; Notice of Affirmative Determination Regarding... Assistance (TAA) applicable to workers and former workers of II-VI, Incorporated, Infrared Optics--Saxonburg...). The workers were engaged in employment related to the production of infrared and CO 2 laser optics...

  6. Mure : [luuletused] / Rafit Min ; tlk. Arvo Valton

    Index Scriptorium Estoniae

    Min, Rafit

    2006-01-01

    Sisu: Mure ; Külas ; "Vaid headust ihkab hing meil ikka alati..." ; "Mu valuvaevas rõõm veel pidu peab..." ; "Vabaks lennuks mul lootused kustuvad taas..." ; Hullumaja õuel ; Kuldne tuul ; Viimne rändaja ; Lollide haigus ; "Me ajas tusases ma pole tuisutuul...". Luuletused paralleelselt udmurdi ja eesti keeles

  7. Mazheikiu tehast varustav Vene naftajuhe kuival / Martti Kass

    Index Scriptorium Estoniae

    Kass, Martti

    2006-01-01

    Delfi.lv andmetel pole juba kaheksa päeva Mazheikiai naftatehas Venemaalt naftat saanud. Lätis prognoositakse bensiinihinna olulist tõusu. USA suursaadik Leedus Keith Smith on hoiatanud, et Mazheikiai naftatehasel võib uue omaniku käe all tarneprobleeme tekkida, tema väitel on tunda survet, et Mazheikiai naftatehas taas Venemaa omandusse viia

  8. Uudiseid maailmast / Nele-Eva Steinfeld

    Index Scriptorium Estoniae

    Steinfeld, Nele-Eva

    2013-01-01

    Gramophone jagas auhindu. Salzburgi festivalil uus juht. James Levine juhatas taas METis. Classic BRIT Awards. Andris Nelsons ei pikendanud lepingut Birminghamis. Osmo Vänskä loobus peadirigendi ametist Minnesotas. Auhinnad ECHO Klassik. Ooperiskandaal Lätis. Patrice Chreau (1944-2013)

  9. Muugalt kostub tsingitünni podin / Katariina Krjutškova

    Index Scriptorium Estoniae

    Krjutškova, Katariina

    2010-01-01

    Muuga sadamas asuv ArcelorMittali lehtmetalli tsinkimise tehas käivitab hea turuolukorra tõttu veebruaris taas tootmise. Seisaku ajal keskenduti mehhaniseerimisele ja tööjõu vähendamisele. Sillamäel tegutsev Akron ostis jaanuaris kogu AS-i Bulk Terminal osaluse

  10. Direct virtual photon production in Au+Au collisions at sNN=200 GeV

    Directory of Open Access Journals (Sweden)

    L. Adamczyk

    2017-07-01

    Full Text Available We report the direct virtual photon invariant yields in the transverse momentum ranges 16 GeV/c the production follows TAA scaling. Model calculations with contributions from thermal radiation and initial hard parton scattering are consistent within uncertainties with the direct virtual photon invariant yield.

  11. Läti presidendi suures etenduses mängis peaosa hoopis Ameerika riigipea George W. Bush / Urmo Soonvald

    Index Scriptorium Estoniae

    Soonvald, Urmo

    2005-01-01

    USA presidendi George W. Bushi külaskäigust Riiga. Vt. samas: Rüütel üritas taas Bushi külla kutsuda ; Küsimus president George W. Bushile ; Reklaamiagentuur 100 000 krooniga Bushi ja USA-meelsuse vastu. Töövisiit Läti Vabariiki 06.-07.05.2005

  12. Adavere lihatööstus üritab kolmandat korda turul läbi lüüa / Rein Raudvere

    Index Scriptorium Estoniae

    Raudvere, Rein, 1955-

    2010-01-01

    Vahepeal tühjana seisnud Adavere lihatööstus töötleb taas liha. Jahimeestelt ulukeid kokku ostev ja liha töötlev Eesti-Soome ühisfirma Chef Foods OÜ on aastaga investeerinud 2,5 miljonit krooni. Põhitoodangu moodustab jahutatud ja külmutatud ulukiliha müük

  13. Riia on Liivimaa akadeemia jaoks kohaseim ja sobivaim paik / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2010-01-01

    Esitatud on kaks dokumenti, kus Liivimaa kindralkuberner Jakob Johann Hastfer ja Liivimaa ülemkonsistooriumi juht Johann Fischer esitavad oma seisukohad ja nägemuse, kus peaks Tartu ülikool (Academia Gustaviana) pärast Vene-Rootsi sõda (1659-1661) taas tegutsemist alustama. Hastfer eelistas Riiat ja Fischer Pärnut. Lisatud autori kommentaar

  14. SEB Eesti juht Ahti Asmann : kokkuhoid on hea mõte nii heal kui ka halval ajal / Ahti Asmann ; interv. Andres Reimer

    Index Scriptorium Estoniae

    Asmann, Ahti, 1973-

    2007-01-01

    Ühispanga juhi sõnul toimub panga prognoosi kohaselt järgmisel aastal Eesti majanduses korrektsioon, mis viib kasvu neljale protsendile, 2009. aastal kasvab majandus taas 5-6%. Tema hinnangul on finantstoodetesse investeerimine see, kuhu me Eestis edasi liigume. SEB Grupi laienemisplaanid on seotud ennekõike Ukrainaga

  15. Emmastes heliseb jälle jõulukell / Michael Tarm

    Index Scriptorium Estoniae

    Tarm, Michael

    2000-01-01

    Emmaste külas Hiiumaal lööb taas kirikukell, mille külamehed peitsid 67 aastat tagasi sõja jalust. Kalifornia firma Critical Mass Films kavatseb vändata mängufilmi Hiiumaal Emmaste kiriku kella peitmise loost

  16. 77 FR 59013 - State Journal Register, Camera and Plate Department, Springfield, IL; Notice of Affirmative...

    Science.gov (United States)

    2012-09-25

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,538] State Journal Register... Assistance (TAA) applicable to workers and former workers of State Journal Register, Camera and Plate... on the findings that a significant number or proportion of workers at State Journal Register, Camera...

  17. 77 FR 27085 - TMI Forest Products, Inc., Crane Creek Division, Morton, WA; Notice of Negative Determination...

    Science.gov (United States)

    2012-05-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employment and Training Administration TMI Forest Products, Inc., Crane Creek Division, Morton, WA; Notice of... (TAA), applicable to workers and former workers of TMI Forest Products, Inc., Crane Creek Division...

  18. "Silja Line is back in business" / Pär-Henrik Sjöström

    Index Scriptorium Estoniae

    Sjöström, Pär-Henrik, 1954-

    2008-01-01

    Pärast Silja liitumist Tallink Groupiga on täieliku muutumise läbi teinud organisatsioon taas konkurentsis, kaubamärgid Tallink ja Silja Line. 2009. a. jaanuaris selgub uue kruiisilaeva Cruise 5 marsruut. Kaubaveo areng. Vt. samas: Kaks kaubamärki

  19. 78 FR 50425 - Prospective Grant of Exclusive License: Development of Brachyury Tumor Associated Antigens as...

    Science.gov (United States)

    2013-08-19

    ... Exclusive License: Development of Brachyury Tumor Associated Antigens as Cancer Vaccines for Colorectal... recent approach where tumor associated antigens (TAAs), which are primarily expressed in human tumor cells and not expressed or minimally expressed in normal tissues, are employed to generate a tumor...

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 451 - 500 of 1010 ... Asefa Taa, D G Tanner, Kefyalew Girma, Amanuel Gorfu. Vol 5, No 2 (1997), Grain ... Vol 6, No 2 (1998), Heritability and genotype x environment interaction for yield and components of a yield model in segregating populations of groundnut under semi-arid conditions, Abstract. B R Ntare, J H Williams.

  1. Direct virtual photon production in Au+Au collisions at √{sNN} = 200 GeV

    Science.gov (United States)

    Adamczyk, L.; Adkins, J. K.; Agakishiev, G.; Aggarwal, M. M.; Ahammed, Z.; Ajitanand, N. N.; Alekseev, I.; Anderson, D. M.; Aoyama, R.; Aparin, A.; Arkhipkin, D.; Aschenauer, E. C.; Ashraf, M. U.; Attri, A.; Averichev, G. S.; Bai, X.; Bairathi, V.; Behera, A.; Bellwied, R.; Bhasin, A.; Bhati, A. K.; Bhattarai, P.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Bordyuzhin, I. G.; Bouchet, J.; Brandenburg, J. D.; Brandin, A. V.; Brown, D.; Bunzarov, I.; Butterworth, J.; Caines, H.; Calderón de la Barca Sánchez, M.; Campbell, J. M.; Cebra, D.; Chakaberia, I.; Chaloupka, P.; Chang, Z.; Chankova-Bunzarova, N.; Chatterjee, A.; Chattopadhyay, S.; Chen, X.; Chen, X.; Chen, J. H.; Cheng, J.; Cherney, M.; Christie, W.; Contin, G.; Crawford, H. J.; Das, S.; De Silva, L. C.; Debbe, R. R.; Dedovich, T. G.; Deng, J.; Derevschikov, A. A.; Didenko, L.; Dilks, C.; Dong, X.; Drachenberg, J. L.; Draper, J. E.; Dunkelberger, L. E.; Dunlop, J. C.; Efimov, L. G.; Elsey, N.; Engelage, J.; Eppley, G.; Esha, R.; Esumi, S.; Evdokimov, O.; Ewigleben, J.; Eyser, O.; Fatemi, R.; Fazio, S.; Federic, P.; Federicova, P.; Fedorisin, J.; Feng, Z.; Filip, P.; Finch, E.; Fisyak, Y.; Flores, C. E.; Fujita, J.; Fulek, L.; Gagliardi, C. A.; Garand, D.; Geurts, F.; Gibson, A.; Girard, M.; Grosnick, D.; Gunarathne, D. S.; Guo, Y.; Gupta, A.; Gupta, S.; Guryn, W.; Hamad, A. I.; Hamed, A.; Harlenderova, A.; Harris, J. W.; He, L.; Heppelmann, S.; Heppelmann, S.; Hirsch, A.; Hoffmann, G. W.; Horvat, S.; Huang, B.; Huang, T.; Huang, H. Z.; Huang, X.; Humanic, T. J.; Huo, P.; Igo, G.; Jacobs, W. W.; Jentsch, A.; Jia, J.; Jiang, K.; Jowzaee, S.; Judd, E. G.; Kabana, S.; Kalinkin, D.; Kang, K.; Kauder, K.; Ke, H. W.; Keane, D.; Kechechyan, A.; Khan, Z.; Kikoła, D. P.; Kisel, I.; Kisiel, A.; Kochenda, L.; Kocmanek, M.; Kollegger, T.; Kosarzewski, L. K.; Kraishan, A. F.; Kravtsov, P.; Krueger, K.; Kulathunga, N.; Kumar, L.; Kvapil, J.; Kwasizur, J. H.; Lacey, R.; Landgraf, J. M.; Landry, K. D.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, J. H.; Li, W.; Li, X.; Li, C.; Li, Y.; Lidrych, J.; Lin, T.; Lisa, M. A.; Liu, Y.; Liu, F.; Liu, H.; Liu, P.; Ljubicic, T.; Llope, W. J.; Lomnitz, M.; Longacre, R. S.; Luo, S.; Luo, X.; Ma, G. L.; Ma, Y. G.; Ma, L.; Ma, R.; Magdy, N.; Majka, R.; Mallick, D.; Margetis, S.; Markert, C.; Matis, H. S.; Meehan, K.; Mei, J. C.; Miller, Z. W.; Minaev, N. G.; Mioduszewski, S.; Mishra, D.; Mizuno, S.; Mohanty, B.; Mondal, M. M.; Morozov, D. A.; Mustafa, M. K.; Nasim, Md.; Nayak, T. K.; Nelson, J. M.; Nie, M.; Nigmatkulov, G.; Niida, T.; Nogach, L. V.; Nonaka, T.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Oh, K.; Okorokov, V. A.; Olvitt, D.; Page, B. S.; Pak, R.; Pandit, Y.; Panebratsev, Y.; Pawlik, B.; Pei, H.; Perkins, C.; Pile, P.; Pluta, J.; Poniatowska, K.; Porter, J.; Posik, M.; Poskanzer, A. M.; Pruthi, N. K.; Przybycien, M.; Putschke, J.; Qiu, H.; Quintero, A.; Ramachandran, S.; Ray, R. L.; Reed, R.; Rehbein, M. J.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Roth, J. D.; Ruan, L.; Rusnak, J.; Rusnakova, O.; Sahoo, N. R.; Sahu, P. K.; Salur, S.; Sandweiss, J.; Saur, M.; Schambach, J.; Schmah, A. M.; Schmidke, W. B.; Schmitz, N.; Schweid, B. R.; Seger, J.; Sergeeva, M.; Seyboth, P.; Shah, N.; Shahaliev, E.; Shanmuganathan, P. V.; Shao, M.; Sharma, A.; Sharma, M. K.; Shen, W. Q.; Shi, Z.; Shi, S. S.; Shou, Q. Y.; Sichtermann, E. P.; Sikora, R.; Simko, M.; Singha, S.; Skoby, M. J.; Smirnov, N.; Smirnov, D.; Solyst, W.; Song, L.; Sorensen, P.; Spinka, H. M.; Srivastava, B.; Stanislaus, T. D. S.; Strikhanov, M.; Stringfellow, B.; Sugiura, T.; Sumbera, M.; Summa, B.; Sun, Y.; Sun, X. M.; Sun, X.; Surrow, B.; Svirida, D. N.; Tang, A. H.; Tang, Z.; Taranenko, A.; Tarnowsky, T.; Tawfik, A.; Thäder, J.; Thomas, J. H.; Timmins, A. R.; Tlusty, D.; Todoroki, T.; Tokarev, M.; Trentalange, S.; Tribble, R. E.; Tribedy, P.; Tripathy, S. K.; Trzeciak, B. A.; Tsai, O. D.; Ullrich, T.; Underwood, D. G.; Upsal, I.; Van Buren, G.; van Nieuwenhuizen, G.; Vasiliev, A. N.; Videbæk, F.; Vokal, S.; Voloshin, S. A.; Vossen, A.; Wang, G.; Wang, Y.; Wang, F.; Wang, Y.; Webb, J. C.; Webb, G.; Wen, L.; Westfall, G. D.; Wieman, H.; Wissink, S. W.; Witt, R.; Wu, Y.; Xiao, Z. G.; Xie, W.; Xie, G.; Xu, J.; Xu, N.; Xu, Q. H.; Xu, Y. F.; Xu, Z.; Yang, Y.; Yang, Q.; Yang, C.; Yang, S.; Ye, Z.; Ye, Z.; Yi, L.; Yip, K.; Yoo, I.-K.; Yu, N.; Zbroszczyk, H.; Zha, W.; Zhang, Z.; Zhang, X. P.; Zhang, J. B.; Zhang, S.; Zhang, J.; Zhang, Y.; Zhang, J.; Zhang, S.; Zhao, J.; Zhong, C.; Zhou, L.; Zhou, C.; Zhu, X.; Zhu, Z.; Zyzak, M.

    2017-07-01

    We report the direct virtual photon invariant yields in the transverse momentum ranges 1 6 GeV / c the production follows TAA scaling. Model calculations with contributions from thermal radiation and initial hard parton scattering are consistent within uncertainties with the direct virtual photon invariant yield.

  2. A single bout of dynamic exercise enhances the expansion of MAGE-A4 and PRAME-specific cytotoxic T-cells from healthy adults

    NARCIS (Netherlands)

    LaVoy, E.C.P.; Bollard, C.M.; Hanley, P.J.; Blaney, J.W.; O'Connor, D.P.; Bosch, J.A.; Simpson, R.J.

    2015-01-01

    The ex vivo expansion of tumor-associated-antigen (TAA)- specific cytotoxic T-cells (CTLs) from healthy donors for adoptive transfer to cancer patients is now providing additional treatment options for patients. Many studies have shown that adoptive transfer of expanded CTLs can reduce the risk of

  3. 76 FR 40400 - Sony Music Holdings, Inc., D/B/A Sony DADC Americas, a Subsidiary of Sony Corporation of America...

    Science.gov (United States)

    2011-07-08

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-75,181] Sony Music Holdings, Inc., D/B/A Sony DADC Americas, a Subsidiary of Sony Corporation of America Including On-Site Leased... Adjustment Assistance (TAA) applicable to workers and former workers of Sony Music Holdings, Inc. (``SMHI...

  4. 75 FR 41430 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-07-16

    ... Service (FAS) has denied a petition (No. 2010017) for trade adjustment assistance (TAA) for apples that was filed by the Minnesota Apple Growers Association, Inc. (MAGA) and accepted for review by USDA on... DEPARTMENT OF AGRICULTURE Foreign Agricultural Service Trade Adjustment Assistance for Farmers...

  5. Avangardi võimatus Eestis / Sirje Helme, Anders Härm, Reet Varblane

    Index Scriptorium Estoniae

    Helme, Sirje, 1949-

    2004-01-01

    Tallinna Kunstihoones avatud Emilia ja Ilja Kabakovi ning Raul Meele ühisnäituse poolt taas tõstatatud küsimusest, miks vene 1960-ndate ja 1970-ndate alternatiivne, põrandaalune, kontseptuaalne kunst on maailmas läbi löönud, eesti oma aga mitte, ka laiemalt avangardismi võimalusest

  6. Hypothyroidism minimizes the effects of acute hepatic failure caused by endoplasmic reticulum stress and redox environment alterations in rats.

    Science.gov (United States)

    Blas-Valdivia, Vanessa; Cano-Europa, Edgar; Martinez-Perez, Yoalli; Lezama-Palacios, Ruth; Franco-Colin, Margarita; Ortiz-Butron, Rocio

    2015-10-01

    The aim of this study was to investigate if a protective effect from hypothyroidism in acute liver failure resulted from reduced endoplasmic reticulum stress and changes to the redox environment. Twenty male Sprague-Dawley rats were divided in four groups: (1) euthyroid (sham surgery), (2) hypothyroid, (3) euthyroid (sham surgery)+thioacetamide and (4) hypothyroid+thioacetamide. Hypothyroidism was confirmed two weeks after thyroidectomy, and thioacetamide (TAA) (400mg/kg, ip) was administrated to the appropriate groups for three days with supportive therapy. Grades of encephalopathy in all animals were determined using behavioral tests. Animals were decapitated and their blood was obtained to assess liver function. The liver was dissected: the left lobe was used for histology and the right lobe was frozen for biochemical assays. Body weight, rectal temperature and T4 concentration were lower in hypothyroid groups. When measurements of oxidative stress markers, redox environment, γ-glutamylcysteine synthetase and glutathione-S-transferase were determined, we observed that hypothyroid animals with TAA compensated better with oxidative damage than euthyroid animals treated with TAA. Furthermore, we measured reduced expressions of GADD34, caspase-12 and GRP78 and subsequently less hypothyroidism-induced cellular damage in hypothyroid animals. We conclude that hypothyroidism protects against hepatic damage caused by TAA because it reduces endoplasmic reticulum stress and changes to the redox environment. Copyright © 2015 Elsevier GmbH. All rights reserved.

  7. Riik nõuab Weroli endiselt juhilt 54 miljonit krooni / Mirko Ojakivi

    Index Scriptorium Estoniae

    Ojakivi, Mirko

    2006-01-01

    Advokaadibüroo Laus & Partnerid koostatud õiguslikust analüüsist, milles käsitletakse Erki Aaviku tegevust AS-i Werol Tehased juhatuse liikmena. Riik on esitanud avalduse tsiviilhagi algatamise kohta E. Aavikult kahju väljanõudmiseks 54 miljoni krooni ulatuses, AS Biodiesel nõuab kohtu kaudu Werolilt 140 miljonit krooni. Lisa: Weroli kohal taas pankrotioht

  8. Instructional Comparative Advantages May Exist Despite the "Comprehensive Uniformity" of Traditional Public Schools

    Science.gov (United States)

    Merrifield, John

    2012-01-01

    A special tabulation of individual student scores from the Texas Assessment of Academic Skills (TAAS) test allowed a ranking of Texas schools according to test score changes ("value added"). The rankings varied greatly by student subpopulation. That is, the vast majority of schools are much more effective with some kinds of students than…

  9. Hugo Bossi kunstiauhind / Maria-Kristiina Soomre

    Index Scriptorium Estoniae

    Soomre, Maria-Kristiina, 1978-

    2002-01-01

    Guggenheimi muuseum New Yorgis annab 2002. a. sügisel taas välja Hugo Bossi kunstiauhinna: 50000 dollarit ja isiknäitus Guggenheimis 2003. a. alguses. Kandidaadid: Francis Alys, Olafur Eliasson, Hachiya Kazuhiko, Koo Jeong-a, Pierre Huyghe, Anri Sala

  10. Uued ja vanad ruumimängud / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    1998-01-01

    Inglise-eesti ühisnäitus 'Private views : taas/avastatud ruum Eesti ja Briti kaasaegses kunstis' Rotermanni soolalaos. Kuraatorid Mare Tralla, Pam Skelton. Feminismist kui tähenduslikust ruumist. Eve Kiileri, Mari Koorti, Liina Siibi, Susan Brindi, Ene-Liis Semperi, Anu Juuraku, Naomi Dinesi, rühmituse F.F.F.F., kuraatorite esinemisest.

  11. Investor kardab ebakindlust / Aigar Ojaots

    Index Scriptorium Estoniae

    Ojaots, Aigar, 1974-

    2007-01-01

    ÜRO eriraportööri Jean Ziegleri avaldus kehtestada biokütuse kasutamisele viieks aastaks moratoorium võib viia olukorrani, kus keegi ei julge investeerida uutesse tehnoloogiatesse, kuna 5 aasta pärast võidakse taas meelt muuta

  12. Järvakandi Klaasi edu tõstab emafirma aktsiat New Yorgi börsil / Annika Matson

    Index Scriptorium Estoniae

    Matson, Annika, 1976-

    2005-01-01

    USA kontserni Owens-Illinoisi tütarfirmadest, turuosast, Eesti tütarfirma AS-i Järvakandi Klaas laienemisplaanidest. Diagrammid: Järvakandi Klaas ootab tänavu taas kasumi kasvu; Owens-Illinoisi aktsia on investoritele tulus olnud. Vt. samas: Owens-Illinois on olnud hea aktsia

  13. 75 FR 34172 - Lordstown Seating Systems, a Subsidiary of Magna Seating, Including Workers Whose Unemployment...

    Science.gov (United States)

    2010-06-16

    ... certification for workers of the subject firm. The workers produce seating for automobiles. New information shows that some workers separated from employment at the subject firm had their wages reported under a... secondarily affected as a supplier of seating for automobiles to a TAA certified firm. The amended notice...

  14. 76 FR 27669 - Automotive Components Holdings, LLC, a Subsidiary of Ford Motor Company, Saline Plant Division...

    Science.gov (United States)

    2011-05-12

    ... Unibar. New information provided by subject firm officials, the United Automobile, Aerospace, and..., Saline, Michigan (subject firm) to apply for Trade Adjustment Assistance (TAA). The Department's Notice..., revealed that workers and former workers of the subject firm, including workers whose wages were reported...

  15. 75 FR 41895 - Inteva Products, LLC Adrian, Michigan; Inteva Products, LLC Troy, Michigan; Amended Certification...

    Science.gov (United States)

    2010-07-19

    ... instruments and door panels) for automobiles to a TAA certified firm. The amended notice applicable to TA-W-72... subject firm. The workers are engaged in the production of component parts (automotive instruments and door panels) for automobiles. New findings show that worker separations occurred during the relevant...

  16. 75 FR 65514 - Automotive Components Holdings, LLC, A Subsidiary of Ford Motor Company, Saline Plant Division...

    Science.gov (United States)

    2010-10-25

    ... United Automobile, Aerospace, and Agricultural Implement Workers of America (UAW), Local 1124, requested... Adjustment Assistance (TAA) applicable to workers and former workers of the subject firm. The determination... workers were employed at the subject firm. The Department has carefully reviewed the request for...

  17. 2256-IJBCS-Article-Essodina Talaki

    African Journals Online (AJOL)

    hp

    Les trypanosomoses animales africaines (TAA) demeurent une des contraintes majeures au développement de l'élevage en Afrique subsaharienne. La présente étude a été conduite en mars 2013 dans cinq (5) localités correspondant aux cantons (Boulohou, Djarkpanga, Kangnigbara, Saiboudè et Tindjassi) de la.

  18. 75 FR 7045 - Key Gas Components, Inc., Marion, NC; Notice of Negative Determination Regarding Application for...

    Science.gov (United States)

    2010-02-16

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-71,701] Key Gas Components, Inc... the decision. The negative determination of the TAA petition filed on behalf of workers at Key Gas... by workers of the subject firm. Moreover, the petitioner alleged that Key Gas Components imports...

  19. Training Humans for the Human Domain

    Science.gov (United States)

    2015-11-01

    Advisors (CULADS-UK); Human Terrain Analysis ( HTA ); Socio-cultural Analysis; Target Audience Analy- sis (TAA); “Influence”; the list is long. As... attention and resources, or lack of them, devoted to it by command. This is further evidenced by the fact that the basic principles of understanding

  20. Iidamast ja Aadamast ehk "Ahvide planeet" / Jaak Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Jaak

    2001-01-01

    Taas on ekraanile jõudnud Pierre Boulle'i raamatu ainetel "Ahvide planeet" ("Planet of the Apes") : režissöör Tim Burton : Ameerika Ühendriigid 2001. Autor võrdleb seda 1968.a. filmiga ning Ain Kaalepi näidendiga "Iidamast ja Aadamast"

  1. Kuidas Helena Bonham Carter ahviks muutus

    Index Scriptorium Estoniae

    2001-01-01

    Taas on ekraanile jõudnud "Ahvide planeet" ("Planet of the Apes") : režissöör Tim Burton : Ameerika Ühendriigid 2001. Kuidas tehti näitlejatele ahvide grimmi. Lähemalt Helena Bonham Carteri grimmist

  2. 75 FR 28661 - Ceda-Pine Veneer, Inc., a Subsidiary of Excaliber, Inc., Sandpoint, ID; Notice of Negative...

    Science.gov (United States)

    2010-05-21

    ... Employment and Training Administration Ceda-Pine Veneer, Inc., a Subsidiary of Excaliber, Inc., Sandpoint, ID... negative determination of the TAA petition filed on behalf of workers at Ceda-Pine Veneer, Inc., Sandpoint... veneer and lumber boards revealed no increase imports nor any increased reliance on imports on the part...

