WorldWideScience

Sample records for essential gene encoding

  1. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  2. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  3. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  4. The multiple sulfatase deficiency gene encodes an essential and limiting factor for the activity of sulfatases.

    Science.gov (United States)

    Cosma, Maria Pia; Pepe, Stefano; Annunziata, Ida; Newbold, Robert F; Grompe, Markus; Parenti, Giancarlo; Ballabio, Andrea

    2003-05-16

    In multiple sulfatase deficiency (MSD), a human inherited disorder, the activities of all sulfatases are impaired due to a defect in posttranslational modification. Here we report the identification, by functional complementation using microcell-mediated chromosome transfer, of a gene that is mutated in MSD and is able to rescue the enzymatic deficiency in patients' cell lines. Functional conservation of this gene was observed among distantly related species, suggesting a critical biological role. Coexpression of SUMF1 with sulfatases results in a strikingly synergistic increase of enzymatic activity, indicating that SUMF1 is both an essential and a limiting factor for sulfatases. These data have profound implications on the feasibility of enzyme replacement therapy for eight distinct inborn errors of metabolism.

  5. Genes encoding A-type flavoproteins are essential for photoreduction of O2 in cyanobacteria.

    Science.gov (United States)

    Helman, Yael; Tchernov, Dan; Reinhold, Leonora; Shibata, Mari; Ogawa, Teruo; Schwarz, Rakefet; Ohad, Itzhak; Kaplan, Aaron

    2003-02-04

    O(2) photoreduction by photosynthetic electron transfer, the Mehler reaction, was observed in all groups of oxygenic photosynthetic organisms, but the electron transport chain mediating this reaction remains unidentified. We provide the first evidence for the involvement of A-type flavoproteins that reduce O(2) directly to water in vitro. Synechocystis sp. strain PCC 6803 mutants defective in flv1 and flv3, encoding A-type flavoproteins, failed to exhibit O(2) photoreduction but performed normal photosynthesis and respiration. We show that the light-enhanced O(2) uptake was not due to respiration or photorespiration. After dark acclimation, photooxidation of P(700) was severely depressed in mutants Deltaflv1 and Deltaflv3 but recovered after light activation of CO(2) fixation, which gives P(700) an additional electron acceptor. Inhibition of CO(2) fixation prevented recovery but scarcely affected P(700) oxidation in the wild-type, where the Mehler reaction provides an alternative route for electrons. We conclude that the source of electrons for O(2) photoreduction is PSI and that the highly conserved A-type flavoproteins Flv1 and Flv3 are essential for this process in vivo. We propose that in cyanobacteria, contrary to eukaryotes, the Mehler reaction produces no reactive oxygen species and may be evolutionarily related to the response of anaerobic bacteria to O(2).

  6. liver-enriched gene 1a and 1b encode novel secretory proteins essential for normal liver development in zebrafish.

    Directory of Open Access Journals (Sweden)

    Changqing Chang

    Full Text Available liver-enriched gene 1 (leg1 is a liver-enriched gene in zebrafish and encodes a novel protein. Our preliminary data suggested that Leg1 is probably involved in early liver development. However, no detailed characterization of Leg1 has been reported thus far. We undertook both bioinformatic and experimental approaches to study leg1 gene structure and its role in early liver development. We found that Leg1 identifies a new conserved protein superfamily featured by the presence of domain of unknown function 781 (DUF781. There are two copies of leg1 in zebrafish, namely leg1a and leg1b. Both leg1a and leg1b are expressed in the larvae and adult liver with leg1a being the predominant form. Knockdown of Leg1a or Leg1b by their respective morpholinos specifically targeting their 5'-UTR each resulted in a small liver phenotype, demonstrating that both Leg1a and Leg1b are important for early liver development. Meanwhile, we found that injection of leg1-ATG(MO, a morpholino which can simultaneously block the translation of Leg1a and Leg1b, caused not only a small liver phenotype but hypoplastic exocrine pancreas and intestinal tube as well. Further examination of leg1-ATG(MO morphants with early endoderm markers and early hepatic markers revealed that although depletion of total Leg1 does not alter the hepatic and pancreatic fate of the endoderm cells, it leads to cell cycle arrest that results in growth retardation of liver, exocrine pancreas and intestine. Finally, we proved that Leg1 is a secretory protein. This intrigued us to propose that Leg1 might act as a novel secreted regulator that is essential for liver and other digestive organ development in zebrafish.

  7. The Rice TCM5 Gene Encoding a Novel Deg Protease Protein is Essential for Chloroplast Development under High Temperatures.

    Science.gov (United States)

    Zheng, Kailun; Zhao, Jian; Lin, Dongzhi; Chen, Jiaying; Xu, Jianlong; Zhou, Hua; Teng, Sheng; Dong, Yanjun

    2016-12-01

    High temperature affects a broad spectrum of cellular components and metabolism in plants. The Deg/HtrA family of ATP-independent serine endopeptidases is present in nearly all organisms. Deg proteases are required for the survival of Escherichia coli at high temperatures. However, it is still unclear whether rice Deg proteases are required for chloroplast development under high temperatures. In this study, we reported the first rice deg mutant tcm5 (thermo-sensitive chlorophyll-deficient mutant 5) that has an albino phenotype, defective chloroplasts and could not survive after the 4-5 leaf seedling stage when grown at high temperature (32 °C). However, when grown at low temperatures (20 °C), tcm5 has a normal phenotype. Map-based cloning showed that TCM5 encoding a chloroplast-targeted Deg protease protein. The TCM5 transcripts were highly expressed in all green tissues and undetectable in other tissues, showing the tissue-specific expression. In tcm5 mutants grown at high temperatures, the transcript levels of certain genes associated with chloroplast development especially PSII-associated genes were severely affected, but recovered to normal levels at low temperatures. These results showed important role of TCM5 for chloroplast development under high temperatures. The TCM5 encodes chloroplast-targeted Deg protease protein which is important for chloroplast development and the maintenance of PSII function and its disruption would lead to a defective chloroplast and affected expression levels of genes associated with chloroplast development and photosynthesis at early rice seedling stage under high temperatures.

  8. ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

    Science.gov (United States)

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-25

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

  9. A Halloween gene noppera-bo encodes a glutathione S-transferase essential for ecdysteroid biosynthesis via regulating the behaviour of cholesterol in Drosophila.

    Science.gov (United States)

    Enya, Sora; Ameku, Tomotsune; Igarashi, Fumihiko; Iga, Masatoshi; Kataoka, Hiroshi; Shinoda, Tetsuro; Niwa, Ryusuke

    2014-10-10

    In insects, the precise timing of moulting and metamorphosis is strictly guided by ecdysteroids that are synthesised from dietary cholesterol in the prothoracic gland (PG). In the past decade, several ecdysteroidogenic enzymes, some of which are encoded by the Halloween genes, have been identified and characterised. Here, we report a novel Halloween gene, noppera-bo (nobo), that encodes a member of the glutathione S-transferase family. nobo was identified as a gene that is predominantly expressed in the PG of the fruit fly Drosophila melanogaster. We generated a nobo knock-out mutant, which displayed embryonic lethality and a naked cuticle structure. These phenotypes are typical for Halloween mutants showing embryonic ecdysteroid deficiency. In addition, the PG-specific nobo knock-down larvae displayed an arrested phenotype and reduced 20-hydroxyecdysone (20E) titres. Importantly, both embryonic and larval phenotypes were rescued by the administration of 20E or cholesterol. We also confirm that PG cells in nobo loss-of-function larvae abnormally accumulate cholesterol. Considering that cholesterol is the most upstream material for ecdysteroid biosynthesis in the PG, our results raise the possibility that nobo plays a crucial role in regulating the behaviour of cholesterol in steroid biosynthesis in insects.

  10. The C. elegans maternal-effect gene clk-2 is essential for embryonic development, encodes a protein homologous to yeast Tel2p and affects telomere length.

    Science.gov (United States)

    Bénard, C; McCright, B; Zhang, Y; Felkai, S; Lakowski, B; Hekimi, S

    2001-10-01

    The Caenorhabditis elegans maternal-effect clk genes are involved in the temporal control of development and behavior. We report the genetic and molecular characterization of clk-2. A temperature-sensitive mutation in the gene clk-2 affects embryonic and post-embryonic development, reproduction, and rhythmic behaviors. Yet, virtually all phenotypes are fully maternally rescued. Embryonic development strictly requires the activity of maternal clk-2 during a narrow time window between oocyte maturation and the two- to four-cell embryonic stage. Positional cloning of clk-2 reveals that it encodes a protein homologous to S. cerevisiae Tel2p. In yeast, the gene TEL2 regulates telomere length and participates in gene silencing at subtelomeric regions. In C. elegans, clk-2 mutants have elongated telomeres, and clk-2 overexpression can lead to telomere shortening. Tel2p has been reported to bind to telomeric DNA repeats in vitro. However, we find that a functional CLK-2::GFP fusion protein is cytoplasmic in worms. We discuss how the phenotype of clk-2 mutants could be the result of altered patterns of gene expression.

  11. The gene fmt, encoding tRNAfMet-formyl transferase, is essential for normal growth of M. bovis, but not for viability.

    Science.gov (United States)

    Vanunu, Miriam; Lang, Ziv; Barkan, Daniel

    2017-11-09

    Mycobacterium tuberculosis is a major health threat, necessitating novel drug targets. Protein synthesis in bacteria uses initiator tRNAi charged with formylated methionine residue. Deletion of the formylase gene, tRNAfMet-formyl transferase (fmt), causes severe growth-retardation in E. coli and in S. pneumoniae, but not in P. aeruginosa or S. aureus. fmt was predicted to be essential in M. tuberculosis by transposon library analysis, but this was never formally tested in any mycobacteria. We performed a targeted deletion of fmt in M. smegmatis as well as Mtb-complex (M. bovis). In both cases, we created a mero-diploid strain, deleted the native gene by two-step allelic exchange or specialized-phage transduction, and then removed the complementing gene to create full deletion mutants. In M. smegmatis a full deletion strain could be easily created. In contrast, in M. bovis-BCG, a full deletion strain could only be created after incubation of 6 weeks, with a generation time ~2 times longer than for wt bacteria. Our results confirm the importance of this gene in pathogenic mycobacteria, but as the deletion mutant is viable, validity of fmt as a drug target remains unclear. Our results also refute the previous reports that fmt is essential in M. tuberculosis-complex.

  12. Identification of a Burkholderia mallei polysaccharide gene cluster by subtractive hybridization and demonstration that the encoded capsule is an essential virulence determinant.

    Science.gov (United States)

    DeShazer, D; Waag, D M; Fritz, D L; Woods, D E

    2001-05-01

    Little is known about the virulence factors of Burkholderia mallei, the etiologic agent of glanders. We employed subtractive hybridization to identify genetic determinants present in B. mallei but not in Burkholderia thailandensis, a non-pathogenic soil microbe. Three subtractive hybridization products were mapped to a genetic locus encoding proteins involved in the biosynthesis, export and translocation of a capsular polysaccharide. We identified an insertion sequence (IS 407 A) at one end of the capsule gene cluster and demonstrated that it was functional in B. mallei. Mutations were introduced in the B. mallei capsular gene cluster and the corresponding mutants were examined for their reactivity with antibodies raised against Burkholderia pseudomallei surface polysaccharides by immunoblotting and ELISA. Immunogold electron microscopy demonstrated the presence of a capsule on the surface of B. mallei ATCC 23344 (parental strain) but not on B. mallei DD3008 (capsule mutant) or B. thailandensis. Surprisingly, B. thailandensis also harboured a portion of the capsule gene cluster. ATCC 23344 was highly virulent in hamsters and mice, but DD3008 was avirulent in both animal models. The results presented here demonstrate that the capsular polysaccharide of B. mallei is required for production of disease in two animal models of glanders infection and is a major virulence factor. Copyright 2001 Crown Copyright.

  13. Arabidopsis MAS2, an Essential Gene That Encodes a Homolog of Animal NF-κ B Activating Protein, Is Involved in 45S Ribosomal DNA Silencing.

    Science.gov (United States)

    Sánchez-García, Ana Belén; Aguilera, Verónica; Micol-Ponce, Rosa; Jover-Gil, Sara; Ponce, María Rosa

    2015-07-01

    Ribosome biogenesis requires stoichiometric amounts of ribosomal proteins and rRNAs. Synthesis of rRNAs consumes most of the transcriptional activity of eukaryotic cells, but its regulation remains largely unclear in plants. We conducted a screen for ethyl methanesulfonate-induced suppressors of Arabidopsis thaliana ago1-52, a hypomorphic allele of AGO1 (ARGONAUTE1), a key gene in microRNA pathways. We identified nine extragenic suppressors as alleles of MAS2 (MORPHOLOGY OF AGO1-52 SUPPRESSED2). Positional cloning showed that MAS2 encodes the putative ortholog of NKAP (NF-κ B activating protein), a conserved eukaryotic protein involved in transcriptional repression and splicing in animals. The mas2 point mutations behave as informational suppressors of ago1 alleles that cause missplicing. MAS2 is a single-copy gene whose insertional alleles are embryonic lethal. In yeast two-hybrid assays, MAS2 interacted with splicing and ribosome biogenesis proteins, and fluorescence in situ hybridization showed that MAS2 colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs). The artificial microRNA amiR-MAS2 partially repressed MAS2 and caused hypomethylation of 45S rDNA promoters as well as partial NOR decondensation, indicating that MAS2 negatively regulates 45S rDNA expression. Our results thus reveal a key player in the regulation of rRNA synthesis in plants. © 2015 American Society of Plant Biologists. All rights reserved.

  14. The exp1 gene essential for pileus expansion and autolysis of the inky cap mushroom Coprinopsis cinerea (Coprinus cinereus) encodes an HMG protein.

    Science.gov (United States)

    Muraguchi, Hajime; Fujita, Takashi; Kishibe, Yuya; Konno, Kanako; Ueda, Nanae; Nakahori, Kiyoshi; Yanagi, Sonoe O; Kamada, Takashi

    2008-06-01

    The homobasidiomycete Coprinopsis cinerea is a member of the fungi known as inky cap mushrooms, and its fruiting-body pileus autolyzes soon after completion of the development. During the last 3h of the development, the pileus exhibits umbrella-like expansion: the pileal tissue is cracked at the base of each gill and then each gill tissue is split to form a V-shape, as seen in a cross section. We identified two C. cinerea mutants defective in both pileus expansion and autolysis. The defects in both mutants are due to recessive mutations in a single gene, designated exp1. The exp1 gene is predicted to encode an HMG1/2-like protein with two HMG domains. The transcription of exp1 is strongly induced in the pileus 3h before pileus expansion. This result, together with the fact that the exp1 mutations cause a specific developmental phenotype, suggest that Exp1 is a novel, transcriptional regulator controlling the final phase of fruiting-body morphogenesis.

  15. The maternal-effect gene cellular island encodes aurora B kinase and is essential for furrow formation in the early zebrafish embryo.

    Directory of Open Access Journals (Sweden)

    Taijiro Yabe

    2009-06-01

    Full Text Available Females homozygous for a mutation in cellular island (cei produce embryos with defects in cytokinesis during early development. Analysis of the cytoskeletal events associated with furrow formation reveal that these defects include a general delay in furrow initiation as well as a complete failure to form furrow-associated structures in distal regions of the blastodisc. A linkage mapping-based candidate gene approach, including transgenic rescue, shows that cei encodes the zebrafish Aurora B kinase homologue. Genetic complementation analysis between the cei mutation and aurB zygotic lethal mutations corroborate gene assignment and reveal a complex nature of the maternal-effect cei allele, which appears to preferentially affect a function important for cytokinesis in the early blastomeres. Surprisingly, in cei mutant embryos a short yet otherwise normal furrow forms in the center of the blastodisc. Furrow formation is absent throughout the width of the blastodisc in cei mutant embryos additionally mutant for futile cycle, which lack a spindle apparatus, showing that the residual furrow signal present in cei mutants is derived from the mitotic spindle. Our analysis suggests that partially redundant signals derived from the spindle and astral apparatus mediate furrow formation in medial and distal regions of the early embryonic blastomeres, respectively, possibly as a spatial specialization to achieve furrow formation in these large cells. In addition, our data also suggest a role for Cei/AurB function in the reorganization of the furrow-associated microtubules in both early cleavage- and somite-stage embryos. In accordance with the requirement for cei/aurB in furrow induction in the early cleavage embryo, germ plasm recruitment to the forming furrow is also affected in embryos lacking normal cei/aurB function.

  16. Essential Bacillus subtilis genes

    DEFF Research Database (Denmark)

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...

  17. Data on the presence or absence of genes encoding essential proteins for ochratoxin and fumonisin biosynthesis in Aspergillus niger and Aspergillus welwitschiae

    Directory of Open Access Journals (Sweden)

    Fernanda Pelisson Massi

    2016-06-01

    Full Text Available We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17% highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5% highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5% highlights strains harboring the fum8 gene. Profile 4 (28% highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, “Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae” [1].

  18. Targeted disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase (G6PD-null): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress.

    NARCIS (Netherlands)

    P.P. Pandolfi; F. Sonati; R. Rivi; P. Mason; F.G. Grosveld (Frank); L. Luzzatto

    1995-01-01

    textabstractGlucose 6-phosphate dehydrogenase (G6PD) is a housekeeping enzyme encoded in mammals by an X-linked gene. It has important functions in intermediary metabolism because it catalyzes the first step in the pentose phosphate pathway and provides reductive potential in the form of NADPH. In

  19. Defining the Role of Essential Genes in Human Disease

    Science.gov (United States)

    Robertson, David L.; Hentges, Kathryn E.

    2011-01-01

    A greater understanding of the causes of human disease can come from identifying characteristics that are specific to disease genes. However, a full understanding of the contribution of essential genes to human disease is lacking, due to the premise that these genes tend to cause developmental abnormalities rather than adult disease. We tested the hypothesis that human orthologs of mouse essential genes are associated with a variety of human diseases, rather than only those related to miscarriage and birth defects. We segregated human disease genes according to whether the knockout phenotype of their mouse ortholog was lethal or viable, defining those with orthologs producing lethal knockouts as essential disease genes. We show that the human orthologs of mouse essential genes are associated with a wide spectrum of diseases affecting diverse physiological systems. Notably, human disease genes with essential mouse orthologs are over-represented among disease genes associated with cancer, suggesting links between adult cellular abnormalities and developmental functions. The proteins encoded by essential genes are highly connected in protein-protein interaction networks, which we find correlates with an over-representation of nuclear proteins amongst essential disease genes. Disease genes associated with essential orthologs also are more likely than those with non-essential orthologs to contribute to disease through an autosomal dominant inheritance pattern, suggesting that these diseases may actually result from semi-dominant mutant alleles. Overall, we have described attributes found in disease genes according to the essentiality status of their mouse orthologs. These findings demonstrate that disease genes do occupy highly connected positions in protein-protein interaction networks, and that due to the complexity of disease-associated alleles, essential genes cannot be ignored as candidates for causing diverse human diseases. PMID:22096564

  20. Ppm1-encoded polyprenyl monophosphomannose synthase activity is essential for lipoglycan synthesis and survival in mycobacteria.

    Directory of Open Access Journals (Sweden)

    Amrita K Rana

    Full Text Available The biosynthesis of mycobacterial mannose-containing lipoglycans, such as lipomannan (LM and the immunomodulator lipoarabinomanan (LAM, is carried out by the GT-C superfamily of glycosyltransferases that require polyprenylphosphate-based mannose (PPM as a sugar donor. The essentiality of lipoglycan synthesis for growth makes the glycosyltransferase that synthesizes PPM, a potential drug target in Mycobacterium tuberculosis, the causative agent of tuberculosis. In M. tuberculosis, PPM has been shown to be synthesized by Ppm1 in enzymatic assays. However, genetic evidence for its essentiality and in vivo role in LM/LAM and PPM biosynthesis is lacking. In this study, we demonstrate that MSMEG3859, a Mycobacterium smegmatis gene encoding the homologue of the catalytic domain of M. tuberculosis Ppm1, is essential for survival. Depletion of MSMEG3859 in a conditional mutant of M. smegmatis resulted in the loss of higher order phosphatidyl-myo-inositol mannosides (PIMs and lipomannan. We were also able to demonstrate that two other M. tuberculosis genes encoding glycosyltransferases that either had been shown to possess PPM synthase activity (Rv3779, or were involved in synthesizing similar polyprenol-linked donors (ppgS, were unable to compensate for the loss of MSMEG3859 in the conditional mutant.