  3. Performant Mutation Identification Using Targeted Next-Generation Sequencing of 14 Thoracic Aortic Aneurysm Genes

    NARCIS (Netherlands)

    Proost, D.; Vandeweyer, G.; Meester, J.A.; Salemink, S.; Kempers, M.; Ingram, C.; Peeters, N.; Saenen, J.; Vrints, C.; Lacro, R.V.; Roden, D.; Wuyts, W.; Dietz, H.C.; Mortier, G.; Loeys, B.L.; Laer, L. Van

    2015-01-01

    At least 14 causative genes have been identified for both syndromic and nonsyndromic forms of thoracic aortic aneurysm/dissection (TAA), an important cause of death in the industrialized world. Molecular confirmation of the diagnosis is increasingly important for gene-tailored patient management but

  4. Kodus isa, sarjas poeg / Harro Puusild

    Index Scriptorium Estoniae

    Puusild, Harro

    2010-01-01

    Muuhulgas ka Kanal 2 krimisarjas "Kelgukoerad" kaasa tegev Madis Milling ja tema poeg Markus. Näitleja uusim projekt on "Laulud tähtedega" TV3-s, mis ühendab teda taas huumorisarjas "Õpetajate tuba" mänginud laulja Inesega

  5. Digitaalelu ja elektroonilised deklaratsioonid / Martin Huberg

    Index Scriptorium Estoniae

    Huberg, Martin, 1976-

    2009-01-01

    Kohustusest esitada tulu- ja sotsiaalmaksu ning kohustusliku kogumispensioni ja töötuskindlustuse maksete deklaratsioon (TSD) ja käibedeklaratsioon (KMD) elektrooniliselt. Lisa: Taas MTA töövõitudest (MTA pressiteade 07. 04. 2009) ; käibemaksuseaduse ja maksukorralduse seaduse muutmise seaduse eelnõu (EML kiri Rahandusministeeriumile 18. 05. 2009)

  6. Synthesis of hierarchical CuS flower-like submicrospheres via an ...

    Indian Academy of Sciences (India)

    Administrator

    Institute of Physical Chemistry, Zhejiang Normal University, Jinhua 321004, PR China. †. College of Chemistry and Life ... The method was based on a reaction between CuCl2 and thioacetamide (TAA) in aqueous solution with using ... Keywords. Copper sulfide; ionic liquids; nanomaterials; semiconductors. 1. Introduction.

  7. Does rural residence impact total ankle arthroplasty utilization and outcomes?

    Science.gov (United States)

    Singh, Jasvinder A; Ramachandaran, Rekha

    2016-02-01

    The objective of this study was to compare total ankle arthroplasty (TAA) utilization and outcomes by patient residence. We used the Nationwide Inpatient Sample (NIS) from 2003 to 2011 to compare utilization and outcomes (post-arthroplasty discharge disposition, length of hospitalization, and mortality) by rural vs. urban residence. Ten thousand eight hundred thirty-three patients in urban and 3,324 patients in rural area underwent TAA. Compared to rural residents, urban residents had: lower mean age, 62.4 vs. 61.8 years (p residence: (1) 11.3 % rural vs. 14.2 % urban residents were discharged to an inpatient facility (p = 0.098); (2) length of hospital stay above the median stay, was 44.8 vs. 42.2 % (p = 0.30); and (3) mortality was 0.2 vs. 0.1 %, respectively (p = 0.81). Multivariable-adjusted logistic regression models did not show any significant differences in discharge to home, length of stay, or mortality, by residence. Our study demonstrated an absence of any evidence of rural-urban differences in TAA outcomes. The rural-urban differences in TAA utilization noted in 2003 were no longer significant in 2011.

  8. NY-ESO-1- and survivin-specific T-cell responses in the peripheral blood from patients with glioma

    DEFF Research Database (Denmark)

    Liu, Zhenjiang; Poiret, Thomas; Persson, Oscar

    2018-01-01

    (n = 38 samples) protein expression in tumor specimens. T-cells from peripheral blood were stimulated with TAAs (synthetic peptides) in IL-2 and IL-7, or using a combination of IL-2, IL-15 and IL-21. CD4+ and CD8+ T-cells were tested for antigen-specific proliferation by flow cytometry, and IFN...

  9. 78 FR 31593 - Aleris Recycling Bens Run, LLC, Including On-Site Leased Workers From Winans Extras Support...

    Science.gov (United States)

    2013-05-24

    ... [Federal Register Volume 78, Number 101 (Friday, May 24, 2013)] [Notices] [Page 31593] [FR Doc No: 2013-12382] DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,388] Aleris Recycling... (TAA) applicable to workers and former workers of Aleris Recycling Bens Run, LLC, Friendly, West...

  10. Avariist paranev maavanem asus tööle / Erik Kalda

    Index Scriptorium Estoniae

    Kalda, Erik, 1969-

    2006-01-01

    Ilmunud ka: Severnoje Poberezhje 29. märts lk. 1, Narvskaja Nedelja 1. apr. lk. 2. Mullu detsembris ränka avariisse sattunud Ida-Viru maavanem Ago Silde asus taas tööle, tegeldes maikuus toimuva Ida-Virumaa arengukonverentsi ettevalmistamisega

  11. 78 FR 11895 - Prospective Grant of Exclusive License: Development of MUC-1 Tumor Associated Antigens as Cancer...

    Science.gov (United States)

    2013-02-20

    ... recent approach where tumor associated antigens (TAAs), which are primarily expressed in human tumor cells, and not expressed or minimally expressed in normal tissues, are employed to generate a tumor... royalty bearing and will comply with the terms and conditions of 35 U.S.C. 209 and 37 CFR Part 404.7. The...

  12. 76 FR 5832 - International Business Machines (IBM), Software Group Business Unit, Optim Data Studio Tools QA...

    Science.gov (United States)

    2011-02-02

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,554] International Business Machines (IBM), Software Group Business Unit, Optim Data Studio Tools QA, San Jose, CA; Notice of... determination of the TAA petition filed on behalf of workers at International Business Machines (IBM), Software...

  13. 76 FR 21033 - International Business Machines (IBM), Sales and Distribution Business Unit, Global Sales...

    Science.gov (United States)

    2011-04-14

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,364] International Business Machines (IBM), Sales and Distribution Business Unit, Global Sales Solution Department, Off-Site Teleworker... (TAA) applicable to workers and former workers of International Business Machines (IBM), Sales and...

  14. Läti tehnoloogiafirma SAF Tehnika on Hiina turgu hülgamas / Lauri Matsulevitsh

    Index Scriptorium Estoniae

    Matsulevitsh, Lauri

    2005-01-01

    Läti ettevõtte SAF Tehnika kasum kahanes enam kui kahekordselt seoses tootmise vähendamisega Hiina turule. Diagramm: SAFi aktsia taas aasta madalamatel tasemetel. Vt. samas: Analüütikud soovitavad SAFi aktsiat osta; Eesti fondid on SAFi aktsiatest suuresti loobunud

  15. Riigikontrolli ja parlamendi koostöö on paranenud / Mihkel Oviir ; inter. Peep Lillemägi

    Index Scriptorium Estoniae

    Oviir, Mihkel, 1942-

    2008-01-01

    Ilmunud ka: Tallinna Teataja : Haabersti, Kristiine ja Põhja-Tallinn märts, lk. 6, Tallinna Teataja : Kesklinn, Lasnamäe ja Pirita märts, lk. 6. Taas ametisse nimetatud riigikontrolör rääkis sellest, mida ta oma ametis oluliseks peab ja mida uuel ametiajal teisiti teha soovib

  16. Olof Palme mõrvar võib olla hoopis tshiillane / Allan Espenberg

    Index Scriptorium Estoniae

    Espenberg, Allan

    2008-01-01

    Rootsi ajakirjanikul Anders Leopoldil ilmus käesoleval aastal teos, mis võtab taas luubi alla Olof Palme mõrva ja tõstatab sellega seoses uusi versioone. Raamatus "Rootsi puu tuleb langetada" seostatakse peaministri mõrva Tšiili tolleaegse kõrgema juhtkonnaga

  17. Using Target Audience Analysis to Aid Strategic Level Decisionmaking

    Science.gov (United States)

    2015-08-01

    come out of Afghanistan.” Dr. Tatham is the author of two books: Los- ing Arab Hearts & Minds. The Coalition, Al-Jazeera and Muslim Public Opinion...center of gravity for government or in the National Security Council Secretariat . 42 WHY GOVERNMENTS WILL NOT INVEST IN STRATEGIC TAA Professor Julian

  18. Low temperature synthesis of wurtzite zinc sulfide (ZnS) thin films by chemical spray pyrolysis.

    Science.gov (United States)

    Zeng, Xin; Pramana, Stevin S; Batabyal, Sudip K; Mhaisalkar, Subodh G; Chen, Xiaodong; Jinesh, K B

    2013-05-14

    Zinc sulfide (ZnS) thin films have been synthesized by spray pyrolysis at 310 °C using an aqueous solution of zinc chloride (ZnCl2) and thioacetamide (TAA). Highly crystalline films were obtained by applying TAA instead of thiourea (TU) as the sulfur source. X-ray diffraction (XRD) analyses show that the films prepared by TAA contained a wurtzite structure, which is usually a high temperature phase of ZnS. The crystallinity and morphology of the ZnS films appeared to have a strong dependence on the spray rate as well. The asymmetric polar structure of the TAA molecule is proposed to be the intrinsic reason of the formation of highly crystalline ZnS at comparatively low temperatures. The violet and green emissions from photoluminescence (PL) spectroscopy reflected the sulfur and zinc vacancies in the film. Accordingly, the photodetectors fabricated using these films exhibit excellent response to green and red photons of 525 nm and 650 nm respectively, though the band gaps of the materials, estimated from optical absorption spectroscopy, are in the range of 3.5-3.6 eV.

  19. Amino acid profiles of sufu, a Chinese fermented soybean food

    NARCIS (Netherlands)

    Han, B.; Rombouts, F.M.; Nout, M.J.R.

    2004-01-01

    Sufu is a Chinese soybean cheese-like product obtained by solid-state fungal fermentation and ripening of tofu. The resulting "pehtze" is salted, followed by maturation in brine. Total (TAA) and free amino acid (FAA) profiles were determined during consecutive stages of sufu manufacture, i.e., tofu,

  20. Super 2000 - ralli MMi päästja? / Madis Vodja

    Index Scriptorium Estoniae

    Vodja, Madis

    2006-01-01

    Ralli WRC-sari on peamiselt autospordiföderatsiooni süü tõttu sügavas kriisis, kuid juba paari aasta pärast näeme Super 2000 sarja, mis võib ralli populaarsuse tõsta taas hiilgeaegade tasemele

  1. 75 FR 41430 - Trade Adjustment Assistance for Farmers

    Science.gov (United States)

    2010-07-16

    ... #0; #0;Notices #0; Federal Register #0; #0; #0;This section of the FEDERAL REGISTER contains documents other than rules #0;or proposed rules that are applicable to the public. Notices of hearings #0... trade adjustment assistance (TAA) for apples that was filed by the New York Apple Association and...

  2. Mobile-bearing total ankle arthroplasty : a fundamental assessment of the clinical, radiographic and functional outcomes

    NARCIS (Netherlands)

    Doets, Hendrik Cornelis

    2009-01-01

    Ankle arthritis often leads to significant impairments for the patient. As total ankle arthroplasty (TAA) with use of fixed-bearing (2-component) total ankle prostheses has a high rate of early failures, fusion of the ankle joint is, until today, considered to be the standard surgical treatment for

  3. Kukk's role in promoting consumers cooperatives in Estonia / Alfons Laar

    Index Scriptorium Estoniae

    Laar, Alfons

    2016-01-01

    Juhan Kuke osast Eesti ühiskaubanduse edendamisel. Kaubandusühistute loomise mõte kandus Eestisse Riia sakslaste poolt. Eesti Tarvitajateühisuste Keskühisusest. 1941. aastal sai ETK-st Eesti Tarbijate Kooperatiivide Vabariiklik Liit ehk ETKVL 1991. aastal sai ETKVL-st taas ETK

  4. Testing as a Service with HammerCloud

    Science.gov (United States)

    Medrano Llamas, Ramón; Barrand, Quentin; Elmsheuser, Johannes; Legger, Federica; Sciacca, Gianfranco; Sciabà, Andrea; van der Ster, Daniel

    2014-06-01

    HammerCloud was designed and born under the needs of the grid community to test the resources and automate operations from a user perspective. The recent developments in the IT space propose a shift to the software defined data centres, in which every layer of the infrastructure can be offered as a service. Testing and monitoring is an integral part of the development, validation and operations of big systems, like the grid. This area is not escaping the paradigm shift and we are starting to perceive as natural the Testing as a Service (TaaS) offerings, which allow testing any infrastructure service, such as the Infrastructure as a Service (IaaS) platforms being deployed in many grid sites, both from the functional and stressing perspectives. This work will review the recent developments in HammerCloud and its evolution to a TaaS conception, in particular its deployment on the Agile Infrastructure platform at CERN and the testing of many IaaS providers across Europe in the context of experiment requirements. The first section will review the architectural changes that a service running in the cloud needs, such an orchestration service or new storage requirements in order to provide functional and stress testing. The second section will review the first tests of infrastructure providers on the perspective of the challenges discovered from the architectural point of view. Finally, the third section will evaluate future requirements of scalability and features to increase testing productivity.

  5. Sõnade asemel ootame tegusid / Raili Lepik

    Index Scriptorium Estoniae

    Lepik, Raili

    2002-01-01

    ERL-i Järva maakonna esinaine Raili Lepik nimetab ERL-i seaduseelnõusid, mille arutelu Riigikogu esimesel töönädalal taas katkestati. Tulumaksuseaduse muutmise eelnõust, selle hääletamisest. Autor: ERL

  6. Effects of pre-harvest methyl jasmonate treatment on post-harvest ...

    African Journals Online (AJOL)

    MeJA) on weight loss, color characteristics (L*, C* and h°), firmness, soluble solids content (SSC), titratable acidity (TA), total phenolics (TP) and total antioxidant activity (TAA) of 'Black Beauty', 'Black Amber' and 'Fortune' plum fruits during the ...

  7. Dollar aina tugevneb / Kristel Raesaar

    Index Scriptorium Estoniae

    Raesaar, Kristel

    2000-01-01

    Valuutaspekulantide hirm USA majanduse järsu halvenemise ees on lahtunud ja vahepeal nõrgenenud dollar võib lähinädalatel taas rünnata uusi rekordtasemeid. Graafik: Dollari kursi muutus alates euro loomisest

  8. Programm Newstandard

    Index Scriptorium Estoniae

    1998-01-01

    Euroopa arhitektidele ja ehitusmaterjalide firmadele on taas hakanud huvi pakkuma konstrueeritavad puumajad. 1998. a. kevadel Austrias toimunud arhitektuurinäitusel moodustasid neljandiku väljapanekust valmiselementidest majad. Nimekaid esinejaid. Esitati uusi lahendusi Philippe Starkilt, Matteo Thunilt. Saksa firma 'Allkauf' käivitatud programmist 'Newstandard', mis hõlmab 15 disainerelamuprojekti. Illustratsiooniks Hilmer & Sattleri, Kollhoff & Timmermanni, Diener & Dieneri projektid.

  9. Assessing educational outcomes in middle childhood: validation of the Teacher Academic Attainment Scale.

    Science.gov (United States)

    Johnson, Samantha; Marlow, Neil; Wolke, Dieter

    2012-06-01

    Assessing educational outcomes in high-risk populations is crucial for defining long-term outcomes. As standardized tests are costly and time-consuming, we assessed the use of the Teacher Academic Attainment Scale (TAAS) as an outcome measure. Three hundred and forty three children in mainstream schools aged 10 to 11 years (144 males, 199 females; 190 extremely preterm and 153 term; mean age 10 y 9 mo, SD 5.5 mo, range 9 y 8 mo-12 y 3 mo) were assessed using the reading and mathematics scales of the criterion standard Wechsler Individual Achievement Test, 2nd (UK) edition (WIAT-II). Class teachers completed the TAAS, a seven-item questionnaire for assessing academic attainment. The TAAS was also completed at 6 years of age for 266 children. Cronbach's alpha 0.95 indicated excellent internal consistency, and the correlation between TAAS scores at 6 and 11 years indicated good test-retest reliability (r=0.77, pscale studies. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

  10. Tamsalu ähvardab töötute arvu plahvatuslik kasv / Väinu Rozental

    Index Scriptorium Estoniae

    Rozental, Väinu, 1957-

    2004-01-01

    Kui AS-i Tamsalu Veskid võlausaldajad otsustavad tegevuse lõpetada, tähendab see 175 inimese koondamist. Kommenteerivad Riho Tell ja Toomas Uudeberg. Diagramm: Töötute arv linnas ja vallas taas tõusmas. Lisa: Tamsalu. Vt. samas: Menetluses on kaks pankrotiprotsessi

  11. 75 FR 24753 - The Walker Auto Group, Inc., Miamisburg, OH; Notice of Negative Determination Regarding...

    Science.gov (United States)

    2010-05-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,471] The Walker Auto Group... Auto Group, Inc., Miamisburg, Ohio, was based on the finding that the subject firm did not shift abroad... of the subject firm should be eligible for TAA because the Walker Auto Group, Inc., Miamisburg, Ohio...

  12. Rüütli selgitustöö tõstis toetust euroliidule / Toomas Mattson

    Index Scriptorium Estoniae

    Mattson, Toomas, 1970-

    2003-01-01

    Emori uuringu kohaselt on president Arnold Rüütli kui riigi usaldusväärseima ja hinnatuima poliitiku jah-sõna Eesti ühinemisele Euroopa Liiduga tõstnud toetuse liitumisele 53 protsendini valimisealistest kodanikest. Kommentaar uuringufirma suunajuhatajalt Aivar Voogilt. Samas diagramm: Poolehoid ELile taas tõusuteel. Ilmunud ka: Eesti Elu = Estonian Life (2003/Jul/23) lk. 2

  13. Bagatellid : maailm / Mailis Põld

    Index Scriptorium Estoniae

    Põld, Mailis

    2006-01-01

    Muusikasõnumeid mujalt maailmast: Pianist Irina Zahharenkova mainekal konkursil Itaalias taas võidukas. Lorin Maazel. Kadunud ja taasleitud Hindemithi teos jõudis esiettekandeni. Suri 20. sajandi olulisimaid ja isikupärasemaid heliloojaid György Ligeti

  14. Adidas nopib jalgpalli EM-ilt suurima kasu / Erik Aru

    Index Scriptorium Estoniae

    Aru, Erik

    2007-01-01

    Adidas esitles ametlikku EM-i jalgpalli EUROPASS. Adidase jalgpallivarustuse müük langes suurvõistluste puudumise tõttu sel aastal miljardi euroni, 2008. aastaks kavatsetakse taas jõuda 1,2 miljardi kroonini. Nike tahab suurendada oma turuosa jalgpallivarustuse vallas. Lisa: Jalgpallureid varustab neli firmat

  15. 76 FR 61744 - Xpedite Systems, LLC Deerfield Beach, Florida; Notice of Negative Determination on Reconsideration

    Science.gov (United States)

    2011-10-05

    ... Adjustment Assistance (TAA) petition is dated October 8, 2010 and was filed by three workers who supplied... firm in the production of an article or supply of a service that was the basis for the afore-mentioned... allegations: ``* * * there was a contract between Xpedite and AppLabs, an Indian company to do customer...

  16. PASS-Predicted Hepatoprotective Activity of Caesalpinia sappan in Thioacetamide-Induced Liver Fibrosis in Rats

    Directory of Open Access Journals (Sweden)

    Farkaad A. Kadir

    2014-01-01

    Full Text Available The antifibrotic effects of traditional medicinal herb Caesalpinia sappan (CS extract on liver fibrosis induced by thioacetamide (TAA and the expression of transforming growth factor β1 (TGF-β1, α-smooth muscle actin (αSMA, and proliferating cell nuclear antigen (PCNA in rats were studied. A computer-aided prediction of antioxidant and hepatoprotective activities was primarily performed with the Prediction Activity Spectra of the Substance (PASS Program. Liver fibrosis was induced in male Sprague Dawley rats by TAA administration (0.03% w/v in drinking water for a period of 12 weeks. Rats were divided into seven groups: control, TAA, Silymarin (SY, and CS 300 mg/kg body weight and 100 mg/kg groups. The effect of CS on liver fibrogenesis was determined by Masson’s trichrome staining, immunohistochemical analysis, and western blotting. In vivo determination of hepatic antioxidant activities, cytochrome P450 2E1 (CYP2E1, and matrix metalloproteinases (MPPS was employed. CS treatment had significantly increased hepatic antioxidant enzymes activity in the TAA-treated rats. Liver fibrosis was greatly alleviated in rats when treated with CS extract. CS treatment was noted to normalize the expression of TGF-β1, αSMA, PCNA, MMPs, and TIMP1 proteins. PASS-predicted plant activity could efficiently guide in selecting a promising pharmaceutical lead with high accuracy and required antioxidant and hepatoprotective properties.

  17. Ühendriigid valmistavad ette uut sõjatandrit Iraanis / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister

    2007-01-01

    USA süüdistused Iraani vastu on teravnenud, Euroopa ühe diplomaadi sõnul on sõjaline rünnak taas päevakorral ning tõsisemalt kui kunagi varem. Zbigniew Brzezinski hoiatab, et USA löök Iraani pihta viiks laiema konfliktini. Lisa: Väed juba kogunevad

  18. Throbbing Gristle ja surnud punktid popkultuuris / Tõnis Kahu

    Index Scriptorium Estoniae

    Kahu, Tõnis, 1962-

    2010-01-01

    Ansamblist Throbbing Gristle (Genesis P-Orridge, Chris Carter, Cosey Fanni Tutti, Peter "Sleazy" Christopherson, 1975-1981). Tegemist on bändiks transformeerunud kunstirühmitusega COUM Transmissions (1969-1976). Throbbing Gristle taasühines 2004. aastal

  19. In Vitro Assessment of the Expression and T Cell Immunogenicity of the Tumor-Associated Antigens BORIS, MUC1, hTERT, MAGE-A3 and Sp17 in Uterine Cancer

    Directory of Open Access Journals (Sweden)

    Anke Vanderstraeten

    2016-09-01

    Full Text Available Background: While immunotherapy moved to the forefront of treatment of various cancers, it remains underexplored for uterine cancer. This might be due to the small patient population with advanced endometrial carcinoma and uterine sarcoma. Data about immunotherapeutic targets are scarce in endometrial carcinoma and lacking in uterine sarcoma. Methods: Expression of five tumor-associated antigens (TAA (BORIS, MUC1, hTERT, MAGE-A3 and Sp17 was validated in uterine tumor samples by immunohistochemistry (IHC and/or quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR. TAA immunogenicity was analyzed by determining spontaneous T cell responses towards overlapping peptide pools covering the whole TAA in patient blood. Results: At mRNA level, MAGE-A3 and Sp17 were overexpressed in a minority of patients and BORIS was moderately overexpressed (26% in endometrial carcinoma and 62% in uterine sarcoma. hTERT was overexpressed in the vast majority of tumors. On protein level, MUC1 was upregulated in primary, recurrent and metastatic EMCAR and in metastatic US tumors. hTERT protein was highly expressed in both normal and malignant tissue. Spontaneous TAA-specific T cell responses were detected in a minority of patients, except for hTERT to which T cell responses occurred more frequently. Conclusions: These data point to MUC1 and hTERT as most suitable targets based on expression levels and T cell immunogenicity for use in immunotherapeutic regimens.

  20. Targeting epigenetic processes in photodynamic therapy-induced anticancer immunity

    Directory of Open Access Journals (Sweden)

    Malgorzata eWachowska

    2015-07-01

    Full Text Available Photodynamic therapy (PDT of cancer is an approved therapeutic procedure that generates oxidative stress leading to cell death of tumour and stromal cells. Cell death resulting from oxidative damage to intracellular components leads to the release of damage-associated molecular patterns (DAMPs that trigger robust inflammatory response and creates local conditions for effective sampling of tumour-associated antigens (TAA by antigen presenting cells. The latter can trigger development of TAA-specific adaptive immune response. However, due to a number of mechanisms, including epigenetic regulation of TAA expression, tumour cells evade immune recognition. Therefore, numerous approaches are being developed to combine PDT with immunotherapies to allow development of systemic immunity. In this review we describe immunoregulatory mechanisms of epigenetic treatments that were shown to restore the expression of epigenetically silenced or down-regulated major histocompatibility complex (MHC molecules as well as TAA. We also discuss the results of our recent studies showing that epigenetic treatments based on administration of methyltransferase inhibitors in combination with photodynamic therapy can release effective mechanisms leading to development of antitumour immunity and potentiated antitumour effects.

  1. Oktoober toob maailmas ühinemiste rekordi / Annika Matson

    Index Scriptorium Estoniae

    Matson, Annika, 1976-

    2003-01-01

    Analüüsikeskuse Thomson Financiali turustrateeg Richard Peterson prognoosib aasta lõpuks 6,65 triljoni krooni suurust liitumis- ja ühinemiskavatsuste mahtu. Seni on ainuüksi oktoobris üle maailma ühinemiskavatsustest teatatud kokku 1,38 triljoni krooni mahus. Diagramm: Firmade ülevõtmine taas kasvamas

  2. Interface engineering of hybrid perovskite solar cells with poly(3-thiophene acetic acid) under ambient conditions.

    Science.gov (United States)

    Shit, Arnab; Nandi, Arun K

    2016-04-21

    The properties of methyl ammonium lead iodide (MAPbI3) perovskite solar cells with poly(3-thiophene acetic acid) (P3TAA) as a hole transporting material (HTM) and a dense layer of ZnO nanoparticle film as an electron transporting material (ETM) are described using the conventional ZnO (n)/perovskite (i)/P3TAA (p) (n-i-p) architecture. The FT-IR spectra of a MAPbI3/P3TAA mixture indicate a shift of the N-H stretching and the abolition of the N-H bending peak indicating the interaction between the components. UV-Vis spectra of the mixture exhibit a large red shift of the π-π* transition peak of the conjugated chain arising from the interaction causing an increase of the conjugation length. The cross-sectional SEM image of the device shows the sequence of the individual layers of ZnO, MAPbI3, P3TAA and Ag, respectively. The current density (J)-voltage (V) curves obtained upon illumination with a light of 100 mW cm(-2) indicate the average PCE to be 7.38 ± 0.59% under ambient conditions. The IPCE values of these cells reach about 63% across a broad range of wavelength (300-800 nm). The HOMO and the LUMO of P3TAA are measured using cyclic voltammetry and the optical band gap and the relative energy level of the components explain the operation of photocurrent in the cell. For comparison purposes a device using poly(3-hexyl thiophene) (P3HT) as the HTM is fabricated under similar conditions and it exhibits a lower PCE (5.85 ± 0.51%) than that of the P3TAA based device. The longevity of the P3TAA based cell is also found to be better than that of the P3HT based cell for storing in air. The UV-Vis and impedance spectral results clearly explain the above results, signifying the influence of the interface on the performance of hybrid solar cells.