  1. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  2. NEMO is essential for Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13-induced gene expression and protection against death receptor-induced cell death, and its N-terminal 251 residues are sufficient for this process.

    Science.gov (United States)

    Tolani, Bhairavi; Matta, Hittu; Gopalakrishnan, Ramakrishnan; Punj, Vasu; Chaudhary, Preet M

    2014-06-01

    Kaposi's sarcoma-associated herpesvirus-encoded viral FLICE inhibitory protein (vFLIP) K13 was originally believed to protect virally infected cells against death receptor-induced apoptosis by interfering with caspase 8/FLICE activation. Subsequent studies revealed that K13 also activates the NF-κB pathway by binding to the NEMO/inhibitor of NF-κB (IκB) kinase gamma (IKKγ) subunit of an IKK complex and uses this pathway to modulate the expression of genes involved in cellular survival, proliferation, and the inflammatory response. However, it is not clear if K13 can also induce gene expression independently of NEMO/IKKγ. The minimum region of NEMO that is sufficient for supporting K13-induced NF-κB has not been delineated. Furthermore, the contribution of NEMO and NF-κB to the protective effect of K13 against death receptor-induced apoptosis remains to be determined. In this study, we used microarray analysis on K13-expressing wild-type and NEMO-deficient cells to demonstrate that NEMO is required for modulation of K13-induced genes. Reconstitution of NEMO-null cells revealed that the N-terminal 251 amino acid residues of NEMO are sufficient for supporting K13-induced NF-κB but fail to support tumor necrosis factor alpha (TNF-α)-induced NF-κB. K13 failed to protect NEMO-null cells against TNF-α-induced cell death but protected those reconstituted with the NEMO mutant truncated to include only the N-terminal 251 amino acid residues [the NEMO(1-251) mutant]. Taken collectively, our results demonstrate that NEMO is required for modulation of K13-induced genes and the N-terminal 251 amino acids of NEMO are sufficient for supporting K13-induced NF-κB. Finally, the ability of K13 to protect against TNF-α-induced cell death is critically dependent on its ability to interact with NEMO and activate NF-κB. Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13 is believed to protect virally infected cells against death receptor-induced apoptosis and to

  3. Prediction and analysis of essential genes using the enrichments of gene ontology and KEGG pathways.

    Science.gov (United States)

    Chen, Lei; Zhang, Yu-Hang; Wang, ShaoPeng; Zhang, YunHua; Huang, Tao; Cai, Yu-Dong

    2017-01-01

    Identifying essential genes in a given organism is important for research on their fundamental roles in organism survival. Furthermore, if possible, uncovering the links between core functions or pathways with these essential genes will further help us obtain deep insight into the key roles of these genes. In this study, we investigated the essential and non-essential genes reported in a previous study and extracted gene ontology (GO) terms and biological pathways that are important for the determination of essential genes. Through the enrichment theory of GO and KEGG pathways, we encoded each essential/non-essential gene into a vector in which each component represented the relationship between the gene and one GO term or KEGG pathway. To analyze these relationships, the maximum relevance minimum redundancy (mRMR) was adopted. Then, the incremental feature selection (IFS) and support vector machine (SVM) were employed to extract important GO terms and KEGG pathways. A prediction model was built simultaneously using the extracted GO terms and KEGG pathways, which yielded nearly perfect performance, with a Matthews correlation coefficient of 0.951, for distinguishing essential and non-essential genes. To fully investigate the key factors influencing the fundamental roles of essential genes, the 21 most important GO terms and three KEGG pathways were analyzed in detail. In addition, several genes was provided in this study, which were predicted to be essential genes by our prediction model. We suggest that this study provides more functional and pathway information on the essential genes and provides a new way to investigate related problems.

  4. Identification of essential genes of the periodontal pathogen Porphyromonas gingivalis

    Science.gov (United States)

    2012-01-01

    Background Porphyromonas gingivalis is a Gram-negative anaerobic bacterium associated with periodontal disease onset and progression. Genetic tools for the manipulation of bacterial genomes allow for in-depth mechanistic studies of metabolism, physiology, interspecies and host-pathogen interactions. Analysis of the essential genes, protein-coding sequences necessary for survival of P. gingivalis by transposon mutagenesis has not previously been attempted due to the limitations of available transposon systems for the organism. We adapted a Mariner transposon system for mutagenesis of P. gingivalis and created an insertion mutant library. By analyzing the location of insertions using massively-parallel sequencing technology we used this mutant library to define genes essential for P. gingivalis survival under in vitro conditions. Results In mutagenesis experiments we identified 463 genes in P. gingivalis strain ATCC 33277 that are putatively essential for viability in vitro. Comparing the 463 P. gingivalis essential genes with previous essential gene studies, 364 of the 463 are homologues to essential genes in other species; 339 are shared with more than one other species. Twenty-five genes are known to be essential in P. gingivalis and B. thetaiotaomicron only. Significant enrichment of essential genes within Cluster of Orthologous Groups ‘D’ (cell division), ‘I’ (lipid transport and metabolism) and ‘J’ (translation/ribosome) were identified. Previously, the P. gingivalis core genome was shown to encode 1,476 proteins out of a possible 1,909; 434 of 463 essential genes are contained within the core genome. Thus, for the species P. gingivalis twenty-two, seventy-seven and twenty-three percent of the genome respectively are devoted to essential, core and accessory functions. Conclusions A Mariner transposon system can be adapted to create mutant libraries in P. gingivalis amenable to analysis by next-generation sequencing technologies. In silico analysis

  5. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  6. The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc)

    DEFF Research Database (Denmark)

    Abildgaard, Lone; Højberg, Ole; Schramm, Andreas

    2010-01-01

    was to investigate the influence of a commercial essential oil blend, CRINA® Poultry, on the intestinal C. perfringens population in broilers vaccinated against coccidiosis. The observed C. perfringens levels were relatively high in general and peaked at 27 days of bird age with numbers ranging from 7 to 8 log cells...... concentrations of 100 and 200 mg/kg feed of the essential oil blend did not reduce the intestinal numbers of C. perfringens compared to a non-supplemented control group (P>0.05). Further, the essential oil blend failed to improve (P>0.05) both the growth and feed conversion ratio of the broilers. For rapid...

  7. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  8. Genes essential for phototrophic growth by a purple alphaproteobacterium: Genes for phototrophic growth

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jianming [Key Lab of Applied Mycology, College of Life Sciences, Qingdao Agricultural University, Qingdao Shandong Province People' s Republic of China; Department of Microbiology, University of Washington, Seattle WA USA; Yin, Liang [Department of Microbiology, University of Washington, Seattle WA USA; Lessner, Faith H. [Department of Biological Sciences, University of Arkansas, Fayetteville AR USA; Nakayasu, Ernesto S. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Payne, Samuel H. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Fixen, Kathryn R. [Department of Microbiology, University of Washington, Seattle WA USA; Gallagher, Larry [Department of Genome Sciences, University of Washington, Seattle WA USA; Harwood, Caroline S. [Department of Microbiology, University of Washington, Seattle WA USA

    2017-07-24

    Anoxygenic purple phototrophic bacteria have served as important models for studies of photophosphorylation. The pigment-protein complexes responsible for converting light energy to ATP are relatively simple and these bacteria can grow heterotrophically under aerobic conditions, thus allowing for the study of mutants defective in photophosphorylation. In the past, genes responsible for anoxygenic phototrophic growth have been identified in a number of different bacterial species. Here we systematically studied the genetic basis for this metabolism by using Tn-seq to identify genes essential for the anaerobic growth of the purple bacterium Rhodopseudomonas palustris on acetate in light. We identified 171 genes required for growth in this condition, 35 of which are annotated as photosynthesis genes. Among these are a few new genes not previously shown to be essential for phototrophic growth. We verified the essentiality of many of the genes we identified by analyzing the phenotypes of mutants we generated by Tn mutagenesis that had altered pigmentation. We used directed mutagenesis to verify that the R. palustris NADH:quinone oxidoreductase complex IE is essential for phototrophic growth. As a complement to the genetic data, we carried out proteomics experiments in which we found that 429 proteins were present in significantly higher amounts in cells grown anaerobically in light compared to aerobically. Among these were proteins encoded by subset of the phototrophic growth-essential genes.

  9. The transferome of metabolic genes explored: analysis of the horizontal transfer of enzyme encoding genes in unicellular eukaryotes.

    Science.gov (United States)

    Whitaker, John W; McConkey, Glenn A; Westhead, David R

    2009-01-01

    Metabolic networks are responsible for many essential cellular processes, and exhibit a high level of evolutionary conservation from bacteria to eukaryotes. If genes encoding metabolic enzymes are horizontally transferred and are advantageous, they are likely to become fixed. Horizontal gene transfer (HGT) has played a key role in prokaryotic evolution and its importance in eukaryotes is increasingly evident. High levels of endosymbiotic gene transfer (EGT) accompanied the establishment of plastids and mitochondria, and more recent events have allowed further acquisition of bacterial genes. Here, we present the first comprehensive multi-species analysis of E/HGT of genes encoding metabolic enzymes from bacteria to unicellular eukaryotes. The phylogenetic trees of 2,257 metabolic enzymes were used to make E/HGT assertions in ten groups of unicellular eukaryotes, revealing the sources and metabolic processes of the transferred genes. Analyses revealed a preference for enzymes encoded by genes gained through horizontal and endosymbiotic transfers to be connected in the metabolic network. Enrichment in particular functional classes was particularly revealing: alongside plastid related processes and carbohydrate metabolism, this highlighted a number of pathways in eukaryotic parasites that are rich in enzymes encoded by transferred genes, and potentially key to pathogenicity. The plant parasites Phytophthora were discovered to have a potential pathway for lipopolysaccharide biosynthesis of E/HGT origin not seen before in eukaryotes outside the Plantae. The number of enzymes encoded by genes gained through E/HGT has been established, providing insight into functional gain during the evolution of unicellular eukaryotes. In eukaryotic parasites, genes encoding enzymes that have been gained through horizontal transfer may be attractive drug targets if they are part of processes not present in the host, or are significantly diverged from equivalent host enzymes.

  10. Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

    Directory of Open Access Journals (Sweden)

    DasSarma Shiladitya

    2007-06-01

    Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten

  11. Genes encoding giant danio and golden shiner ependymin.

    Science.gov (United States)

    Adams, D S; Kiyokawa, M; Getman, M E; Shashoua, V E

    1996-03-01

    Ependymin (EPN) is a brain glycoprotein that functions as a neurotrophic factor in optic nerve regeneration and long-term memory consolidation in goldfish. To date, true epn genes have been characterized in one order of teleost fish, Cypriniformes. In the study presented here, polymerase chain reactions were used to analyze the complete epn genes, gd (1480 bp), and sh (2071 bp), from Cypriniformes giant danio and shiner, respectively. Southern hybridizations demonstrated the existence of one copy of each gene per corresponding haploid genome. Each gene was found to contain six exons and five introns. Gene gd encodes a predicted 218-amino acid (aa) protein GD 93 percent conserved to goldfish EPN, while sh encodes a predicted 214-aa protein SH 91 percent homologous to goldfish. Evidence is presented classifying proteins previously termed "EPNs" into two major categories: true EPNs and non-EPN cerebrospinal fluid glycoproteins. Proteins GD and SH contain all the hallmark, features of true EPNs.

  12. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...

  13. Characterization of genes encoding poly(A polymerases in plants: evidence for duplication and functional specialization.

    Directory of Open Access Journals (Sweden)

    Lisa R Meeks

    Full Text Available BACKGROUND: Poly(A polymerase is a key enzyme in the machinery that mediates mRNA 3' end formation in eukaryotes. In plants, poly(A polymerases are encoded by modest gene families. To better understand this multiplicity of genes, poly(A polymerase-encoding genes from several other plants, as well as from Selaginella, Physcomitrella, and Chlamydomonas, were studied. METHODOLOGY/PRINCIPAL FINDINGS: Using bioinformatics tools, poly(A polymerase-encoding genes were identified in the genomes of eight species in the plant lineage. Whereas Chlamydomonas reinhardtii was found to possess a single poly(A polymerase gene, other species possessed between two and six possible poly(A polymerase genes. With the exception of four intron-lacking genes, all of the plant poly(A polymerase genes (but not the C. reinhardtii gene possessed almost identical intron positions within the poly(A polymerase coding sequences, suggesting that all plant poly(A polymerase genes derive from a single ancestral gene. The four Arabidopsis poly(A polymerase genes were found to be essential, based on genetic analysis of T-DNA insertion mutants. GFP fusion proteins containing three of the four Arabidopsis poly(A polymerases localized to the nucleus, while one such fusion protein was localized in the cytoplasm. The fact that this latter protein is largely pollen-specific suggests that it has important roles in male gametogenesis. CONCLUSIONS/SIGNIFICANCE: Our results indicate that poly(A polymerase genes have expanded from a single ancestral gene by a series of duplication events during the evolution of higher plants, and that individual members have undergone sorts of functional specialization so as to render them essential for plant growth and development. Perhaps the most interesting of the plant poly(A polymerases is a novel cytoplasmic poly(A polymerase that is expressed in pollen in Arabidopsis; this is reminiscent of spermatocyte-specific cytoplasmic poly(A polymerases in

  14. Human germline antibody gene segments encode polyspecific antibodies.

    Science.gov (United States)

    Willis, Jordan R; Briney, Bryan S; DeLuca, Samuel L; Crowe, James E; Meiler, Jens

    2013-04-01

    Structural flexibility in germline gene-encoded antibodies allows promiscuous binding to diverse antigens. The binding affinity and specificity for a particular epitope typically increase as antibody genes acquire somatic mutations in antigen-stimulated B cells. In this work, we investigated whether germline gene-encoded antibodies are optimal for polyspecificity by determining the basis for recognition of diverse antigens by antibodies encoded by three VH gene segments. Panels of somatically mutated antibodies encoded by a common VH gene, but each binding to a different antigen, were computationally redesigned to predict antibodies that could engage multiple antigens at once. The Rosetta multi-state design process predicted antibody sequences for the entire heavy chain variable region, including framework, CDR1, and CDR2 mutations. The predicted sequences matched the germline gene sequences to a remarkable degree, revealing by computational design the residues that are predicted to enable polyspecificity, i.e., binding of many unrelated antigens with a common sequence. The process thereby reverses antibody maturation in silico. In contrast, when designing antibodies to bind a single antigen, a sequence similar to that of the mature antibody sequence was returned, mimicking natural antibody maturation in silico. We demonstrated that the Rosetta computational design algorithm captures important aspects of antibody/antigen recognition. While the hypervariable region CDR3 often mediates much of the specificity of mature antibodies, we identified key positions in the VH gene encoding CDR1, CDR2, and the immunoglobulin framework that are critical contributors for polyspecificity in germline antibodies. Computational design of antibodies capable of binding multiple antigens may allow the rational design of antibodies that retain polyspecificity for diverse epitope binding.

  15. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  16. THE YARROWIA-LIPOLYTICA GENE PAY2 ENCODES A 42-KDA PEROXISOMAL INTEGRAL MEMBRANE-PROTEIN ESSENTIAL FOR MATRIX PROTEIN IMPORT AND PEROXISOME ENLARGEMENT BUT NOT FOR PEROXISOME PROLIFERATION

    NARCIS (Netherlands)

    EITZEN, GA; AITCHISON, JD; SZILARD, RK; VEENHUIS, M; NUTTLEY, WM; RACHUBINSKI, RA

    1995-01-01

    PAY genes are required for peroxisome assembly in the yeast Yarrowia lipolytica. Here we show that a mutant strain, pay2, is disrupted for the import of proteins targeted by either peroxisomal targeting signal-1 or -2. Electron microscopy of pay2 cells revealed the presence of small peroxisomal

  17. The Yarrowia lipolytica Gene PAY2 Encodes a 42-kDa Peroxisomal Integral Membrane Protein Essential for Matrix Protein Import and Peroxisome Enlargement but Not for Peroxisome Membrane Proliferation

    NARCIS (Netherlands)

    Eitzen, Gary A.; Aitchison, John D.; Szilard, Rachel K.; Veenhuis, Marten; Nuttley, William M.; Rachubinski, Richard A.

    1995-01-01

    PAY genes are required for peroxisome assembly in the yeast Yarrowia lipolytica. Here we show that a mutant strain, pay2, is disrupted for the import of proteins targeted by either peroxisomal targeting signal-1 or -2. Electron microscopy of pay2 cells revealed the presence of small peroxisomal

  18. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: smthiem@msu.edu [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)

    2013-01-20

    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  19. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  20. Functional analysis of a gene encoding threonine synthase from rice ...

    African Journals Online (AJOL)

    The predicted amino acid sequence of OsTS is highly homologous to that of Arabidopsis TS and many bacterial TS encoded by thrC gene. The OsTS protein harbors a signature binding motif for pyridoxal- 5' -phosphate at the amino terminus. A thrC mutant strain of Escherichia coli was complemented by OsTS expression.

  1. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  2. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    In the yeast Saccharomyces cerevisiae, sterol. C-14 reductase is encoded by the ERG24 gene and erg24 null mutants are not viable on rich medium but they are viable on synthetic medium (Crowley et al 1996). Both the Neurospora and the yeast mutants have been used previously to test for sterol C-14 reductase function ...

  3. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    http://www.ias.ac.in/article/fulltext/jbsc/027/02/0105-0112. Keywords. Lamin B receptor; sterol reductase. Abstract. The human gene TM7SF2 encodes a polypeptide (SR-1) with high sequence similarity to sterol C-14 reductase, a key sterol biosynthetic enzyme in fungi, plants and mammals. In Neurospora and yeast this ...

  4. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  5. Glycerol dehydrogenase, encoded by gldB is essential to osmotolerance in Aspergillus nidulans

    NARCIS (Netherlands)

    Vries, de R.P.; Flitter, S.J.; Vondervoort, van de P.J.I.; Chaveroche, M.K.; Fontaine, T.; Fillinger, S.; Ruijter, G.J.G.; Enfert, d' C.; Visser, J.

    2003-01-01

    We have characterized the Aspergillus nidulans gldB gene encoding a NADP(+) -dependent glycerol dehydrogenase. A basal expression level was observed for gldB , which increased significantly under conditions of hyper-osmotic shock (1 M NaCl). Growth of strains in which gldB was disrupted was severely

  6. Cloning and sequencing the genes encoding goldfish and carp ependymin.

    Science.gov (United States)

    Adams, D S; Shashoua, V E

    1994-04-20

    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  7. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  8. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  9. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae.

    Science.gov (United States)

    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae

    2008-04-01

    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae.

  10. Exploring the Optimal Strategy to Predict Essential Genes in Microbes

    Directory of Open Access Journals (Sweden)

    Yao Lu

    2011-12-01

    Full Text Available Accurately predicting essential genes is important in many aspects of biology, medicine and bioengineering. In previous research, we have developed a machine learning based integrative algorithm to predict essential genes in bacterial species. This algorithm lends itself to two approaches for predicting essential genes: learning the traits from known essential genes in the target organism, or transferring essential gene annotations from a closely related model organism. However, for an understudied microbe, each approach has its potential limitations. The first is constricted by the often small number of known essential genes. The second is limited by the availability of model organisms and by evolutionary distance. In this study, we aim to determine the optimal strategy for predicting essential genes by examining four microbes with well-characterized essential genes. Our results suggest that, unless the known essential genes are few, learning from the known essential genes in the target organism usually outperforms transferring essential gene annotations from a related model organism. In fact, the required number of known essential genes is surprisingly small to make accurate predictions. In prokaryotes, when the number of known essential genes is greater than 2% of total genes, this approach already comes close to its optimal performance. In eukaryotes, achieving the same best performance requires over 4% of total genes, reflecting the increased complexity of eukaryotic organisms. Combining the two approaches resulted in an increased performance when the known essential genes are few. Our investigation thus provides key information on accurately predicting essential genes and will greatly facilitate annotations of microbial genomes.