  3. Melatonin mitigates thioacetamide-induced hepatic fibrosis via antioxidant activity and modulation of proinflammatory cytokines and fibrogenic genes.

    Science.gov (United States)

    Lebda, Mohamed A; Sadek, Kadry M; Abouzed, Tarek K; Tohamy, Hossam G; El-Sayed, Yasser S

    2018-01-01

    The potential antifibrotic effects of melatonin against induced hepatic fibrosis were explored. Rats were allocated into four groups: placebo; thioacetamide (TAA) (200mg/kg bwt, i.p twice weekly for two months); melatonin (5mg/kgbwt, i.p daily for a week before TAA and continued for an additional two months); and melatonin plus TAA. Hepatic fibrotic changes were evaluated biochemically and histopathologically. Hepatic oxidative/antioxidative indices were assessed. The expression of hepatic proinflammatory cytokines (tumor necrosis factor-α, and interleukin-1β), fibrogenic-related genes (transforming growth factor-1β, collagen I, collagen, III, laminin, and autotaxin) and an antioxidant-related gene (thioredoxin-1) were detected by qRT-PCR. In fibrotic rats, melatonin lowered serum aspartate aminotransferase, alanine aminotransferase, and autotaxin activities, bilirubin, hepatic hydroxyproline and plasma ammonia levels. Melatonin displayed hepatoprotective and antifibrotic potential as indicated by mild hydropic degeneration of some hepatocytes and mild fibroplasia. In addition, TAA induced the depletion of glutathione, glutathione s-transferase, glutathione peroxidase, superoxide dismutase, catalase, and paraoxonase-1 (PON-1), while inducing the accumulation of malondialdehyde, protein carbonyl (C=O) and nitric oxide (NO), and DNA fragmentation. These effects were restored by melatonin pretreatment. Furthermore, melatonin markedly attenuated the expression of proinflammatory cytokines and fibrogenic genes via the upregulation of thioredoxin-1 mRNA transcripts. Melatonin exhibits potent anti-inflammatory, antioxidant and fibrosuppressive activities against TAA-induced hepatic fibrogenesis via the suppression of oxidative stress, DNA damage, proinflammatory cytokines and fibrogenic gene transcripts. In addition, we demonstrate that the antifibrotic activity of melatonin is mediated by the induction of thioredoxin-1 with attenuation of autotaxin expressions

  4. Dimorphic effects of transforming growth factor-β signaling during aortic aneurysm progression in mice suggest a combinatorial therapy for Marfan syndrome.

    Science.gov (United States)

    Cook, Jason R; Clayton, Nicholas P; Carta, Luca; Galatioto, Josephine; Chiu, Emily; Smaldone, Silvia; Nelson, Carol A; Cheng, Seng H; Wentworth, Bruce M; Ramirez, Francesco

    2015-04-01

    Studies of mice with mild Marfan syndrome (MFS) have correlated the development of thoracic aortic aneurysm (TAA) with improper stimulation of noncanonical (Erk-mediated) TGFβ signaling by the angiotensin type I receptor (AT1r). This correlation was largely based on comparable TAA modifications by either systemic TGFβ neutralization or AT1r antagonism. However, subsequent investigations have called into question some key aspects of this mechanism of arterial disease in MFS. To resolve these controversial points, here we made a head-to-head comparison of the therapeutic benefits of TGFβ neutralization and AT1r antagonism in mice with progressively severe MFS (Fbn1(mgR/mgR) mice). Aneurysm growth, media degeneration, aortic levels of phosphorylated Erk and Smad proteins and the average survival of Fbn1(mgR/mgR) mice were compared after a ≈3-month-long treatment with placebo and either the AT1r antagonist losartan or the TGFβ-neutralizing antibody 1D11. In contrast to the beneficial effect of losartan, TGFβ neutralization either exacerbated or mitigated TAA formation depending on whether treatment was initiated before (postnatal day 16; P16) or after (P45) aneurysm formation, respectively. Biochemical evidence-related aneurysm growth with Erk-mediated AT1r signaling, and medial degeneration with TGFβ hyperactivity that was in part AT1r dependent. Importantly, P16-initiated treatment with losartan combined with P45-initiated administration of 1D11 prevented death of Fbn1(mgR/mgR) mice from ruptured TAA. By demonstrating that promiscuous AT1r and TGFβ drive partially overlapping processes of arterial disease in MFS mice, our study argues for a therapeutic strategy against TAA that targets both signaling pathways although sparing the early protective role of TGFβ. © 2015 American Heart Association, Inc.

  5. Definitive Management of Oligometastatic Melanoma in a Murine Model Using Combined Ablative Radiation Therapy and Viral Immunotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, Miran [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Shim, Kevin G. [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Department of Immunology, Mayo Clinic, Rochester, Minnesota (United States); Grams, Michael P. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Rajani, Karishma; Diaz, Rosa M. [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Furutani, Keith M. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Thompson, Jill [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Olivier, Kenneth R.; Park, Sean S. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Markovic, Svetomir N. [Department of Immunology, Mayo Clinic, Rochester, Minnesota (United States); Department of Medical Oncology, Mayo Clinic, Rochester, Minnesota (United States); Pandha, Hardev [The Postgraduate Medical School, University of Surrey, Guildford (United Kingdom); Melcher, Alan [Leeds Institute of Cancer Studies and Pathology, University of Leeds, Leeds (United Kingdom); Harrington, Kevin [Targeted Therapy Laboratory, The Institute of Cancer Research, London (United Kingdom); Zaidi, Shane [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Targeted Therapy Laboratory, The Institute of Cancer Research, London (United Kingdom); Vile, Richard, E-mail: vile.richard@mayo.edu [Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota (United States); Department of Immunology, Mayo Clinic, Rochester, Minnesota (United States); Leeds Institute of Cancer Studies and Pathology, University of Leeds, Leeds (United Kingdom)

    2015-11-01

    Purpose: The oligometastatic state is an intermediate state between a malignancy that can be completely eradicated with conventional modalities and one in which a palliative approach is undertaken. Clinically, high rates of local tumor control are possible with stereotactic ablative radiation therapy (SABR), using precisely targeted, high-dose, low-fraction radiation therapy. However, in oligometastatic melanoma, virtually all patients develop progression systemically at sites not initially treated with ablative radiation therapy that cannot be managed with conventional chemotherapy and immunotherapy. We have demonstrated in mice that intravenous administration of vesicular stomatitis virus (VSV) expressing defined tumor-associated antigens (TAAs) generates systemic immune responses capable of clearing established tumors. Therefore, in the present preclinical study, we tested whether the combination of systemic VSV-mediated antigen delivery and SABR would be effective against oligometastatic disease. Methods and Materials: We generated a model of oligometastatic melanoma in C57BL/6 immunocompetent mice and then used a combination of SABR and systemically administered VSV-TAA viral immunotherapy to treat both local and systemic disease. Results: Our data showed that SABR generates excellent control or cure of local, clinically detectable, and accessible tumor through direct cell ablation. Also, the immunotherapeutic activity of systemically administered VSV-TAA generated T-cell responses that cleared subclinical metastatic tumors. We also showed that SABR induced weak T-cell-mediated tumor responses, which, particularly if boosted by VSV-TAA, might contribute to control of local and systemic disease. In addition, VSV-TAA therapy alone had significant effects on control of both local and metastatic tumors. Conclusions: We have shown in the present preliminary murine study using a single tumor model that this approach represents an effective, complementary

  6. Investigation of Therapeutic Effects of α-Mangostin on Thioacetamide-Induced Cirrhosis in Rats.

    Science.gov (United States)

    Supawadee, Sukseree; Thanet, Sophonnithiprasert; Wisut, Pradidarcheep; Somneuk, Nilbunga; Sirinun, Nilwarangoon; Ramida, Watanapokasin

    2015-10-01

    To determine the effects of alpha-mangostin on thioacetamide (TAA)-induced liver cirrhosis in rats. Male Wistar rats were divided into 3 groups and treated with intraperitoneal injections of TAA (200 mg/kg) 3 times per week for per week for 8, 12 and 16 weeks, respectively. One subgroup was left untreated whereas the other two were treated either with 100 mg/kg α-mangostin or vehicle alone (80% DMSO, 20% water), which were administered intraperitoneally 3 times per weekfor a total of4 weeks. The incidence offibrotic nodules on the liver and the serum levels of the liver enzymes aspartate transaminase (AST) and alanine transaminase (ALT) were measured. Moreover the liver cirrhosis-related genes expression and p53 protein level in liver were analyzed by quantitative reverse transcription PCR and Western blot analysis, respectively. Fibrotic nodules on the liver were formed upon treatment with TAA for 12 or 16 weeks. The nodules were then reduced by treatment with α-mangostin as compared to treatment with the vehicle DMSO. Moreover, the serum levels of the liver enzymes AST and ALT after treatment with α-mangostin decreased as compared to DMSO alone. The liver cirrhosis-related genes expression showed no significant differences, whereas the p53 protein level in liver showed that α-mangostin reduced risk of liver fibrosis through the decrease in p53 expression as compared to the TAA_DMSO treatment. The results suggest that α-mangostin has a beneficial therapeutic effect in the TAA liver cirrhosis model. Further investigations on mechanisms of α-mangostin as therapeutic agent should be determined.

  7. Persistent Aortic Arch Hypoplasia After Coarctation Treatment Is Associated With Late Systemic Hypertension.

    Science.gov (United States)

    Quennelle, Sophie; Powell, Andrew J; Geva, Tal; Prakash, Ashwin

    2015-06-25

    Mild transverse aortic arch (TAA) hypoplasia is common after coarctation treatment, but is considered benign in the absence of an arm-leg systolic blood pressure (SBP) difference. Hypertension (HTN) is a common long-term morbidity after successful coarctation treatment. We examined whether mild TAA hypoplasia after coarctation treatment is associated with late systemic HTN. We retrospectively reviewed 92 patients (median age, 19.9 years; range, 4.9 to 57.8; 60% male) 14.1±10.3 years after successful coarctation treatment (surgery in 63, stent in 16, and balloon dilation in 13), excluding those with resting right arm-leg blood pressure gradient >20 mm Hg, atypical coarctation, and major associated heart defects. Minimum body-surface area (BSA)-adjusted TAA cross-sectional area (CSA) was calculated from cardiac magnetic resonance (CMR) images. On follow-up, 38 of 92 (41%) patients had systemic HTN using standard criteria. Systemic HTN was independently associated with smaller TAA CSA/BSA (P=0.006; odds ratio [OR], 6.41 per 0.5 cm(2)/m(2) decrease), higher age at CMR (P=0.03; OR, 1.57 per 5-year increase), and in a subset (n=61), higher arm-leg SBP difference during exercise (P=0.05; OR, 1.03 per 1-mm-Hg increase). Lower ratio of TAA diameter/descending aorta diameter was associated with a larger increase in right arm SBP during peak exercise (P=0.006; r(2)=0.11). Persistent mild aortic arch hypoplasia, even in the absence of an arm-leg SBP difference at rest, is associated with late systemic HTN. Further studies should be undertaken to determine whether more-aggressive arch reconstruction at initial repair can reduce the incidence of systemic HTN. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

  8. Decreased excitability and voltage-gated sodium currents in aortic baroreceptor neurons contribute to the impairment of arterial baroreflex in cirrhotic rats.

    Science.gov (United States)

    Lee, Choong-Ku; Park, Kwang-Hwa; Baik, Soon-Koo; Jeong, Seong-Woo

    2016-06-01

    Cardiovascular autonomic dysfunction, which is manifested by an impairment of the arterial baroreflex, is prevalent irrespective of etiology and contributes to the increased morbidity and mortality in cirrhotic patients. However, the cellular mechanisms that underlie the cirrhosis-impaired arterial baroreflex remain unknown. In the present study, we examined whether the cirrhosis-impaired arterial baroreflex is attributable to the dysfunction of aortic baroreceptor (AB) neurons. Biliary and nonbiliary cirrhotic rats were generated via common bile duct ligation (CBDL) and intraperitoneal injections of thioacetamide (TAA), respectively. Histological and molecular biological examinations confirmed the development of fibrosis in the livers of both cirrhotic rat models. The heart rate changes during phenylephrine-induced baroreceptor activation indicated that baroreflex sensitivity was blunted in the CBDL and TAA rats. Under the current-clamp mode of the patch-clamp technique, cell excitability was recorded in DiI-labeled AB neurons. The number of action potential discharges in the A- and C-type AB neurons was significantly decreased because of the increased rheobase and threshold potential in the CBDL and TAA rats compared with sham-operated rats. Real-time PCR and Western blotting indicated that the NaV1.7, NaV1.8, and NaV1.9 transcripts and proteins were significantly downregulated in the nodose ganglion neurons from the CBDL and TAA rats compared with the sham-operated rats. Consistent with these molecular data, the tetrodotoxin-sensitive NaV currents and the tetrodotoxin-resistant NaV currents were significantly decreased in A- and C-type AB neurons, respectively, from the CBDL and TAA rats compared with the sham-operated rats. Taken together, these findings implicate a key cellular mechanism in the cirrhosis-impaired arterial baroreflex. Copyright © 2016 the American Physiological Society.

  9. Intracerebral Administration of S-Adenosylhomocysteine or S-Adenosylmethionine Attenuates the Increases in the Cortical Extracellular Levels of Dimethylarginines Without Affecting cGMP Level in Rats with Acute Liver Failure.

    Science.gov (United States)

    Czarnecka, Anna; Milewski, Krzysztof; Jaźwiec, Radosław; Zielińska, Magdalena

    2017-01-01

    Alterations in brain nitric oxide (NO)/cGMP synthesis contribute to the pathogenesis of hepatic encephalopathy (HE). An increased asymmetrically dimethylated derivative of L-arginine (ADMA), an endogenous inhibitor of NO synthases, was observed in plasma of HE patients and animal models. It is not clear whether changes in brain ADMA reflect its increased local synthesis therefore affecting NO/cGMP pathway, or are a consequence of its increased peripheral blood content. We measured extracellular concentration of ADMA and symmetrically dimethylated isoform (SDMA) in the prefrontal cortex of control and thioacetamide (TAA)-induced HE rats. A contribution of locally synthesized dimethylarginines (DMAs) in their extracellular level in the brain was studied after direct infusion of the inhibitor of DMAs synthesizing enzymes (PRMTs), S-adenosylhomocysteine (AdoHcy, 2 mM), or the methyl donor, S-adenosylmethionine (AdoMet, 2 mM), via a microdialysis probe. Next, we analyzed whether locally synthesized ADMA attains physiological significance by determination of extracellular cGMP. The expression of PRMT-1 was also examined. Concentration of ADMA and SDMA, detected by positive mode electrospray LC-DMS-MS/MS, was greatly enhanced in TAA rats and was decreased (by 30 %) after AdoHcy and AdoMet infusion. TAA-induced increase (by 40 %) in cGMP was unaffected after AdoHcy administration. The expression of PRMT-1 in TAA rat brain was unaltered. The results suggest that (i) the TAA-induced increase in extracellular DMAs may result from their effective synthesis in the brain, and (ii) the excess of extracellular ADMA does not translate into changes in the extracellular cGMP concentration and implicate a minor role in brain NO/cGMP pathway control.

  10. Organometallic catalysts for primary phosphoric acid fuel cells

    Science.gov (United States)

    Walsh, Fraser

    1987-01-01

    A continuing effort by the U.S. Department of Energy to improve the competitiveness of the phosphoric acid fuel cell by improving cell performance and/or reducing cell cost is discussed. Cathode improvement, both in performance and cost, available through the use of a class of organometallic cathode catalysts, the tetraazaannulenes (TAAs), was investigated. A new mixed catalyst was identified which provides improved cathode performance without the need for the use of a noble metal. This mixed catalyst was tested under load for 1000 hr. in full cell at 160 to 200 C in phosphoric acid H3PO4, and was shown to provide stable performance. The mixed catalyst contains an organometallic to catalyze electroreduction of oxygen to hydrogen peroxide and a metal to catalyze further electroreduction of the hydrogen peroxide to water. Cathodes containing an exemplar mixed catalyst (e.g., Co bisphenyl TAA/Mn) operate at approximately 650 mV vs DHE in 160 C, 85% H3PO4 with oxygen as reactant. In developing this mixed catalyst, a broad spectrum of TAAs were prepared, tested in half-cell and in a rotating ring-disk electrode system. TAAs found to facilitate the production of hydrogen peroxide in electroreduction were shown to be preferred TAAs for use in the mixed catalyst. Manganese (Mn) was identified as a preferred metal because it is capable of catalyzing hydrogen peroxide electroreduction, is lower in cost and is of less strategic importance than platinum, the cathode catalyst normally used in the fuel cell.

  11. Circulating type-1 anti-tumor CD4+ T cells are preferentially pro-apoptotic in cancer patients

    Directory of Open Access Journals (Sweden)

    Amy K. Wesa

    2014-09-01

    Full Text Available Melanoma patients frequently exhibit a deficiency in Type-1 (but not Type-2 or regulatory CD4+ T cell responses against tumor-associated antigens (TAA, which may limit protection against cancer progression or responsiveness to immunotherapy in these individuals. Since such deficiency was acutely evident in patients with active disease, where chronic stimulation of anti-tumor CD4+ T cells would be expected and activation-induced cell death may be prevalent, we employed MHC Class II-peptide tetramers to characterize the frequency and apoptotic status of TAA- vs. influenza (FluM1 virus-specific CD4+ T cells in the peripheral blood of HLA-DR*0401+ patients with melanoma or renal cell carcinoma (RCC. We observed that Flu-specific CD4+ T cells ranged from 0.17 to 3.89%, while up to approximately 1% of CD4+ T cells reacted against individual TAA epitopes derived from the EphA2 or MAGE-6 proteins. The frequencies of EphA2 and MAGE-6-specific CD4+ T cells in patients were significantly correlated with active disease and patient gender (i.e. females > males, while frequencies of Flu-specific CD4+ T cells were distributed within a normal range in all patients. Notably, patient CD4+ T cells reactive with MHC class II-TAA (but not MHC class II-Flu tetramers were significantly enriched for a pro-apoptotic (Annexin-V+ phenotype, particularly amongst the Th1 (T-bet+ subset. These results suggest that the preferential sensitivity of TAA (but not viral-specific CD4+ Th1 cells to apoptosis in melanoma patients with active disease will need to be overcome for optimal clinical benefit of immunotherapeutic approaches to be realized.

  12. Association of modeled long-term personal exposure to ultrafine particles with inflammatory and coagulation biomarkers.

    Science.gov (United States)

    Lane, Kevin J; Levy, Jonathan I; Scammell, Madeleine K; Peters, Junenette L; Patton, Allison P; Reisner, Ellin; Lowe, Lydia; Zamore, Wig; Durant, John L; Brugge, Doug

    2016-01-01

    Long-term exposure to fine particulate matter has been linked to cardiovascular disease and systemic inflammatory responses; however, evidence is limited regarding the effects of long-term exposure to ultrafine particulate matter (UFP, <100nm). We used a cross-sectional study design to examine the association of long-term exposure to near-highway UFP with measures of systemic inflammation and coagulation. We analyzed blood samples from 408 individuals aged 40-91years living in three near-highway and three urban background areas in and near Boston, Massachusetts. We conducted mobile monitoring of particle number concentration (PNC) in each area, and used the data to develop and validate highly resolved spatiotemporal (hourly, 20m) PNC regression models. These models were linked with participant time-activity data to determine individual time-activity adjusted (TAA) annual average PNC exposures. Multivariable regression modeling and stratification were used to assess the association between TAA-PNC and single peripheral blood measures of high-sensitivity C-reactive protein (hsCRP), interleukin-6 (IL-6), tumor-necrosis factor alpha receptor II (TNFRII) and fibrinogen. After adjusting for age, sex, education, body mass index, smoking and race/ethnicity, an interquartile-range (10,000particles/cm(3)) increase in TAA-PNC had a positive non-significant association with a 14.0% (95% CI: -4.6%, 36.2%) positive difference in hsCRP, an 8.9% (95% CI: -0.4%, 10.9%) positive difference in IL-6, and a 5.1% (95% CI: -0.4%, 10.9%) positive difference in TNFRII. Stratification by race/ethnicity revealed that TAA-PNC had larger effect estimates for all three inflammatory markers and was significantly associated with hsCRP and TNFRII in white non-Hispanic, but not East Asian participants. Fibrinogen had a negative non-significant association with TAA-PNC. Our findings suggest an association between annual average near-highway TAA-PNC and subclinical inflammatory markers of CVD risk

  13. Severe nivolumab-induced pneumonitis preceding durable clinical remission in a patient with refractory, metastatic lung squamous cell cancer: a case report

    Directory of Open Access Journals (Sweden)

    Hong Li

    2017-02-01

    Full Text Available Abstract Background Programmed cell death 1 (PD-1 and its ligand 1 (PD-L1 inhibitors have quickly become standard of care for patients with advanced non-small cell lung cancer and increasing numbers of other cancer types. In this report, we discuss the clinical history, pathological evaluation, and genomic findings in a patient with metastatic lung squamous cell cancer (SCC who developed severe nivolumab-induced pneumonitis preceding durable clinical remission after three doses of nivolumab. Case presentation A patient with chemotherapy-refractory, metastatic lung SCC developed symptomatic pneumonitis by week 4 after nivolumab treatment, concurrently with onset of a potent antitumor response. Despite discontinuation of nivolumab after three doses and the use of high dose oral corticosteroids for grade 3 pneumonitis, continued tumor response to a complete remission by 3 months was evident by radiographic assessment. At the time of this submission, the patient has remained in clinical remission for 14 months. High PD-L1 expression by immunohistochemistry staining was seen in intra-alveolar macrophages and viable tumor cells in the pneumonitis and recurrent tumor specimens, respectively. Tumor genomic profiling by FoundationOne targeted exome sequencing revealed a very high tumor mutation burden (TMB corresponding to 95–96 percentile in lung SCC, i.e., 87.4–91.0 and 82.9 mut/Mb, respectively, in pre- and post-nivolumab tumor specimens. Except for one, the 13 functional genomic alterations remained the same in the diagnostic, recurrent, and post-treatment, relapsed tumor specimens, suggesting that nivolumab reset the patient’s immune system against one or more preexisting tumor-associated antigens (TAAs. One potential TAA candidate is telomerase reverse transcriptase (TERT in which an oncogenic promoter -146C>T mutation was detected. Human leukocyte antigen (HLA typing revealed HLA-A*0201 homozygosity, which is the prevalent HLA class I

  14. Polyphenols content and antioxidant activity of paprika and pepper spices

    Directory of Open Access Journals (Sweden)

    Soňa Škrovánková

    2017-01-01

    Full Text Available Paprika spices (Capsicium annuum and black pepper spices (Piper nigrum are very popular seasonings for culinary and industrial utilization due to the change of sensory quality (taste, aroma, color of foods and meals with their addition; their health promoting properties; and also, relevant antioxidant activity. Polyphenols are often responsible for the antioxidant capacity of plant products therefore in our study the content of polyphenols (TP and antioxidant activity (TAA were assessed in two common culinary spices - paprika spices (12, ground powder spices and pepper spices (20, unground and ground, black, green, white and colored spices of Czech, Austrian, and Slovak producers. These parameters were determined using spectrometric method, for total polyphenols method with Folin-Ciocaulteu reagent; the antioxidant activity (TAA of aqueous and ethanolic extracts of spices was measured by DPPH method with IC50 evaluation. For paprika the total polyphenol content ranged from 14.67 to 28.78 mg GAE.g-1. However, there is only weak connection between the pungency of the spices and the polyphenolic amount, the hotter samples of paprika spices have slightly higher values of TP than sweet types. Also, more pungent paprika products showed a higher potency in scavenging of DPPH free radical than sweeter ones; and ethanolic extracts had slightly higher TAA values (8.73 to 16.17 mg AAE.g-1 than aqueous spice extracts (4.45 to 16.24 mg AAE.g-1. Phenolic amount for pepper spices was assessed in the range of 12.03 to 22.88 mg GAE.g-1. Generally, paprika spices contained more polyphenols than pepper spices. The values of TAA of pepper spices were in the range from 7.07 to 15.81 mg AAE.g-1 for aqueous extracts and from 8.25 to 15.93 mg AAE.g-1 for ethanolic extracts respectively. The highest TAA values were observed for white ground pepper and unground black pepper spices. Unground black pepper samples had higher TAA than ground black pepper. The extent of

  15. Potent and conditional redirected T cell killing of tumor cells using Half DVD-Ig.

    Science.gov (United States)

    Bardwell, Philip D; Staron, Matthew M; Liu, Junjian; Tao, Qingfeng; Scesney, Susanne; Bukofzer, Gail; Rodriguez, Luis E; Choi, Chee-Ho; Wang, Jennifer; Chang, Qing; Dong, Feng; Donawho, Cherrie; Wang, Jieyi; Grinnell, Christine M; Tarcsa, Edit; Hutchins, Charles; Ghayur, Tariq; Gu, Jijie

    2018-01-01

    Novel biologics that redirect cytotoxic T lymphocytes (CTLs) to kill tumor cells bearing a tumor associated antigen hold great promise in the clinic. However, the ability to safely and potently target CD3 on CTL toward tumor associated antigens (TAA) expressed on tumor cells remains a challenge of both technology and biology. Herein we describe the use of a Half DVD-Ig format that can redirect CTL to kill tumor cells. Notably, Half DVD-Ig molecules that are monovalent for each specificity demonstrated reduced non-specific CTL activation and conditional CTL activation upon binding to TAA compared to intact tetravalent DVD-Ig molecules that are bivalent for each specificity, while maintaining good drug like properties and appropriate PK properties.

  16. No effect of melatonin on oxidative stress after laparoscopic cholecystectomy

    DEFF Research Database (Denmark)

    Kücükakin, B.; Klein, M.; Lykkesfeldt, Jens

    2010-01-01

    Background Melatonin, an endogenous circadian regulator, also has antioxidant and anti-inflammatory properties. The aim of this study was to evaluate the antioxidative effect of melatonin in patients undergoing laparoscopic cholecystectomy. Methods Patients were randomized to receive 10 mg...... melatonin or placebo during surgery. Blood samples for analysis of malondialdehyde (MDA), ascorbic acid (AA), total ascorbic acid (TAA) dehydroascorbic acid (DHA) and C-reactive protein (CRP) were collected pre-operatively and at 5 min, 6 h and 24 h after operation. Results Twenty patients received...... melatonin and 21 patients received placebo during surgery. No significant differences were observed between the groups in the oxidative stress variables MDA, TAA, AA and DHA or in the inflammatory variable CRP (repeated-measures ANOVA, P > 0.05 for all variables). Conclusions Administration of 10 mg...