  11. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49.

  12. Identification of β-haemolysin-encoding genes in Streptococcus anginosus.

    Science.gov (United States)

    Asam, D; Mauerer, S; Walheim, E; Spellerberg, B

    2013-08-01

    Streptococcus anginosus is an emerging pathogen, but little is known about its virulence factors. To detect the genes responsible for β-haemolysis we performed genomic mutagenesis of the β-haemolytic S. anginosus type strain ATCC 12395 using the vector pGhost9:ISS1. Integration site analysis of 15 non-haemolytic mutants identified a gene cluster with high homology to the genes of the streptolysin S (SLS) encoding sag gene cluster of S. pyogenes. The gene cluster harbours 10 open reading frames displaying significant similarities to the S. pyogenes genes sagA-sagI, with the identities on protein level ranging from 38 to 87%. Complementation assays of S. anginosus sagB and sagD integration mutants with the respective genes confirmed their importance for β-haemolysin production and suggest the presence of post-translational modifications in S. anginosus SLS similar to SLS of S. pyogenes. Characterization of the S. anginosus haemolysin in comparison to the S. pyogenes SLS showed that the haemolysin is surface bound, but in contrast to S. pyogenes neither fetal calf serum nor RNA was able to stabilize the haemolysin of S. anginosus in culture supernatants. Inhibition of β-haemolysis by polyethylene glycol of different sizes was carried out, giving no evidence of a pore-forming haemolytic mechanism. Analysis of a whole genome shotgun sequence of Streptococcus constellatus, a closely related streptococcal species that belongs to the S. anginosus group, revealed a similar sag gene cluster. Employing a genomic mutagenesis strategy we were able to determine an SLS encoding gene cluster in S. anginosus and demonstrate its importance for β-haemolysin production in S. anginosus. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. In silico network topology-based prediction of gene essentiality

    CERN Document Server

    da Silva, Joao Paulo Muller; Mombach, Jose Carlos Merino; Vieira, Renata; da Silva, Jose Guliherme Camargo; Lemke, Ney; Sinigaglia, Marialva

    2007-01-01

    The identification of genes essential for survival is important for the understanding of the minimal requirements for cellular life and for drug design. As experimental studies with the purpose of building a catalog of essential genes for a given organism are time-consuming and laborious, a computational approach which could predict gene essentiality with high accuracy would be of great value. We present here a novel computational approach, called NTPGE (Network Topology-based Prediction of Gene Essentiality), that relies on network topology features of a gene to estimate its essentiality. The first step of NTPGE is to construct the integrated molecular network for a given organism comprising protein physical, metabolic and transcriptional regulation interactions. The second step consists in training a decision tree-based machine learning algorithm on known essential and non-essential genes of the organism of interest, considering as learning attributes the network topology information for each of these genes...

  14. Systems properties of proteins encoded by imprinted genes.

    Science.gov (United States)

    Sandhu, Kuljeet Singh

    2010-10-01

    Genomically imprinted genes show parentally fixed mono-allelic expression and are important for the mammalian development. Dysregulation of genomic imprinting leads to several complex pathological conditions. Though the genetic and epigenetic regulation of imprinted genes has been well studied, their protein aspects are largely ignored. Here, we systematically studied a sub-network centered on proteins encoded by imprinted genes within human interactome. Using concepts of network biology, we uncover a highly connected, transitive and central network module of imprinted gene-products and their interacting partners (IGPN). The network is enriched in development, metabolism and cell cycle related functions and its malfunctioning ascribes error intolerance to human interactome network. Further, detailed analysis revealed that its higher centrality is determined by 'date' interactions among the proteins belonging to different functional classes than the 'party' interactions within the same functional class. Interestingly, a significant proportion of this network genetically associates with disease phenotypes. Moreover, the network comprises of gene-sets that are upregulated in leukemia, psychosis, obesity/diabetes and downregulated in autism. We conclude that imprinted gene-products are part of a functionally and topologically important module of human interactome and errors in this sub-network are intolerant to, otherwise robust, human interactome. The findings might also shed light on how imprinted genes, which are rather very few, coordinate at protein level to pleiotropically regulate growth and metabolism during embryonic and post-natal development.

  15. Genes encoding longevity: from model organisms to humans.

    Science.gov (United States)

    Kuningas, Maris; Mooijaart, Simon P; van Heemst, Diana; Zwaan, Bas J; Slagboom, P Eline; Westendorp, Rudi G J

    2008-03-01

    Ample evidence from model organisms has indicated that subtle variation in genes can dramatically influence lifespan. The key genes and molecular pathways that have been identified so far encode for metabolism, maintenance and repair mechanisms that minimize age-related accumulation of permanent damage. Here, we describe the evolutionary conserved genes that are involved in lifespan regulation of model organisms and humans, and explore the reasons of discrepancies that exist between the results found in the various species. In general, the accumulated data have revealed that when moving up the evolutionary ladder, together with an increase of genome complexity, the impact of candidate genes on lifespan becomes smaller. The presence of genetic networks makes it more likely to expect impact of variation in several interacting genes to affect lifespan in humans. Extrapolation of findings from experimental models to humans is further complicated as phenotypes are critically dependent on the setting in which genes are expressed, while laboratory conditions and modern environments are markedly dissimilar. Finally, currently used methodologies may have only little power and validity to reveal genetic variation in the population. In conclusion, although the study of model organisms has revealed potential candidate genetic mechanisms determining aging and lifespan, to what extent they explain variation in human populations is still uncertain.

  16. In silico network topology-based prediction of gene essentiality

    Science.gov (United States)

    da Silva, João Paulo Müller; Acencio, Marcio Luis; Mombach, José Carlos Merino; Vieira, Renata; da Silva, José Camargo; Lemke, Ney; Sinigaglia, Marialva

    2008-02-01

    The identification of genes essential for survival is important for the understanding of the minimal requirements for cellular life and for drug design. As experimental studies with the purpose of building a catalog of essential genes for a given organism are time-consuming and laborious, a computational approach which could predict gene essentiality with high accuracy would be of great value. We present here a novel computational approach, called NTPGE (Network Topology-based Prediction of Gene Essentiality), that relies on the network topology features of a gene to estimate its essentiality. The first step of NTPGE is to construct the integrated molecular network for a given organism comprising protein physical, metabolic and transcriptional regulation interactions. The second step consists in training a decision-tree-based machine-learning algorithm on known essential and non-essential genes of the organism of interest, considering as learning attributes the network topology information for each of these genes. Finally, the decision-tree classifier generated is applied to the set of genes of this organism to estimate essentiality for each gene. We applied the NTPGE approach for discovering the essential genes in Escherichia coli and then assessed its performance.

  17. Gene family encoding the major toxins of lethal Amanita mushrooms.

    Science.gov (United States)

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  18. Gene family encoding the major toxins of lethal Amanita mushrooms

    Science.gov (United States)

    Hallen, Heather E.; Luo, Hong; Scott-Craig, John S.; Walton, Jonathan D.

    2007-01-01

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode α-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. α-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable “toxin” region capable of encoding a wide variety of peptides of 7–10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes. PMID:18025465

  19. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring γ-retrovirus-encoded hsvtk suicide genes

    OpenAIRE

    Wang, X.; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M.; Samakoglu, S; Chang, AH; Sadelain, M.; Rivière, I

    2008-01-01

    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that γ-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes...

  20. Why There Are No Essential Genes on Plasmids.

    Science.gov (United States)

    Tazzyman, Samuel J; Bonhoeffer, Sebastian

    2015-12-01

    Mobile genetic elements such as plasmids are important for the evolution of prokaryotes. It has been suggested that there are differences between functions coded for by mobile genes and those in the "core" genome and that these differences can be seen between plasmids and chromosomes. In particular, it has been suggested that essential genes, such as those involved in the formation of structural proteins or in basic metabolic functions, are rarely located on plasmids. We model competition between genotypically varying bacteria within a single population to investigate whether selection favors a chromosomal location for essential genes. We find that in general, chromosomal locations for essential genes are indeed favored. This is because the inheritance of chromosomes is more stable than that for plasmids. We define the "degradation" rate as the rate at which chance genetic processes, for example, mutation, deletion, or translocation, render essential genes nonfunctioning. The only way in which plasmids can be a location for functioning essential genes is if chromosomal genes degrade faster than plasmid genes. If the two degradation rates are equal, or if plasmid genes degrade faster than chromosomal genes, functioning essential genes will be found only on chromosomes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Phenotypic interactions of spinster with the genes encoding proteins for cell death control in Drosophila melanogaster.

    Science.gov (United States)

    Sakurai, Akira; Nakano, Yoshiro; Koganezawa, Masayuki; Yamamoto, Daisuke

    2010-03-01

    The spin gene was first identified by its mutant phenotype, which is characterized by extremely strong mate refusal by females in response to male courtship in Drosophila. Spin mutants are also known to be accompanied by a remarkable reduction in programmed cell death in the reproductive and nervous systems. To better understand the molecular functions of spin, we searched for its genetic modifiers. Forced expression of spin(+) in somatic cells as driven by ptc-Gal4 in the testis resulted in the invasion of mature sperm into the anterior testes tip, which is otherwise occupied only by immature germ cells. To obtain genes that modulate spin's effect, the gain-of-function spin phenotype was observed in the presence of a chromosome harboring an EP or GS P-element insertion, which initiates transcription of the genomic sequence neighboring the insertion site. We isolated th and emc as suppressors of spin and atg8a as a gene that reproduces the spin phenotype on its own. th encodes Inhibitor of apoptosis-1, and mammalian Id genes homologous to emc are known to inhibit apoptosis. atg8a encodes a protein essential for autophagy. These results suggest that spin promotes cell death mechanisms that are regulated negatively by th and emc and positively by atg8a. (c) 2010 Wiley Periodicals, Inc.

  2. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  3. A new computational strategy for predicting essential genes.

    Science.gov (United States)

    Cheng, Jian; Wu, Wenwu; Zhang, Yinwen; Li, Xiangchen; Jiang, Xiaoqian; Wei, Gehong; Tao, Shiheng

    2013-12-21

    Determination of the minimum gene set for cellular life is one of the central goals in biology. Genome-wide essential gene identification has progressed rapidly in certain bacterial species; however, it remains difficult to achieve in most eukaryotic species. Several computational models have recently been developed to integrate gene features and used as alternatives to transfer gene essentiality annotations between organisms. We first collected features that were widely used by previous predictive models and assessed the relationships between gene features and gene essentiality using a stepwise regression model. We found two issues that could significantly reduce model accuracy: (i) the effect of multicollinearity among gene features and (ii) the diverse and even contrasting correlations between gene features and gene essentiality existing within and among different species. To address these issues, we developed a novel model called feature-based weighted Naïve Bayes model (FWM), which is based on Naïve Bayes classifiers, logistic regression, and genetic algorithm. The proposed model assesses features and filters out the effects of multicollinearity and diversity. The performance of FWM was compared with other popular models, such as support vector machine, Naïve Bayes model, and logistic regression model, by applying FWM to reciprocally predict essential genes among and within 21 species. Our results showed that FWM significantly improves the accuracy and robustness of essential gene prediction. FWM can remarkably improve the accuracy of essential gene prediction and may be used as an alternative method for other classification work. This method can contribute substantially to the knowledge of the minimum gene sets required for living organisms and the discovery of new drug targets.

  4. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans

    NARCIS (Netherlands)

    de Boer, A P; van der Oost, J.; Reijnders, W N; Westerhoff, H V; Stouthamer, A.H.; van Spanning, R J

    1996-01-01

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N.,

  5. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  6. Apolipoprotein gene variants and susceptibility to essential ...

    African Journals Online (AJOL)

    Objective: To investigate the relationship between Apo ɛ gene polymorphisms and EH in the Bantu ethnic group of Cameroon. Design: Cross sectional study. Setting: Bantu ethnic group of South West Cameroon. Results: Whereas advanced age, SBP, DBP, lack of exercise and family history constituted risk factors of EH, ...

  7. Gene essentiality prediction based on fractal features and machine learning.

    Science.gov (United States)

    Yu, Yongming; Yang, Licai; Liu, Zhiping; Zhu, Chuansheng

    2017-02-28

    Essential genes are required for the viability of an organism. Accurate and rapid identification of new essential genes is of substantial theoretical interest to synthetic biology and has practical applications in biomedicine. Fractals provide facilitated access to genetic structure analysis on a different scale. In this study, machine learning-based methods using solely fractal features are presented and the problem of predicting essential genes in bacterial genomes is evaluated. Six fractal features were investigated to learn the parameters of five supervised classification methods for the binary classification task. The optimal parameters of these classifiers are determined via grid-based searching technique. All the currently available identified genes from the database of essential genes were utilized to build the classifiers. The fractal features were proven to be more robust and powerful in the prediction performance. In a statistical sense, the ELM method shows superiority in predicting the essential genes. Non-parameter tests of the average AUC and ACC showed that the fractal feature is much better than other five compared features sets. Our approach is promising and convenient to identify new bacterial essential genes.

  8. A transforming ras gene can provide an essential function ordinarily supplied by an endogenous ras gene

    DEFF Research Database (Denmark)

    Papageorge, A G; Willumsen, B M; Johnsen, M

    1986-01-01

    several transformation-competent mutant v-rasH genes whose protein products in transformed NIH 3T3 cells are not immunoprecipitated by this monoclonal antibody. These mutant proteins are, however, precipitated by a different anti-ras antibody. Each of these mutants lacks Met-72 of v-rasH. In contrast...... to the result for cells transformed by wild-type v-rasH, Y13-259 microinjection of NIH 3T3 cells transformed by these mutant ras genes did not prevent the cells from entering the S phase. These results imply that a transformation-competent ras gene can supply a normal essential function for NIH 3T3 cells. When...... the proteins encoded by the mutant ras genes were overproduced in Escherichia coli, several mutant proteins that lacked Met-72 failed to bind Y13-259 in a Western blot. However, a ras protein from a mutant lacking amino antibody, but a ras protein from a mutant lacking amino acids 72 to 84 did not...

  9. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  10. Three computational tools for predicting bacterial essential genes.

    Science.gov (United States)

    Guo, Feng-Biao; Ye, Yuan-Nong; Ning, Lu-Wen; Wei, Wen

    2015-01-01

    Essential genes are those genes indispensable for the survival of any living cell. Bacterial essential genes constitute the cornerstones of synthetic biology and are often attractive targets in the development of antibiotics and vaccines. Because identification of essential genes with wet-lab ways often means expensive economic costs and tremendous labor, scientists changed to seek for alternative way of computational prediction. Aiming to help to solve this issue, our research group (CEFG: group of Computational, Comparative, Evolutionary and Functional Genomics, http://cefg.uestc.edu.cn) has constructed three online services to predict essential genes in bacterial genomes. These freely available tools are applicable for single gene sequences without annotated functions, single genes with definite names, and complete genomes of bacterial strains. To ensure reliable predictions, the investigated species should belong to the same family (for EGP) or phylum (for CEG_Match and Geptop) with one of the reference species, respectively. As the pilot software for the issue, predicting accuracies of them have been assessed and compared with existing algorithms, and note that all of other published algorithms have not any formed online services. We hope these services at CEFG will help scientists and researchers in the field of essential genes.

  11. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin

    2016-08-22

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  12. Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS

    Directory of Open Access Journals (Sweden)

    Yee-Chin Wong

    2016-08-01

    Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  13. MERISTEM DISORGANIZATION1 encodes TEN1, an essential telomere protein that modulates telomerase processivity in Arabidopsis.

    Science.gov (United States)

    Leehy, Katherine A; Lee, Jung Ro; Song, Xiangyu; Renfrew, Kyle B; Shippen, Dorothy E

    2013-04-01

    Telomeres protect chromosome ends from being recognized as DNA damage, and they facilitate the complete replication of linear chromosomes. CST [for CTC1(Cdc13)/STN1/TEN1] is a trimeric chromosome end binding complex implicated in both aspects of telomere function. Here, we characterize TEN1 in the flowering plant Arabidopsis thaliana. We report that TEN1 (for telomeric pathways in association with Stn1, which stands for suppressor of cdc thirteen) is encoded by a previously characterized gene, MERISTEM DISORGANIZATION1 (MDO1). A point mutation in MDO1, mdo1-1/ten1-3 (G77E), triggers stem cell differentiation and death as well as a constitutive DNA damage response. We provide biochemical and genetic evidence that ten1-3 is likely to be a null mutation. As with ctc1 and stn1 null mutants, telomere tracts in ten1-3 are shorter and more heterogeneous than the wild type. Mutants also exhibit frequent telomere fusions, increased single-strand telomeric DNA, and telomeric circles. However, unlike stn1 or ctc1 mutants, telomerase enzyme activity is elevated in ten1-3 mutants due to an increase in repeat addition processivity. In addition, TEN1 is detected at a significantly smaller fraction of telomeres than CTC1. These data indicate that TEN1 is critical for telomere stability and also plays an unexpected role in modulating telomerase enzyme activity.

  14. Methods for identifying an essential gene in a prokaryotic microorganism

    Energy Technology Data Exchange (ETDEWEB)

    Shizuya, Hiroaki

    2006-01-31

    Methods are provided for the rapid identification of essential or conditionally essential DNA segments in any species of haploid cell (one copy chromosome per cell) that is capable of being transformed by artificial means and is capable of undergoing DNA recombination. This system offers an enhanced means of identifying essential function genes in diploid pathogens, such as gram-negative and gram-positive bacteria.

  15. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced,...

  16. Metazoan Ribosome Inactivating Protein encoding genes acquired by Horizontal Gene Transfer.

    Science.gov (United States)

    Lapadula, Walter J; Marcet, Paula L; Mascotti, María L; Sanchez-Puerta, M Virginia; Juri Ayub, Maximiliano

    2017-05-12

    Ribosome inactivating proteins (RIPs) are RNA N-glycosidases that depurinate a specific adenine residue in the conserved sarcin/ricin loop of 28S rRNA. These enzymes are widely distributed among plants and their presence has also been confirmed in several bacterial species. Recently, we reported for the first time in silico evidence of RIP encoding genes in metazoans, in two closely related species of insects: Aedes aegypti and Culex quinquefasciatus. Here, we have experimentally confirmed the presence of these genes in mosquitoes and attempted to unveil their evolutionary history. A detailed study was conducted, including evaluation of taxonomic distribution, phylogenetic inferences and microsynteny analyses, indicating that mosquito RIP genes derived from a single Horizontal Gene Transfer (HGT) event, probably from a cyanobacterial donor species. Moreover, evolutionary analyses show that, after the HGT event, these genes evolved under purifying selection, strongly suggesting they play functional roles in these organisms.

  17. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  18. DNA variants within the 5'-flanking region of milk-protein-encoding genes II. The β-lactoglobulin-encoding gene.

    Science.gov (United States)

    Wagner, V A; Schild, T A; Geldermann, H

    1994-09-01

    For the detection of polymorphisms within the 5'-flanking region of the β-lactoglobulin (-LG) -encoding gene a nucleotide sequence containing 795 bp of the promoter and 59 bp of exon I was cloned and sequenced. After comparing the sequence from the DNA of 11 diverse cows (different breeds and milk-protein yields), 14 singlebp substitutions were identified within the 5'-flanking region and two in the 5'-untranslated region (5'-UTR) of exon I. Some of the variants are located in potential binding sites for trans-acting factors or in the 5'-UTR. A PCR-based RFLP analysis was performed, and the genotypes of an additional 60 cows were identified at five variable 5'-flanking sites. The results reveal three frequent combinations between the A and B alleles of the protein-coding region and the novel 5'-flanking DNA variants. This finding may explain the differences of the protein-variant-dependent β-LG synthesis (A>B) observed in vivo. A sequence comparison of the bovine and ovine promoters reveals an homology of 92.8% and shows a higher degree of conservation between positions -600 and -300.

  19. Cloning, characterization and identification of the gene encoding phosphatidylinositol 4-kinase.

    Science.gov (United States)

    Pramanik, A; Garcia, E; Ospina, R; Powell, M; Martinez, M; Alejo, W; McKoy, J; Moore, C W

    1997-11-01

    The vast majority of AIDS-related deaths are associated with opportunistic infections. For fungal infections, there are few effective antifungals, particularly for systemic use. The discovery that very low doses of the bleomycin family of anticancer chemical congeners compromise the integrity of fungal cell walls led to our approach to identify genes that complement-cell wall defects, and develop methods to facilitate the identification of new antifungals targeted to fungal cell walls. This report describes one of the genes cloned by complementation of the blm1-1 mutation of S. cerevisiae using a YCp50-based yeast genomic library. Characterization and identification of the gene were carried out using drug screening tests, Southern hybridization analyses, DNA sequencing and DNA sequence similarity searches in databases. The gene STT4, is essential for viability and encodes a phosphatidylinositol 4-kinase that plays an important role in the phosphatidylinositol-mediated signal transduction pathway required for cell wall integrity. Like blm1-1 mutant strains, stt4 cells arrest mostly in the G2/M phase of the cell cycle. Further studies using this approach should help us understand the role of PI4-K in maintaining fungal cell-wall integrity, identify additional genes affecting potential target structures in cell walls of opportunistic fungal pathogens in AIDS patients, and assist in drug discovery and antifungal drug design.

  20. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  1. Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species.

    Science.gov (United States)

    Xiang, Liuxin; Liu, Jinggao; Wu, Chaofeng; Deng, Yushan; Cai, Chaowei; Zhang, Xiao; Cai, Yingfan

    2017-04-12

    Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium barbadense allow for a more comprehensive and systematic comparative study of NBS-encoding genes to elucidate the mechanisms of cotton disease resistance. Based on the genome assembly data, 246, 365, 588 and 682 NBS-encoding genes were identified in G. arboreum, G. raimondii, G. hirsutum and G. barbadense, respectively. The distribution of NBS-encoding genes among the chromosomes was nonrandom and uneven, and was tended to form clusters. Gene structure analysis showed that G. arboreum and G. hirsutum possessed a greater proportion of CN, CNL, and N genes and a lower proportion of NL, TN and TNL genes compared to that of G. raimondii and G. barbadense, while the percentages of RN and RNL genes remained relatively unchanged. The percentage changes among them were largest for TNL genes, about 7 times. Exon statistics showed that the average exon numbers per NBS gene in G. raimondii and G. barbadense were all greater than that in G. arboretum and G. hirsutum. Phylogenetic analysis revealed that the TIR-NBS genes of G. barbadense were closely related with that of G. raimondii. Sequence similarity analysis showed that diploid cotton G. arboreum possessed a larger proportion of NBS-encoding genes similar to that of allotetraploid cotton G. hirsutum, while diploid G. raimondii possessed a larger proportion of NBS-encoding genes similar to that of allotetraploid cotton G. barbadense. The synteny analysis showed that more NBS genes in G. raimondii and G. arboreum were syntenic with that in G. barbadense and G. hirsutum, respectively. The structural architectures, amino acid sequence similarities and synteny of NBS-encoding genes between G. arboreum and G. hirsutum, and between G

  2. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  3. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  4. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  5. Comparison of inherently essential genes of Porphyromonas gingivalis identified in two transposon-sequencing libraries.

    Science.gov (United States)

    Hutcherson, J A; Gogeneni, H; Yoder-Himes, D; Hendrickson, E L; Hackett, M; Whiteley, M; Lamont, R J; Scott, D A

    2016-08-01

    Porphyromonas gingivalis is a Gram-negative anaerobe and keystone periodontal pathogen. A mariner transposon insertion mutant library has recently been used to define 463 genes as putatively essential for the in vitro growth of P. gingivalis ATCC 33277 in planktonic culture (Library 1). We have independently generated a transposon insertion mutant library (Library 2) for the same P. gingivalis strain and herein compare genes that are putatively essential for in vitro growth in complex media, as defined by both libraries. In all, 281 genes (61%) identified by Library 1 were common to Library 2. Many of these common genes are involved in fundamentally important metabolic pathways, notably pyrimidine cycling as well as lipopolysaccharide, peptidoglycan, pantothenate and coenzyme A biosynthesis, and nicotinate and nicotinamide metabolism. Also in common are genes encoding heat-shock protein homologues, sigma factors, enzymes with proteolytic activity, and the majority of sec-related protein export genes. In addition to facilitating a better understanding of critical physiological processes, transposon-sequencing technology has the potential to identify novel strategies for the control of P. gingivalis infections. Those genes defined as essential by two independently generated TnSeq mutant libraries are likely to represent particularly attractive therapeutic targets. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. The Phytophthora infestans avirulence gene Avr4 encodes an RXLR-dEER effector

    NARCIS (Netherlands)

    Poppel, van P.M.J.A.; Jun Guo, J.; Vondervoort, van de P.J.I.; Jung, M.W.M.; Birch, P.R.J.; Whisson, S.C.; Govers, F.

    2008-01-01

    Resistance in potato against the oomycete Phytophthora infestans is conditioned by resistance (R) genes that are introgressed from wild Solanum spp. into cultivated potato. According to the gene-for-gene model, proteins encoded by R genes recognize race-specific effectors resulting in a

  7. Cloning and identification of a gene encoding spore cortex-lytic enzyme in Bacillus thuringiensis.

    Science.gov (United States)

    Hu, Kun; Yang, Haihua; Liu, Gang; Tan, Huarong

    2007-04-01

    Spore cortex-lytic enzymes are essential for germination in Bacilli. A gene-encoding spore cortex-lytic enzyme designated sleB was cloned from Bacillus thuringiensis. Disruption of sleB did not affect vegetative growth of B. thuringiensis, but the fall in optical density at 600 nm in the mutant spores was much slower than in the wild type strain during spore germination induced by L-alanine. Moreover, the mutant spores did not become completely dark, as compared with the wild type strain. These showed that sleB is required for normal spore germination in B. thuringiensis. Reverse transcription polymerase chain reaction analysis indicated that sleB is transcribed during sporulation. Western blot experiment also proved that SleB accumulated in sporulating cells as a precursor protein, and in spores as a mature processed form.

  8. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  9. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    Energy Technology Data Exchange (ETDEWEB)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  10. Characterization of the Genes Encoding d-Amino Acid Transaminase and Glutamate Racemase, Two d-Glutamate Biosynthetic Enzymes of Bacillus sphaericus ATCC 10208

    Science.gov (United States)

    Fotheringham, Ian G.; Bledig, Stefan A.; Taylor, Paul P.

    1998-01-01

    In Bacillus sphaericus and other Bacillus spp., d-amino acid transaminase has been considered solely responsible for biosynthesis of d-glutamate, an essential component of cell wall peptidoglycan, in contrast to the glutamate racemase employed by many other bacteria. We report here the cloning of the dat gene encoding d-amino acid transaminase and the glr gene encoding a glutamate racemase from B. sphaericus ATCC 10208. The glr gene encodes a 28.8-kDa protein with 40 to 50% sequence identity to the glutamate racemases of Lactobacillus, Pediococcus, and Staphylococcus species. The dat gene encodes a 31.4-kDa peptide with 67% primary sequence homology to the d-amino acid transaminase of the thermophilic Bacillus sp. strain YM1. PMID:9696787

  11. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    OpenAIRE

    Baiquan Ma; Liao Liao; Hongyu Zheng; Jie Chen; Benhong Wu; Collins Ogutu; Shaohua Li; Korban, Schuyler S.; Yuepeng Han

    2015-01-01

    A gene encoding aluminum-activated malate transporter (ALMT) was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.). In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated wi...

  12. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production.

    Science.gov (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-07-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  13. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... data demonstrated that AhLPAT4 had 1631 nucleotides, encoding a putative 43.8 kDa protein with 383 amino acid residues. The deduced protein ... senting the major components of vegetable oils. It is an efficient ... are then transported to endoplasmic reticulum (ER) or cyto- plasm to form acyl-CoA ...

  14. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... 1Department of Entomology, China Agricultural University, Beijing 100193, China. 2Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, Baoding 071000, China. ... cDNA from Bemisia tabaci encoding a CSP (GU250808), denoted BtabCSP was cloned by RT-PCR and.

  15. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lei [Los Alamos National Laboratory

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  16. Sudden infant death syndrome caused by cardiac arrhythmias: only a matter of genes encoding ion channels?

    Science.gov (United States)

    Sarquella-Brugada, Georgia; Campuzano, Oscar; Cesar, Sergi; Iglesias, Anna; Fernandez, Anna; Brugada, Josep; Brugada, Ramon

    2016-03-01

    Sudden infant death syndrome is the unexpected demise of a child younger than 1 year of age which remains unexplained after a complete autopsy investigation. Usually, it occurs during sleep, in males, and during the first 12 weeks of life. The pathophysiological mechanism underlying the death is unknown, and the lethal episode is considered multifactorial. However, in cases without a conclusive post-mortem diagnosis, suspicious of cardiac arrhythmias may also be considered as a cause of death, especially in families suffering from any cardiac disease associated with sudden cardiac death. Here, we review current understanding of sudden infant death, focusing on genetic causes leading to lethal cardiac arrhythmias, considering both genes encoding ion channels as well as structural proteins due to recent association of channelopathies and desmosomal genes. We support a comprehensive analysis of all genes associated with sudden cardiac death in families suffering of infant death. It allows the identification of the most plausible cause of death but also of family members at risk, providing cardiologists with essential data to adopt therapeutic preventive measures in families affected with this lethal entity.

  17. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  18. The novel BLM3 gene encodes a protein that protects against lethal effects of oxidative damage.

    Science.gov (United States)

    Febres, D E; Pramanik, A; Caton, M; Doherty, K; McKoy, J; Garcia, E; Alejo, W; Moore, C W

    2001-11-01

    Mutational alteration of the BLM3 gene in Saccharomyces cerevisiae confers hypersensitivities to lethal effects of ionizing radiation, anticancer bleomycins and structurally-related phleomycins. Bleomycin is used clinically in the treatment of many types of cancers, including Kaposi's sarcoma. The BLM3 gene was cloned from a genomic library by complementing the drug hypersensitivities conferred by the codominant blm3-1 mutation. The nucleotide sequence of BLM3 encodes a predicted integral protein of 1804 amino acids with seven to ten potential transmembrane domains and additional motifs. The blm3 null mutation was created by gene replacement, and found not to be essential for growth in the absence of the bleomycin-phleomycin antibiotics. Sequence analyses suggest the Blm3p could be a potential member of the major facilitator superfamily (MFS) of permeases. Northern dot blot analyses using a human RNA master tissue blot containing RNA from fifty different fetal and adult tissues revealed sequence homology in adult tissues to BLM3, but no sequence homology in fetal tissues. The function of the Blm3p is presently unknown. We propose several functions for the Blm3p in protecting cells against oxidative agents, including roles in detoxification, transport and defending against DNA damage.

  19. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim was to...

  20. Differential Expression of Two Paralogous Genes of Bacillus subtilis Encoding Single-Stranded DNA Binding Protein

    NARCIS (Netherlands)

    Lindner, Cordula; Nijland, Reindert; Hartskamp, Mariska van; Bron, Sierd; Hamoen, Leendert W.; Kuipers, Oscar P.

    The Bacillus subtilis genome comprises two paralogous single-stranded DNA binding protein (SSB) genes, ssb and ywpH, which show distinct expression patterns. The main ssb gene is strongly expressed during exponential growth and is coregulated with genes encoding the ribosomal proteins S6 and S18.

  1. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  2. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  3. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  4. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Sequencing and structural analyses of the full length cDNA indicated that BtabCSP is 381 bp in length, encoding 126 amino acid residues of which a 22 amino acid residue coded for a signal peptide. The predicted molecular weight of BtabCSP is 14.17 kDa. The BtabCSP amino acid residues deduced from the respective ...

  5. Gene essentiality, conservation index and co-evolution of genes in cyanobacteria.

    Science.gov (United States)

    Tiruveedula, Gopi Siva Sai; Wangikar, Pramod P

    2017-01-01

    Cyanobacteria, a group of photosynthetic prokaryotes, dominate the earth with ~ 1015 g wet biomass. Despite diversity in habitats and an ancient origin, cyanobacterial phylum has retained a significant core genome. Cyanobacteria are being explored for direct conversion of solar energy and carbon dioxide into biofuels. For this, efficient cyanobacterial strains will need to be designed via metabolic engineering. This will require identification of target knockouts to channelize the flow of carbon toward the product of interest while minimizing deletions of essential genes. We propose "Gene Conservation Index" (GCI) as a quick measure to predict gene essentiality in cyanobacteria. GCI is based on phylogenetic profile of a gene constructed with a reduced dataset of cyanobacterial genomes. GCI is the percentage of organism clusters in which the query gene is present in the reduced dataset. Of the 750 genes deemed to be essential in the experimental study on S. elongatus PCC 7942, we found 494 to be conserved across the phylum which largely comprise of the essential metabolic pathways. On the contrary, the conserved but non-essential genes broadly comprise of genes required under stress conditions. Exceptions to this rule include genes such as the glycogen synthesis and degradation enzymes, deoxyribose-phosphate aldolase (DERA), glucose-6-phosphate 1-dehydrogenase (zwf) and fructose-1,6-bisphosphatase class1, which are conserved but non-essential. While the essential genes are to be avoided during gene knockout studies as potentially lethal deletions, the non-essential but conserved set of genes could be interesting targets for metabolic engineering. Further, we identify clusters of co-evolving genes (CCG), which provide insights that may be useful in annotation. Principal component analysis (PCA) plots of the CCGs are demonstrated as data visualization tools that are complementary to the conventional heatmaps. Our dataset consists of phylogenetic profiles for 23

  6. Gene essentiality and the topology of protein interaction networks

    Science.gov (United States)

    Coulomb, Stéphane; Bauer, Michel; Bernard, Denis; Marsolier-Kergoat, Marie-Claude

    2005-01-01

    The mechanistic bases for gene essentiality and for cell mutational resistance have long been disputed. The recent availability of large protein interaction databases has fuelled the analysis of protein interaction networks and several authors have proposed that gene dispensability could be strongly related to some topological parameters of these networks. However, many results were based on protein interaction data whose biases were not taken into account. In this article, we show that the essentiality of a gene in yeast is poorly related to the number of interactants (or degree) of the corresponding protein and that the physiological consequences of gene deletions are unrelated to several other properties of proteins in the interaction networks, such as the average degrees of their nearest neighbours, their clustering coefficients or their relative distances. We also found that yeast protein interaction networks lack degree correlation, i.e. a propensity for their vertices to associate according to their degrees. Gene essentiality and more generally cell resistance against mutations thus seem largely unrelated to many parameters of protein network topology. PMID:16087428

  7. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding......, and galactomannan. The method is a fermentation process performed under strict anaerobic conditions....

  8. ACTTS3 encoding a polyketide synthase is essential for the biosynthesis of ACT-toxin and pathogenicity in the tangerine pathotype of Alternaria alternata.

    Science.gov (United States)

    Miyamoto, Y; Masunaka, A; Tsuge, T; Yamamoto, M; Ohtani, K; Fukumoto, T; Gomi, K; Peever, T L; Tada, Y; Ichimura, K; Akimitsu, K

    2010-04-01

    The tangerine pathotype of Alternaria alternata produces host-selective ACT-toxin and causes Alternaria brown spot disease of tangerine and tangerine hybrids. Sequence analysis of a genomic BAC clone identified part of the ACT-toxin TOX (ACTT) gene cluster, and knockout experiments have implicated several open reading frames (ORF) contained within the cluster in the biosynthesis of ACT-toxin. One of the ORF, designated ACTTS3, encoding a putative polyketide synthase, was isolated by rapid amplification of cDNA ends and genomic/reverse transcription-polymerase chain reactions using the specific primers designed from the BAC sequences. The 7,374-bp ORF encodes a polyketide synthase with putative beta-ketoacyl synthase, acyltransferase, methyltransferase, beta-ketoacyl reductase, and phosphopantetheine attachment site domains. Genomic Southern blots demonstrated that ACTTS3 is present on the smallest chromosome in the tangerine pathotype of A. alternata, and the presence of ACTTS3 is highly correlated with ACT-toxin production and pathogenicity. Targeted gene disruption of two copies of ACTTS3 led to a complete loss of ACT-toxin production and pathogenicity. These results indicate that ACTTS3 is an essential gene for ACT-toxin biosynthesis in the tangerine pathotype of A. alternata and is required for pathogenicity of this fungus.

  9. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  10. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification is pro...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  11. OGEE v2: an update of the online gene essentiality database with special focus on differentially essential genes in human cancer cell lines.

    Science.gov (United States)

    Chen, Wei-Hua; Lu, Guanting; Chen, Xiao; Zhao, Xing-Ming; Bork, Peer

    2017-01-04

    OGEE is an Online GEne Essentiality database. To enhance our understanding of the essentiality of genes, in OGEE we collected experimentally tested essential and non-essential genes, as well as associated gene properties known to contribute to gene essentiality. We focus on large-scale experiments, and complement our data with text-mining results. We organized tested genes into data sets according to their sources, and tagged those with variable essentiality statuses across data sets as conditionally essential genes, intending to highlight the complex interplay between gene functions and environments/experimental perturbations. Developments since the last public release include increased numbers of species and gene essentiality data sets, inclusion of non-coding essential sequences and genes with intermediate essentiality statuses. In addition, we included 16 essentiality data sets from cancer cell lines, corresponding to 9 human cancers; with OGEE, users can easily explore the shared and differentially essential genes within and between cancer types. These genes, especially those derived from cell lines that are similar to tumor samples, could reveal the oncogenic drivers, paralogous gene expression pattern and chromosomal structure of the corresponding cancer types, and can be further screened to identify targets for cancer therapy and/or new drug development. OGEE is freely available at http://ogee.medgenius.info. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

    Science.gov (United States)

    Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-12-01

    Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

  13. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  14. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  15. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  16. Arabidopsis STAY-GREEN, Mendel's Green Cotyledon Gene, Encodes Magnesium-Dechelatase.

    Science.gov (United States)

    Shimoda, Yousuke; Ito, Hisashi; Tanaka, Ayumi

    2016-09-07

    Pheophytin a is an essential component of oxygenic photosynthetic organisms, because the primary charge separation between chlorophyll a and pheophytin a is the first step in the conversion of light energy. In addition, conversion of chlorophyll a to pheophytin a is the first step of chlorophyll degradation. Pheophytin is synthesized by extracting magnesium (Mg) from chlorophyll; the enzyme Mg-dechelatase catalyzes this reaction. In this study, we report that Mendel's green cotyledon gene, STAY-GREEN (SGR), encodes Mg-dechelatase. The Arabidopsis thaliana genome has three SGR genes, STAY-GREEN1 (SGR1), STAY-GREEN2 (SGR2), and STAY-GREEN LIKE (SGRL). Recombinant SGR1/2 extracted Mg from chlorophyll a but had very low or no activity against chlorophyllide a; in contrast, SGRL had higher dechelating activity against chlorophyllide a compared to chlorophyll a. All SGRs could not extract Mg from chlorophyll b. Enzymatic experiments using the photosystem and light-harvesting complexes showed that SGR extracts Mg not only from free chlorophyll but also from chlorophyll in the chlorophyll-protein complexes. Furthermore, most of the chlorophyll and chlorophyll-binding proteins disappeared when SGR was transiently expressed by a chemical induction system. Thus, SGR is not only involved in chlorophyll degradation but also contributes to photosystem degradation. {copyright, serif} 2016 American Society of Plant Biologists. All rights reserved.