  17. No effect of melatonin on oxidative stress after laparoscopic cholecystectomy: a randomized placebo-controlled trial

    DEFF Research Database (Denmark)

    Kucukakin, B.; Klein, M.; Lykkesfeldt, Jens

    2010-01-01

    Background Melatonin, an endogenous circadian regulator, also has antioxidant and anti-inflammatory properties. The aim of this study was to evaluate the antioxidative effect of melatonin in patients undergoing laparoscopic cholecystectomy. Methods Patients were randomized to receive 10 mg...... melatonin or placebo during surgery. Blood samples for analysis of malondialdehyde (MDA), ascorbic acid (AA), total ascorbic acid (TAA) dehydroascorbic acid (DHA) and C-reactive protein (CRP) were collected pre-operatively and at 5 min, 6 h and 24 h after operation. Results Twenty patients received...... melatonin and 21 patients received placebo during surgery. No significant differences were observed between the groups in the oxidative stress variables MDA, TAA, AA and DHA or in the inflammatory variable CRP (repeated-measures ANOVA, P > 0.05 for all variables). Conclusions Administration of 10 mg...

  18. Foundations for Tools as a Service Workspace: A Reference Architecture

    DEFF Research Database (Denmark)

    Chauhan, Muhammad Aufeef

    Nowadays, on-demand provisioning of computing resources following a payper- use service model have enabled client organizations to have easy and on the fly access to the resources. The resources that are provisioned using the service model are generally characterized as resource as a Service (*aa....... This dissertation presents an approach to provide Tools as a service workSPACE (TSPACE), which is characterized as provisioning of a bundled suite of Tools as a Service (TaaS) required to perform activities associated with a specific domain as part of a cloud-enabled workspace. The presented approach is focused...... associated with software architecting of cloud-enabled systems, (b) TSPACE reference architecture design guidelines, (c) TSPACE requirements, (d) information structuring needs and methods of TSPACE reference architecture, (e) a detailed description of TSPACE reference architecture sub-systems and components...

  19. T cell recognition of breast cancer antigens

    DEFF Research Database (Denmark)

    Petersen, Nadia Viborg; Andersen, Sofie Ramskov; Andersen, Rikke Sick

    Recent studies are encouraging research of breast cancer immunogenicity to evaluate the applicability ofimmunotherapy as a treatment strategy. The epitope landscape in breast cancer is minimally described, thus it is necessary to identify T cell targets to develop immune mediated therapies.......This project investigates four proteins commonly upregulated in breast cancer and thus probable tumor associated antigens (TAAs). Aromatase, prolactin, NEK3, and PIAS3 contribute to increase growth, survival, and motility of malignant cells. Aspiring to uncover novel epitopes for cytotoxic T cells, a reverse...... recognition utilizing DNA barcode labeled MHC multimers to screen peripheral blood lymphocytes from breast cancer patients and healthy donor samples. Signif-icantly more TAA specific T cell responses were detected in breast cancer patients than healthy donors for both HLA-A*0201 (P

  20. The auxins, IAA and PAA, are synthesized by similar steps catalyzed by different enzymes.

    Science.gov (United States)

    Cook, Sam D; Ross, John J

    2016-11-01

    One of the fundamental plant growth substances, indole-3-acetic acid (IAA), belongs to a class of phytohormones known as auxins. The main IAA biosynthesis pathway involves the conversion of tryptophan to indole-3-pyruvic acid, which is in turn converted to IAA. The two enzymes responsible for these conversions, members of the TAA1 and YUCCA gene families, respectively, have recently been implicated in the synthesis of another auxin, phenylacetic acid (PAA). While there is some evidence to support this theory, there are also some concerns. Here we address the question: to what extent does the TAA1/YUCCA system contribute to the biosynthesis of PAA? In addition, we highlight the importance of measuring auxin metabolites and conjugates in addressing such questions.

  1. Architecturally Significant Requirements Identification, Classification and Change Management for Multi-tenant Cloud-Based Systems

    DEFF Research Database (Denmark)

    Chauhan, Muhammad Aufeef; Probst, Christian W.

    2017-01-01

    identification, classification, and change management challenges. We have explored findings from systematic as well as structured reviews of the literature on quality requirements of the cloud-based systems including but not limited to security, availability, scalability, privacy, and multi-tenancy. We have...... presented a framework for requirements classification and change management focusing on distributed Platform as a Service (PaaS) and Software as a Service (SaaS) systems as well as complex software ecosystems that are built using PaaS and SaaS, such as Tools as a Service (TaaS). We have demonstrated......-time status of the tenant-specific architecture quality requirements can be monitored and system configurations can be adjusted accordingly. For the systems that can be used by multiple tenants, the requirements change management framework should consider if the addition or modification (triggered...

  2. Ameliorative Effect of Camel's Milk and Nigella Sativa Oil against Thioacetamide-induced Hepatorenal Damage in Rats.

    Science.gov (United States)

    Ahmad, Aftab; Al-Abbasi, Fahad A; Sadath, Saida; Ali, Soad Shaker; Abuzinadah, Mohammed F; Alhadrami, Hani A; Mohammad Alghamdi, Anwar Ali; Aseeri, Ali H; Khan, Shah Alam; Husain, Asif

    2018-01-01

    Camel milk (CM) and Nigella sativa (NS) have been traditionally claimed to cure wide range of diseases and used as medicine in different part of world, particularly in Saudi Arabia. Several research studies have been published that proved beneficial effects of CM and NS. This study was undertaken to investigate the antihepatotxic potential of CM and NS oil (NSO) against thioacetamide (TAA)-induced hepato and nephrotoxicity in rats. Thirty female Albino Wistar rats were randomly divided in to six groups having five rats in each group. A single subcutaneous injection of TAA (100 mg/kg b. w.) was administered to all the rats in Group-II to VI on 1 st day to induce hepatorenal damage. Group I served as a normal control while Group II served as toxic control for comparison purpose. Experimental animals in Group III, IV, and V were supplemented with fresh CM, (250 mL/24 h/cage), NSO (2 mL/kg/day p. o.), and NSO + fresh CM, respectively. Group VI was treated with a polyherbal hepatoprotective Unani medicine Jigreen (2 mL/kg/day p. o.) for 21 days. TAA-induced hepatorenal damage and protective effects of CM and NSO were assessed by analyzing liver and kidney function tests in the serum. Histopathology of liver and kidney tissues was also carried out to corroborate the findings of biochemical investigation. The results indicated that the TAA intoxicated rats showed significant increase in the alanine transaminase, aspartate transaminase, gamma-glutamyl transpeptidase, alkaline phosphatase, lipid profile, urea, creatinine, uric acid, sodium, and potassium levels in serum. Treatment of rats with CM, NSO, and CM plus NSO combination and Jigreen significantly reversed the damage and brought down the serum biochemical parameters and lipid profile toward the normal levels. The histopathological studies also support the hepato and nephroprotective effects of CM and NSO. This study demonstrated the ameliorative effects of CM, NSO, and CM plus NSO combination against TAA

  3. Identification of new tumor associated antigens and their usage for new therapeutic strategies based on the combination of chemotherapy and immunotherapy for colorectal cancer patients

    International Nuclear Information System (INIS)

    Proietti, E.; Maccalli, C.; Rosenberg, S.A.; Robbins, P.F.

    2009-01-01

    The main general objective of this project was to characterize a new colorectal carcinoma (CRC) tumor-associated antigen (TAA) and validate a new therapeutic strategy combining chemotherapy and tumor vaccination for the treatment of cancer patients. To this purpose a strategic interaction between Drs. Proietti/Maccali at the ISS and the group of Drs. Rosenberg/Robbins at the NIH was established. A stage of Dr. Maccalli at the NIH allowed to carry out the first steps for the identification and the initial characterization of the CRC TAA named COA-1. A laboratory meeting with Dr. Robbins has been planned on May 24-25 2006 at the ISS, during the International Meeting on Immunotherapy of Cancer: Challenges and Needs, for discussing results and perspectives of this research project

  4. High-temperature extraction of rhenium from sulfuric acid solutions with trialkylamines

    International Nuclear Information System (INIS)

    Gladyhev, V.P.; Andreeva, N.N.; Kim, E.M.; Kovaleva, S.V.

    1985-01-01

    This paper attempts to determine the possibility of conducting high-temperature extraction of rhenium from sulfuric acid solutions with trialkylamines (TAA) using higher hydrocarbon-paraffin mixtures as the diluent of the extraction system. Substitution of kerosene by paraffin in the extraction system would permit decreasing the danger of fire and explosions during he extraction process. In extracting rhenium from industrial solutions with a melt of higher paraffins containing TAA and alcohols, the extraction system can be continously heated in heat exchangers through which washing sulfuric acid passes and then goes to the extractor. This permits utilizing the heat and decreases the temperature of the solutions for extraction to the optimum temperatures. Extraction of rhenium with a melt of trioctylamine in paraffin obeys the same mechanisms as high-temperature extraction of ruthenium (IV) by amines in kerosene and aromatic hydrocarbons

  5. A Reference Architecture for Providing Tools as a Service to Support Global Software Development

    DEFF Research Database (Denmark)

    Chauhan, Aufeef

    2014-01-01

    Global Software Development (GSD) teams encounter challenges that are associated with distribution of software development activities across multiple geographic regions. The limited support for performing collaborative development and engineering activities and lack of sufficient support for main......Global Software Development (GSD) teams encounter challenges that are associated with distribution of software development activities across multiple geographic regions. The limited support for performing collaborative development and engineering activities and lack of sufficient support......-computing paradigm for addressing above-mentioned issues by providing a framework to select appropriate tools as well as associated services and reference architecture of the cloud-enabled middleware platform that allows on demand provisioning of software engineering Tools as a Service (TaaS) with focus...

  6. Suicide Gene Therapy to Increase the Safety of Chimeric Antigen Receptor-Redirected T Lymphocytes

    Directory of Open Access Journals (Sweden)

    Monica Casucci, Attilio Bondanza

    2011-01-01

    Full Text Available Chimeric antigen receptors (CARs are generated by fusing the antigen-binding motif of a monoclonal antibody (mAb with the signal transduction machinery of the T-cell receptor (TCR. The genetic modification of T lymphocytes with chimeric receptors specific for tumor-associated antigens (TAAs allows for the redirection towards tumor cells. Clinical experience with CAR-redirected T cells suggests that antitumor efficacy associates with some degree of toxicity, especially when TAA expression is shared with healthy tissues. This situation closely resembles the case of allogeneic hematopoietic stem cell transplantation (HSCT, wherein allorecognition causes both the graft-versus-leukemia (GVL effect and graft-versus-host disease (GVHD. Suicide gene therapy, i.e. the genetic induction of a conditional suicide phenotype into donor T cells, enables dissociating the GVL effect from GVHD. Applying suicide gene modification to CAR-redirected T cells may therefore greatly increase their safety profile and facilitate their clinical development.

  7. On the treatment of saturation effects in Moessbauer spectroscopy and the evaluation of spectra

    International Nuclear Information System (INIS)

    Jernberg, P.

    1984-01-01

    Two different methods for solving the transmission integral (TI) encountered in, e.g., Moessbauer spectroscopy are presented. In the first one the TI is approximated by a single channel calculation, while taking care of the nearby absorption cross section contributing to the absorption by comparing the cross section at the energy of the actual channel with the appropriate solution in the 'thin absorber approximation' (TAA). The method is compared with the results of TAA and of a simple 'single channel' approximation. The second method is more elaborate, aiming to be as exact as possible although not too time-consuming. The inner part of the TI is convoluted numerically whereas the outer part is calculated analytically by an asymptotic approximation. (orig.)

  8. Superconductivity in a generalized Hubbard model

    Science.gov (United States)

    Arrachea, Liliana; Aligia, A. A.

    1997-02-01

    We consider a Hubbard model in the square lattice, with a generalized hopping between nearest-neighbor sites for spin up (down), which depends on the total occupation nb of spin down (up) electrons on both sites. We call the hopping parameters tAA, tAB, and tBB for nb = 0, 1 or 2 respectively. Using the Hartree-Fock and Bardeen-Cooper-Schrieffer mean-field approximations to decouple the two-body and three-body interactions, we find that the model exhibits extended s-wave superconductivity in the electron-hole symmetric case tAB > tAA = tBB for small values of the Coulomb repulsion U or small band fillings. For moderate values of U, the antiferromagnetic normal (AFN) state has lower energy. The translationally invariant d-wave superconducting state has always larger energy than the AFN state.

  9. Cancer Immunotherapy Utilized Bubble Liposomes and Ultrasound as Antigen Delivery System

    Science.gov (United States)

    Oda, Yusuke; Otake, Shota; Suzuki, Ryo; Otake, Shota; Nishiie, Norihito; Hirata, Keiichi; Taira, Yuichiro; Utoguchi, Naoki; Maruyama, Kazuo

    2010-03-01

    In dendritic cells (DCs)-based cancer immunotherapy, it is important to present the epitope peptide derived from tumor associated antigens (TAAs) on MHC class I in order to induce tumor specific cytotoxic T lymphocytes (CTLs). However, MHC class I molecules generally present the epitope peptides derived from endogenous antigens for DCs but not exogenous ones such as TAAs. Recently, we developed the novel liposomal bubbles (Bubble liposomes) encapsulating perfluoropropane nanobubbles. In this study, we attempted to establish the novel antigen delivery system to induce MHC class I presentation using the combination of ultrasound and Bubble liposomes. Using ovalbumin (OVA) as model antigen, the combination of Bubble liposomes and ultrasound exposure for the DC could induce MHC class I presentation. In addition, the viability of DCs was more than 80%. These results suggest that Bubble liposomes might be a novel ultrasound enhanced antigen delivery tool in DC-based cancer immunotherapy.

  10. Novel Therapeutic Strategy for the Prevention of Bone Fractures

    Science.gov (United States)

    2015-02-01

    TGT TGG M32599 18S AGT GCG GGT CAT AAG CTT GC GGG CCT CAC TAA AC CAT CCA V00851 β-actin GTT TGA GAC CTT CAA CAC CCC GTG GCC ATC TCC TGC TCG AAG TC...GGA AAG GCA CTG ACT GAC CTA ACA AAT TCT AAG CTT GGG AGG A NM_009820 Osx ACT ACC CAC CCT TCC CTC AC ACT AGG CAG GCA GTC AGA CG AY803733 * Meredith ME

  11. Kultusfilmi igav hingamine / Sulev Teinemaa

    Index Scriptorium Estoniae

    Teinemaa, Sulev, 1947-

    2009-01-01

    Tallinnfilmi 1979.a. mängufilmist "Hukkunud Alpinisti hotell" (režissöör Grigori Kromanov, operaator Jüri Sillart, kunstnik Tõnu Virve, helilooja Sven Grünberg), mis värskelt restaureerituna taas kinoekraanile jõudis. Ka põgus kõrvutus A. Tarkovski "Stalkeriga", mis loodud samal ajal ja samuti vendade Strugatskite järgi

  12. Unexpected abundance of HLA class II presented peptides in primary renal cell carcinomas.

    Science.gov (United States)

    Dengjel, Jörn; Nastke, Maria-Dorothea; Gouttefangeas, Cécile; Gitsioudis, Gitsios; Schoor, Oliver; Altenberend, Florian; Müller, Margret; Krämer, Björn; Missiou, Anna; Sauter, Martina; Hennenlotter, Jörg; Wernet, Dorothee; Stenzl, Arnulf; Rammensee, Hans-Georg; Klingel, Karin; Stevanović, Stefan

    2006-07-15

    To elicit a long-lasting antitumor immune response, CD8+ and CD4+ T cells should be activated. We attempted to isolate HLA-DR-presented peptides directly from dissected solid tumors, in particular from renal cell carcinoma, to identify MHC class II ligands from tumor-associated antigens (TAA) for their use in peptide-based immunotherapy. Tumor specimens were analyzed by immunohistochemical staining for their HLA class II expression. HLA class II peptides were subsequently isolated and identified by mass spectrometry. Gene expression analysis was done to detect genes overexpressed in tumor tissue. Peptides from identified TAAs were used to induce peptide-specific CD4+ T-cell responses in healthy donors and in tumor patients. In the absence of inflammation, expression of MHC class II molecules is mainly restricted to cells of the immune system. To our surprise, we were able to isolate and characterize hundreds of class II peptides directly from primary dissected solid tumors, especially from renal cell carcinomas, and from colorectal carcinomas and transitional cell carcinomas. Infiltrating leukocytes expressed MHC class II molecules and tumor cells, very likely under the influence of IFNgamma. Our list of identified peptides contains ligands from several TAAs, including insulin-like growth factor binding protein 3 and matrix metalloproteinase 7. The latter bound promiscuously to HLA-DR molecules and were able to elicit CD4+ T-cell responses. Thus, our direct approach will rapidly expand the limited number of T-helper epitopes from TAAs for their use in clinical vaccination protocols.

  13. Gazprom hoiatas euroliitu gaasi kinnikeeramisega / Erkki Bahovski

    Index Scriptorium Estoniae

    Bahovski, Erkki, 1970-

    2006-01-01

    Gazprom manitses Euroopa Liitu mitte blokeerima ettevõtte ärihuve, ähvardades vastasel korral suunata oma gaasitarned mujale, teatas Briti majandusleht Financial Times. Euroopa Komisjon vastas Gazpromi ähvardustele, et kompanii peaks oma lepinguid täitma ning mitte ähvardama Euroopa gaasitarnete ümbersuunamisega. Samas möönis eurokomisjon taas, et euroliit sõltub välismaistest energiahiidudest

  14. Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin biosynthesis.

    Science.gov (United States)

    Nishimura, Takeshi; Hayashi, Ken-Ichiro; Suzuki, Hiromi; Gyohda, Atsuko; Takaoka, Chihiro; Sakaguchi, Yusuke; Matsumoto, Sachiko; Kasahara, Hiroyuki; Sakai, Tatsuya; Kato, Jun-Ichi; Kamiya, Yuji; Koshiba, Tomokazu

    2014-02-01

    Indole-3-acetic acid (IAA), an auxin plant hormone, is biosynthesized from tryptophan. The indole-3-pyruvic acid (IPyA) pathway, involving the tryptophan aminotransferase TAA1 and YUCCA (YUC) enzymes, was recently found to be a major IAA biosynthetic pathway in Arabidopsis. TAA1 catalyzes the conversion of tryptophan to IPyA, and YUC produces IAA from IPyA. Using a chemical biology approach with maize coleoptiles, we identified 5-(4-chlorophenyl)-4H-1,2,4-triazole-3-thiol (yucasin) as a potent inhibitor of IAA biosynthesis in YUC-expressing coleoptile tips. Enzymatic analysis of recombinant AtYUC1-His suggested that yucasin strongly inhibited YUC1-His activity against the substrate IPyA in a competitive manner. Phenotypic analysis of Arabidopsis YUC1 over-expression lines (35S::YUC1) demonstrated that yucasin acts in IAA biosynthesis catalyzed by YUC. In addition, 35S::YUC1 seedlings showed resistance to yucasin in terms of root growth. A loss-of-function mutant of TAA1, sav3-2, was hypersensitive to yucasin in terms of root growth and hypocotyl elongation of etiolated seedlings. Yucasin combined with the TAA1 inhibitor l-kynurenine acted additively in Arabidopsis seedlings, producing a phenotype similar to yucasin-treated sav3-2 seedlings, indicating the importance of IAA biosynthesis via the IPyA pathway in root growth and leaf vascular development. The present study showed that yucasin is a potent inhibitor of YUC enzymes that offers an effective tool for analyzing the contribution of IAA biosynthesis via the IPyA pathway to plant development and physiological processes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  15. Nicaragua läheb võitlusesse näljaga / Allan Espenberg

    Index Scriptorium Estoniae

    Espenberg, Allan

    2007-01-01

    Nicaragua on Haiti järel Ameerika vaeseim riik. Jaanuaris taas võimule tulles nimetas president Daniel Ortega oma valitsuse prioriteediks ja tähtsaimaks sotsiaalprogrammiks vaesuse likvideerimise, projekt käivitati riigi põhjaosas Atlandi ookeani rannikul Hondurase piiri ääres Raiti-Bocayu piirkonnas, mida peetakse kõige mahajäänumaks ja vaesemaks

  16. Regression of fibrosis and reversal of cirrhosis in rats by galectin inhibitors in thioacetamide-induced liver disease.

    Directory of Open Access Journals (Sweden)

    Peter G Traber

    Full Text Available Galectin-3 protein is critical to the development of liver fibrosis because galectin-3 null mice have attenuated fibrosis after liver injury. Therefore, we examined the ability of novel complex carbohydrate galectin inhibitors to treat toxin-induced fibrosis and cirrhosis. Fibrosis was induced in rats by intraperitoneal injections with thioacetamide (TAA and groups were treated with vehicle, GR-MD-02 (galactoarabino-rhamnogalaturonan or GM-CT-01 (galactomannan. In initial experiments, 4 weeks of treatment with GR-MD-02 following completion of 8 weeks of TAA significantly reduced collagen content by almost 50% based on Sirius red staining. Rats were then exposed to more intense and longer TAA treatment, which included either GR-MD-02 or GM-CT-01 during weeks 8 through 11. TAA rats treated with vehicle developed extensive fibrosis and pathological stage 6 Ishak fibrosis, or cirrhosis. Treatment with either GR-MD-02 (90 mg/kg ip or GM-CT-01 (180 mg/kg ip given once weekly during weeks 8-11 led to marked reduction in fibrosis with reduction in portal and septal galectin-3 positive macrophages and reduction in portal pressure. Vehicle-treated animals had cirrhosis whereas in the treated animals the fibrosis stage was significantly reduced, with evidence of resolved or resolving cirrhosis and reduced portal inflammation and ballooning. In this model of toxin-induced liver fibrosis, treatment with two galectin protein inhibitors with different chemical compositions significantly reduced fibrosis, reversed cirrhosis, reduced galectin-3 expressing portal and septal macrophages, and reduced portal pressure. These findings suggest a potential role of these drugs in human liver fibrosis and cirrhosis.

  17. Kolmevõistlus sisemaneežis / Ago Ruus

    Index Scriptorium Estoniae

    Ruus, Ago, 1949-

    2010-01-01

    Sisemaneežis toimuvatest kolmevõistlustest, kus sõidetakse krossitakistusi sisemaneežis - Inglismaal toimunud 10. Bailey's Jump and Style Eventing; Kurtna sisekolmevõistlus, mis toimus 10.-11. aprillil 2010; Talvine kahevõistluse karikasari, mille 3 etappi ning finaal toimus ajavahemikul 28. veebruarist kuni 3. aprillini 2010 Harjumaal Jüris, Tartumaal Saksa talus ja Järvamaal Koordi tallides ning finaal taas Saksa talus

  18. miRNome Profiling in Bicuspid Aortic Valve-Associated Aortopathy by Next-Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Andrea Borghini

    2017-11-01

    Full Text Available The molecular mechanisms underlying thoracic aortic aneurysm (TAA in patients with bicuspid aortic valve (BAV are incompletely characterized. MicroRNAs (miRNAs may play a major role in the different pathogenesis of aortopathy. We sought to employ next-generation sequencing to analyze the entire miRNome in TAA tissue from patients with BAV and tricuspid aortic valve (TAV. In the discovery stage, small RNA sequencing was performed using the Illumina MiSeq platform in 13 TAA tissue samples (seven patients with BAV and six with TAV. Gene ontology (GO and KEGG pathway analysis were used to identify key pathways and biological functions. Validation analysis was performed by qRT-PCR in an independent cohort of 30 patients with BAV (26 males; 59.5 ± 12 years and 30 patients with TAV (16 males; 68.5 ± 9.5 years. Bioinformatic analysis identified a total of 489 known mature miRNAs and five novel miRNAs. Compared to TAV samples, 12 known miRNAs were found to be differentially expressed in BAV, including two up-regulated and 10 down-regulated (FDR-adjusted p-value ≤ 0.05 and fold change ≥  1.5. GO and KEGG pathway enrichment analysis (FDR-adjusted p-value < 0.05 identified different target genes and pathways linked to BAV and aneurysm formation, including Hippo signaling pathway, ErbB signaling, TGF-beta signaling and focal adhesion. Validation analysis of selected miRNAs confirmed the significant down-regulation of miR-424-3p (p = 0.01 and miR-3688-3p (p = 0.03 in BAV patients as compared to TAV patients. Our study provided the first in-depth screening of the whole miRNome in TAA specimens and identified specific dysregulated miRNAs in BAV patients.