  17. Variation of genes encoding GGPLs syntheses among Mycoplasma fermentans strains.

    Science.gov (United States)

    Fujihara, Masatoshi; Ishida, Noriko; Asano, Kozo; Matsuda, Kazuhiro; Nomura, Nobuo; Nishida, Yoshihiro; Harasawa, Ryô

    2010-06-01

    The information of the biosynthesis pathways of Mycoplasma fermentans specific major lipid-antigen, named glycoglycerophospholipids (GGPLs), is expected to be some of help to understand the virulence of M. fermentans. We examined primary structure of cholinephosphotransferase (mf1) and glucosyltransferase (mf3) genes, which engage GGPL-I and GGPL-III synthesis, in 20 strains, and found four types of variations in the mf1 gene but the mf3 gene in two strains was not detected by PCR. These results may have important implications in virulence factor of M. fermentans.

  18. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  19. Designing of a single gene encoding four functional proteins.

    Science.gov (United States)

    Inouye, Masayori; Ishida, Yojiro; Inouye, Keiko

    2017-04-21

    In the genomes of some organisms such as bacteriophages and bacteria, a DNA sequence is able to encode two different proteins, indicating that genetic information is compacted in DNA twice denser than in usual DNA. In theory, a DNA sequence has a maximal capacity to produce six different mRNAs, however, it is an intriguing question how many of these mRNAs are able to synthesize functional proteins. Here, we design a DNA sequence encoding four collagen-like proteins, two, (Gly-Arg-Pro)n and (Gly-Ala-Pro)n, from a sense mRNA and the other two, also (Gly-Arg-Pro)n and (Gly-Ala-Pro)n from its antisense mRNA, all of which are expected to form triple-helical structures unique to collagens. Other designs such as the combination of (Gly-Arg-Pro)n, (Gly-Val-Pro)n, (Gly-Thr-Pro)n and (Gly-Arg-Pro)n are also possible. The proposed DNA sequence is considered to contain the most compact genetic information ever created. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Putative ACP phosphodiesterase gene (acpD) encodes an azoreductase.

    Science.gov (United States)

    Nakanishi, M; Yatome, C; Ishida, N; Kitade, Y

    2001-12-07

    An FMN-dependent NADH-azoreductase of Escherichia coli was purified and analyzed for identification of the gene responsible for azo reduction by microorganisms. The N-terminal sequence of the azoreductase conformed to that of the acpD gene product, acyl carrier protein phosphodiesterase. Overexpression of the acpD gene provided the E. coli with a large amount of the 23-kDa protein and more than 800 times higher azoreductase activity. The purified gene product exhibited activity corresponding to that of the native azoreductase. The reaction followed a ping-pong mechanism requiring 2 mol of NADH to reduce 1 mol of methyl red (4'-dimethylaminoazobenzene-2-carboxylic acid) into 2-aminobenzoic acid and N,N'-dimethyl-p-phenylenediamine. On the other hand, the gene product could not convert holo-acyl carrier protein into the apo form under either in vitro or in vivo conditions. These data indicate that the acpD gene product is not acyl carrier protein phosphodiesterase but an azoreductase.

  1. Identification of genes encoding glycosyltransferases involved in lipopolysaccharide synthesis in Porphyromonas gingivalis.

    Science.gov (United States)

    Shoji, Mikio; Sato, Keiko; Yukitake, Hideharu; Kamaguchi, Arihide; Sasaki, Yuko; Naito, Mariko; Nakayama, Koji

    2017-10-03

    Porphyromonas gingivalis can synthesize both A-LPS and O-LPS, which contain anionic O-polysaccharides and conventional O-polysaccharides, respectively. A-LPS can anchor virulence proteins to the cell surface, and elucidating the mechanism of A-LPS synthesis is therefore important for understanding the pathogenicity of this bacterium. To identify the genes involved in LPS synthesis, we focused on uncharacterized genes encoding the glycosyltransferases, PGN_0361, PGN_ 1239, PGN_1240, and PGN_1668, which were tentatively named gtfC, gtfD, gtfE, and gtfF, respectively, and characterized their mutants. We found that disruption of gtfC and gtfF resulted in A-LPS deficiency. In addition, a gtfD mutant had abnormal A-LPS synthesis, and a gtfE mutant exhibited a rough-type LPS which possesses a short oligosaccharide with lipid A-core. We then constructed a gtfC and gtfD double mutant, since their amino acid sequences are very similar, and this mutant similarly possessed a rough-type LPS. Cross-complementation analysis revealed that the GtfD protein is a functional homolog of the Escherichia coli WbbL protein, which is a rhamnosyltransferase. These results suggested that the GtfE protein is essential for the synthesis of both O-LPS and A-LPS, and that GtfC and GtfD proteins may work together to synthesize the two kinds of LPS. In addition, the GtfF protein was essential for A-LPS synthesis, although this may be achieved in a strain-specific manner. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  2. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  3. Chromosomal location of the gene encoding phosphoribosylpyrophosphate synthetase in Escherichia coli

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    1983-01-01

    by conjugation. Transductional analysis of the prs region established the gene order as purB-fadR-dadR-tre-pth-prs-hemA-trp. Two additional mutations were identified in the mutant: one in gsk, the gene encoding guanosine kinase, and one in lon, conferring a mucoid colony morphology. The contribution of each...

  4. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  5. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  6. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.

    Science.gov (United States)

    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A

    1987-06-01

    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  7. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.

    OpenAIRE

    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A

    1987-01-01

    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  8. Molecular characterization and evolution of a gene family encoding both female- and male-specific reproductive proteins in Drosophila.

    Science.gov (United States)

    Sirot, Laura K; Findlay, Geoffrey D; Sitnik, Jessica L; Frasheri, Dorina; Avila, Frank W; Wolfner, Mariana F

    2014-06-01

    Gene duplication is an important mechanism for the evolution of new reproductive proteins. However, in most cases, each resulting paralog continues to function within the same sex. To investigate the possibility that seminal fluid proteins arise through duplicates of female reproductive genes that become "co-opted" by males, we screened female reproductive genes in Drosophila melanogaster for cases of duplication in which one of the resulting paralogs produces a protein in males that is transferred to females during mating. We identified a set of three tandemly duplicated genes that encode secreted serine-type endopeptidase homologs, two of which are expressed primarily in the female reproductive tract (RT), whereas the third is expressed specifically in the male RT and encodes a seminal fluid protein. Evolutionary and gene expression analyses across Drosophila species suggest that this family arose from a single-copy gene that was female-specific; after duplication, one paralog evolved male-specific expression. Functional tests of knockdowns of each gene in D. melanogaster show that one female-expressed gene is essential for full fecundity, and both female-expressed genes contribute singly or in combination to a female's propensity to remate. In contrast, knockdown of the male-expressed paralog had no significant effect on female fecundity or remating. These data are consistent with a model in which members of this gene family exert effects on females by acting on a common, female-expressed target. After duplication and male co-option of one paralog, the evolution of the interacting proteins could have resulted in differential strengths or effects of each paralog. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Science.gov (United States)

    Lockhart, J Scott; DeVeaux, Linda C

    2013-01-01

    Recent evidence has implicated single-stranded DNA-binding protein (SSB) expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  10. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  11. Mutations in the gene encoding the low-density lipoprotein receptor LRP4 cause abnormal limb development in the mouse.

    Science.gov (United States)

    Simon-Chazottes, Dominique; Tutois, Sylvie; Kuehn, Michael; Evans, Martin; Bourgade, Franck; Cook, Sue; Davisson, Muriel T; Guénet, Jean-Louis

    2006-05-01

    Positional cloning of two recessive mutations of the mouse that cause polysyndactyly (dan and mdig-Chr 2) confirmed that the gene encoding MEGF7/LRP4, a member of the low-density lipoprotein receptor family, plays an essential role in the process of digit differentiation. Pathologies observed in the mutant mice provide insight into understanding the function(s) of LRP4 as a negative regulator of the Wnt-beta-catenin signaling pathway and may help identify the genetic basis for common human disorders with similar phenotypes.

  12. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Eric U Selker

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  13. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  14. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  15. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... It is a branch point enzyme, which regulates coordination with the other prenyltransferases (GDP and FDP synthase respectively) of the precursor flux towards mono-, sesqui-, and diterpenoids ... branch point enzyme in terpenoid biosynthesis, and that ..... complementation of the gene cluster for carotenoid.

  16. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Common wheat Hanxuan 10, a drought-tolerant cultivar, was used as the plant material. Seeds were germinated and grown in a growth chamber (20°±1°C, ..... References. Bechtold N, Ellis J and Pelletier G 1993 In planta Agrobacterium- mediated gene transfer by infiltration of Arabidopsis thaliana plants; C. R. Acad. Sci.

  17. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    In this study, a full-length AhLPAT4 gene was isolated via cDNA library screening and rapid amplification of cDNA ends (RACE); our data demonstrated that AhLPAT4 ... Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of ...

  18. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  19. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    The National Key Facility for Crop Gene Resources and Genetic Improvement, Key Laboratory of Crop Germplasm & Biotechnology, Ministry of Agriculture, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China; Biotechnology Research Institute, Chinese Academy of Agricultural ...

  20. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  1. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  2. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  3. Absence of repellents in Ustilago maydis induces genes encoding small secreted proteins.

    Science.gov (United States)

    Teertstra, Wieke R; Krijgsheld, Pauline; Wösten, Han A B

    2011-08-01

    The rep1 gene of the maize pathogen Ustilago maydis encodes a pre-pro-protein that is processed in the secretory pathway into 11 peptides. These so-called repellents form amphipathic amyloid fibrils at the surface of aerial hyphae. A SG200 strain in which the rep1 gene is inactivated (∆rep1 strain) is affected in aerial hyphae formation. We here assessed changes in global gene expression as a consequence of the inactivation of the rep1 gene. Microarray analysis revealed that only 31 genes in the ∆rep1 SG200 strain had a fold change in expression of ≥2. Twenty-two of these genes were up-regulated and half of them encode small secreted proteins (SSPs) with unknown functions. Seven of the SSP genes and two other genes that are over-expressed in the ∆rep1 SG200 strain encode proteins that can be classified as secreted cysteine-rich proteins (SCRPs). Interestingly, most of the SCRPs are predicted to form amyloids. The SCRP gene um00792 showed the highest up-regulation in the ∆rep1 strain. Using GFP as a reporter, it was shown that this gene is over-expressed in the layer of hyphae at the medium-air interface. Taken together, it is concluded that inactivation of rep1 hardly affects the expression profile of U. maydis, despite the fact that the mutant strain has a strong reduced ability to form aerial hyphae.

  4. What is a gene, post-ENCODE? History and updated definition.

    Science.gov (United States)

    Gerstein, Mark B; Bruce, Can; Rozowsky, Joel S; Zheng, Deyou; Du, Jiang; Korbel, Jan O; Emanuelsson, Olof; Zhang, Zhengdong D; Weissman, Sherman; Snyder, Michael

    2007-06-01

    While sequencing of the human genome surprised us with how many protein-coding genes there are, it did not fundamentally change our perspective on what a gene is. In contrast, the complex patterns of dispersed regulation and pervasive transcription uncovered by the ENCODE project, together with non-genic conservation and the abundance of noncoding RNA genes, have challenged the notion of the gene. To illustrate this, we review the evolution of operational definitions of a gene over the past century--from the abstract elements of heredity of Mendel and Morgan to the present-day ORFs enumerated in the sequence databanks. We then summarize the current ENCODE findings and provide a computational metaphor for the complexity. Finally, we propose a tentative update to the definition of a gene: A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products. Our definition side-steps the complexities of regulation and transcription by removing the former altogether from the definition and arguing that final, functional gene products (rather than intermediate transcripts) should be used to group together entities associated with a single gene. It also manifests how integral the concept of biological function is in defining genes.

  5. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the. AdZFP1 gene in ... For heat treatment, plants were incubated in sealed flasks at 37ºC for 1, 3, 6, 12 and 24 .... After drying in an oven, the samples were weighed again. The percentage of moisture in the soil ...

  6. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  7. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque...... strains harboring the rpiA gene in a multicopy plasmid contained up to 42-fold as much ribose phosphate isomerase A activity as the haploid strain....

  8. Taxonomically Restricted Genes with Essential Functions Frequently Play Roles in Chromosome Segregation inCaenorhabditis elegansandSaccharomyces cerevisiae.

    Science.gov (United States)

    Verster, Adrian J; Styles, Erin B; Mateo, Abigail; Derry, W Brent; Andrews, Brenda J; Fraser, Andrew G

    2017-10-05

    Genes encoding essential components of core cellular processes are typically highly conserved across eukaryotes. However, a small proportion of essential genes are highly taxonomically restricted; there appear to be no similar genes outside the genomes of highly related species. What are the functions of these poorly characterized taxonomically restricted genes (TRGs)? Systematic screens in Saccharomyces cerevisiae and Caenorhabditis elegans previously identified yeast or nematode TRGs that are essential for viability and we find that these genes share many molecular features, despite having no significant sequence similarity. Specifically, we find that those TRGs with essential phenotypes have an expression profile more similar to highly conserved genes, they have more protein-protein interactions and more protein disorder. Surprisingly, many TRGs play central roles in chromosome segregation; a core eukaryotic process. We thus find that genes that appear to be highly evolutionarily restricted do not necessarily play roles in species-specific biological functions but frequently play essential roles in core eukaryotic processes. Copyright © 2017 Verste et al.

  9. Combining Shigella Tn-seq data with gold-standard E. coli gene deletion data suggests rare transitions between essential and non-essential gene functionality.

    Science.gov (United States)

    Freed, Nikki E; Bumann, Dirk; Silander, Olin K

    2016-09-06

    Gene essentiality - whether or not a gene is necessary for cell growth - is a fundamental component of gene function. It is not well established how quickly gene essentiality can change, as few studies have compared empirical measures of essentiality between closely related organisms. Here we present the results of a Tn-seq experiment designed to detect essential protein coding genes in the bacterial pathogen Shigella flexneri 2a 2457T on a genome-wide scale. Superficial analysis of this data suggested that 481 protein-coding genes in this Shigella strain are critical for robust cellular growth on rich media. Comparison of this set of genes with a gold-standard data set of essential genes in the closely related Escherichia coli K12 BW25113 revealed that an excessive number of genes appeared essential in Shigella but non-essential in E. coli. Importantly, and in converse to this comparison, we found no genes that were essential in E. coli and non-essential in Shigella, implying that many genes were artefactually inferred as essential in Shigella. Controlling for such artefacts resulted in a much smaller set of discrepant genes. Among these, we identified three sets of functionally related genes, two of which have previously been implicated as critical for Shigella growth, but which are dispensable for E. coli growth. The data presented here highlight the small number of protein coding genes for which we have strong evidence that their essentiality status differs between the closely related bacterial taxa E. coli and Shigella. A set of genes involved in acetate utilization provides a canonical example. These results leave open the possibility of developing strain-specific antibiotic treatments targeting such differentially essential genes, but suggest that such opportunities may be rare in closely related bacteria.

  10. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  11. Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

    Directory of Open Access Journals (Sweden)

    Irina Makarevitch

    Full Text Available The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system.

  12. Gene essentiality, conservation index and co-evolution of genes in cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Gopi Siva Sai Tiruveedula

    Full Text Available Cyanobacteria, a group of photosynthetic prokaryotes, dominate the earth with ~ 1015 g wet biomass. Despite diversity in habitats and an ancient origin, cyanobacterial phylum has retained a significant core genome. Cyanobacteria are being explored for direct conversion of solar energy and carbon dioxide into biofuels. For this, efficient cyanobacterial strains will need to be designed via metabolic engineering. This will require identification of target knockouts to channelize the flow of carbon toward the product of interest while minimizing deletions of essential genes. We propose "Gene Conservation Index" (GCI as a quick measure to predict gene essentiality in cyanobacteria. GCI is based on phylogenetic profile of a gene constructed with a reduced dataset of cyanobacterial genomes. GCI is the percentage of organism clusters in which the query gene is present in the reduced dataset. Of the 750 genes deemed to be essential in the experimental study on S. elongatus PCC 7942, we found 494 to be conserved across the phylum which largely comprise of the essential metabolic pathways. On the contrary, the conserved but non-essential genes broadly comprise of genes required under stress conditions. Exceptions to this rule include genes such as the glycogen synthesis and degradation enzymes, deoxyribose-phosphate aldolase (DERA, glucose-6-phosphate 1-dehydrogenase (zwf and fructose-1,6-bisphosphatase class1, which are conserved but non-essential. While the essential genes are to be avoided during gene knockout studies as potentially lethal deletions, the non-essential but conserved set of genes could be interesting targets for metabolic engineering. Further, we identify clusters of co-evolving genes (CCG, which provide insights that may be useful in annotation. Principal component analysis (PCA plots of the CCGs are demonstrated as data visualization tools that are complementary to the conventional heatmaps. Our dataset consists of phylogenetic

  13. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  14. Identification and characterization of MFA1, the gene encoding Candida albicans a-factor pheromone.

    Science.gov (United States)

    Dignard, Daniel; El-Naggar, Ahmed L; Logue, Mary E; Butler, Geraldine; Whiteway, Malcolm

    2007-03-01

    In the opaque state, MTLa and MTLalpha strains of Candida albicans are able to mate, and this mating is directed by a pheromone-mediated signaling process. We have used comparisons of genome sequences to identify a C. albicans gene encoding a candidate a-specific mating factor. This gene is conserved in Candida dubliniensis and is similar to a three-gene family in the related fungus Candida parapsilosis but has extremely limited similarity to the Saccharomyces cerevisiae MFA1 (ScMFA1) and ScMFA2 genes. All these genes encode C-terminal CAAX box motifs characteristic of prenylated proteins. The C. albicans gene, designated CaMFA1, is found on chromosome 2 between ORF19.2165 and ORF19.2219. MFA1 encodes an open reading frame of 42 amino acids that is predicted to be processed to a 14-amino-acid prenylated mature pheromone. Microarray analysis shows that MFA1 is poorly expressed in opaque MTLa cells but is induced when the cells are treated with alpha-factor. Disruption of this C. albicans gene blocks the mating of MTLa cells but not MTLalpha cells, while the reintegration of the gene suppresses this cell-type-specific mating defect.

  15. A Comprehensive Overview of Online Resources to Identify and Predict Bacterial Essential Genes

    Directory of Open Access Journals (Sweden)

    Chong Peng

    2017-11-01

    Full Text Available Genes critical for the survival or reproduction of an organism in certain circumstances are classified as essential genes. Essential genes play a significant role in deciphering the survival mechanism of life. They may be greatly applied to pharmaceutics and synthetic biology. The continuous progress of experimental method for essential gene identification has accelerated the accumulation of gene essentiality data which facilitates the study of essential genes in silico. In this article, we present some available online resources related to gene essentiality, including bioinformatic software tools for transposon sequencing (Tn-seq analysis, essential gene databases and online services to predict bacterial essential genes. We review several computational approaches that have been used to predict essential genes, and summarize the features used for gene essentiality prediction. In addition, we evaluate the available online bacterial essential gene prediction servers based on the experimentally validated essential gene sets of 30 bacteria from DEG. This article is intended to be a quick reference guide for the microbiologists interested in the essential genes.