  19. Kontserdipeegel / Evi Arujärv

    Index Scriptorium Estoniae

    Arujärv, Evi, 1953-

    2002-01-01

    16. apr. Tallinna raekojas kontserdisarjas "Upbeat" esinesid läti noored muusikud. 20. apr. kontserdisarja "Euroopa tippsoliste" viimasel kontserdil esines koos Estonia sümfooniaorkestriga norra vioolamängija Lars-Anders Tomter. 19. apr. mängis Nyyd Ensemble Kanuti gildi saalis Mauricio Kageli kava, kus kaasa tegid ka Von Krahli teatri näitlejad. 21. apr. oli Eesti Filharmoonia Kammerkoori ja Tallinna Kammerorkestri ees taas Tõnu Kaljuste ja seekord olid kavas missad

  20. Romano Prodi : "Minu ülesanne Itaalias on anda noortele energiat" / Romano Prodi ; interv. Ülle Toode

    Index Scriptorium Estoniae

    Prodi, Romano, 1939-

    2006-01-01

    Itaalia vasakpoolse opositsiooni peaministrikandidaadi sõnul loodi uus valimissüsteem ekstra tema vastu. Valimisvõitlus Silvio Berlusconiga pole olnud võrdne - 47% Itaalia telekanalitest kuulub S. Berlusconile. Valimised võites tahab R. Prodi alustada Itaalias taas Euroopa-meelset poliitikat, leida USA-ga ühine keel, tuua Itaalia väed Iraagist ära. Lisa: Prodi vasaktsentristid võidukad

  1. Norra rahustab võõraid hea tasuva ameti ja töökaaslastega / Kaarel Kaas

    Index Scriptorium Estoniae

    Kaas, Kaarel, 1978-

    2006-01-01

    Ilmunud ka: Postimees : na russkom jazõke 17. mai lk. 7. Norra sotsiaaluuringute instituudi uurimisdirektori Grete Brochmani sõnul leidub Norra 4,6 miljonilise elanikkonna seas üle 200 erineva etnilise grupi esindajaid, sisserändajate arv ulatub 360 tuhandeni. Taas kiirelt kasvav majandus soodustab tööjõu sisserännet veelgi. Lisa: Sisserändajad

  2. Kui suudab Steve, suudab ka Apple / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2008-01-01

    Ehkki Apple'i kolmanda kvartali kasum kasvas kolmandiku võrra ja oli oodatust kümnendiku jagu suurem, langes ettevõtte aktsia hind börsil. Investoreid teeb rahutuks nii ettevõtte juhi Steve Jobsi tervis kui ka Apple'i majandusprognoos neljandaks kvartaliks. Lisa: Analüütikud on aktsia suhtes üksmeelel. Diagramm: Aktsia hinnal taas suund alla

  3. Vaba mees Mart Laar / Mart Laar ; interv. Toomas Sildam

    Index Scriptorium Estoniae

    Laar, Mart, 1960-

    2006-01-01

    Riigikogu saadik, Rootsi Swedpanki nõukogu liige vastab küsimustele, mis puudutavad temale CATO Instituudi poolt omistatud Milton Friedmani auhinda, osalemist poliitikas, vabaduse tähendust, võimalust saada taas peaministriks, Eesti iseseisvuse eest hääletanud Illar Hallaste ja Indrek Toome väljajäämist ordenisaajate nimekirjast, Isamaaliidu ja Res Publica ühinemist ning uue partei võimalikku juhti. Lisa: Mart Laar. Kommenteerib Tiit Pruuli

  4. Highly sensitive determination of hydroxylamine using fused gold nanoparticles immobilized on sol-gel film modified gold electrode

    Energy Technology Data Exchange (ETDEWEB)

    Kannan, P. [Department of Chemistry, Gandhigram Rural University, Gandhigram 624302, Dindigul, Tamilnadu (India); John, S. Abraham, E-mail: abrajohn@yahoo.co.in [Department of Chemistry, Gandhigram Rural University, Gandhigram 624302, Dindigul, Tamilnadu (India)

    2010-03-24

    We are reporting the highly sensitive determination of hydroxylamine (HA) using 2-mercapto-4-methyl-5-thiazoleacetic acid (TAA) capped fused spherical gold nanoparticles (AuNPs) modified Au electrode. The fused TAA-AuNPs were immobilized on (3-mercaptopropyl)-trimethoxysilane (MPTS) sol-gel film, which was pre-assembled on Au electrode. The immobilization of fused TAA-AuNPs on MPTS sol-gel film was confirmed by UV-vis absorption spectroscopy and atomic force microscopy (AFM). The AFM image showed that the AuNPs retained the fused spherical morphology after immobilized on sol-gel film. The fused TAA-AuNPs on MPTS modified Au electrode were used for the determination of HA in phosphate buffer (PB) solution (pH = 7.2). When compared to bare Au electrode, the fused AuNPs modified electrode not only shifted the oxidation potential of HA towards less positive potential but also enhanced its oxidation peak current. Further, the oxidation of HA was highly stable at fused AuNPs modified electrode. Using amperometric method, determination of 17.5 nM HA was achieved for the first time. Further, the current response of HA increases linearly while increasing its concentration from 17.5 nM to 22 mM and a detection limit was found to be 0.39 nM (S/N = 3). The present modified electrode was also successfully used for the determination of 17.5 nM HA in the presence of 200-fold excess of common interferents such as urea, NO{sub 2}{sup -}, NH{sub 4}{sup +}, oxalate, Mn{sup 2+}, Na{sup +}, K{sup +}, Mg{sup 2+}, Ca{sup 2+}, Ba{sup 2+} and Cu{sup 2+}. The practical application of the present modified electrode was demonstrated by measuring the concentration of HA in ground water samples.

  5. Highly sensitive determination of hydroxylamine using fused gold nanoparticles immobilized on sol-gel film modified gold electrode.

    Science.gov (United States)

    Kannan, P; John, S Abraham

    2010-03-24

    We are reporting the highly sensitive determination of hydroxylamine (HA) using 2-mercapto-4-methyl-5-thiazoleacetic acid (TAA) capped fused spherical gold nanoparticles (AuNPs) modified Au electrode. The fused TAA-AuNPs were immobilized on (3-mercaptopropyl)-trimethoxysilane (MPTS) sol-gel film, which was pre-assembled on Au electrode. The immobilization of fused TAA-AuNPs on MPTS sol-gel film was confirmed by UV-vis absorption spectroscopy and atomic force microscopy (AFM). The AFM image showed that the AuNPs retained the fused spherical morphology after immobilized on sol-gel film. The fused TAA-AuNPs on MPTS modified Au electrode were used for the determination of HA in phosphate buffer (PB) solution (pH=7.2). When compared to bare Au electrode, the fused AuNPs modified electrode not only shifted the oxidation potential of HA towards less positive potential but also enhanced its oxidation peak current. Further, the oxidation of HA was highly stable at fused AuNPs modified electrode. Using amperometric method, determination of 17.5 nM HA was achieved for the first time. Further, the current response of HA increases linearly while increasing its concentration from 17.5 nM to 22 mM and a detection limit was found to be 0.39 nM (S/N=3). The present modified electrode was also successfully used for the determination of 17.5 nM HA in the presence of 200-fold excess of common interferents such as urea, NO(2)(-), NH(4)(+), oxalate, Mn(2+), Na(+), K(+), Mg(2+), Ca(2+), Ba(2+) and Cu(2+). The practical application of the present modified electrode was demonstrated by measuring the concentration of HA in ground water samples. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Laser-assisted synthesis, and structural and thermal properties of ZnS nanoparticles stabilised in polyvinylpyrrolidone

    Energy Technology Data Exchange (ETDEWEB)

    Onwudiwe, Damian C. [Chemical Resource Beneficiation (CRB) Research Focus Area, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Krüger, Tjaart P.J. [Department of Physics, University of Pretoria, Private Bag X20, Hatfield 0028 (South Africa); Jordaan, Anine [Laboratory for Electron Microscopy, CRB Research Focus Area, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Strydom, Christien A., E-mail: christien.strydom@nwu.ac.za [Chemical Resource Beneficiation (CRB) Research Focus Area, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa)

    2014-12-01

    Graphical abstract: - Highlights: • Zinc sulphide (ZnS) nanoparticles were synthesised by laser irradiation. • The structural and morphological properties of the prepared samples were analysed. • Larger particles were obtained by using Na{sub 2}S instead of TAA as the sulphur source. • Phonon softening and line broadening of the peaks were observed. • Size reduction occurred in the samples obtained from both sources. - Abstract: Zinc sulphide (ZnS) nanoparticles have been synthesised by a green approach involving laser irradiation of an aqueous solution of zinc acetate (Znac{sub 2}) and sodium sulphide (Na{sub 2}S·9H{sub 2}O) or thioacetamide (TAA) in polyvinylpyrrolidone (PVP). The structural and morphological properties of the prepared samples were analysed using a transmission electron microscope, TEM, a high resolution transmission electron microscope, HRTEM, X-ray diffraction, and Raman spectroscopy. The thermal properties were studied using a simultaneous thermal analyser (SDTA). Better dispersed and larger particles were obtained by using sodium sulphide (Na{sub 2}S) instead of TAA as the sulphur source. X-ray diffraction (XRD) analyses and Raman measurement show that the particles have a cubic structure, which is usually a low temperature phase of ZnS. There were phonon softening and line broadening of the peaks which are attributed to the phonon confinement effect. The average crystallite size of the ZnS nanoparticles estimated from the XRD showed a reduction in size from 13.62 to 10.42 nm for samples obtained from Na{sub 2}S, and 9.13 to 8.16 nm for samples obtained from TAA, with an increase in the time of irradiation. The thermal stability of PVP was increased due to the incorporation of the ZnS nanoparticles in the matrices. The absorption spectra showed that the nanoparticles exhibit quantum confinement effects.

  7. Case Reports1. A Late Presentation of Loeys-Dietz Syndrome: Beware of TGFβ Receptor Mutations in Benign Joint Hypermobility

    OpenAIRE

    Mehta, Puja; Holder, Susan; Fisher, Benjamin; Vincent, Tonia; Nadesalingam, Kavitha; Maciver, Helen; Shingler, Wendy; Bakshi, Jyoti; Hassan, Sadon; D'Cruz, David; Chan, Antoni; Litwic, Anna E.; McCrae, Fiona; Seth, Rakhi; McCrae, Fiona

    2017-01-01

    Background: Thoracic aortic aneurysms (TAA) and dissections are not uncommon causes of sudden death in young adults. Loeys-Dietz syndrome (LDS) is a rare, recently described, autosomal dominant, connective tissue disease characterized by aggressive arterial aneurysms, resulting from mutations in the transforming growth factor beta (TGFβ) receptor genes TGFBR1 and TGFBR2. Mean age at death is 26.1 years, most often due to aortic dissection. We report an unusually late presentation of LDS, diag...

  8. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  9. [Results of operations for ascending aortic aneurysm in Iceland 2000-2014].

    Science.gov (United States)

    Brynjarsdottir, Helga Bjork; Melvinsdottir, Inga Hlif; Gudbjartsson, Tomas; Geirsson, Arnar

    2016-01-01

    Thoracic aortic aneurysm (TAA) is an uncommon disease where treatment is complex and associated with significant comorbidity. The main aim of this study was to evaluate the outcomes of operations for TAA in Iceland with emphasis on postoperative complications, 30 day mortality and survival. A retrospective study on 105 patients (mean age 60.7 yrs., 69.5% males) that underwent operations for TAA between 2000 and 2014 in Iceland. Patients with aortic injury or acute aortic dissection were excluded. Clinical information was collected from hospital charts and long-term survival estimated by Kaplan-Meier method. Mean follow-up was 5.7 yrs. Bicuspid aortic valve was present in 52 patients (51.0%) and family history was positive in 10 of the cases (9.5%). Every other patient (50.5%) was asymptomatic and diagnosed incidentally. The most common procedure was aortic root replacement using biological prosthesis. Two out of three patients had complications, that were regarded as major in 31.4% of cases, however, stroke was only detected in 2 (1.9%) patients. Two patients died within 30 days postoperatively (1.9%). The overall survival at one year was 95.1%; more favorable for males compared to females (97.2 vs. 90.4%, p=0.0012, log rank test) and at 5 years 90.3%. Outcome following surgery for TAA in Iceland is comparable to studies in neighbouring countries. The complications rate is high, however, the stroke rate was low, as was 30 day mortality. Longterm survival is favorable, and is more favorable for males than females. Key words: Thoracic aortic aneurysm, ascending aorta, open heart surgery, complications, operative mortality, survival. Correspondance: Arnar Geirsson, arnarge@landspitali.is.

  10. Microsoft Word - UJAH 12.doc

    African Journals Online (AJOL)

    Tracie1

    ụzọ mmadụ na ibe ya ga-esi na-emekorita n'ataghịoke ahụhụ. Nke a mere e ji asizi na ụwa anyi nke taa bụzi obodo zuru ụwa niile. Ihe ndị mebere ICT gunyere komputaa, usoro nzikorịta ozi, mgbasa ozi, nchekwa, mbipụta, foto, wdg. O bụ usoro gbasara nnukwu mgbasa ma metụta nnabata ozi, nrụchasi ozi na nzighachi ...

  11. Sporõ pod zvjozdami JeS

    Index Scriptorium Estoniae

    2007-01-01

    Artiklis väidetakse, et Euroopas on taas liikvel antisemitism. Poolas puhkes skandaal Euroopa Parlamendi Poola-saadiku Maciej Giertych'i antisemiitliku raamatu ümber. EL-i justiitsministrite nõukogud ei võtnud vastu Saksamaa eelnõu, mille kohaselt oleks holokausti eitamine olnud karistatav. Belgia parlamendi komisjoni aruande kohaselt tegid võimud Saksa okupatsiooni ajal aktiivselt koostööd okupantidega

  12. MYCN: From Oncoprotein To Tumor-Associated Antigen

    Directory of Open Access Journals (Sweden)

    Vito ePistoia

    2012-11-01

    Full Text Available MYCN is a well known oncogene overexpressed in different human malignancies including neuroblastoma, rhabdomyosarcoma, medulloblastoma, astrocytoma, Wilms’ tumor and small cell lung cancer. In the case of neuroblastoma (NB, MYCN amplification is an established biomarker of poor prognosis. MYCN belongs to a family of transcription factors (the most important of which is CMYC that show a high degree of homology. Downregulation of MYC protein expression leads to tumor regression in animal models, indicating that MYC proteins represent interesting therapeutic targets.Pre-requisites for a candidate tumor-associated antigen (TAA to be targeted by immunotherapeutic approaches are the following, i expression should be tumor-restricted, ii the putative TAA should be up-regulated in cancer cells and iii protein should be processed into immunogenic peptides capable of associating to MHC molecules with high affinity. Indeed, the MYCN protein is not expressed in human adult tissues and upregulated variably in NB cells, and MYCN peptides capable of associating to HLA-A1 or –A2 molecules with high affinity have been identified. Thus the MYCN protein qualifies as putative TAA in NB.Additional issues that determine the feasibility of targeting a putative TAA with cytotoxic T lymphocytes (CTL and will be here discussed are the following, i the inadequacy of tumor cells per se to act as antigen-presenting cells witnessed, in the case of NB cells, by the low to absent expression of HLA- class I molecules, the lack of costimulatory molecules and multiple defects in the HLA class I related antigen processing machinery, and ii the immune evasion mechanisms operated by cancer cells to fool the host immune system, such as up-regulation of soluble immunosuppressive molecules (e.g. soluble MICA and HLA-G in the case of NB or generation of immunosuppressive cells in the tumor microenvironment. A final issue that deserves consideration is the strategy used to generate

  13. Esineiden internet vähittäiskaupan alalla ja sen vaikutukset asiakaskokemukseen

    OpenAIRE

    Yrjänä, Laura

    2017-01-01

    Esineiden internet (IoT) on verkkoon kytkettyjen laitteiden ja esineiden kokonaisuus, jonka mahdollisuudet on havaittu monilla eri aloilla. Vähittäiskaupan alan kovan kilpailun vuoksi esineiden internet -innovaatiot yleistyvät hiljalleen ja muokkaavat ostotapahtumaa radikaalisti. Näiden teknologioiden osalta tutkimuksessa on keskitytty erityisesti niiden teknisiin ominaisuuksiin, kun taas liiketoiminnan, erityisesti asiakaskokemuksen näkökulmasta ne ovat jätetty vähemmälle huomiolle. Tämä kir...

  14. Prevalence of gastrointestinal pathogenic bacteria in patients with ...

    African Journals Online (AJOL)

    AAA GAA GCT ACT AAG GGT ACA AA. 65 55*. C. difficile tpi gene. 230. 3. TpiR. CAT AAT ATT GGG TCT ATT CCT AC. TcdAF. AGA TTC CTA TAT TTA CAT GAC AAT AT. 65 55*. C. difficile tcdA gene. 369/110†. 3. TcdAR. GTA TCA GGC ATA AAG TAA TAT ACT TT. TcdBF. GGA AAA GAG AAT GGT TTT ATT AA. 65 55*.

  15. Prevalence des trypanosomoses bovines dans les cercles de ...

    African Journals Online (AJOL)

    L'objectif du projet TCP/MLI/3402 FAO est d'initier une campagne de protection efficace et durable des bovins contre la Trypanosomose Animale Africaine (TAA) et la résistance aux trypanocides par le contrôle de la mouche tsé-tsé combiné aux traitements stratégiques des animaux. Préalablement à la mise en oeuvre des ...

  16. Prospections des glossines et autres mouches piqueuses dans les ...

    African Journals Online (AJOL)

    Le but du projet TCP/MLI/3402 FAO est d'initier une campagne de protection efficace et durable des bovins contre la Trypanosomose Animale Africaine (TAA) et la résistance aux trypanocides par le contrôle de la mouche tsé-tsé combiné aux traitements stratégiques des animaux. Préalablement à la mise en oeuvre des ...

  17. Oppimiseen liittyvät ajattelutavat opetuksessa – Tapaustutkimus Helsingin yliopiston Viikin normaalikoulun ensimmäiseltä luokalta

    OpenAIRE

    Tuominen, Moona

    2017-01-01

    Tämän tutkimuksen viitekehyksenä toimii Carol Dweckin (2000, 2006) teoria ajattelutavoista, kasvun ajattelutavasta ja muuttumattomasta ajattelutavasta. Kasvun ajattelutapa johtaa uskomuksiin ihmisen perusominaisuuksien muovautuvuudesta, kun taas muuttumaton ajattelutapa johtaa ihmisten kykyjen ja älykkyyden näkemiseen annettuna ominaisuutena. Ajattelutavoista on runsaasti tutkimustietoa, mutta suurin osa niistä on määrällisiä tutkimuksia. Tämän tutkimuksen tarkoituksena on selvittää miten opp...

  18. Fulltext PDF

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... RFLP followed by agarose gel electrophoresis. The restric- tion enzymes that were used for RFLP analysis include AleI for rs941798, TaaI for rs3787345, BsoBI for rs2230604,. BslI for rs2282147, HhaI for rs718049, HpyCH4III for rs718050, BfaI for rs16995309, and SacII for rs16989673. To assure that the ...

  19. Raudteel osaluse ostmine nõuab poliitikutelt kiiret otsustamist / Priit Rajalo

    Index Scriptorium Estoniae

    Rajalo, Priit, 1975-

    2005-01-01

    Vt. ka Postimees : na russkom jazõke 22. dets. lk. 2. Eesti Raudtee 66 protsendi aktsiate omanik Baltic Rail Service (BRS) on teinud riigile kuuluvale AS-ile Tallinna Sadam ettepaneku omandada osalus BRS-is. Arvamust avaldavad Mihkel Pärnoja, Toivo Jürgenson ja Väino Sarnet. Lisa: Mida BRS raudtee eest lubas. Diagrammid: Riik võib taas raudteed hallata

  20. Untitled

    Indian Academy of Sciences (India)

    In order to compare our results with those of Mizokawa et al (1991) we first perform. ... Hamiltonian for the CuO cluster with Cu 3d-a-2 and b, symmetry adapted p-function as given by. H = (ea + U.n.)na + 8,n, +- Unana -- taa, + h.c., where e, and ea are the bare on-site energies of the oxygen 2p and copper 3d orbitals.

  1. Moderately Elevated Homocysteine Does Not Contribute to Thoracic Aortic Aneurysm in Mice.

    Science.gov (United States)

    Roohi, Jasmin; Kang, Benjamin; Bernard, David; Bedja, Djahida; Dietz, Harry C; Brody, Lawrence C

    2017-07-01

    Background: Moderate hyperhomocysteinemia is an attractive target for intervention because it is present in 5-7% of the population and can be reversed by diet. This approach presupposes that hyperhomocysteinemia is directly involved in the disease process. Epidemiologic studies have indicated that moderately elevated homocysteine may contribute to thoracic aortic aneurysm (TAA) dilatation and dissection in humans. In vitro, elevated homocysteine disrupts the structure and function of extracellular matrix components, suggesting that moderate hyperhomocysteinemia may contribute to the development and/or progression of TAA. Objective: We investigated moderately elevated homocysteine in the development and progression of TAA in a mouse model of Marfan syndrome (MFS) and in isogenic wild-type mice. The MFS mouse is a well-described model of a systemic connective tissue disorder characterized by thoracic aortic dilatation, dissection, and rupture. We used this model as a sensitized indicator system to examine the impact of homocysteine on the progression of TAA. Methods: Murine fibrillin 1 gene ( Fbn1 ) C1039G/+ MFS and C57BL/6J wild-type mice were fed a cobalamin-restricted diet to induce moderate hyperhomocysteinemia from weaning until the age of 32 wk. Homocysteine and methylmalonic acid were measured and aortic root diameter assessed with the use of echocardiography in mice aged 3, 7, 15, and 32 wk. Results: Cobalamin-restricted mice exhibited significantly higher homocysteine ( P < 0.0001) and methylmalonic acid ( P < 0.0001) in the blood. For both strains, no significant difference in thoracic aortic diameter was observed in mice on the cobalamin-restricted diet compared with those on the control diet. Conclusions: Fbn1 C1039G/+ mice are a well-characterized model of progressive aortic root dilation. Hyperhomocysteinemia in the physiologic range did not induce abnormal aortic growth in wild-type mice and did not accelerate or otherwise influence aortic root growth

  2. Experimental FTIR and FT-Raman and theoretical studies on the molecular structures of monomer and dimer of 3-thiopheneacrylic acid

    Science.gov (United States)

    Issaoui, N.; Ghalla, H.; Brandán, Silvia Antonia; Bardak, F.; Flakus, H. T.; Atac, A.; Oujia, B.

    2017-05-01

    This work presents an experimental and theoretical investigation on the properties of 3-thiopheneacrylic acid (3TAA) by using the FT-Raman and FT-IR spectra in the solid state. The structural, electronic, topological and vibrational properties of 3TAA were theoretically studied by using the hybrid B3LYP method with the 6-311++G (d,p) basis set. The complete assignments of the bands observed in both spectra were performed taking into account the presence of both monomer and dimer species of the acid. Two bands observed at 1682 and 1625 cm-1 attributed to the Cdbnd C and Cdbnd O stretching modes, respectively support the presence of the dimeric species in the solid phase. The percentages of intermolecular interactions are analyzed by Fingerprint plots of Hirshfeld surface. The natural bond orbital (NBO), atoms in molecules (AIM), frontier molecular orbitals (FMOs) and molecular electrostatic potential surface (MEPs) calculations were employed to determine the structural properties while the chemical selectivity or reactivity sites were revealed by using the Fukui functions. The GIAO and time-dependent density functional theory (TD-DFT) methods were used to predict the 1H and 13C NMR and electronic spectra of the acid. The diagrams of the density of state of that acid have been also presented. Finally, reasonable correlations between experimental and theoretical vibrational spectra were found. Effect of positioning and orientation of the acrylic group on the inhibitor characteristics on human MAOB enzyme of stable conformers of 3TAA is investigated in comparison with that of 3-2TAA and four selective inhibitors via molecular docking.

  3. Otsime loodushuvilisi õpilasi! / Annika Liivak

    Index Scriptorium Estoniae

    Liivak, Annika

    2002-01-01

    TELO Loodusmaja juures tööd alustanud kaugõppevormis Looduse kool alustab taas tegevust, läbiviijaks on Metsanoorte Ühendus ehk Metsaordu. Töö toimub kirjalike voorude, seminaride ja välipraktikate vormis. Aastas on neli kirjalikku tööd, kaks seminari ja välipraktika/laager. Looduskooli küsimused: veebruar 2002: kirjalik voor

  4. Taastame õigluspõhimõtte / Janno Reiljan

    Index Scriptorium Estoniae

    Reiljan, Janno, 1951-2018

    2002-01-01

    Ilmunud ka: Võrumaa Teataja 19. nov. lk. 2, Meie Maa 20. november lk. 2, Põhjarannik ; Severnoje Poberezhje 20. november lk. 2, Sakala 21. november lk. 2, Pärnu Postimees 20. november lk. 15. Eesti rahvale turvalise tuleviku kindlustamiseks tuleb ühiskonnas taas ausse tõsta solidaarsus- ja õiguspõhimõtted. Eesti pensionäridele eraldatakse vaid 7% rahvatulust. Autor: ERL. Parlamendisaadik

  5. Splenectomy attenuates murine liver fibrosis with hypersplenism stimulating hepatic accumulation of Ly-6C(lo) macrophages.

    Science.gov (United States)

    Yada, Akito; Iimuro, Yuji; Uyama, Naoki; Uda, Yugo; Okada, Toshihiro; Fujimoto, Jiro

    2015-10-01

    Splenectomy in cirrhotic patients has been reported to improve liver function; however the underlying mechanism remains obscure. In the present study, we investigated the mechanism using a murine model, which represents well the compensated liver cirrhosis. C57BL/6 male mice were allowed to drink water including thioacetamide (TAA: 300 mg/L) ad libitum for 32 weeks. After splenectomy at 32 weeks, mice were sacrificed on days one, seven, and 28, respectively, while TAA-administration was continued. Perioperative changes in peripheral blood and liver tissues were analyzed. TAA treatment of mice for 32 weeks reproducibly achieved advanced liver fibrosis with splenomegaly, thrombocytopenia, and leukocytopenia. After splenectomy, liver fibrosis was attenuated, and macrophages/monocytes were significantly increased in peripheral blood, as well as in the liver. Progenitor-like cells expressing CK-19, EpCAM, or CD-133 appeared in the liver after TAA treatment, and gradually disappeared after splenectomy. Macrophages/monocytes accumulated in the liver, most of which were negative for Ly-6C, were adjacent to the hepatic progenitor-like cells, and quantitative RT-PCR indicated increased canonical Wnt and decreased Notch signals. As a result, a significant amount of β-catenin accumulated in the progenitor-like cells. Moreover, relatively small Ki67-positive hepatic cells were significantly increased. Protein expression of MMP-9, to which Ly-6G-positive neutrophils contributed, was also increased in the liver after splenectomy. The hepatic accumulation of macrophages/monocytes, most of which are Ly-6C(lo), the reduction of fibrosis, and the gradual disappearance of hepatic progenitor-like cells possibly play significant roles in the tissue remodeling process in cirrhotic livers after splenectomy. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  6. Tumor-Associated Antigens for Specific Immunotherapy of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Marc Schmitz

    2012-02-01

    Full Text Available Prostate cancer (PCa is the most common noncutaneous cancer diagnosis and the second leading cause of cancer-related deaths among men in the United States. Effective treatment modalities for advanced metastatic PCa are limited. Immunotherapeutic strategies based on T cells and antibodies represent interesting approaches to prevent progression from localized to advanced PCa and to improve survival outcomes for patients with advanced disease. CD8+ cytotoxic T lymphocytes (CTLs efficiently recognize and destroy tumor cells. CD4+ T cells augment the antigen-presenting capacity of dendritic cells and promote the expansion of tumor-reactive CTLs. Antibodies mediate their antitumor effects via antibody-dependent cellular cytotoxicity, activation of the complement system, improving the uptake of coated tumor cells by phagocytes, and the functional interference of biological pathways essential for tumor growth. Consequently, several tumor-associated antigens (TAAs have been identified that represent promising targets for T cell- or antibody-based immunotherapy. These TAAs comprise proteins preferentially expressed in normal and malignant prostate tissues and molecules which are not predominantly restricted to the prostate, but are overexpressed in various tumor entities including PCa. Clinical trials provide evidence that specific immunotherapeutic strategies using such TAAs represent safe and feasible concepts for the induction of immunological and clinical responses in PCa patients. However, further improvement of the current approaches is required which may be achieved by combining T cell- and/or antibody-based strategies with radio-, hormone-, chemo- or antiangiogenic therapy.