  16. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  17. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  18. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  19. Essential roles for imuA′- and imuB-encoded accessory factors in DnaE2-dependent mutagenesis in Mycobacterium tuberculosis

    Science.gov (United States)

    Warner, Digby F.; Ndwandwe, Duduzile E.; Abrahams, Garth L.; Kana, Bavesh D.; Machowski, Edith E.; Venclovas, Česlovas; Mizrahi, Valerie

    2010-01-01

    In Mycobacterium tuberculosis (Mtb), damage-induced mutagenesis is dependent on the C-family DNA polymerase, DnaE2. Included with dnaE2 in the Mtb SOS regulon is a putative operon comprising Rv3395c, which encodes a protein of unknown function restricted primarily to actinomycetes, and Rv3394c, which is predicted to encode a Y-family DNA polymerase. These genes were previously identified as components of an imuA-imuB-dnaE2–type mutagenic cassette widespread among bacterial genomes. Here, we confirm that Rv3395c (designated imuA′) and Rv3394c (imuB) are individually essential for induced mutagenesis and damage tolerance. Yeast two-hybrid analyses indicate that ImuB interacts with both ImuA′ and DnaE2, as well as with the β-clamp. Moreover, disruption of the ImuB-β clamp interaction significantly reduces induced mutagenesis and damage tolerance, phenocopying imuA′, imuB, and dnaE2 gene deletion mutants. Despite retaining structural features characteristic of Y-family members, ImuB homologs lack conserved active-site amino acids required for polymerase activity. In contrast, replacement of DnaE2 catalytic residues reproduces the dnaE2 gene deletion phenotype, strongly implying a direct role for the α-subunit in mutagenic lesion bypass. These data implicate differential protein interactions in specialist polymerase function and identify the split imuA′-imuB/dnaE2 cassette as a compelling target for compounds designed to limit mutagenesis in a pathogen increasingly associated with drug resistance. PMID:20615954

  20. The essential function of B. subtilis RNase III is to silence foreign toxin genes.

    Directory of Open Access Journals (Sweden)

    Sylvain Durand

    Full Text Available RNase III-related enzymes play key roles in cleaving double-stranded RNA in many biological systems. Among the best-known are RNase III itself, involved in ribosomal RNA maturation and mRNA turnover in bacteria, and Drosha and Dicer, which play critical roles in the production of micro (mi-RNAs and small interfering (si-RNAs in eukaryotes. Although RNase III has important cellular functions in bacteria, its gene is generally not essential, with the remarkable exception of that of Bacillus subtilis. Here we show that the essential role of RNase III in this organism is to protect it from the expression of toxin genes borne by two prophages, Skin and SPβ, through antisense RNA. Thus, while a growing number of organisms that use RNase III or its homologs as part of a viral defense mechanism, B. subtilis requires RNase III for viral accommodation to the point where the presence of the enzyme is essential for cell survival. We identify txpA and yonT as the two toxin-encoding mRNAs of Skin and SPβ that are sensitive to RNase III. We further explore the mechanism of RNase III-mediated decay of the txpA mRNA when paired to its antisense RNA RatA, both in vivo and in vitro.

  1. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    Science.gov (United States)

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    Full Text Available BACKGROUND: The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. METHODOLOGY/PRINCIPAL FINDINGS: Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6. CONCLUSIONS: Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  3. Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras.

    Science.gov (United States)

    Wang, Tim; Yu, Haiyan; Hughes, Nicholas W; Liu, Bingxu; Kendirli, Arek; Klein, Klara; Chen, Walter W; Lander, Eric S; Sabatini, David M

    2017-02-23

    The genetic dependencies of human cancers widely vary. Here, we catalog this heterogeneity and use it to identify functional gene interactions and genotype-dependent liabilities in cancer. By using genome-wide CRISPR-based screens, we generate a gene essentiality dataset across 14 human acute myeloid leukemia (AML) cell lines. Sets of genes with correlated patterns of essentiality across the lines reveal new gene relationships, the essential substrates of enzymes, and the molecular functions of uncharacterized proteins. Comparisons of differentially essential genes between Ras-dependent and -independent lines uncover synthetic lethal partners of oncogenic Ras. Screens in both human AML and engineered mouse pro-B cells converge on a surprisingly small number of genes in the Ras processing and MAPK pathways and pinpoint PREX1 as an AML-specific activator of MAPK signaling. Our findings suggest general strategies for defining mammalian gene networks and synthetic lethal interactions by exploiting the natural genetic and epigenetic diversity of human cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  5. The rnhB gene encoding RNase HII of Streptococcus pneumoniae and evidence of conserved motifs in eucaryotic genes.

    Science.gov (United States)

    Zhang, Y B; Ayalew, S; Lacks, S A

    1997-06-01

    A single RNase H enzyme was detected in extracts of Streptococcus pneumoniae. The gene encoding this enzyme was cloned and expressed in Escherichia coli, as demonstrated by its ability to complement a double-mutant rnhA recC strain. Sequence analysis of the cloned DNA revealed an open reading frame of 290 codons that encodes a polypeptide of 31.9 kDa. The predicted protein exhibits a low level of homology (19% identity of amino acid residues) to RNase HII encoded by rnhB of E. coli. Identification of the S. pneumoniae RNase HII translation start site by amino-terminal sequencing of the protein and of mRNA start sites by primer extension with reverse transcriptase showed that the major transcript encoding rnhB begins at the protein start site. Comparison of the S. pneumoniae and E. coli RNase HII sequences and sequences of other, putative bacterial rnhB gene products surmised from sequencing data revealed three conserved motifs. Use of these motifs to search for homologous genes in eucaryotes demonstrated the presence of rnhB genes in a yeast and a roundworm. Partial rnhB gene sequences were detected among expressed sequences of mouse and human cells. From these data, it appears that RNase HII is universally present in living cells.

  6. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  7. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens.

    Science.gov (United States)

    Charlebois, Audrey; Jalbert, Louis-Alexandre; Harel, Josée; Masson, Luke; Archambault, Marie

    2012-01-01

    Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90) (>256 µg/ml) was identical for both turkey and chicken isolates; whereas MIC(50) was higher in turkey isolates (6 µg/ml) than in chicken isolates (3 µg/ml). Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml) and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  8. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens.

    Directory of Open Access Journals (Sweden)

    Audrey Charlebois

    Full Text Available Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90 (>256 µg/ml was identical for both turkey and chicken isolates; whereas MIC(50 was higher in turkey isolates (6 µg/ml than in chicken isolates (3 µg/ml. Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  9. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin

    OpenAIRE

    Pelegrino,Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz,Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello

    2015-01-01

    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(−) vector and expressed in E. coli TOP10.

  10. The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

    DEFF Research Database (Denmark)

    Schwientek, Tilo; Keck, Birgit; Levery, Steven B

    2002-01-01

    The Drosophila genes fringe and brainiac exhibit sequence similarities to glycosyltransferases. Drosophila and mammalian fringe homologs encode UDP-N-acetylglucosamine:fucose-O-Ser beta1,3-N-acetylglucosaminyltransferases that modulate the function of Notch family receptors. The biological functi...

  11. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-o...... glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica....

  12. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Spleen lymphocytes of rats were transfected with the lentiviral vector system encoding FasL gene and 5 days later were induced by doxycycline for 24 h, followed by detection of FasL mRNA. The apoptosis index of Th1 cells was measured through both Annexin V-FITC flow cytometry and TUNEL. Additionally flow cytometry ...

  13. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    1990-01-01

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  14. Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome.

    NARCIS (Netherlands)

    Dauwerse, J.G.; Dixon, J.; Seland, S.; Ruivenkamp, C.A.; Haeringen, A. van; Hoefsloot, L.H.; Peters, D.J.; Boers, A.C.; Daumer-Haas, C.; Maiwald, R.; Zweier, C.; Kerr, B.; Cobo, A.M.; Toral, J.F.; Hoogeboom, A.J.M.; Lohmann, D.R.; Hehr, U.; Dixon, M.J.; Breuning, M.H.; Wieczorek, D.

    2011-01-01

    We identified a deletion of a gene encoding a subunit of RNA polymerases I and III, POLR1D, in an individual with Treacher Collins syndrome (TCS). Subsequently, we detected 20 additional heterozygous mutations of POLR1D in 252 individuals with TCS. Furthermore, we discovered mutations in both

  15. Erratum Genomewide analysis of NBS-encoding genes in kiwi fruit ...

    Indian Academy of Sciences (India)

    c Indian Academy of Sciences. Erratum. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis). Yingjun Li, Yan Zhong, Kaihui Huang and Zong-Ming Cheng. J. Genet. 95, 997–1001. The following statement in the footnote of the first page is missing in the published version of the above article.

  16. Phenotypical Manifestations of Mutations in the Genes Encoding Subunits of the Cardiac Sodium Channel

    NARCIS (Netherlands)

    Wilde, Arthur A. M.; Brugada, Ramon

    2011-01-01

    Variations in the gene encoding for the major sodium channel (Na(v)1.5) in the heart, SCN5A, has been shown to cause a number of arrhythmia syndromes (with or without structural changes in the myocardium), including the long-QT syndrome (type 3), Brugada syndrome, (progressive) cardiac conduction

  17. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  18. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  19. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  20. Partial AUC maximization for essential gene prediction using genetic algorithms.

    Science.gov (United States)

    Hwang, Kyu-Baek; Ha, Beom-Yong; Ju, Sanghun; Kim, Sangsoo

    2013-01-01

    Identifying genes indispensable for an organism's life and their characteristics is one of the central questions in current biological research, and hence it would be helpful to develop computational approaches towards the prediction of essential genes. The performance of a predictor is usually measured by the area under the receiver operating characteristic curve (AUC). We propose a novel method by implementing genetic algorithms to maximize the partial AUC that is restricted to a specific interval of lower false positive rate (FPR), the region relevant to follow-up experimental validation. Our predictor uses various features based on sequence information, protein-protein interaction network topology, and gene expression profiles. A feature selection wrapper was developed to alleviate the over-fitting problem and to weigh each feature's relevance to prediction. We evaluated our method using the proteome of budding yeast. Our implementation of genetic algorithms maximizing the partial AUC below 0.05 or 0.10 of FPR outperformed other popular classification methods.

  1. Patterns of evolutionary conservation of essential genes correlate with their compensability.

    Directory of Open Access Journals (Sweden)

    Tobias Bergmiller

    2012-06-01

    Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.

  2. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  3. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  4. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Florian Barbi

    Full Text Available Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5 and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2, active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may

  5. Identification of five new genes, closely related to the interleukin-1beta converting enzyme gene, that do not encode functional proteases.

    Science.gov (United States)

    Rocher, C; Faucheu, C; Blanchet, A M; Claudon, M; Hervé, F; Durand, L; Harnois, M; Diu-Hercend, A; Lalanne, J L

    1997-06-01

    Interleukin-1beta converting enzyme (ICE) was the first identified member of a growing family of cysteine proteases that now includes ten mammalian homologs. Within this large family, two functional proteins, denoted TX and TY share 60% amino-acid identity with ICE in the mature protein and, together with ICE, constitute the ICE subfamily. The present study describes the identification of five new gene sequences, denoted S1-S5, closely related to ICE and TX and belonging to this subfamily. Sequences were identified using genomic Southern-blot analysis of human DNA with probes corresponding to ICE and TX exon 6. Using PCR amplification and cloning, the complete exon-6 sequence of these new genes was identified; three exhibit around 90% identity with Ice within exon 6, whereas the two others share about 70% identity with Ice. Examination of open reading frames and of amino acids essential for ICE activity indicate that none of these genes encodes for a functional protease. In conclusion, extensive analysis of the genes closely related to Ice shows that the Ice subfamily is constituted of eight members. Three of them encode for functional proteases (ICE, TX and TY) whereas the remaining members probably correspond to pseudogenes.

  6. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf...

  7. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  8. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities.

    Science.gov (United States)

    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei

    2010-03-01

    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  9. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  10. Human genes with a greater number of transcript variants tend to show biological features of housekeeping and essential genes

    DEFF Research Database (Denmark)

    Ryu, Jae Yong; Kim, Hyun Uk; Lee, Sang Yup

    2015-01-01

    found to have a single transcript, and the remaining genes had 2 to 77 transcript variants. The genes with more transcript variants exhibited greater frequencies of acting as housekeeping and essential genes rather than tissue-selective and non-essential genes. They were found to be more conserved among...

  11. Nucleotide sequence and characterization of a Bacillus subtilis gene encoding a flagellar switch protein.

    OpenAIRE

    Zuberi, A R; Bischoff, D S; Ordal, G W

    1991-01-01

    The nucleotide sequence of the Bacillus subtilis fliM gene has been determined. This gene encodes a 38-kDa protein that is homologous to the FliM flagellar switch proteins of Escherichia coli and Salmonella typhimurium. Expression of this gene in Che+ cells of E. coli and B. subtilis interferes with normal chemotaxis. The nature of the chemotaxis defect is dependent upon the host used. In B. subtilis, overproduction of FliM generates mostly nonmotile cells. Those cells that are motile switch ...

  12. Isolation and molecular characterisation of the gene encoding eburicol 14α-demethylase (CYP51) from Penicillium italicum

    NARCIS (Netherlands)

    Nistelrooy, J.G.M. van; Brink, J.M. van den; Kan, J.A.L. van; Gorcom, R.F.M. van; Waard, M.A. de

    1996-01-01

    The CYP51 gene encoding eburicol 14α-demethylase (P450(14DM)) was cloned from a genomic library of the filamentous fungal plant pathogen Penicillium italicum, by heterologous hybridisation with the corresponding gene encoding lanosterol 14α-demethylase from the yeast Candida tropicalis. The

  13. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown to b...

  14. Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.

    Science.gov (United States)

    Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin

    2016-04-01

    Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.

  15. Variants within the 5'-flanking regions of bovine milk protein genes: I. κ-casein-encoding gene.

    Science.gov (United States)

    Schild, T A; Wagner, V; Geldermann, H

    1994-09-01

    In order to identify DNA variants within the 5'-flanking region of the bovine κ-casein (κCn)-encoding gene, this area of the gene from 13 cows belonging to seven breeds (Holstein Friesian, Brown Swiss, German Simmental, Jersey, Galloway, Scottish Highland and Ceylon Dwarf Zebu) was analysed. For each individual, about 1 kb of the 5'-flanking region including exon I was amplified by polymerase chain reaction (PCR). The biotinylated PCR product was immobilized on magnetic beads followed by direct bidirectional sequencing using an automated DNA sequencer. Fifteen DNA variants were identified, some of which are located within potential regulatory sites and possibly involved in the expression of the κ-casein encoding gene.

  16. Two essential Thioredoxins mediate apicoplast biogenesis, protein import, and gene expression in Toxoplasma gondii.

    Science.gov (United States)

    Biddau, Marco; Bouchut, Anne; Major, Jack; Saveria, Tracy; Tottey, Julie; Oka, Ojore; van-Lith, Marcel; Jennings, Katherine Elizabeth; Ovciarikova, Jana; DeRocher, Amy; Striepen, Boris; Waller, Ross Frederick; Parsons, Marilyn; Sheiner, Lilach

    2018-02-01

    Apicomplexan parasites are global killers, being the causative agents of diseases like toxoplasmosis and malaria. These parasites are known to be hypersensitive to redox imbalance, yet little is understood about the cellular roles of their various redox regulators. The apicoplast, an essential plastid organelle, is a verified apicomplexan drug target. Nuclear-encoded apicoplast proteins traffic through the ER and multiple apicoplast sub-compartments to their place of function. We propose that thioredoxins contribute to the control of protein trafficking and of protein function within these apicoplast compartments. We studied the role of two Toxoplasma gondii apicoplast thioredoxins (TgATrx), both essential for parasite survival. By describing the cellular phenotypes of the conditional depletion of either of these redox regulated enzymes we show that each of them contributes to a different apicoplast biogenesis pathway. We provide evidence for TgATrx1's involvement in ER to apicoplast trafficking and TgATrx2 in the control of apicoplast gene expression components. Substrate pull-down further recognizes gene expression factors that interact with TgATrx2. We use genetic complementation to demonstrate that the function of both TgATrxs is dependent on their disulphide exchange activity. Finally, TgATrx2 is divergent from human thioredoxins. We demonstrate its activity in vitro thus providing scope for drug screening. Our study represents the first functional characterization of thioredoxins in Toxoplasma, highlights the importance of redox regulation of apicoplast functions and provides new tools to study redox biology in these parasites.

  17. Identification and characterization of the genes encoding carbon monoxide dehydrogenase in Terrabacter carboxydivorans.

    Science.gov (United States)

    Lee, Jae Ho; Park, Sae Woong; Kim, Young Min; Oh, Jeong-Il

    2017-06-01

    Terrabacter carboxydivorans is able to grow aerobically at low concentrations of carbon monoxide (CO) as a sole source of carbon and energy. The genes for carbon monoxide dehydrogenase (CO-DH) were cloned from T. carboxydivorans and analyzed. The operon encoding T. carboxydivorans CO-DH was composed of three structural genes with the transcriptional order of cutB, cutC and cutA, as well as an additional accessory gene (orf4). Phylogenetic analysis of CutA revealed that T. carboxydivorans CO-DH was classified into a group distinct from previously characterized CO-DHs. Expression of antisense RNA for the cutB or cutA gene in T. carboxydivorans led to a decrease in CO-DH activity, confirming that cutBCA genes are the functional genes encoding CO-DH. The CO-DH operon was expressed even in the absence of CO and further inducible by CO. In addition, CO-DH synthesis was increased in the stationary phase compared to the exponential phase during heterotrophic growth on glucose and glycerol. Point mutations of a partially inverted repeat sequence (TCGGA-N6-GCCCA) in the upstream region of the cutB gene almost abolished expression of the CO-DH operon, indicating that the inverted-repeat sequence might be a cis-acting regulatory site for the positive regulation of the CO-DH operon. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  18. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.

    Science.gov (United States)

    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka

    2011-07-15

    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. The Early-Acting Peroxin PEX19 Is Redundantly Encoded, Farnesylated, and Essential for Viability in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Margaret M McDonnell

    Full Text Available Peroxisomes are single-membrane bound organelles that are essential for normal development in plants and animals. In mammals and yeast, the peroxin (PEX proteins PEX3 and PEX19 facilitate the early steps of peroxisome membrane protein (PMP insertion and pre-peroxisome budding from the endoplasmic reticulum. The PEX3 membrane protein acts as a docking site for PEX19, a cytosolic chaperone for PMPs that delivers PMPs to the endoplasmic reticulum or peroxisomal membrane. PEX19 is farnesylated in yeast and mammals, and we used immunoblotting with prenylation mutants to show that PEX19 also is fully farnesylated in wild-type Arabidopsis thaliana plants. We examined insertional alleles disrupting either of the two Arabidopsis PEX19 isoforms, PEX19A or PEX19B, and detected similar levels of PEX19 protein in the pex19a-1 mutant and wild type; however, PEX19 protein was nearly undetectable in the pex19b-1 mutant. Despite the reduction in PEX19 levels in pex19b-1, both pex19a-1 and pex19b-1 single mutants lacked notable peroxisomal β-oxidation defects and displayed normal levels and localization of peroxisomal matrix and membrane proteins. The pex19a-1 pex19b-1 double mutant was embryo lethal, indicating a redundantly encoded critical role for PEX19 during embryogenesis. Expressing YFP-tagged versions of either PEX19 isoform rescued this lethality, confirming that PEX19A and PEX19B act redundantly in Arabidopsis. We observed that pex19b-1 enhanced peroxisome-related defects of a subset of peroxin-defective mutants, supporting a role for PEX19 in peroxisome function. Together, our data indicate that Arabidopsis PEX19 promotes peroxisome function and is essential for viability.

  20. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    Energy Technology Data Exchange (ETDEWEB)

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.

    1989-06-01

    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  1. [The SNPs analysis of encoding sequence of interacting factor gene in Chinese population].

    Science.gov (United States)

    Li, Jiang; Zhang, Qing-jiong; Xiao, Xue-shan; Li, Jia-zhang; Zhang, Feng-sheng; Li, Shi-qiang; Li, Wei; Li, Tuo; Jia, Xiao-yun; Guo, Li; Guo, Xiang-ming

    2003-10-01

    To screen the variations of TG interacting factor(TGIF) gene in encoding sequence in Chinese high myopia patients and normal controls and to analyze the SNPs of TGIF gene encoding sequence in Chinese population. Genomic DNA was collected from 204 probands with high myopia and 112 unrelated persons without high myopia. The coding sequences of TGIF gene in 316 subjects were analyzed by using exon-by-exon PCR heteroduplex-SSCP analysis and sequencing. There were 3 types of SNP and one single nucleotide mutation in the coding sequence of TGIF gene: IVS-2 nt350 G --> T(36/204), codon140 CCA --> CCG; Pro140Pro codon163 CCG --> CTG;Pro163Leu and codon126 GTG --> GCG; Val126Ala(1/204). The SNPs of codon140 CCA --> CCG and codon163 CCG --> CTG were composed of 3 alleles and 5 genotypes in Chinese population which abide by Hardy-Weinberg law. There was no evidence to prove that mutations in the TGIF gene are responsible for the high myopia in Chinese. Three SNPs of coding sequence TGIF gene in Chinese population abide by Hardy-Weinberg law.

  2. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  3. Organization and expression of the Paramecium caudatum gene encoding nucleosome assembly protein 1.