  7. Conversion of Tumors into Autologous Vaccines by Intratumoral Injection of α-Gal Glycolipids that Induce Anti-Gal/α-Gal Epitope Interaction

    Directory of Open Access Journals (Sweden)

    Uri Galili

    2011-01-01

    Full Text Available Anti-Gal is the most abundant antibody in humans, constituting 1% of immunoglobulins. Anti-Gal binds specifically α-gal epitopes (Galα1-3Galβ1-4GlcNAc-R. Immunogenicity of autologous tumor associated antigens (TAA is greatly increased by manipulating tumor cells to express α-gal epitopes and bind anti-Gal. Glycolipids with αgal epitopes (α-gal glycolipids injected into tumors insert into the tumor cell membrane. Anti-Gal binding to the multiple α-gal epitopes de novo presented on the tumor cells results in targeting of these cells to APC via the interaction between the Fc portion of the bound anti-Gal and Fcγ; receptors on APC. The APC process and present immunogenic TAA peptides and thus, effectively activate tumor specific CD4+ helper T cells and CD8+ cytotoxic T cells which destroy tumor cells in micrometastases. The induced immune response is potent enough to overcome immunosuppression by Treg cells. A phase I clinical trial indicated that α-gal glycolipid treatment has no adverse effects. In addition to achieving destruction of micrometastases in cancer patients with advance disease, α-gal glycolipid treatment may be effective as neo-adjuvant immunotherapy. Injection of α-gal glycolipids into primary tumors few weeks prior to resection can induce a protective immune response capable of destroying micrometastases expressing autologous TAA, long after primary tumor resection.

  8. Cervical artery dissection expands the cardiovascular phenotype in FBN1-related Weill-Marchesani syndrome.

    Science.gov (United States)

    Newell, Kelsey; Smith, Wendy; Ghoshhajra, Brian; Isselbacher, Eric; Lin, Angela; Lindsay, Mark E

    2017-09-01

    Weill-Marchesani syndrome (WMS) is a rare form of acromelic dysplasia that is characterized by distinctive skeletal, ocular, and cardiovascular abnormalities. Previously described cardiac manifestations of WMS include aortic and pulmonary valve stenosis, mitral valve prolapse, mitral stenosis, and QTc prolongation. Autosomal dominant forms of WMS result from heterozygous pathogenic variants in FBN1, a gene with a well characterized role in the pathogenesis of thoracic aortic aneurysm (TAA) in the context of Marfan syndrome. In contrast, only one patient has been reported with aortic disease in WMS. Although the risk of aortic dissection from preceding TAA remains the leading cause of morbidity for individuals with Marfan syndrome, rare reports of arterial dissection in the peripheral vasculature have been described. Peripheral artery dissection has not been previously reported in other FBN1-related diseases. We describe a three generation family with FBN1-related WMS whose cardiovascular manifestations include TAA and cervical artery dissection, thus expanding the cardiovascular phenotype of WMS. Further research is required to quantify these risks and establish appropriate recommendations for cardiovascular imaging, medical management, and prophylactic surgical intervention in individuals with FBN1--related acromelic dysplasia. © 2017 Wiley Periodicals, Inc.

  9. Screening of multiple myeloma by polyclonal rabbit anti-human plasmacytoma cell immunoglobulin.

    Directory of Open Access Journals (Sweden)

    Bo Mu

    Full Text Available Antibody-based immunotherapy has been effectively used for tumor treatment. However, to date, only a few tumor-associated antigens (TAAs or therapeutic targets have been identified. Identification of more immunogenic antigens is essential for improvements in multiple myeloma (MM diagnosis and therapy. In this study, we synthesized a polyclonal antibody (PAb by immunizing rabbits with whole human plasmacytoma ARH-77 cells and identified MM-associated antigens, including enlonase, adipophilin, and HSP90s, among others, via proteomic technologies. 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay showed that 200 µg/mL PAb inhibits the proliferation of ARH-77 cells by over 50% within 48 h. Flow cytometric assay indicated that PAb treatment significantly increases the number of apoptotic cells compared with other treatments (52.1% vs. NS, 7.3% or control rabbit IgG, 9.9%. In vivo, PAb delayed tumor growth and prolonged the lifespan of mice. Terminal deoxynucleotidyl transferase dUTP nick end labeling assay showed that PAb also induces statistically significant changes in apoptosis compared with other treatments (P<0.05. We therefore conclude that PAb could be used for the effective screening and identification of TAA. PAb may have certain anti-tumor functions in vitro and in vivo. As such, its combination with proteomic technologies could be a promising approach for sieving TAA for the diagnosis and therapy of MM.

  10. Development and validation of a near infrared spectrophotometric method to determine total antioxidant activity of milk.

    Science.gov (United States)

    Niero, G; Penasa, M; Currò, S; Masi, A; Trentin, A R; Cassandro, M; De Marchi, M

    2017-04-01

    In the present study a spectrophotometric method for the determination of total antioxidant activity (TAA) based on ABTS assay was developed and validated on raw milk (RM), whole UHT milk (WUM), partially skimmed UHT milk (SUM), whole pasteurised milk (WM) and partially skimmed pasteurised milk (SM). The most suitable solvent for antioxidant extraction was 80% acetone. Regardless of the type of milk, the coefficient of determination from the linearity test was greater than 0.95. The limit of detection ranged from 0.74 to 6.07μmoll -1 Trolox equivalents. Repeatability, calculated as relative standard deviation of twenty measurements within a day, and reproducibility, calculated as relative standard deviation of sixty measurements across three days, ranged from 1.24 to 4.04% and from 2.18 to 3.52%, respectively. Preservative added to RM had negligible effects on the TAA of milk. The greatest TAA was measured for SM followed by SUM, RM, WM and WUM. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. The CD8⁺ T Cell-Mediated Immunity Induced by HPV-E6 Uploaded in Engineered Exosomes Is Improved by ISCOMATRIXTM Adjuvant.

    Science.gov (United States)

    Manfredi, Francesco; di Bonito, Paola; Ridolfi, Barbara; Anticoli, Simona; Arenaccio, Claudia; Chiozzini, Chiara; Baz Morelli, Adriana; Federico, Maurizio

    2016-11-09

    We recently described the induction of an efficient CD8⁺ T cell-mediated immune response against a tumor-associated antigen (TAA) uploaded in engineered exosomes used as an immunogen delivery tool. This immune response cleared tumor cells inoculated after immunization, and controlled the growth of tumors implanted before immunization. We looked for new protocols aimed at increasing the CD8⁺ T cell specific response to the antigen uploaded in engineered exosomes, assuming that an optimized CD8⁺ T cell immune response would correlate with a more effective depletion of tumor cells in the therapeutic setting. By considering HPV-E6 as a model of TAA, we found that the in vitro co-administration of engineered exosomes and ISCOMATRIX TM adjuvant, i.e., an adjuvant composed of purified ISCOPREP TM saponin, cholesterol, and phospholipids, led to a stronger antigen cross-presentation in both B- lymphoblastoid cell lines ( and monocyte-derived immature dendritic cells compared with that induced by the exosomes alone. Consistently, the co-inoculation in mice of ISCOMATRIX TM adjuvant and engineered exosomes induced a significant increase of TAA-specific CD8⁺ T cells compared to mice immunized with the exosomes alone. This result holds promise for effective usage of exosomes as well as alternative nanovesicles in anti-tumor therapeutic approaches.

  12. The CD8+ T Cell-Mediated Immunity Induced by HPV-E6 Uploaded in Engineered Exosomes Is Improved by ISCOMATRIXTM Adjuvant

    Science.gov (United States)

    Manfredi, Francesco; di Bonito, Paola; Ridolfi, Barbara; Anticoli, Simona; Arenaccio, Claudia; Chiozzini, Chiara; Baz Morelli, Adriana; Federico, Maurizio

    2016-01-01

    We recently described the induction of an efficient CD8+ T cell-mediated immune response against a tumor-associated antigen (TAA) uploaded in engineered exosomes used as an immunogen delivery tool. This immune response cleared tumor cells inoculated after immunization, and controlled the growth of tumors implanted before immunization. We looked for new protocols aimed at increasing the CD8+ T cell specific response to the antigen uploaded in engineered exosomes, assuming that an optimized CD8+ T cell immune response would correlate with a more effective depletion of tumor cells in the therapeutic setting. By considering HPV-E6 as a model of TAA, we found that the in vitro co-administration of engineered exosomes and ISCOMATRIXTM adjuvant, i.e., an adjuvant composed of purified ISCOPREPTM saponin, cholesterol, and phospholipids, led to a stronger antigen cross-presentation in both B- lymphoblastoid cell lines ( and monocyte-derived immature dendritic cells compared with that induced by the exosomes alone. Consistently, the co-inoculation in mice of ISCOMATRIXTM adjuvant and engineered exosomes induced a significant increase of TAA-specific CD8+ T cells compared to mice immunized with the exosomes alone. This result holds promise for effective usage of exosomes as well as alternative nanovesicles in anti-tumor therapeutic approaches. PMID:27834857

  13. Amino Acid Composition of Breast Milk from Urban Chinese Mothers.

    Science.gov (United States)

    Garcia-Rodenas, Clara L; Affolter, Michael; Vinyes-Pares, Gerard; De Castro, Carlos A; Karagounis, Leonidas G; Zhang, Yumei; Wang, Peiyu; Thakkar, Sagar K

    2016-09-28

    Human breast milk (BM) amino acid (AA) composition may be impacted by lactation stage or factors related to geographical location. The present cross-sectional study is aimed at assessing the temporal changes of BMAA over lactation stages in a large cohort of urban mothers in China. Four hundred fifty BM samples, collected in three Chinese cities covering eight months of lactation were analyzed for free (FAA) and total (TAA) AA by o-phthalaldehyde/ fluorenylmethylchloroformate (OPA/FMOC) derivatization. Concentrations and changes over lactation were aligned with previous reports. Both the sum and the individual TAA values significantly decreased during the first periods of lactation and then generally leveled off. Leucine and methionine were respectively the most and the least abundant indispensable amino acids across all the lactation stages, whereas glutamic acid + glutamine (Glx) was the most and cystine the least abundant dispensable AA. The contribution of FAA to TAA levels was less than 2%, except for free Glx, which was the most abundant FAA. In conclusion, the AA composition of the milk from our cohort of urban Chinese mothers was comparable to previous studies conducted in other parts of the world, suggesting that this is an evolutionary conserved trait largely independent of geographical, ethnic, or dietary factors.

  14. Differentiation defect in neural crest-derived smooth muscle cells in patients with aortopathy associated with bicuspid aortic valves

    Directory of Open Access Journals (Sweden)

    Jiao Jiao

    2016-08-01

    Full Text Available Individuals with bicuspid aortic valves (BAV are at a higher risk of developing thoracic aortic aneurysms (TAA than patients with trileaflet aortic valves (TAV. The aneurysms associated with BAV most commonly involve the ascending aorta and spare the descending aorta. Smooth muscle cells (SMCs in the ascending and descending aorta arise from neural crest (NC and paraxial mesoderm (PM, respectively. We hypothesized defective differentiation of the neural crest stem cells (NCSCs-derived SMCs but not paraxial mesoderm cells (PMCs-derived SMCs contributes to the aortopathy associated with BAV. When induced pluripotent stem cells (iPSCs from BAV/TAA patients were differentiated into NCSC-derived SMCs, these cells demonstrated significantly decreased expression of marker of SMC differentiation (MYH11 and impaired contraction compared to normal control. In contrast, the PMC-derived SMCs were similar to control cells in these aspects. The NCSC-SMCs from the BAV/TAA also showed decreased TGF-β signaling based on phosphorylation of SMAD2, and increased mTOR signaling. Inhibition of mTOR pathway using rapamycin rescued the aberrant differentiation. Our data demonstrates that decreased differentiation and contraction of patient's NCSC-derived SMCs may contribute to that aortopathy associated with BAV.

  15. Influence of alcohol consumption on oxidative stress and antioxidant status in cancer patients--case-control study from Western Nepal.

    Science.gov (United States)

    Nagamma, T; Bhutia, Rinchen Doma; Pokharel, Daya Ram; Yadav, Saraswati; Baxi, J

    2012-01-01

    The present study assess the effect of consumption of alcohol on oxidative stress and antioxidant status in patients suffering from different types of cancer. This hospital based case control study conducted in the Western part of Nepal covered a total of 93 cancer patients with or without alcohol intake and smoking habits, along with 94 age, sex and habit-matched individuals serving as controls. Plasma thiobarbituric acid reacting substances (TBARS), total antioxidant activity (TAA), vitamin C, α-tocopherol and erythrocyte reduced glutathione (GSH) were estimated and compared. The TBARS level was found to be significantly higher (p≤0.001) in all types of cancer patients when compared to controls, being aggravated in alcoholics with a smoking habit. No statistical significance (p≥0.05) was observed in the level of vitamin C and α-tocopherol. GSH and TAA level were significantly decreased (p≤0.001) in all the groups except those who consumed both branded as well as homemade alcohol and non-alcoholics without smoking habit. Alcohol, irrespective of its commercial brand, increases oxidative stress in all types of cancer patients. This is even higher when alcohol intake is combined with a smoking habit. Decreased TAA and GSH are major risk factors for cancer development.

  16. Effect of time-activity adjustment on exposure assessment for traffic-related ultrafine particles

    Science.gov (United States)

    Lane, Kevin J; Levy, Jonathan I; Scammell, Madeleine Kangsen; Patton, Allison P; Durant, John L; Mwamburi, Mkaya; Zamore, Wig; Brugge, Doug

    2015-01-01

    Exposures to ultrafine particles (<100 nm, estimated as particle number concentration, PNC) differ from ambient concentrations because of the spatial and temporal variability of both PNC and people. Our goal was to evaluate the influence of time-activity adjustment on exposure assignment and associations with blood biomarkers for a near-highway population. A regression model based on mobile monitoring and spatial and temporal variables was used to generate hourly ambient residential PNC for a full year for a subset of participants (n=140) in the Community Assessment of Freeway Exposure and Health study. We modified the ambient estimates for each hour using personal estimates of hourly time spent in five micro-environments (inside home, outside home, at work, commuting, other) as well as particle infiltration. Time-activity adjusted (TAA)-PNC values differed from residential ambient annual average (RAA)-PNC, with lower exposures predicted for participants who spent more time away from home. Employment status and distance to highway had a differential effect on TAA-PNC. We found associations of RAA-PNC with high sensitivity C-reactive protein and Interleukin-6, although exposure-response functions were non-monotonic. TAA-PNC associations had larger effect estimates and linear exposure-response functions. Our findings suggest that time-activity adjustment improves exposure assessment for air pollutants that vary greatly in space and time. PMID:25827314

  17. Optical signature of Weyl electronic structures in tantalum pnictides Ta P n (P n = P, As)

    Science.gov (United States)

    Kimura, Shin-ichi; Yokoyama, Hiroko; Watanabe, Hiroshi; Sichelschmidt, Jörg; Süß, Vicky; Schmidt, Marcus; Felser, Claudia

    2017-08-01

    To investigate the electronic structure of Weyl semimetals Ta P n (P n = P, As), optical conductivity [σ (ω )] spectra are measured over a wide range of photon energies and temperatures, and these measured values are compared with band calculations. Two significant structures can be observed: a bending structure at ℏ ω ˜85 meV in TaAs, and peaks at ℏ ω ˜ 50 meV (TaP) and ˜30 meV (TaAs). The bending structure can be explained by the interband transition between saddle points connecting a set of W2 Weyl points. The temperature dependence of the peak intensity can be fitted by assuming the interband transition between saddle points connecting a set of W1 Weyl points. Owing to the different temperature dependence of the Drude weight in both materials, it is found that the Weyl points of TaAs are located near the Fermi level, whereas those of TaP are further away.

  18. Determination of amino acids and protein content in fresh and commercial royal jelly from Bulgaria

    Directory of Open Access Journals (Sweden)

    R. Balkanska

    2015-10-01

    Full Text Available Royal jelly (RJ is popular among consumers around the world due to its perceived health benefits. The purpose of this study was to assess the levels of free and total amino acid profile as well as protein content in order to characterize Bulgarian RJ samples. A total of 17 fresh and commercial RJ samples from different regions of Bulgaria were analyzed. The results obtained show that proline (Pro, lysine (Lys, methionine (Met, aspartic acid (Asp, cysteine (Cys, histidine (His were major free amino acids (FAAs in RJ. The average content of Pro was 2.3 mg/g. The FAA content ranged from 5.5 to 6.2 mg/g of RJ. The most abundant total amino acids (TAAs were aspartic acid (Asp, glutamic acid (Glu, lysine (Lys, leucine (Leu, serine (Ser and proline (Pro. The average TAA content in fresh and commercial RJ were 129±10 and 114±8 mg/g, respectively. The results obtained for TAA content were used to establish a range for amino acid composition of Bulgarian RJ. The content of proteins was higher in fresh RJ than in commercial samples and this difference was significant (p<0.05. The following ranges were observed for fresh and commercial samples 14.7–17.3 and 12.5–14.9 mg/g, respectively. DOI: http://dx.doi.org/10.4314/bcse.v29i3.16

  19. Auxin Import and Local Auxin Biosynthesis Are Required for Mitotic Divisions, Cell Expansion and Cell Specification during Female Gametophyte Development in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Aneesh Panoli

    Full Text Available The female gametophyte of flowering plants, called the embryo sac, develops from a haploid cell named the functional megaspore, which is specified after meiosis by the diploid sporophyte. In Arabidopsis, the functional megaspore undergoes three syncitial mitotic divisions followed by cellularization to form seven cells of four cell types including two female gametes. The plant hormone auxin is important for sporophytic developmental processes, and auxin levels are known to be regulated by biosynthesis and transport. Here, we investigated the role of auxin biosynthetic genes and auxin influx carriers in embryo sac development. We find that genes from the YUCCA/TAA pathway (YUC1, YUC2, YUC8, TAA1, TAR2 are expressed asymmetrically in the developing ovule and embryo sac from the two-nuclear syncitial stage until cellularization. Mutants for YUC1 and YUC2 exhibited defects in cell specification, whereas mutations in YUC8, as well as mutations in TAA1 and TAR2, caused defects in nuclear proliferation, vacuole formation and anisotropic growth of the embryo sac. Additionally, expression of the auxin influx carriers AUX1 and LAX1 were observed at the micropylar pole of the embryo sac and in the adjacent cells of the ovule, and the aux1 lax1 lax2 triple mutant shows multiple gametophyte defects. These results indicate that both localized auxin biosynthesis and auxin import, are required for mitotic divisions, cell expansion and patterning during embryo sac development.

  20. Enhancement of anti-murine colon cancer immunity by fusion of a SARS fragment to a low-immunogenic carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Lin Chen-Si

    2012-02-01

    Full Text Available Abstract Background It is widely understood that tumor cells express tumor-associated antigens (TAAs, of which many are usually in low immunogenicity; for example, carcinoembryonic antigen (CEA is specifically expressed on human colon cancer cells and is viewed as a low-immunogenic TAA. How to activate host immunity against specific TAAs and to suppress tumor growth therefore becomes important in cancer therapy development. Results To enhance the immune efficiency of CEA in mice that received, we fused a partial CEA gene with exogenous SARS-CoV fragments. Oral vaccination of an attenuated Salmonella typhimurium strain transformed with plasmids encoding CEA-SARS-CoV fusion gene into BALB/c mice elicited significant increases in TNF-α and IL-10 in the serum. In addition, a smaller tumor volume was observed in CT26/CEA-bearing mice who received CEA-SARS-CoV gene therapy in comparison with those administered CEA alone. Conclusion The administration of fusing CEA-SARS-CoV fragments may provide a promising strategy for strengthening the anti-tumor efficacy against low-immunogenic endogenous tumor antigens.

  1. Impacts of Different Water Pollution Sources on Antioxidant Defense Ability in Three Aquatic Macrophytes in Assiut Province, Egypt

    Directory of Open Access Journals (Sweden)

    Mohamed A.A. Gadallah

    2014-08-01

    Full Text Available The present study was undertaken to evaluate the impacts of surface water pollution with wastes coming from sewage effluents (Site 2, agricultural runoff (Site 4 and oils and detergents factory (Site 3 on the stability of leaf membrane (measured as injury %, hydrogen peroxide (H2O2, ascorbic acid (Asc A, lipid peroxidation, chlorophyll (Chl content, soluble sugars (SS, soluble proteins (SP and total free amino acids (TAA of Cyperus alopeucroides, Persicaria salicifolia and Echinochloa stagnina. Concentration of H2O2, MDA and TAA were higher in the three plants collected from polluted sites as compared with those of plants grown in control Nile site (Site1. The opposite was true for Asc A, SS and SP where their concentrations reduced significantly in response to water pollution. Leaf membrane was more damaged (high injury % in plants exposed to wastes from different sources than in plants growing at control site. The results of this study indicated that water pollution reduced the oxidative defense abilities in the three plants through reduction of Asc A activities, enhancement of H2O2 production and increasing MDA accumulation. In addition it impaired the metabolic activity through lowering the SS and SP contents and enhancement of TAA accumulation and increase membrane injury. The over production of hydrogen peroxide by the studied aquatic plants under water pollution could be used as an oxygen source needed to oxidize the more resistant organic and inorganic pollutants and used for pollution control and municipal and industrial wastewater treatment.

  2. Tumor-Associated Antigens for Specific Immunotherapy of Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Kiessling, Andrea [Biologics Safety and Disposition, Preclinical Safety, Translational Sciences, Novartis Institutes for BioMedical Research, Novartis Pharma AG, Werk Klybeck, Klybeckstraße 141, Basel CH-4057 (Switzerland); Wehner, Rebekka [Institute of Immunology, Medical Faculty, University of Technology Dresden, Fetscherstraße 74, Dresden 01307 (Germany); Füssel, Susanne [Department of Urology, Medical Faculty, University of Technology Dresden, Fetscherstraße 74, Dresden 01307 (Germany); Bachmann, Michael [Institute of Immunology, Medical Faculty, University of Technology Dresden, Fetscherstraße 74, Dresden 01307 (Germany); Wirth, Manfred P. [Department of Urology, Medical Faculty, University of Technology Dresden, Fetscherstraße 74, Dresden 01307 (Germany); Schmitz, Marc, E-mail: marc.schmitz@tu-dresden.de [Institute of Immunology, Medical Faculty, University of Technology Dresden, Fetscherstraße 74, Dresden 01307 (Germany)

    2012-02-22

    Prostate cancer (PCa) is the most common noncutaneous cancer diagnosis and the second leading cause of cancer-related deaths among men in the United States. Effective treatment modalities for advanced metastatic PCa are limited. Immunotherapeutic strategies based on T cells and antibodies represent interesting approaches to prevent progression from localized to advanced PCa and to improve survival outcomes for patients with advanced disease. CD8{sup +} cytotoxic T lymphocytes (CTLs) efficiently recognize and destroy tumor cells. CD4{sup +} T cells augment the antigen-presenting capacity of dendritic cells and promote the expansion of tumor-reactive CTLs. Antibodies mediate their antitumor effects via antibody-dependent cellular cytotoxicity, activation of the complement system, improving the uptake of coated tumor cells by phagocytes, and the functional interference of biological pathways essential for tumor growth. Consequently, several tumor-associated antigens (TAAs) have been identified that represent promising targets for T cell- or antibody-based immunotherapy. These TAAs comprise proteins preferentially expressed in normal and malignant prostate tissues and molecules which are not predominantly restricted to the prostate, but are overexpressed in various tumor entities including PCa. Clinical trials provide evidence that specific immunotherapeutic strategies using such TAAs represent safe and feasible concepts for the induction of immunological and clinical responses in PCa patients. However, further improvement of the current approaches is required which may be achieved by combining T cell- and/or antibody-based strategies with radio-, hormone-, chemo- or antiangiogenic therapy.

  3. Students' meaning making in classroom discussions: the importance of peer interaction

    Science.gov (United States)

    Rudsberg, Karin; Östman, Leif; Aaro Östman, Elisabeth

    2017-09-01

    The aim is to investigate how encounters with peers affect an individual's meaning making in argumentation about socio-scientific issues, and how the individual's meaning making influences the argumentation at the collective level. The analysis is conducted using the analytical method "transactional argumentation analysis" (TAA) which enables in situ studies. TAA combines a transactional perspective on meaning making based on John Dewey's pragmatic philosophy with an argument analysis based on Toulmin's argument pattern. Here TAA is developed further to enable analysis that in detail clarifies the dynamic interplay between the individual and the collective—the intra- and the inter-personal dimensions—and the result of this interplay in terms of meaning making and learning. The empirical material in this study consists of a video-recorded lesson in a Swedish upper secondary school. The results show that the analysed student is influenced by peers when construing arguments, and thereby acts on others' reasoning when making meaning. Further, the results show that most of the additions made by the analysed student are taken further by peers in the subsequent discussion. This study shows how an individual's earlier experiences, knowledge and thinking contribute to the collective meaning making in the classroom.

  4. Criteria for Directly Detecting Topological Fermi Arcs in Weyl Semimetals.

    Science.gov (United States)

    Belopolski, Ilya; Xu, Su-Yang; Sanchez, Daniel S; Chang, Guoqing; Guo, Cheng; Neupane, Madhab; Zheng, Hao; Lee, Chi-Cheng; Huang, Shin-Ming; Bian, Guang; Alidoust, Nasser; Chang, Tay-Rong; Wang, BaoKai; Zhang, Xiao; Bansil, Arun; Jeng, Horng-Tay; Lin, Hsin; Jia, Shuang; Hasan, M Zahid

    2016-02-12

    The recent discovery of the first Weyl semimetal in TaAs provides the first observation of a Weyl fermion in nature and demonstrates a novel type of anomalous surface state, the Fermi arc. Like topological insulators, the bulk topological invariants of a Weyl semimetal are uniquely fixed by the surface states of a bulk sample. Here we present a set of distinct conditions, accessible by angle-resolved photoemission spectroscopy (ARPES), each of which demonstrates topological Fermi arcs in a surface state band structure, with minimal reliance on calculation. We apply these results to TaAs and NbP. For the first time, we rigorously demonstrate a nonzero Chern number in TaAs by counting chiral edge modes on a closed loop. We further show that it is unreasonable to directly observe Fermi arcs in NbP by ARPES within available experimental resolution and spectral linewidth. Our results are general and apply to any new material to demonstrate a Weyl semimetal.

  5. Surgical Stress Abrogates Pre-Existing Protective T Cell Mediated Anti-Tumor Immunity Leading to Postoperative Cancer Recurrence.

    Directory of Open Access Journals (Sweden)

    Abhirami A Ananth

    Full Text Available Anti-tumor CD8+ T cells are a key determinant for overall survival in patients following surgical resection for solid malignancies. Using a mouse model of cancer vaccination (adenovirus expressing melanoma tumor-associated antigen (TAA-dopachrome tautomerase (AdDCT and resection resulting in major surgical stress (abdominal nephrectomy, we demonstrate that surgical stress results in a reduction in the number of CD8+ T cell that produce cytokines (IFNγ, TNFα, Granzyme B in response to TAA. This effect is secondary to both reduced proliferation and impaired T cell function following antigen binding. In a prophylactic model, surgical stress completely abrogates tumor protection conferred by vaccination in the immediate postoperative period. In a clinically relevant surgical resection model, vaccinated mice undergoing a positive margin resection with surgical stress had decreased survival compared to mice with positive margin resection alone. Preoperative immunotherapy with IFNα significantly extends survival in surgically stressed mice. Importantly, myeloid derived suppressor cell (MDSC population numbers and functional impairment of TAA-specific CD8+ T cell were altered in surgically stressed mice. Our observations suggest that cancer progression may result from surgery-induced suppression of tumor-specific CD8+ T cells. Preoperative immunotherapies aimed at targeting the prometastatic effects of cancer surgery will reduce recurrence and improve survival in cancer surgery patients.

  6. Surgical treatment of thoraco-abdominal and low thoracic aneurysms of the aorta. One single center experience over ten years.

    Science.gov (United States)

    El Arid, J M; Creemers, E; Limet, R

    2006-01-01

    This work presents the results of surgery in thoraco-abdominal aortic aneurysms (TAA) and thoracic descending aortic aneurysms (TDA) in one single center between January 1rst, 1996 and December 31, 2005. It concerns open surgery in 42 and endovascular procedures in ten patients. Forty two patients (11 TDA and 31 TAA (4 type I, 12 type II , 6 type III and 9 type IV)) define the open surgery series. Twenty six patients were operated on elective basis and 16 patients in emergency condition. Surgical correction was made under partial cardio-pulmonary bypass (PCPB) in 70% of cases via femoral vessels; most significant intercostal arteries were reimplanted and cerebro-spinal fluid (CSF) drainage used in half of the cases. Operative mortality was zero in the elective group (0/26) and attained 19% in the emergent group (3/16). Mortality was linked to cerebrovascular accidents (CVA) in two cases and post-pump left lung hemorrhagic infarction in one case. The paraplegia accounts 2/26 in the elective group and one in the emergent group (1/16). That is 7.1% in both groups. At the end of five years, survival is 66% in elective group and 74% in the emergency group. Ten patients (5 TDA and 5 TAA (2 type I, 3 type III)) were treated endovascularly. Operative mortality and postoperative paraplegia were nil.

  7. Interaction of large DNA viruses with dendritic cells.

    Science.gov (United States)

    Jenne, L; Thumann, P; Steinkasserer, A

    2001-12-01

    Dendritic cells (DC) with their unique capacity to prime naïve T cells are crucial in the induction of immunological responses, including anti-tumoral and anti-viral immunity. DC based immunotherapies are thus currently considered a particularly promising approach for cellular immunotherapy. The cloning of tumor associated antigens (TAAs) together with the possibility of manipulating viral genomes by biotechnological techniques has sparked the interest of using genetically modified viruses to transduce DC in order to achieve antigenic expression of TAA with the aim of inducing a protective immune response. An increasing number of modified viral vectors has been designed for gene therapy purposes and consecutively has been used for the ex vivo transduction of DC. It has been shown that viral vectors genetically engineered to express TAA or immune modifiers like cytokines or costimulatory molecules can lead to a high level of transgene expression. Furthermore, these studies have also revealed that viruses have developed several immune evasion mechanisms specifically targeting DC. Therefore, analysing the interactions of viruses with DC is crucial for the development of new viral vectors suitable for the transduction of DC. In this report we describe the interaction of two large DNA viruses, herpes simplex virus type 1 (HSV-1) and vaccinia virus (VV), with DC generated from peripheral blood mononuclear cells.

  8. A Seasonal Feature in Mercury's Exosphere Caused by Meteoroids from Comet Encke

    Science.gov (United States)

    Burger, M. H.; Christou, A.; Killen, R. M.

    2015-12-01

    The planet Mercury is enveloped in a tenuous atmosphere, the result of a delicate balance between poorly understood sources and sinks (Killen et al, 2007). Meteoroid impacts are a contributing source process (eg Wurz et al, 2010), but their importance compared to other production mechanisms is uncertain. Killen and Hahn (2015) found that seasonal variations in Mercury's calcium exosphere as observed by the MASCS spectrometer onboard the MESSENGER spacecraft (Burger et al, 2014) may be due to impact vaporization of surface material by the infall of interplanetary dust. However, an additional dust source was required to explain a Ca excess at a True Anomaly Angle (TAA) of 25±5 deg. Killen and Hahn suggested that dust from comet 2P/Encke, crossing Mercury's orbital plane at TAA=45 deg, may be the culprit. We have simulated numerically the stream of meteoroids ejected from Encke to test the Killen and Hahn conjecture. We find that Encke particles evolving solely under the gravity of the major planets and the Sun encounter Mercury at TAA=50-60 deg, well after the peak of the Ca excess emission. However, the addition of Poynting-Robertson (P-R) drag in our model couples the age and size of the meteoroids to the TAA at encounter, causing smaller, older particles to encounter Mercury progressively earlier in the Hermean year. In particular, mm-sized grains ejected between 10 and 20 kyr ago impact on the nightside hemisphere of Mercury at TAA = 350-30 deg, near the observed peak time of the exospheric feature. During this presentation, we will describe our model results and discuss their implications for the physical mechanism that injects impact-liberated Ca into sunlight as well as the origin and evolution of the Encke stream of meteoroids. Astronomical research at the Armagh Observatory is funded by the Northern Ireland Department of Culture, Arts and Leisure (DCAL). RMK was supported by NASA Grant NNX07AR78G-S01 as a Participating Scientist on the NASA MESSENGER

  9. Epidemiology of aortic disease - aneurysm, dissection, occlusion

    International Nuclear Information System (INIS)

    Steckmeier, B.

    2001-01-01

    The physiological infrarenal aortic diameter varies between 12.4 mm in women an 27.6 mm in men. As defined, an aneurysmatic dilatation begins with 29 mm. According to that, 9% of all people above the age of 65 are affected by an abdominal aortic aneurysm (AAA). Compared with the female sex, the male sex predominates at a rate of about 5:1. The disease is predominant in men of the white race. In black men, black and white women the incidence of AAA is identical. 38 to 50 percent of the AAA patients (patients) suffer from hypertension, 33 to 60% from coronary, 28% from cerebrovascular and 25% from peripheral occlusive disease. The AAA expansion rate varies between 0.2 and 0.8 cm per year and is exponential from a diameter of 5 cm on. In autopsy studies, the rupture rates with AAA diameters of 7 cm were below 5%, 39% and 65%, respecitvely. 70% of the AAA patients do not die of a rupture, but of a cardiac disease. Serum markers, such as metalloproteinases and procollagen peptides are significantly increased in AAA patients. Thoraco-abdominal aneurysms (TAA) make up only 2 to 5% of all degenerative aneurysms. 20 to 30% of the TAA patients are also affected by an AAA. 80% of the TAA are degenerative, 15 to 20% are a consequence of the chronic dissection - including 5% of Marfan patients -, 2% occur in case of infections and 1 to 2% in case of aortitis. The TAA incidence in 100,000 person-years is 5.9% during a monitoring period of 30 years. In case of TAA, an operation is indicated with a maximum diameter of 5.5 to 6 cm and more and, in case of a Marfan's syndrome (incidence of 1:10,000), with a maximum diameter of 5.5 cm and more. With regard to aorto-iliac occlusive diseases, there are defined 3 types of distribution. Type I refers to the region of the bifurcation itself. Type II defines the diffuse aortoiliac spread of the disease. Type III designates multiple-level occlusions also beyond the inguinal ligament. Type I patients in most cases are female and more

  10. Tetrazole acetic acid: Tautomers, conformers, and isomerization

    Energy Technology Data Exchange (ETDEWEB)

    Araujo-Andrade, C. [Unidad Académica de Física de la Universidad Autónoma de Zacatecas, Zacatecas (Mexico); Department of Chemistry, University of Coimbra, 3004-535 Coimbra (Portugal); Reva, I., E-mail: reva@qui.uc.pt; Fausto, R. [Department of Chemistry, University of Coimbra, 3004-535 Coimbra (Portugal)

    2014-02-14

    Monomers of (tetrazol-5-yl)-acetic acid (TAA) were obtained by sublimation of the crystalline compound and the resulting vapors were isolated in cryogenic nitrogen matrices at 13 K. The conformational and tautomeric composition of TAA in the matrix was characterized by infrared spectroscopy and vibrational calculations carried out at the B3LYP/6-311++G(d,p) level. TAA may adopt two tautomeric modifications, 1H- and 2H-, depending on the position of the annular hydrogen atom. Two-dimensional potential energy surfaces (PESs) of TAA were theoretically calculated at the MP2/6-311++G(d,p) level, for each tautomer. Four and six symmetry-unique minima were located on these PESs, for 1H- and 2H-TAA, respectively. The energetics of the detected minima was subsequently refined by calculations at the QCISD level. Two 1H- and three 2H-conformers fall within the 0–8 kJ mol{sup −1} energy range and should be appreciably populated at the sublimation temperature (∼330 K). Observation of only one conformer for each tautomer (1ccc and 2pcc) is explained in terms of calculated barriers to conformational rearrangements. All conformers with the cis O=COH moiety are separated by low barriers (less than 10 kJ mol{sup −1}) and collapse to the most stable 1ccc (1H-) and 2pcc (2H-) forms during deposition of the matrix. On the trans O=COH surfaces, the relative energies are very high (between 12 and 27 kJ mol{sup −1}). The trans forms are not thermally populated at the sublimation conditions and were not detected in matrices. One high-energy form in each tautomer, 1cct (1H-) and 2pct (2H-), was found to differ from the most stable form only by rotation of the OH group and separated from other forms by high barriers. This opened a perspective for their stabilization in a matrix. 1cct and 2pct were generated in the matrices selectively by means of narrow-band near-infrared (NIR) irradiations of the samples at 6920 and 6937 cm{sup −1}, where the first OH stretching overtone

  11. Epidemiology of aortic disease - aneurysm, dissection, occlusion; Epidemiologie der Aortenerkrankung: Aneurysma, Dissektion, Verschluss

    Energy Technology Data Exchange (ETDEWEB)

    Steckmeier, B. [Klinikum der Universitaet Muenchen-Innenstadt, Muenchen (Germany). Chirurgische Klinik und Poliklinik, Gefaesschirurgie

    2001-08-01

    The physiological infrarenal aortic diameter varies between 12.4 mm in women an 27.6 mm in men. As defined, an aneurysmatic dilatation begins with 29 mm. According to that, 9% of all people above the age of 65 are affected by an abdominal aortic aneurysm (AAA). Compared with the female sex, the male sex predominates at a rate of about 5:1. The disease is predominant in men of the white race. In black men, black and white women the incidence of AAA is identical. 38 to 50 percent of the AAA patients (patients) suffer from hypertension, 33 to 60% from coronary, 28% from cerebrovascular and 25% from peripheral occlusive disease. The AAA expansion rate varies between 0.2 and 0.8 cm per year and is exponential from a diameter of 5 cm on. In autopsy studies, the rupture rates with AAA diameters of <5 cm, between 5.1 and 6.9 cm, and of >7 cm were below 5%, 39% and 65%, respecitvely. 70% of the AAA patients do not die of a rupture, but of a cardiac disease. Serum markers, such as metalloproteinases and procollagen peptides are significantly increased in AAA patients. Thoraco-abdominal aneurysms (TAA) make up only 2 to 5% of all degenerative aneurysms. 20 to 30% of the TAA patients are also affected by an AAA. 80% of the TAA are degenerative, 15 to 20% are a consequence of the chronic dissection - including 5% of Marfan patients -, 2% occur in case of infections and 1 to 2% in case of aortitis. The TAA incidence in 100,000 person-years is 5.9% during a monitoring period of 30 years. In case of TAA, an operation is indicated with a maximum diameter of 5.5 to 6 cm and more and, in case of a Marfan's syndrome (incidence of 1:10,000), with a maximum diameter of 5.5 cm and more. With regard to aorto-iliac occlusive diseases, there are defined 3 types of distribution. Type I refers to the region of the bifurcation itself. Type II defines the diffuse aortoiliac spread of the disease. Type III designates multiple-level occlusions also beyond the inguinal ligament. Type I

  12. [In Process Citation].

    Science.gov (United States)

    Gonçalves Schemitt, Elizângela; Raskopf Colares, Josieli; Minuzzo Hartmann, Renata; Morgan-Martins, María Isabel; Marroni, Cláudio Augusto; Tuñón, M Jesús; Possa Marroni, Norma

    2016-03-25

    Introducción: la insuficiencia hepática fulminante (IHF) es un síndrome clínico poco frecuente, que se caracteriza por una disfunción hepática severa y repentina. La tioacetamida (TAA) es una hepatotoxina cuya administración puede inducir necrosis centrolobulillar en las células hepáticas y aumentar la formación de especies reactivas de oxígeno y la peroxidación lipídica en ratas. La glutamina es un precursor para la síntesis de glutatión. Objetivo: el objetivo del estudio es evaluar los efectos antioxidantes de la glutamina en un modelo de rata de IHF inducida por TAA. Métodos: ratas macho Wistar se dividieron en cuatro grupos de acuerdo con el tratamiento y el tiempo de evaluación: control, glutamina (25 mg/kg), tioacetamida (400 mg/kg) y tioacetamida más glutamina. Los animales se evaluaron después de 24, 36 y 48 horas. Se recogieron muestras de sangre para el análisis de los niveles de aspartato aminotransferasa (AST), alanina aminotransferasa (ALT), fosfatasa alcalina (AP), bilirrubina total (TB) y creatinina (CRE), y muestras de hígado para evaluar la peroxidación lipídica, las sustancias reactivas al ácido tiobarbitúrico (TBARS), la actividad de las enzimas antioxidantes superóxido dismutasa (SOD), glutatión peroxidasa (GPx), catalasa (CAT) y glutatión S-transferasa (GST). Además se midieron mediante inmunohistoquímica el factor nuclear kappa N (NF-κB), el fator de necrosis tumoral (TNF-α) y la óxido nítrico sintasa inducible (iNOS). Resultados: la TAA causó alteraciones en los parámetros bioquímicos e histológicos, y el aumento de los marcadores del proceso inflamatorio. Los niveles de TBARS y la actividad de SOD y GST fueron significativamente inferiores en los grupos de glutamina en comparación con TAA. La actividad de CAT se incrementó en los animales tratados con glutamina en comparación con la TAA. La actividad GPx también fue menor a las 36 y 48 h en los animales tratados com glutamina. El daño tisular y

  13. Genetic Engineering of T Cells to Target HERV-K, an Ancient Retrovirus on Melanoma.

    Science.gov (United States)

    Krishnamurthy, Janani; Rabinovich, Brian A; Mi, Tiejuan; Switzer, Kirsten C; Olivares, Simon; Maiti, Sourindra N; Plummer, Joshua B; Singh, Harjeet; Kumaresan, Pappanaicken R; Huls, Helen M; Wang-Johanning, Feng; Cooper, Laurence J N

    2015-07-15

    The human endogenous retrovirus (HERV-K) envelope (env) protein is a tumor-associated antigen (TAA) expressed on melanoma but not normal cells. This study was designed to engineer a chimeric antigen receptor (CAR) on T-cell surface, such that they target tumors in advanced stages of melanoma. Expression of HERV-K protein was analyzed in 220 melanoma samples (with various stages of disease) and 139 normal organ donor tissues using immunohistochemical (IHC) analysis. HERV-K env-specific CAR derived from mouse monoclonal antibody was introduced into T cells using the transposon-based Sleeping Beauty (SB) system. HERV-K env-specific CAR(+) T cells were expanded ex vivo on activating and propagating cells (AaPC) and characterized for CAR expression and specificity. This includes evaluating the HERV-K-specific CAR(+) T cells for their ability to kill A375-SM metastasized tumors in a mouse xenograft model. We detected HERV-K env protein on melanoma but not in normal tissues. After electroporation of T cells and selection on HERV-K(+) AaPC, more than 95% of genetically modified T cells expressed the CAR with an effector memory phenotype and lysed HERV-K env(+) tumor targets in an antigen-specific manner. Even though there is apparent shedding of this TAA from tumor cells that can be recognized by HERV-K env-specific CAR(+) T cells, we observed a significant antitumor effect. Adoptive cellular immunotherapy with HERV-K env-specific CAR(+) T cells represents a clinically appealing treatment strategy for advanced-stage melanoma and provides an approach for targeting this TAA on other solid tumors. ©2015 American Association for Cancer Research.

  14. Measurements After Image Post-processing Are More Precise in the Morphometric Assessment of Thoracic Aortic Aneurysms: An Intermodal and Intra-observer Evaluation.

    Science.gov (United States)

    Reutersberg, B; Haller, B; Mariss, J; Eckstein, H-H; Ockert, S

    2016-10-01

    Precise pre-procedural anatomical analysis of aneurysmal anatomy is essential for successful thoracic endovascular aortic repair (TEVAR). Since surgeons and radiologists have to perform multiple measurements in the same patient, high intra-observer reliability of any imaging method is mandatory. Commercially available three dimensional (3D) post-processing techniques are expected to be superior to conventional two dimensional multiplanar reconstructions (MPRs) derived from computed tomography angiograms (CTAs). However, few data exist to support this view. This study aims to evaluate the intermodal and intra-observer differences using 3D software (3surgery) in descending thoracic aortic aneurysms (dTAAs). Pre-operative CTAs (performed between 2004 and 2010) of 30 dTAAs (mean maximum diameter 61.4 ± 13 mm) were assessed by three independent investigators with different experience in the measurement of aortic pathologies. Intra-observer reliability and intermodal differences (3D vs. 2D) were investigated using pre-specified measurement points (distances of total length, maximum diameter, proximal and distal landing zones). Statistical analyses were performed using the Bland-Altman method and a mixed regression model. Intermodal comparison showed that 2D measurements significantly underestimate the measured distances (maximum diameter 3.7 mm [95% CI -5.3 to -2.1] and landing zone maximum 1.4 mm [95% CI -2.0 to -0.2] shorter with 2D, p post-processing software therefore leads to more precise device selection for TEVAR in TAA. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  15. Antioxidant capacity reduced in scallions grown under elevated CO 2 independent of assayed light intensity

    Science.gov (United States)

    Levine, Lanfang H.; Paré, Paul W.

    2009-10-01

    Long-duration manned space missions mandate the development of a sustainable life support system and effective countermeasures against damaging space radiation. To mitigate the risk of inevitable exposure to space radiation, cultivation of fresh fruits and vegetables rich in antioxidants is an attractive alternative to pharmacological agents. However it has yet to be established whether antioxidant properties of crops can be preserved or enhanced in a space environment where environmental conditions differ from that which plants have acclimated to on earth. Scallion ( Allium fistulosum) rich in antioxidant vitamins C and A, and flavonoids was used as a model plant to study the impact of a range of CO 2 concentrations and light intensities that are likely encountered in a space habitat on food quality traits. Scallions were hydroponically grown in controlled environmental chambers under a combination of 3 CO 2 concentrations of 400, 1200 and 4000 μmol mol -1 and 3 light intensity levels of 150, 300, 450 μmol m -2 s -1. Total antioxidant activity (TAA) of scallion extracts was determined using a radical cation scavenging assay. Both elevated CO 2 and increasing light intensity enhanced biomass accumulation, but effects on TAA (based on dry weight) differed. TAA was reduced for plants grown under elevated CO 2, but remained unchanged with increases in light intensity. Elevated CO 2 stimulated greater biomass production than antioxidants, while an increase in photosynthetic photo flux promoted the synthesis of antioxidant compounds at a rate similar to that of biomass. Consequently light is a more effective stimulus than CO 2 for antioxidant production.

  16. Genomics and relative expression analysis identifies key genes associated with high female to male flower ratio in Jatropha curcas L.

    Science.gov (United States)

    Gangwar, Manali; Sood, Hemant; Chauhan, Rajinder Singh

    2016-04-01

    Jatropha curcas, has been projected as a major source of biodiesel due to high seed oil content (42 %). A major roadblock for commercialization of Jatropha-based biodiesel is low seed yield per inflorescence, which is affected by low female to male flower ratio (1:25-30). Molecular dissection of female flower development by analyzing genes involved in phase transitions and floral organ development is, therefore, crucial for increasing seed yield. Expression analysis of 42 genes implicated in floral organ development and sex determination was done at six floral developmental stages of a J. curcas genotype (IC561235) with inherently higher female to male flower ratio (1:8-10). Relative expression analysis of these genes was done on low ratio genotype. Genes TFL1, SUP, AP1, CRY2, CUC2, CKX1, TAA1 and PIN1 were associated with reproductive phase transition. Further, genes CUC2, TAA1, CKX1 and PIN1 were associated with female flowering while SUP and CRY2 in female flower transition. Relative expression of these genes with respect to low female flower ratio genotype showed up to ~7 folds increase in transcript abundance of SUP, TAA1, CRY2 and CKX1 genes in intermediate buds but not a significant increase (~1.25 folds) in female flowers, thereby suggesting that these genes possibly play a significant role in increased transition towards female flowering by promoting abortion of male flower primordia. The outcome of study has implications in feedstock improvement of J. curcas through functional validation and eventual utilization of key genes associated with female flowering.

  17. High-protein-PUFA supplementation, red blood cell membranes, and plasma antioxidant activity in volleyball athletes.

    Science.gov (United States)

    Malaguti, Marco; Baldini, Marta; Angeloni, Cristina; Biagi, Pierluigi; Hrelia, Silvana

    2008-06-01

    The authors evaluated the role of a high-protein, low-calorie, polyunsaturated fatty-acid (PUFA) -supplemented diet on anthropometric parameters, erythrocyte-membrane fatty-acid composition, and plasma antioxidant defenses of nonprofessional volleyball athletes. The athletes were divided in two groups: One (n = 5) followed the Mediterranean diet, and the other (n = 6) followed a high-protein, low-calorie diet with a 3-g/day fish-oil supplementation. All the athletes had anthropometric measurements taken, both at the beginning and at the end of the study, which lasted for 2 months. Body-mass index and total body fat were significantly diminished in the second group, while they remained unchanged in the first. Plasma total antioxidant activity (TAA) was significantly increased in the plasma of both groups, with no differences between the groups, suggesting that physical activity, not the different diets, is the main contributor to the increase of plasma TAA. The second group showed a significant increase in erythrocyte-membrane PUFA content and in the unsaturation index value (UI) because of the fish-oil supplementation.A high-protein, low-carbohydrate, fish-oil-supplemented diet seems to be useful only when the aim of the diet is to obtain weight loss in a short-term period. The significant increase in the UI of erythrocyte membranes indicates the potential for harm, because a high intake of PUFA might increase susceptibility to lipid peroxidation not counterbalanced by a higher increase in TAA. Adherence to the Mediterranean diet seems to be the better choice.

  18. Genotyping of German and Austrian Taylorella equigenitalis isolates using repetitive extragenic palindromic (REP) PCR and pulsed-field gel electrophoresis (PFGE).

    Science.gov (United States)

    Sting, Reinhard; Seeh, Christoph; Mauder, Norman; Maurer, Michaela; Loncaric, Igor; Stessl, Beatrix; Kopp, Peter; Banzhaf, Klaus; Martin, Brigitte; Melzer, Falk; Raßbach, Astrid; Spergser, Joachim

    2016-12-01

    A total of 124 Taylorella (T.) equigenitalis and five T. asinigenitalis field isolates collected between 2002 and 2014 were available for genotyping using REP- (repetitive extragenic palindromic) PCR and PFGE (pulsed-field gel electrophoresis). The study comprised 79 T. equigenitalis field isolates originating from ten defined breeds of German horses and revealed a spectrum of five REP (rep-E1-E4, rep-E3a) and 15 PFGE (TE-A1-A9, TE-B1-B3, TE-C, TE-E1, and TE-E2) genotypes. T. equigenitalis field isolates (n=40) obtained from Austrian Lipizzaner horses were differentiated into three REP (rep-E1, rep-E3a, and rep-E4) and three PFGE genotypes (TE-A2, TE-A5, and TE-D); those isolated from four Austrian Trotters belonged to the REP/PFGE genotype rep-E2/TE-A1. Interestingly, a T. equigenitalis isolate recovered from a Holsteiner stallion living in South Africa revealed the REP/PFGE genotype rep-E1/TE-A5 which was otherwise exclusively present in the majority of Austrian Lipizzaner horses in our study. The type strain included in this study revealed the genotype REP/PFGE rep-E1/TE-F. Six strains of T. asinigenitalis including the type strain were separated into three REP (rep-A1-A3) and six PFGE genotypes (TA-A1, TA-A2, TA-A3, TA-B, TA-C, TA-D). Overall, the generated REP and PFGE genotypes showed a good correlation, whereas REP-PCR proved to be a suitable method for molecular epidemiological screening of T. equigenitalis and T. asinigenitalis isolates that should be differentiated in detail by genotyping using PFGE. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Modified vaccinia virus ankara recombinants are as potent as vaccinia recombinants in diversified prime and boost vaccine regimens to elicit therapeutic antitumor responses.

    Science.gov (United States)

    Hodge, James W; Poole, Diane J; Aarts, Wilhelmina M; Gómez Yafal, Alicia; Gritz, Linda; Schlom, Jeffrey

    2003-11-15

    Cancer vaccine regimens use various strategies to enhance immune responses to specific tumor-associated antigens (TAAs), including the increasing use of recombinant poxviruses [vaccinia (rV) and fowlpox (rF)] for delivery of the TAA to the immune system. However, the use of replication competent vectors with the potential of adverse reactions have made attenuation a priority for next-generation vaccine strategies. Modified vaccinia Ankara (MVA) is a replication defective form of vaccinia virus. Here, we investigated the use of MVA encoding a tumor antigen gene, carcinoembryonic antigen (CEA), in addition to multiple costimulatory molecules (B7-1, intercellular adhesion molecule-1, and lymphocyte function-associated antigen-3 designated TRICOM). Vaccination of mice with MVA-CEA/TRICOM induced potent CD4+ and CD8+ T-cell responses specific for CEA. MVA-CEA/TRICOM could be administered twice in vaccinia naïve mice and only a single time in vaccinia-immune mice before being inhibited by antivector-immune responses. The use of MVA-CEA/TRICOM in a diversified prime and boost vaccine regimen with rF-CEA/TRICOM, however, induced significantly greater levels of both CD4+ and CD8+ T-cell responses specific for CEA than that seen with rV-CEA/TRICOM prime and rF-CEA/TRICOM boost. In a self-antigen tumor model, the diversified MVA-CEA/TRICOM/rF-CEA/ TRICOM vaccination regimen resulted in a significant therapeutic antitumor response as measured by increased survival, when compared with the diversified prime and boost regimen, rV-CEA/TRICOM/rF-CEA/TRICOM. The studies reported here demonstrate that MVA, when used as a prime in a diversified vaccination, is clearly comparable with the regimen using the recombinant vaccinia in both the induction of cellular immune responses specific for the "self"-TAA transgene and in antitumor activity.