    Science.gov (United States)

    Nishiyama, N; Sawatsubashi, S; Ishida, M; Yamauchi, K

    2001-12-12

    The complete genomic and partial complementary DNAs encoding the ciliate Paramecium caudatum nucleosome assembly protein 1 (NAP1) have been sequenced. The nap1 gene is situated 1.2 kbp from the hemoglobin (hb) gene, with the 3' end of both genes facing each other. The nap1 gene contains no introns, and encodes a protein of 369 amino acid residues with a calculated molecular weight of 42,627. The P. caudatum NAP1 amino acid sequence shares only 23-27% identity with NAP1 amino acid sequences from other eukaryotes. Although the nap1 transcript was detected in the P. caudatum cells at both the logarithmic and stationary phases, its level increased during the stationary phase. Southern blot analysis and polymerase chain reaction amplification revealed that the P. caudatum macronucleus has a heterogeneous composition at genomic regions around the nap1 gene. The present studies indicate the nap1 and hb genes are closely arranged in the macronucleus with the intergenic region between their sequences heterogeneously composed.

  4. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  5. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  6. Computational Prediction and Experimental Verification of the Gene Encoding the NAD+/NADP+-Dependent Succinate Semialdehyde Dehydrogenase in Escherichia coli▿ †

    Science.gov (United States)

    Fuhrer, Tobias; Chen, Lifeng; Sauer, Uwe; Vitkup, Dennis

    2007-01-01

    Although NAD+-dependent succinate semialdehyde dehydrogenase activity was first described in Escherichia coli more than 25 years ago, the responsible gene has remained elusive so far. As an experimental proof of concept for a gap-filling algorithm for metabolic networks developed earlier, we demonstrate here that the E. coli gene yneI is responsible for this activity. Our biochemical results demonstrate that the yneI-encoded succinate semialdehyde dehydrogenase can use either NAD+ or NADP+ to oxidize succinate semialdehyde to succinate. The gene is induced by succinate semialdehyde, and expression data indicate that yneI plays a unique physiological role in the general nitrogen metabolism of E. coli. In particular, we demonstrate using mutant growth experiments that the yneI gene has an important, but not essential, role during growth on arginine and probably has an essential function during growth on putrescine as the nitrogen source. The NADP+-dependent succinate semialdehyde dehydrogenase activity encoded by the functional homolog gabD appears to be important for nitrogen metabolism under N limitation conditions. The yneI-encoded activity, in contrast, functions primarily as a valve to prevent toxic accumulation of succinate semialdehyde. Analysis of available genome sequences demonstrated that orthologs of both yneI and gabD are broadly distributed across phylogenetic space. PMID:17873044

  7. Molecular evolution and expression profile of the chemerine encoding gene RARRES2 in baboon and chimpanzee

    OpenAIRE

    González Alvarez, Rafael; Garza Rodríguez, María; DELGADO ENCISO, IVÁN; Treviño Alvarado, Víctor M.; Canales del Castillo, Ricardo.; Martínez De Villarreal, Laura E.; Lugo Trampe, Ángel; Tejero, María E.; Schlabritz Loutsevitch, Natalia E.; Rocha Pizaña, María; Cole, Shelley A.; Reséndez Pérez, Diana; Moises Alvarez, Mario; Comuzzie, Anthony G.; Barrera Saldaña, Hugo A.

    2015-01-01

    Abstract Background Chemerin, encoded by the retinoic acid receptor responder 2 (RARRES2) gene is an adipocytesecreted protein with autocrine/paracrine functions in adipose tissue, metabolism and inflammation with a recently described function in vascular tone regulation, liver, steatosis, etc. This molecule is believed to represent a critical endocrine signal linking obesity to diabetes. There are no data available regarding evolution of RARRES2 in non-human primates and great apes. Expressi...

  8. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  9. The rad9 gene of Coprinus cinereus encodes a proline-rich protein required for meiotic chromosome condensation and synapsis

    Energy Technology Data Exchange (ETDEWEB)

    Seitz, L.C.; Tang, Keliang; Cummings, W.J.; Zolan, M.E. [Indiana Univ., Bloomington, IN (United States)

    1996-04-01

    The rad9 gene of Coprinus cinereus is essential for the normal completion of meiosis. We examined surface-spread preparations of wild-type and rad9-1 nuclei from the meiotic stages of karyogamy through metaphase I, and we determined the primary sequence, structure, and meiotic expression of the rad9 gene. In wild-type C. cinereus, karyogamy is followed by condensation and alignment of homologous chromosomes. Condensation and axial core development largely precede synapsis, which often initiates at telomeres. A diffuse diplotene phase coincides with dissolution of the synaptonemal complex, and subsequently chromosomes further condense as the cells progress into metaphase I. In contrast, although karyogamy and nucleolar fusion are apparently normal in rad9-1 basidia, only short stretches of synaptonemal complex form. These correlate with stretches of condensed chromatin, mostly at apparent chromosome ends, and regions of presumptive triple synapsis are numerous. rad9-1 basidia enter the diffuse stages of early diplotene, and then 50% of these cells enter metaphase I by the criteria of nucleolar elimination and at least some chromatin condensation. rad9 gene expression is induced after gamma irradiation and during meiosis. The gene has 27 exons and encodes a predicted protein of 2157 amino acids, with a proline-rich amino terminus. 62 refs., 10 figs.

  10. The Rad9 Gene of Coprinus Cinereus Encodes a Proline-Rich Protein Required for Meiotic Chromosome Condensation and Synapsis

    Science.gov (United States)

    Seitz, L. C.; Tang, K.; Cummings, W. J.; Zolan, M. E.

    1996-01-01

    The rad9 gene of Coprinus cinereus is essential for the normal completion of meiosis. We examined surface-spread preparations of wild-type and rad9-1 nuclei from the meiotic stages of karyogamy through metaphase I, and we determined the primary sequence, structure, and meiotic expression of the rad9 gene. In wild-type C. cinereus, karyogamy is followed by condensation and alignment of homologous chromosomes. Condensation and axial core development largely precede synapsis, which often initiates at telomeres. A diffuse diplotene phase coincides with dissolution of the synaptonemal complex, and subsequently chromosomes further condense as the cells progress into metaphase I. In contrast, although karyogamy and nucleolar fusion are apparently normal in rad9-1 basidia, only short stretches of synaptonemal complex form. These correlate with stretches of condensed chromatin, mostly at apparent chromosome ends, and regions of presumptive triple synapsis are numerous. rad9-1 basidia enter the diffuse stage of early diplotene, and then 50% of these cells enter metaphase I by the criteria of nucleolar elimination and at least some chromatin condensation. rad9 gene expression is induced after gamma irradiation and during meiosis. The gene has 27 exons and encodes a predicted protein of 2157 amino acids, with a proline-rich amino terminus. PMID:8846891

  11. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring γ-retrovirus-encoded hsvtk suicide genes

    Science.gov (United States)

    Wang, X; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M; Samakoglu, S; Chang, AH; Sadelain, M; Rivière, I

    2015-01-01

    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that γ-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes undergo recombination with molecular signatures indicative of template switching in GC-rich regions displaying homology at the deletion junctions or RNA splicing. In the absence of ganciclovir selection, the frequency of recombination is 3% per retroviral replication cycle. Our results underscore the importance of the five nucleotide difference between the two hsvtk genes that account for the presence of recombinogenic hot spots in one variant and not the other, indicating that the probability of RNA splicing is influenced by minute nucleotide changes in sequences adjacent to the splice donor and acceptor sites. Furthermore, our mutational analysis in an unbiased panel of human lymphoid cells (that is, without immune or ganciclovir-mediated selective pressure) provides a robust in vitro assay to predict and quantify clinically relevant mutations in hsvtk suicide genes, which can be applied to studying and improving the stability of any transgene expressed in γ-retroviral or lentiviral vectors. PMID:18563185

  12. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring gamma-retrovirus-encoded hsvtk suicide genes.

    Science.gov (United States)

    Wang, X; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M; Samakoglu, S; Chang, A H; Sadelain, M; Rivière, I

    2008-11-01

    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that gamma-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes undergo recombination with molecular signatures indicative of template switching in GC-rich regions displaying homology at the deletion junctions or RNA splicing. In the absence of ganciclovir selection, the frequency of recombination is 3% per retroviral replication cycle. Our results underscore the importance of the five nucleotide difference between the two hsvtk genes that account for the presence of recombinogenic hot spots in one variant and not the other, indicating that the probability of RNA splicing is influenced by minute nucleotide changes in sequences adjacent to the splice donor and acceptor sites. Furthermore, our mutational analysis in an unbiased panel of human lymphoid cells (that is, without immune or ganciclovir-mediated selective pressure) provides a robust in vitro assay to predict and quantify clinically relevant mutations in hsvtk suicide genes, which can be applied to studying and improving the stability of any transgene expressed in gamma-retroviral or lentiviral vectors.

  13. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  14. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    Science.gov (United States)

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is , the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

  15. TMpcp: a Tuber magnatum gene which encodes a putative mitochondrial phosphate carrier.

    Science.gov (United States)

    Garnero, L; Bonfante, P

    2000-01-01

    Little is known about the genome of Tuber, Ascomycetes which comprise a number of ectomycorrhizal species. Screening of a genomic library of Tuber magnatum led to identification of a chitin synthase gene (chs). On sequencing upstream of it in the same phage, we found a 2000 bp long fragment that proved to contain a hypothetical gene with high homology with mitochondrial phosphate carriers from human and bovine heart, and from Saccharomyces cerevisiae. The sequence contains two putative introns and its open reading frame encodes for a protein 305 amino acids long. A primary sequence analysis revealed 6 hydrophobic segments and a signature pattern, similar to that of other mitochondrial carriers.

  16. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  17. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin.

    Science.gov (United States)

    Pelegrino, Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz, Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello

    2015-11-09

    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(-) vector and expressed in E. coli TOP10. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  19. Two homologous low-temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins.

    Science.gov (United States)

    Capel, J; Jarillo, J A; Salinas, J; Martínez-Zapater, J M

    1997-10-01

    We have characterized two related cDNAs (RCI2A and RCI2B) corresponding to genes from Arabidopsis thaliana, the expression of which is transiently induced by low, nonfreezing temperatures. RCI2A and RCI2B encode small (54 amino acids), highly hydrophobic proteins that bear two potential transmembrane domains. They show similarity to proteins encoded by genes from barley (Hordeum vulgare L.) and wheatgrass (Lophophyrum elongatum) that are regulated by different stress conditions. Their high level of sequence homology (78%) and their genomic location in a single restriction fragment suggest that both genes originated as a result of a tandem duplication. However, their regulatory sequences have diverged enough to confer on them different expression patterns. Like most of the cold-inducible plant genes characterized, the expression of RCI2A and RCI2B is also promoted by abscisic acid (ABA) and dehydration but is not a general response to stress conditions, since it is not induced by salt stress or by anaerobiosis. Furthermore, low temperatures are able to induce RCI2A and RCI2B expression in ABA-deficient and -insensitive genetic backgrounds, indicating that both ABA-dependent and -independent pathways regulate the low-temperature responsiveness of these two genes.

  20. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  1. Comparative analysis of resistance gene analogues encoding NBS-LRR domains in cotton.

    Science.gov (United States)

    Khan, Abdul Manan; Khan, Asif Ali; Azhar, Muhammad Tehseen; Amrao, Luqman; Cheema, Hafiza Masooma Naseer

    2016-01-30

    Plant production is severely affected by biotic and abiotic stresses R-genes exhibit resistance against a range of diseases and pathogens in plants. The nucleotide binding site and leucine rich repeat (NBS-LRR) class of R-genes is the most comprehensively studied in terms of sequence evolution and genome distribution. The differential response for resistance against biotic and abiotic stress has been observed in cultivated and wild relatives of the genus Gossypium. Efforts have been made to address the recent evolution of NBS-LRR sequences within Gossypium hirsutum and resistance gene analogue (RGA) sequences derived from G. arboreum and G. raimondii. The % identity and phylogenetic analysis of NBS-LRR-encoded RGAs from tetraploid New World cotton and its diploid ancestors G. raimondii and G. arboreum suggest that the evolution of NBS-LRR-encoding sequences in G. hirsutum occurred by gradual accumulation of mutants that led to positive selection and a slow rate of divergence within distinct R-gene families. The allotetraploid genome of cotton, after separating from its diploid parents, experienced polyploidisation, natural and artificial selection, hybrid necrosis, duplication and recombination which became the reason to shed off and evolve new genes for its survival. These driving forces influenced the development of genomic architecture that make it susceptible to diseases and pathogens as compared to donor parents. © 2015 Society of Chemical Industry.

  2. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  3. The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

    Science.gov (United States)

    Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

    1998-03-01

    Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

  4. The yield of essential oils in Melaleuca alternifolia (Myrtaceae is regulated through transcript abundance of genes in the MEP pathway.

    Directory of Open Access Journals (Sweden)

    Hamish Webb

    Full Text Available Medicinal tea tree (Melaleuca alternifolia leaves contain large amounts of an essential oil, dominated by monoterpenes. Several enzymes of the chloroplastic methylerythritol phosphate (MEP pathway are hypothesised to act as bottlenecks to the production of monoterpenes. We investigated, whether transcript abundance of genes encoding for enzymes of the MEP pathway were correlated with foliar terpenes in M. alternifolia using a population of 48 individuals that ranged in their oil concentration from 39 -122 mg x g DM(-1. Our study shows that most genes in the MEP pathway are co-regulated and that the expression of multiple genes within the MEP pathway is correlated with oil yield. Using multiple regression analysis, variation in expression of MEP pathway genes explained 87% of variation in foliar monoterpene concentrations. The data also suggest that sesquiterpenes in M. alternifolia are synthesised, at least in part, from isopentenyl pyrophosphate originating from the plastid via the MEP pathway.

  5. The yield of essential oils in Melaleuca alternifolia (Myrtaceae) is regulated through transcript abundance of genes in the MEP pathway.

    Science.gov (United States)

    Webb, Hamish; Lanfear, Robert; Hamill, John; Foley, William J; Külheim, Carsten

    2013-01-01

    Medicinal tea tree (Melaleuca alternifolia) leaves contain large amounts of an essential oil, dominated by monoterpenes. Several enzymes of the chloroplastic methylerythritol phosphate (MEP) pathway are hypothesised to act as bottlenecks to the production of monoterpenes. We investigated, whether transcript abundance of genes encoding for enzymes of the MEP pathway were correlated with foliar terpenes in M. alternifolia using a population of 48 individuals that ranged in their oil concentration from 39 -122 mg x g DM(-1). Our study shows that most genes in the MEP pathway are co-regulated and that the expression of multiple genes within the MEP pathway is correlated with oil yield. Using multiple regression analysis, variation in expression of MEP pathway genes explained 87% of variation in foliar monoterpene concentrations. The data also suggest that sesquiterpenes in M. alternifolia are synthesised, at least in part, from isopentenyl pyrophosphate originating from the plastid via the MEP pathway.

  6. A putative gene cluster from a Lyngbya wollei bloom that encodes paralytic shellfish toxin biosynthesis.

    Directory of Open Access Journals (Sweden)

    Troco K Mihali

    Full Text Available Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds.

  7. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  8. The Goddard and Saturn Genes Are Essential for Drosophila Male Fertility and May Have Arisen De Novo.

    Science.gov (United States)

    Gubala, Anna M; Schmitz, Jonathan F; Kearns, Michael J; Vinh, Tery T; Bornberg-Bauer, Erich; Wolfner, Mariana F; Findlay, Geoffrey D

    2017-05-01

    New genes arise through a variety of mechanisms, including the duplication of existing genes and the de novo birth of genes from noncoding DNA sequences. While there are numerous examples of duplicated genes with important functional roles, the functions of de novo genes remain largely unexplored. Many newly evolved genes are expressed in the male reproductive tract, suggesting that these evolutionary innovations may provide advantages to males experiencing sexual selection. Using testis-specific RNA interference, we screened 11 putative de novo genes in Drosophila melanogaster for effects on male fertility and identified two, goddard and saturn, that are essential for spermatogenesis and sperm function. Goddard knockdown (KD) males fail to produce mature sperm, while saturn KD males produce few sperm, and these function inefficiently once transferred to females. Consistent with a de novo origin, both genes are identifiable only in Drosophila and are predicted to encode proteins with no sequence similarity to any annotated protein. However, since high levels of divergence prevented the unambiguous identification of the noncoding sequences from which each gene arose, we consider goddard and saturn to be putative de novo genes. Within Drosophila, both genes have been lost in certain lineages, but show conserved, male-specific patterns of expression in the species in which they are found. Goddard is consistently found in single-copy and evolves under purifying selection. In contrast, saturn has diversified through gene duplication and positive selection. These data suggest that de novo genes can acquire essential roles in male reproduction. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. The malQ gene is essential for starch metabolism in Streptococcus mutans

    Directory of Open Access Journals (Sweden)

    Yutaka Sato

    2013-08-01

    Full Text Available Background: The malQ and glgP genes, respectively, annotated as putative 4-α-glucanotransferase and putative glycogen phosphorylase are located with a 29 nucleotide overlap on the Streptococcus mutans genome. We found that the glgP gene of this organism was induced with maltose, and the gene likely constituted an operon with the upstream gene malQ. This putative operon was negatively regulated with the malR gene located upstream from the malQ gene and a MalR-binding consensus sequence was found upstream of the malQ gene. S. mutans is not able to catabolize starch. However, this organism utilizes maltose degraded from starch in the presence of saliva amylase. Therefore, we hypothesized that the MalQ/GlgP system may participate in the metabolism of starch-degradation products. Methods: A DNA fragment amplified from the malQ or glgP gene overexpressed His-tagged proteins with the plasmid pBAD/HisA. S. mutans malQ and/or glgP mutants were also constructed. Purified proteins were assayed for glucose-releasing and phosphorylase activities with appropriate buffers containing maltose, maltotriose, maltodextrin, or amylodextrin as a substrate, and were photometrically assayed with a glucose-6-phosphate dehydrogenase–NADP system. Results: Purified MalQ protein released glucose from maltose and maltotriose but did not from either maltodextrin or amylodextrin. The purified GlgP protein did not exhibit a phosphorylase reaction with maltose or maltotriose but generated glucose-1-phosphate from maltodextrin and amylodextrin. However, the GlgP protein released glucose-1-phosphate from maltose and maltotriose in the presence of the MalQ protein. In addition, the MalQ enzyme activity with maltose released not only glucose but also produced maltooligosaccharides as substrates for the GlgP protein. Conclusion: These results suggest that the malQ gene encodes 4-α-glucanotransferase but not α-1,4-glucosidase activity. The malQ mutant could not grow in the

  10. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes.

    Directory of Open Access Journals (Sweden)

    H Charlotte van der Does

    2016-11-01

    Full Text Available Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol, effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  11. Cloning and sequencing of the gene encoding LipL21 in the vaccinal leptospira serovars

    Directory of Open Access Journals (Sweden)

    Rasoul Hoseinpur

    2016-01-01

    Full Text Available Background: Leptospirosis is a zoonotic disease in humans and animals, caused by the bacterium Leptospira interrogans. Gene expressing LipL21 is one of the genes identified in the bacterium, existing only in the pathogenic strains. The aim of this study was to cloning and analyzing the sequence of the gene encoding surface lipoprotein, LipL21, in five vaccinal leptospira serovars in Iran. Material and Methods: Pathogenic Leptospira interrogans serovars were cultured in EMJH medium with 10% rabbit serum. After genomic DNA extraction, PCR with specific primers was employed and the resulting product inserted in a vector then transferred into E. Coli DH5&alpha. The recombinant plasmids were finally sent for sequencing. Results: The analysis of gene lipL21 in domestic vaccinal serovars and comparison of them with other serovars in the GenBank database revealed that three vaccinal serovars serjo hardjo, canicola and pomona had 100% similarity with each other and grippotyphosa serovar had the highest difference with the vaccinal serovars. In general, the results showed that this gene is a highly conserved gene in the domestic vaccinal serovars and serovars in the GenBank database with more than 95.7 percent similarity. Conclusion: These results showed that the gene, lipL21, is highly conserved in the vaccinal serovars (similarities > 96.4 %. Therefore, the gene encoding surface protein LipL21 can serve as a useful serologic test with high specificity and sensitivity for diagnosis of leptospirosis in clinical samples and in future as an effective subunit vaccine candidate to be used.