  20. Oncolytic viruses sensitize human tumor cells for NY-ESO-1 tumor antigen recognition by CD4+ effector T cells.

    Science.gov (United States)

    Delaunay, Tiphaine; Violland, Mathilde; Boisgerault, Nicolas; Dutoit, Soizic; Vignard, Virginie; Münz, Christian; Gannage, Monique; Dréno, Brigitte; Vaivode, Kristine; Pjanova, Dace; Labarrière, Nathalie; Wang, Yaohe; Chiocca, E Antonio; Boeuf, Fabrice Le; Bell, John C; Erbs, Philippe; Tangy, Frédéric; Grégoire, Marc; Fonteneau, Jean-François

    2018-01-01

    Oncolytic immunotherapy using oncolytic viruses (OV) has been shown to stimulate the antitumor immune response by inducing the release of tumor-associated antigens (TAA) and danger signals from the dying infected tumor cells. In this study, we sought to determine if the lysis of tumor cells induced by different OV: measles virus, vaccinia virus, vesicular stomatitis virus, herpes simplex type I virus, adenovirus or enterovirus, has consequences on the capacity of tumor cells to present TAA, such as NY-ESO-1. We show that the co-culture of NY-ESO-1 neg /HLA-DP4 pos melanoma cells with NY-ESO-1 pos /HLA-DP4 neg melanoma cells infected and killed by different OV induces an intercellular transfer of NY-ESO-1 that allows the recognition of NY-ESO-1 neg /HLA-DP4 pos tumor cells by an HLA-DP4/NY-ESO-1 (157-170) -specific CD4+ cytotoxic T cell clone, NY67. We then confirmed this result in a second model with an HLA-DP4+ melanoma cell line that expresses a low amount of NY-ESO-1. Recognition of this cell line by the NY67 clone is largely increased in the presence of OV productive infection. Altogether, our results show for the first time another mechanism of stimulation of the anti-tumor immune response by OV, via the loading of tumor cells with TAA that sensitizes them for direct recognition by specific effector CD4+ T cells, supporting the use of OV for cancer immunotherapy.

  1. Comparison of Free Total Amino Acid Compositions and Their Functional Classifications in 13 Wild Edible Mushrooms.

    Science.gov (United States)

    Sun, Liping; Liu, Qiuming; Bao, Changjun; Fan, Jian

    2017-02-24

    Thirteen popular wild edible mushroom species in Yunnan Province, Boletus bicolor , Boletus speciosus , Boletus sinicus , Boletus craspedius , Boletus griseus , Boletus ornatipes , Xerocomus , Suillus placidus , Boletinus pinetorus , Tricholoma terreum , Tricholomopsis lividipileata , Termitomyces microcarpus , and Amanita hemibapha , were analyzed for their free amino acid compositions by online pre-column derivazation reversed phase high-performance liquid chromatography (RP-HPLC) analysis. Twenty free amino acids, aspartic acid, glutamic acid, serine, glycine, alanine, praline, cysteine, valine, methionine, phenylalanine, isoleucine, leucine, lysine, histidine, threonine, asparagines, glutamine, arginine, tyrosine, and tryptophan, were determined. The total free amino acid (TAA) contents ranged from 1462.6 mg/100 g in B. craspedius to 13,106.2 mg/100 g in T. microcarpus . The different species showed distinct free amino acid profiles. The ratio of total essential amino acids (EAA) to TAA was 0.13-0.41. All of the analyzed species showed high contents of hydrophobic amino acids, at 33%-54% of TAA. Alanine, cysteine, glutamine, and glutamic acid were among the most abundant amino acids present in all species. The results showed that the analyzed mushrooms possessed significant free amino acid contents, which may be important compounds contributing to the typical mushroom taste, nutritional value, and potent antioxidant properties of these wild edible mushrooms. Furthermore, the principal component analysis (PCA) showed that the accumulative variance contribution rate of the first four principal components reached 94.39%. Cluster analysis revealed EAA composition and content might be an important parameter to separate the mushroom species, and T. microcarpus and A. hemibapha showed remarkable EAA content among the 13 species.

  2. Stimulation of dendritic cells enhances immune response after photodynamic therapy

    Science.gov (United States)

    Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.

    2009-02-01

    Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.

  3. Comparison of Free Total Amino Acid Compositions and Their Functional Classifications in 13 Wild Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    Liping Sun

    2017-02-01

    Full Text Available Thirteen popular wild edible mushroom species in Yunnan Province, Boletus bicolor, Boletus speciosus, Boletus sinicus, Boletus craspedius, Boletus griseus, Boletus ornatipes, Xerocomus, Suillus placidus, Boletinus pinetorus, Tricholoma terreum, Tricholomopsis lividipileata, Termitomyces microcarpus, and Amanita hemibapha, were analyzed for their free amino acid compositions by online pre-column derivazation reversed phase high-performance liquid chromatography (RP-HPLC analysis. Twenty free amino acids, aspartic acid, glutamic acid, serine, glycine, alanine, praline, cysteine, valine, methionine, phenylalanine, isoleucine, leucine, lysine, histidine, threonine, asparagines, glutamine, arginine, tyrosine, and tryptophan, were determined. The total free amino acid (TAA contents ranged from 1462.6 mg/100 g in B. craspedius to 13,106.2 mg/100 g in T. microcarpus. The different species showed distinct free amino acid profiles. The ratio of total essential amino acids (EAA to TAA was 0.13–0.41. All of the analyzed species showed high contents of hydrophobic amino acids, at 33%–54% of TAA. Alanine, cysteine, glutamine, and glutamic acid were among the most abundant amino acids present in all species. The results showed that the analyzed mushrooms possessed significant free amino acid contents, which may be important compounds contributing to the typical mushroom taste, nutritional value, and potent antioxidant properties of these wild edible mushrooms. Furthermore, the principal component analysis (PCA showed that the accumulative variance contribution rate of the first four principal components reached 94.39%. Cluster analysis revealed EAA composition and content might be an important parameter to separate the mushroom species, and T. microcarpus and A. hemibapha showed remarkable EAA content among the 13 species.

  4. Reduction of the argyrophilic nucleolar organizing region associated protein synthesis with age in buccal epithelial cells of healthy individuals.

    Science.gov (United States)

    Selvi, Burak; Demirtas, Halil; Eroz, Recep; Imamoglu, Nalan

    2015-04-01

    Nucleolus organizer regions (NORs) consist of the rRNA coding gene family (rDNA) in the cell nucleus. The argyrophilic proteins are selectively stained with silver nitrate and bind these regions. It was reported that NOR (rDNA) activity decreases in human lymphocytes, fibroblasts and bone marrow with age. However, to our knowledge there have not been any studies related to the NORs in oral epithelial cells of healthy individuals. Our aim is to detect any correlation between age and Total AgNOR area/Total nucleus area (TAA/TNA) values in buccal epithelial cells of healthy individuals. Oral epithelial cells from 50 healthy individuals (age range of 2-80 years old) were spread onto a clean glass slide, air dried and fixed. Then the AgNOR staining protocol was performed on these cells. TAA/TNA ratio and AgNOR dots were calculated using software. From each person 50 oral epithelial cells were evaluated. Statistically significant correlations were found between mean TAA/TNA values and age (Rsq = 0.534, p < 0.001 for linear and Rsq = 0.728, p < 0.0001 for polynominal regression), and between AgNOR number and age (Rsq = 0.621, p < 0.001 for linear and Rsq = 0.693, p < 0.0001 for polynominal regression). There is a significant correlation between age and AgNOR amount (ribosome biosynthesis rate) in buccal epithelial cells of healthy individuals. AgNORs in buccal epithelial cells may be used for detection of age.

  5. Liposomal Bupivacaine Versus Continuous Popliteal Sciatic Nerve Block in Total Ankle Arthroplasty.

    Science.gov (United States)

    Mulligan, Ryan P; Morash, Joel G; DeOrio, James K; Parekh, Selene G

    2017-11-01

    Liposomal bupivacaine (LB) is widely used in joint arthroplasty, but there is little reported on the use of LB in foot and ankle surgery. Continuous popliteal sciatic nerve block (CPSNB) is more commonly used for major foot and ankle reconstructions. The purpose of this study was to compare use of intraoperative LB injection to CPSNB as a regional anesthetic for total ankle arthroplasty (TAA), with attention to postoperative pain scores, narcotic use, and complications. Retrospective review of TAA patients of 2 fellowship-trained orthopedic foot and ankle surgeons was performed. Patients received either preoperative single-shot popliteal sciatic nerve block with 0.2% ropivacaine followed by intraoperative injection of LB or preoperative CPSNB alone. Outcomes examined were visual analog scale (VAS) pain score at 8 hours, 24 hours, 1 week, and 3 weeks following surgery; need for opioid pain medication refill; physician office notification for pain issues or other adverse events; and complications within the first 90 days following surgery. Standard statistical analysis was performed, and P < .05 was considered significant. Seventy-five patients were identified who underwent TAA and met inclusion criteria. Forty-one received LB, and 34 received CPSNB. No statistical difference was seen between groups with regard to complications, emergency department visits, readmissions, reoperations, VAS pain score at any time point, physician office contacts, and narcotic refills. Sixteen of 41 (39%) LB patients had narcotic refills, versus 12 of 34 (35%) CPSNB patients ( P = .81). Two of 41 (5%) LB patients had a complication postoperatively, versus 4 of 34 (12%) CPSNB patients. There were no complications specific to the anesthetic used in either group. This is the first study evaluating the use of LB for total ankle arthroplasty. Liposomal bupivacaine was safe and effective as an option for regional anesthetic and postoperative pain control, with comparable results to CPSNB

  6. Serum auto-antibody testing for early diagnosis of breast cancer

    International Nuclear Information System (INIS)

    Parvez, S.

    2012-01-01

    The aim of this thesis is generate prototype-tests suitable for randomized prospective validation of auto-antibody based diagnostic testing using serum samples. Tumours can stimulate the production of auto-antibodies against autologous cellular proteins known as TAAs (tumour associated antigens). This discovery has lead to a possibility of using the auto-antibodies as serological tools for the early diagnosis and management of breast cancer. The recombinant proteins expressed by the SEREX clones, identified from screenings of brain and lung tumour, were used for the production of the protein microarrays and macroarrays. The protein microarrays showed better correlation between the replicates of the serum samples used. The optimized protocols were used for the subsequent experiments. A sizable panel of 642 clone-proteins was selected by marker-screening on protein macroarrays with 38000 clones. These 642 clone-proteins were used to generate protein microarrays that differentiated serum samples from breast cancer patients and controls. Antigenic peptide motifs were identified by in-silico analysis of 642 clone-proteins and peptide arrays were generated using synthetically generated peptides. Comparative studies between protein microarrays and peptide microarrays were done using breast cancer and healthy control samples. Simultaneously, SEREX strategy was used for the identification of the immunogenic TAAs. I identified 192 cDNA expression clones derived from breast cancer tissue samples and the selection was done using breast cancer sera. The genes corresponding to these clones were found over-represented for the pathways that are known to be associated with cancers. These genes showed typical features of TAAs, like over-expression, mutations and fusion genes. (author)

  7. Xenogeneic therapeutic cancer vaccines as breakers of immune tolerance for clinical application: to use or not to use?

    Science.gov (United States)

    Strioga, Marius M; Darinskas, Adas; Pasukoniene, Vita; Mlynska, Agata; Ostapenko, Valerijus; Schijns, Virgil

    2014-07-07

    Accumulation of firm evidence that clinically apparent cancer develops only when malignant cells manage to escape immunosurveillance led to the introduction of tumor immunotherapy strategies aiming to reprogramm the cancer-dysbalanced antitumor immunity and restore its capacity to control tumor growth. There are several immunotherapeutical strategies, among which specific active immunotherapy or therapeutic cancer vaccination is one of the most promising. It targets dendritic cells (DCs) which have a unique ability of inducing naive and central memory T cell-mediated immune response in the most efficient manner. DCs can be therapeutically targeted either in vivo/in situ or by ex vivo manipulations followed by their re-injection back into the same patient. The majority of current DC targeting strategies are based on autologous or allogeneic tumor-associated antigens (TAAs) which possess various degrees of inherent tolerogenic potential. Therefore still limited efficacy of various tumor immunotherapy approaches may be attributed, among various other mechanisms, to the insufficient immunogenicity of self-protein-derived TAAs. Based on such an idea, the use of homologous xenogeneic antigens, derived from different species was suggested to overcome the natural immune tolerance to self TAAs. Xenoantigens are supposed to differ sufficiently from self antigens to a degree that renders them immunogenic, but at the same time preserves an optimal homology range with self proteins still allowing xenoantigens to induce cross-reactive T cells. Here we discuss the concept of xenogeneic vaccination, describe the cons and pros of autologous/allogeneic versus xenogeneic therapeutic cancer vaccines, present the results of various pre-clinical and several clinical studies and highlight the future perspectives of integrating xenovaccination into rapidly developing tumor immunotherapy regimens. Copyright © 2014. Published by Elsevier Ltd.

  8. Effective cancer vaccine platform based on attenuated salmonella and a type III secretion system.

    Science.gov (United States)

    Xu, Xin; Hegazy, Wael A H; Guo, Linjie; Gao, Xiuhua; Courtney, Amy N; Kurbanov, Suhrab; Liu, Daofeng; Tian, Gengwen; Manuel, Edwin R; Diamond, Don J; Hensel, Michael; Metelitsa, Leonid S

    2014-11-01

    Vaccines explored for cancer therapy have been based generally on injectable vector systems used to control foreign infectious pathogens, to which the immune system evolved to respond naturally. However, these vectors may not be effective at presenting tumor-associated antigens (TAA) to the immune system in a manner that is sufficient to engender antitumor responses. We addressed this issue with a novel orally administered Salmonella-based vector that exploits a type III secretion system to deliver selected TAA in the cytosol of professional antigen-presenting cells in situ. A systematic comparison of candidate genes from the Salmonella Pathogenicity Island 2 (SPI2) locus was conducted in the vaccine design, using model antigens and a codon-optimized form of the human TAA survivin (coSVN), an oncoprotein that is overexpressed in most human cancers. In a screen of 20 SPI2 promoter:effector combinations, a PsifB::sseJ combination exhibited maximal potency for antigen translocation into the APC cytosol, presentation to CD8 T cells, and murine immunogenicity. In the CT26 mouse model of colon carcinoma, therapeutic vaccination with a lead PsifB::sseJ-coSVN construct (p8032) produced CXCR3-dependent infiltration of tumors by CD8 T cells, reversed the CD8:Treg ratio at the tumor site, and triggered potent antitumor activity. Vaccine immunogenicity and antitumor potency were enhanced by coadministration of the natural killer T-cell ligand 7DW8-5, which heightened the production of IL12 and IFNγ. Furthermore, combined treatment with p8032 and 7DW8-5 resulted in complete tumor regression in A20 lymphoma-bearing mice, where protective memory was demonstrated. Taken together, our results demonstrate how antigen delivery using an oral Salmonella vector can provide an effective platform for the development of cancer vaccines. ©2014 American Association for Cancer Research.

  9. Serum Autoantibody Measurement for the Detection of Hepatocellular Carcinoma

    Science.gov (United States)

    Middleton, Catrin H.; Irving, William; Robertson, John F. R.; Murray, Andrea; Parsy-Kowalska, Celine B.; Macdonald, Isabel K.; McElveen, Jane; Allen, Jared; Healey, Graham F.; Thomson, Brian J.; Ryder, Stephen J.; Holdenrieder, Stefan; Chapman, Caroline J.

    2014-01-01

    Background Individuals with liver disease, and especially those with Hepatitis B or C, are at an increased risk of developing hepatocellular carcinoma (HCC) which is the third most common cause of cancer-related death worldwide. Inadequate screening tests largely account for presentation of advanced tumours and high mortality rates. Early detection of HCC amongst high-risk groups is paramount in improving prognosis. This research aimed to further characterise the previously described humoral immune response raised to tumour-associated antigens (TAAs) in the serum of patients with HCC. Methods Serum from 96 patients with confirmed HCC, 96 healthy controls matched for age and sex, 78 patients with confirmed liver cirrhosis and 91 patients with confirmed chronic liver disease were analysed for the presence of IgG autoantibodies raised to 41 recombinant TAAs/antigen fragments by ELISA. Results Varying autoantibody specificities (97–100%) and sensitivities (0–10%) were observed to individual TAAs. A 21-antigen panel achieved a specificity of 92% and sensitivity of 45% for the detection of HCC. This same panel identified 21% of 169 high-risk controls as having elevated autoantibody levels. A reproducible panel of 10 antigens achieved a specificity of 91% and sensitivity of 41% in HCC. 15% of 152 high-risk controls gave positive results with this panel. Conclusions This minimally invasive blood test has the potential to offer advantages over currently available tools for the identification of HCC amongst pre-disposed patients. Results are comparable to current gold standards in HCC (Ultrasonography) and to similar tests in other cancers (EarlyCDT-Lung). PMID:25093332

  10. Serum autoantibody measurement for the detection of hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Catrin H Middleton

    Full Text Available BACKGROUND: Individuals with liver disease, and especially those with Hepatitis B or C, are at an increased risk of developing hepatocellular carcinoma (HCC which is the third most common cause of cancer-related death worldwide. Inadequate screening tests largely account for presentation of advanced tumours and high mortality rates. Early detection of HCC amongst high-risk groups is paramount in improving prognosis. This research aimed to further characterise the previously described humoral immune response raised to tumour-associated antigens (TAAs in the serum of patients with HCC. METHODS: Serum from 96 patients with confirmed HCC, 96 healthy controls matched for age and sex, 78 patients with confirmed liver cirrhosis and 91 patients with confirmed chronic liver disease were analysed for the presence of IgG autoantibodies raised to 41 recombinant TAAs/antigen fragments by ELISA. RESULTS: Varying autoantibody specificities (97-100% and sensitivities (0-10% were observed to individual TAAs. A 21-antigen panel achieved a specificity of 92% and sensitivity of 45% for the detection of HCC. This same panel identified 21% of 169 high-risk controls as having elevated autoantibody levels. A reproducible panel of 10 antigens achieved a specificity of 91% and sensitivity of 41% in HCC. 15% of 152 high-risk controls gave positive results with this panel. CONCLUSIONS: This minimally invasive blood test has the potential to offer advantages over currently available tools for the identification of HCC amongst pre-disposed patients. Results are comparable to current gold standards in HCC (Ultrasonography and to similar tests in other cancers (EarlyCDT-Lung.

  11. Evaluación de la influencia de la Terapia Asistida por Animales en Salud Mental

    OpenAIRE

    Fontalba Navas, José Luis

    2017-01-01

    La Terapia Asistida por Animales (TAA) es un tipo de procedimiento terapéutico que implica a animales como método de tratamiento con el objetivo de mejorar el funcionamiento social, físico, emocional o cognitivo del paciente, especialmente aquellos que padecen enfermedades crónicas. Los trastornos mentales graves (TMG), son un conjunto de patologías que producen un significativo impacto y repercusión en la calidad de vida de las personas que los padecen, dificultándoles su adaptación socio...

  12. Matsalu loodusfilmifestival rajab endale kohta / Silvia Lotman

    Index Scriptorium Estoniae

    Lotman, Silvia, 1980-

    2004-01-01

    23.-26.09. 2004 toimus Matsalu II rahvusvaheline loodusfilmide festival Lihulas. Peapreemia võitis "Pelikani odüsseia" : stsenarist Malcolm Penny : režissöör Moshe Alpert : produtsent Yossi Weissler : Iisrael - Holland 2003. Kategoorias "Kaamera ees on linnud" sai esimese preemia rootslase "Rõõm kohtuda, künnivares" ja kategoorias "Inimene ja loodus" oli parim saksa režissööri Aija Bley "Läti - kõnnumaa Venemaa ja Riia vahel". Žüriid juhtis Jeffery Boswall BBC-st. Festivalil osalesid taas loodusfotograafid

  13. No effect of melatonin on oxidative stress after laparoscopic cholecystectomy: a randomized placebo-controlled trial

    DEFF Research Database (Denmark)

    Kucukakin, B.; Klein, M.; Lykkesfeldt, Jens

    2010-01-01

    Background Melatonin, an endogenous circadian regulator, also has antioxidant and anti-inflammatory properties. The aim of this study was to evaluate the antioxidative effect of melatonin in patients undergoing laparoscopic cholecystectomy. Methods Patients were randomized to receive 10 mg...... melatonin and 21 patients received placebo during surgery. No significant differences were observed between the groups in the oxidative stress variables MDA, TAA, AA and DHA or in the inflammatory variable CRP (repeated-measures ANOVA, P > 0.05 for all variables). Conclusions Administration of 10 mg...... melatonin did not reduce variables of oxidative stress in patients undergoing elective laparoscopic cholecystectomy...

  14. A influência do cão na expressividade emocional de crianças com transtorno do espectro do autismo

    OpenAIRE

    Renata Paula da Silva Roma

    2016-01-01

    O Transtorno do Espectro do Autismo (TEA) inclui um conjunto de sintomas, tais como dificuldade para sustentar contato visual direto e comprometimento da linguagem. Apesar da Terapia Assistida Por Animais (TAA) com cães ser considerada uma modalidade terapêutica eficaz para promover o desenvolvimento de pessoas com TEA, ainda não são se sabe quais características dos cães possibilitam alcançar sucesso na terapia. Esta análise quantitativa tem como objetivo verificar o impacto de abordagens la...

  15. Role of Adenosine Receptor A2A in Traumatic Optic Neuropathies

    Science.gov (United States)

    2015-02-01

    CAT GGC CTC CAA GGA GTAAGA GAG GGA GAT GCT CAG TGT TGG M32599 18S AGT GCG GGT CAT AAG CTT GC GGG CCT CAC TAA ACC ATC CA NR_003278 55S. Ahmad et al...CAT GGC CTC CAA GGA GTAAGA M32599 GAG GGA GAT GCT CAG TGTTGG 185 AGT GCG GGT CAT MG CTT GC NR...003278 GGG CCT CACTAA ACCATCCA MD) counter stained...TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC NM_031168.1 GAPDH CAT GGC CTC CAA GGA GTAAGAGAG GGA GAT GCT CAG TGT TGG M32599 18S AGT GCG GGT CAT AAG CTT GC GGG CCT

  16. Tärinänmittauslaitteisto

    OpenAIRE

    Haataja, Jani

    2007-01-01

    Insinöörityön aiheena oli suunnitella ja toteuttaa ihmisen kehotärinänmittauslaitteisto. Tarkoituksena oli mitata ihmiseen penkin kautta siirtyvää työkoneentärinää. Laitteisto perustui EU-tärinädirektiiviin, joka taas pohjautui ISO 2631 -standardiin. Kansainvälinen ISO 8041 -standardi asettaa mittauksissa käytettäville antureille ja laitteistolle erilaisia vaatimuksia, joiden avulla laitteisto valittiin. ISO 2631-1 -standardi määrittelee laskutavat ja mittausvaatimukset kehotärinä...

  17. Miks on Savisaar ja proua Bush Birma kallal / Mai Loog

    Index Scriptorium Estoniae

    Loog, Mai, 1960-

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke 29. mai lk. 7. Birma sõjaväeline valitsus otsustas taas pikendada aasta võrra Nobeli rahupreemia laureaadi ja demokraatliku opositsiooni liidri Aung San Suu Kyi 11-aastast koduaresti, mille vastu astusid välja USA senaatorid presidendiproua Laura Bushi juhtimisel kui ka Tallinna linnapea Edgar Savisaar koos Pariisi ja Rooma linnapeadega. Birma hunta plaanitavast konstitutsioonist, kus aatomienergia on pandud riigikaitse ja julgeoleku alla. Venemaa aatomienergia agentuuri Rosatomi lepingust Birma huntaga aatomienergia tootmiseks

  18. El Mejoramiento de la Efectividad del Personal de las Diferentes Unidades del Ejrcito de Guatemala Involucradas en la Integracin de Contingentes Desplegados en Diferentes Misiones de Paz de la Organizacin de las Naciones Unidas (Improving the Effectiveness of Guatemalan Army Units that Provide Soldiers to Units Deployed in United Nations Peace Missions)

    Science.gov (United States)

    2017-06-09

    Commonwealth Institute, 2017, acceso 15 de abril de 2017, http://www.comw.org/qdr/fulltext/08TAA.pdf. 9 2004, después de que el Presidente Bertrand...octubre de 2004, el Presidente de la República de Guatemala considerando que en las funciones reguladas en los artículos 182, 183 y 246 de la...Constitución Política de la República de Guatemala; se establece que el Presidente de la República es el Jefe del Estado de Guatemala y dentro de sus

  19. Functional and clinical outcomes of total ankle arthroplasty in elderly compared to younger patients.

    Science.gov (United States)

    Tenenbaum, Shay; Bariteau, Jason; Coleman, Scott; Brodsky, James

    2017-06-01

    Total ankle arthroplasty (TAA) is becoming an increasingly utilized procedure for the management of end-stage ankle arthritis. Elderly patients are the fastest growing segment of the population in the western world, creating a unique challenge to the health economics of our era. Determining if elderly patients with end-stage ankle arthritis demonstrate the same improvements in clinical outcomes and functional measures of gait following TAA would be valuable. This can aid to evaluate the utilization of TAA in this enlarging cohort of our population. Consecutive series of twenty-one patients over the age of 70, who underwent TAA for end-stage ankle arthritis, was prospectively compared to a series of twenty-one patients aged 50-60, who underwent the same procedure by single surgeon during same time period. Clinical outcomes were measured with outcome scores including VAS pain score, AOFAS Ankle and Hindfoot Score, and the SF-36. Three-dimensional gait analysis was performed preoperatively and at a minimum of one year postoperatively, to measure temporal-spatial, kinematic, and kinetic parameters of gait. Mixed model multivariate statistical analysis was used to evaluate and compare the independent contributions to outcomes of the surgical intervention over time; of patient age; and of time-plus-age interaction, as these influenced both the clinical outcomes and the functional gait outcomes. Statistically significant improvements in VAS pain scores, AOFAS ankle/hindfoot scores, and SF-36 scores were demonstrated in both age groups. Following surgery, there were improvements in all parameters of gait, including temporal-spatial parameters as step length and walking velocity; kinematic parameters, including, increase in total range of motion to a total of 17-19°; and kinetic parameters, including increase in ankle power and moment. The improvements both in clinical and gait outcomes were equivalent in the two age groups. In this comparative study, it is shown that both

  20. Muusikauudiseid maailmast / Nele-Eva Steinfeld

    Index Scriptorium Estoniae

    Steinfeld, Nele-Eva

    2016-01-01

    Lühisõnumeid maailmast: Suri Sir Peter Maxwell Davies. Pärijad ei võimalda juurdepääsu Verdi ja Puccini arhiividele. Eksklusiivne plaadileping Ksenija Sidorovale. Thomas Adès Bostoni sümfooniaorkestri kunstiline partner. Jätkuvad probleemid Inglise Rahvusooperis. Tõusev täht Karina Canellakis pälvis Georg Solti preemia. Suri biitlite mänedžer George Martin. Saksamaal taas üks orkester vähem. Milline kontserdisaal võimaldab võimsamat elamust. Beethoveni kiri