  12. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes.

    Science.gov (United States)

    van der Does, H Charlotte; Fokkens, Like; Yang, Ally; Schmidt, Sarah M; Langereis, Léon; Lukasiewicz, Joanna M; Hughes, Timothy R; Rep, Martijn

    2016-11-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity

  13. Identification and differential expression dynamics of peach small GTPases encoding genes during fruit development and ripening

    Science.gov (United States)

    Falchi, Rachele; Cipriani, Guido; Marrazzo, Teresa; Nonis, Alberto; Vizzotto, Giannina; Ruperti, Benedetto

    2010-01-01

    The function of monomeric GTPases of the RAS superfamily in fruit development and ripening has been partially characterized. Here the identification of peach (Prunus persica) small GTPases of the RAS superfamily expressed in fruit and the characterization of their expression profiles during fruit development are described. Extensive searches on expressed sequence tag (EST) databases led to the selection of a total of 24 genes from peach encoding proteins with significant similarity to Arabidopsis small GTPases. Sequence similarity analyses and identification of conserved motifs, diagnostic of specific RAS families and subfamilies, enabled bona fide assignment of fourteen PpRAB, seven PpARF/ARL/SAR, two PpROP and one PpRAN GTPases. Transcriptional expression profiles of peach monomeric GTPases, analysed by real-time quantitative reverse transcription-PCR, were obtained for mesocarp samples, collected in two consecutive years. Reproducible patterns of expression could be identified for five peach RAB-encoding genes (PpRABA1-1, PpRABA2, PpRABD2-1, PpRABD2-2, and PpRABC2), two ARFs (PpARFA1-1 and PpARLB1), and two ROPs (PpROP3 and PpROP4). Interestingly, the transient transcriptional up-regulation of PpARF genes and of PpRAB genes of the A and D clades, putatively controlling the exocytic delivery of cell wall components and modifying enzymes, appeared to coincide with peaks of growth speed and sugar accumulation and with the final phases of ripening. To our knowledge, this is the first description of the co-ordinated differential expression of a set of genes encoding small GTPases of the ARF and RAB families which takes place during key moments of fruit development and maturation. PMID:20501747

  14. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  15. Identification and characterization of multiple Spidroin 1 genes encoding major ampullate silk proteins in Nephila clavipes.

    Science.gov (United States)

    Gaines, W A; Marcotte, W R

    2008-09-01

    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSps) that consist of a large repeat array flanked by nonrepetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species.

  16. Expression and characterization of the genes encoding azoreductases from Bacillus subtilis and Geobacillus stearothermophilus.

    Science.gov (United States)

    Sugiura, Wataru; Yoda, Tomoko; Matsuba, Takashi; Tanaka, Yoshinori; Suzuki, Yasuhiko

    2006-07-01

    Azoreductases have been characterized as enzymes that can decolorize azo dyes by reducing azo groups. In this study, genes encoding proteins having homology with the azoreductase gene of Bacillus sp. OY1-2 were obtained from Bacillus subtilis ATCC6633, B. subtilis ISW1214, and Geobacillus stearotherophilus IFO13737 by polymerase chain reaction. All three genes encoded proteins with 174 amino acids. The deduced amino acid sequences of azoreductase homologs from B. subtilis ISW1214, B. subtilis ATCC6633, and G. stearotherophilus IFO13737 showed similarity of 53.3, 53.9, and 53.3% respectively to that of Bacillus sp. OY1-2. All three genes were expressed in Escherichia coli, and were characterized as having the decolorizing activity of azo dyes in a beta-NADPH dependent manner. The transformation of several azo dyes into colorless compounds by recombinant enzymes was demonstrated to have distinct substrate specificity from that of azoreductase from Bacillus sp. OY1-2.

  17. A universal method for the identification of genes encoding amatoxins and phallotoxins in poisonous mushrooms

    Science.gov (United States)

    Wołoszyn, Agata; Kotłowski, Roman

    As the currently known diagnostic DNA targets amplified in the PCR assays for detection of poisonous mushrooms have their counterparts in edible species, there is a need to design PCR primers specific to the genes encoding amanitins and phallotoxins, which occur only in poisonous mushrooms. The aim of the study was testing of PCR-based method for detection of all genes encoding hepatotoxic cyclic peptides - amanitins and phallotoxins present in the most dangerous poisonous mushrooms. Degenerate primers in the PCR were designed on the basis of amanitins (n=13) and phallotoxins (n=5) genes in 18 species of poisonous mushrooms deposited to Genbank of the National Center for Biotechnology Information. The specificity of the PCR assays was confirmed against 9 species of edible mushrooms, death cap - Amanita phalloides and panther cap - Amanita pantherina. Designed two couples of PCR-primers specific to amanitins and phallotoxins genes can be recommended for detection of Amanita phalloides and other mushroom species producing hepatotoxic cyclic peptides - amanitins and phallotoxins.

  18. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  19. Chitinase Genes Responsive to Cold Encode Antifreeze Proteins in Winter Cereals1

    Science.gov (United States)

    Yeh, Sansun; Moffatt, Barbara A.; Griffith, Marilyn; Xiong, Fei; Yang, Daniel S.C.; Wiseman, Steven B.; Sarhan, Fathey; Danyluk, Jean; Xue, Yi Qi; Hew, Choy L.; Doherty-Kirby, Amanda; Lajoie, Gilles

    2000-01-01

    Antifreeze proteins similar to two different chitinases accumulate during cold acclimation in winter rye (Secale cereale). To determine whether these cold-responsive chitinases require post-translational modification to bind to ice, cDNAs coding for two different full-length chitinases were isolated from a cDNA library produced from cold-acclimated winter rye leaves. CHT9 is a 1,193-bp clone that encodes a 31.7-kD class I chitinase and CHT46 is a 998-bp clone that codes for a 24.8-kD class II chitinase. Chitinase-antifreeze proteins purified from the plant were similar in mass to the predicted mature products of CHT9 and CHT46, thus indicating that there was little chemical modification of the amino acid sequences in planta. To confirm these results, the mature sequences of CHT9 and CHT46 were expressed in Escherichia coli and the products of both cDNAs modified the growth of ice. Transcripts of both genes accumulated late in cold acclimation in winter rye. Southern analysis of winter rye genomic DNA indicated the presence of a small gene family homologous to CHT46. In hexaploid wheat, CHT46 homologs mapped to the homeologous group 1 chromosomes and were expressed in response to cold and drought. We conclude that two novel cold-responsive genes encoding chitinases with ice-binding activity may have arisen in winter rye and other cereals through gene duplication. PMID:11080301

  20. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  1. Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana

    Science.gov (United States)

    Samac, Deborah A.; Hironaka, Cathy M.; Yallaly, Peter E.; Shah, Dilip M.

    1990-01-01

    Plants synthesize a number of antimicrobial proteins in response to pathogen invasion and environmental stresses. These proteins include two classes of chitinases that have either basic or acidic isoelectric points and that are capable of degrading fungal cell wall chitin. We have cloned and determined the nucleotide sequence of the genes encoding the acidic and basic chitinases from Arabidopsis thaliana (L.) Heynh. Columbia wild type. Both chitinases are encoded by single copy genes that contain introns, a novel feature in chitinase genes. The basic chitinase has 73% amino acid sequence similarity to the basic chitinase from tobacco, and the acidic chitinase has 60% amino acid sequence similarity to the acidic chitinase from cucumber. Expression of the basic chitinase is organ-specific and age-dependent in Arabidopsis. A high constitutive level of expression was observed in roots with lower levels in leaves and flowering shoots. Exposure of plants to ethylene induced high levels of systemic expression of basic chitinase with expression increasing with plant age. Constitutive expression of basic chitinase was observed in roots of the ethylene insensitive mutant (etr) of Arabidopsis, demonstrating that root-specific expression is ethylene independent. Expression of the acidic chitinase gene was not observed in normal, untreated Arabidopsis plants or in plants treated with ethylene or salicylate. However, a transient expression assay indicated that the acidic chitinase promoter is active in Arabidopsis leaf tissue. Images Figure 6 Figure 7 PMID:16667600

  2. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  3. The Non-Mendelian Green Cotyledon Gene in Soybean Encodes a Small Subunit of Photosystem II.

    Science.gov (United States)

    Kohzuma, Kaori; Sato, Yutaka; Ito, Hisashi; Okuzaki, Ayako; Watanabe, Mai; Kobayashi, Hideki; Nakano, Michiharu; Yamatani, Hiroshi; Masuda, Yu; Nagashima, Yumi; Fukuoka, Hiroyuki; Yamada, Tetsuya; Kanazawa, Akira; Kitamura, Keisuke; Tabei, Yutaka; Ikeuchi, Masahiko; Sakamoto, Wataru; Tanaka, Ayumi; Kusaba, Makoto

    2017-04-01

    Chlorophyll degradation plays important roles in leaf senescence including regulation of degradation of chlorophyll-binding proteins. Although most genes encoding enzymes of the chlorophyll degradation pathway have been identified, the regulation of their activity has not been fully understood. Green cotyledon mutants in legume are stay-green mutants, in which chlorophyll degradation is impaired during leaf senescence and seed maturation. Among them, the soybean (Glycine max) green cotyledon gene cytG is unique because it is maternally inherited. To isolate cytG, we extensively sequenced the soybean chloroplast genome, and detected a 5-bp insertion causing a frame-shift in psbM, which encodes one of the small subunits of photosystem II. Mutant tobacco plants (Nicotiana tabacum) with a disrupted psbM generated using a chloroplast transformation technique had green senescent leaves, confirming that cytG encodes PsbM. The phenotype of cytG was very similar to that of mutant of chlorophyll b reductase catalyzing the first step of chlorophyll b degradation. In fact, chlorophyll b-degrading activity in dark-grown cytG and psbM-knockout seedlings was significantly lower than that of wild-type plants. Our results suggest that PsbM is a unique protein linking photosynthesis in presenescent leaves with chlorophyll degradation during leaf senescence and seed maturation. Additionally, we discuss the origin of cytG, which may have been selected during domestication of soybean. © 2017 American Society of Plant Biologists. All Rights Reserved.

  4. The duplicated Saccharomyces cerevisiae gene SSM1 encodes a eucaryotic homolog of the eubacterial and archaebacterial L1 ribosomal proteins.

    Science.gov (United States)

    Petitjean, A; Bonneaud, N; Lacroute, F

    1995-09-01

    A previously unknown Saccharomyces cerevisiae gene, SSM1a, was isolated by screening for high-copy-number suppressors of thermosensitive mutations in the RNA14 gene, which encodes a component from the polyadenylation complex. The SSM1 a gene codes for a 217-amino-acid protein, Ssm1p, which is significantly homologous to eubacterial and archaebacterial ribosomal proteins of the L1 family. Comparison of the Ssm1p amino acid sequence with that of eucaryotic polypeptides with unknown functions reveals that Ssm1p is the prototype of a new eucaryotic protein family. Biochemical analysis shows that Ssm1p is a structural protein that forms part of the largest 60S ribosomal subunit, which does not exist in a pool of free proteins. SSM1 a is duplicated. The second gene copy, SSM1b, is functional and codes for an identical and functionally interchangeable Ssm1p protein. In wild-type cells, SSM1b transcripts accumulate to twice the level of SSM1a transcripts, suggesting that SSM1b is responsible for the majority of the Ssm1p pool. Haploid cells lacking both SSM1 genes are inviable, demonstrating that, in contrast with its Escherichia coli homolog, Ssm1p is an essential ribosomal protein. Deletion of the most expressed SSM1b gene leads to a severe decrease in the level of SSM1 transcript, associated with a reduced growth rate. Polysome profile analysis suggests that the primary defect caused by the depletion in Ssm1p is at the level of translation initiation.

  5. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  6. An Epstein-Barr Virus-Encoded Protein Complex Requires an Origin of Lytic Replication In Cis to Mediate Late Gene Transcription.

    Science.gov (United States)

    Djavadian, Reza; Chiu, Ya-Fang; Johannsen, Eric

    2016-06-01

    Epstein-Barr virus lytic replication is accomplished by an intricate cascade of gene expression that integrates viral DNA replication and structural protein synthesis. Most genes encoding structural proteins exhibit "true" late kinetics-their expression is strictly dependent on lytic DNA replication. Recently, the EBV BcRF1 gene was reported to encode a TATA box binding protein homolog, which preferentially recognizes the TATT sequence found in true late gene promoters. BcRF1 is one of seven EBV genes with homologs found in other β- and γ-, but not in α-herpesviruses. Using EBV BACmids, we systematically disrupted each of these "βγ" genes. We found that six of them, including BcRF1, exhibited an identical phenotype: intact viral DNA replication with loss of late gene expression. The proteins encoded by these six genes have been found by other investigators to form a viral protein complex that is essential for activation of TATT-containing reporters in EBV-negative 293 cells. Unexpectedly, in EBV infected 293 cells, we found that TATT reporter activation was weak and non-specific unless an EBV origin of lytic replication (OriLyt) was present in cis. Using two different replication-defective EBV genomes, we demonstrated that OriLyt-mediated DNA replication is required in cis for TATT reporter activation and for late gene expression from the EBV genome. We further demonstrate by fluorescence in situ hybridization that the late BcLF1 mRNA localizes to EBV DNA replication factories. These findings support a model in which EBV true late genes are only transcribed from newly replicated viral genomes.

  7. Characterisation of genes encoding key enzymes involved in sugar metabolism of apple fruit in controlled atmosphere storage.

    Science.gov (United States)

    Zhu, Zhu; Liu, Ruiling; Li, Boqiang; Tian, Shiping

    2013-12-15

    Sugars are essential contributors to fruit flavour. Controlled atmosphere (CA) storage has been proved to be beneficial for maintaining harvested fruit quality. To explore regulatory mechanism of sugar metabolism in fruit stored in CA condition, we cloned several genes, encoding key enzymes, involved in sugar metabolism in apple fruit, and analyzed sugar contents, along with gene expression and enzyme activities in fruits stored in air and CA. The results indicated that CA could maintain higher contents of sugars, including sucrose, fructose and glucose. Expression levels of key genes, such as sucrose synthase (SS), sucrose phosphate synthase (SPS), fructokinase (FK) and hexokinase (HK), were shown to be correlated with the corresponding enzyme activities. We found that activities of neutral invertase (NI), vacuolar invertase (VI), FK and HK were inhibited, but SPS activity was promoted in apple fruit stored in CA, suggesting that CA storage could enhance sucrose synthesis and delay hydrolysis of sucrose and hexose. These findings provided molecular evidence to explain why higher sugar levels in harvested fruit are maintained under CA storage. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  9. Characterisation and expression of a gene encoding a mutarotase from the fungus Rhizopus nigricans.

    Science.gov (United States)

    Vilfan, Tanja; Cresnar, Bronislava; Fournier, Didier; Stojan, Jure; Breskvar, Katja

    2004-06-01

    A gene coding for a mutarotase was isolated and characterised from the filamentous fungus Rhizopus nigricans. In order to determine the encoded enzyme's activity a recombinant protein was prepared in the baculovirus expression system and the mutarotase activity was determined. Expression studies showed that the gene is repressed by high as well as low concentrations of glucose and derepressed during deficiency of glucose. Besides the regulation at the level of transcription, an accelerative effect of glucose in growth medium on the mutarotase mRNA decay was also demonstrated. Moreover, a Southern hybridisation performed at lower temperatures suggested that the R. nigricans genome harbours a nucleotide sequence, that is homologous to the isolated gene.

  10. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    Energy Technology Data Exchange (ETDEWEB)

    Crozet, F.; El Amraoui, Z.; Blanchard, S. [Institut Pasteur, Paris (France)] [and others

    1997-03-01

    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  11. Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Shan Goh

    Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

  12. Identification of three genes encoding microsomal oleate desaturases (FAD2) from the oilseed crop Camelina sativa.

    Science.gov (United States)

    Kang, Jinling; Snapp, Anna R; Lu, Chaofu

    2011-02-01

    Camelina sativa is a re-emerging low-input oilseed crop that may provide economical vegetable oils for industrial applications. It is desirable to increase the monounsaturated oleic acid (cis-9-octadecenoic acid, 18:1), and to decrease polyunsaturated fatty acids (PUFA), linoleic (cis, cis-9,12-octadecadienoic acid, 18:2) and α-linolenic (all-cis-9,12,15-octadecatrienoic acid, 18:3) acids, in camelina oils to improve oxidative stability. 18:1 desaturation is mainly controlled by the microsomal oleate desaturase (FAD2; EC 1.3.1.35) encoded by the FAD2 gene. Three FAD2 genes, designated CsFAD2-1 to 3, were identified in camelina. Functional expression of these genes in yeast confirmed that they all encode microsomal oleate desaturases. Although the three CsFAD2 genes share very high sequence similarity, they showed different expression patterns. Expression of CsFAD2-1 was detected in all tissues examined, including developing seed, flower, as well as in vegetable tissues such as leaf, root, and stem. Transcripts of CsFAD2-2 and CsFAD2-3 were mainly detected in developing seeds, suggesting their major roles in storage oil desaturation in seed. The introns of the three CsFAD2 genes, which showed greater sequence variations, may provide additional resources for designing molecular markers in breeding. Furthermore, the roles of CsFAD2 in PUFA synthesis were demonstrated by mutant analysis and by antisense gene expression in camelina seed. Published by Elsevier Masson SAS.

  13. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding "...

  14. Predicting Essential Genes and Proteins Based on Machine Learning and Network Topological Features: A Comprehensive Review

    Science.gov (United States)

    Zhang, Xue; Acencio, Marcio Luis; Lemke, Ney

    2016-01-01

    Essential proteins/genes are indispensable to the survival or reproduction of an organism, and the deletion of such essential proteins will result in lethality or infertility. The identification of essential genes is very important not only for understanding the minimal requirements for survival of an organism, but also for finding human disease genes and new drug targets. Experimental methods for identifying essential genes are costly, time-consuming, and laborious. With the accumulation of sequenced genomes data and high-throughput experimental data, many computational methods for identifying essential proteins are proposed, which are useful complements to experimental methods. In this review, we show the state-of-the-art methods for identifying essential genes and proteins based on machine learning and network topological features, point out the progress and limitations of current methods, and discuss the challenges and directions for further research. PMID:27014079

  15. Predicting Essential Genes and Proteins Based on Machine Learning and Network Topological Features: A Comprehensive Review.

    Science.gov (United States)

    Zhang, Xue; Acencio, Marcio Luis; Lemke, Ney

    2016-01-01

    Essential proteins/genes are indispensable to the survival or reproduction of an organism, and the deletion of such essential proteins will result in lethality or infertility. The identification of essential genes is very important not only for understanding the minimal requirements for survival of an organism, but also for finding human disease genes and new drug targets. Experimental methods for identifying essential genes are costly, time-consuming, and laborious. With the accumulation of sequenced genomes data and high-throughput experimental data, many computational methods for identifying essential proteins are proposed, which are useful complements to experimental methods. In this review, we show the state-of-the-art methods for identifying essential genes and proteins based on machine learning and network topological features, point out the progress and limitations of current methods, and discuss the challenges and directions for further research.

  16. Proanthocyanidin Synthesis and Expression of Genes Encoding Leucoanthocyanidin Reductase and Anthocyanidin Reductase in Developing Grape Berries and Grapevine Leaves

    National Research Council Canada - National Science Library

    Jochen Bogs; Mark O. Downey; John S. Harvey; Anthony R. Ashton; Gregory J. Tanner; Simon P. Robinson

    2005-01-01

    .... We measured PA content and expression of genes encoding ANR, LAR, and leucoanthocyanidin dioxygenase in grape berries during development and in grapevine leaves, which accumulated PA throughout leaf expansion...

  17. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  18. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  19. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  1. Role of sequence encoded κB DNA geometry in gene regulation by Dorsal

    Science.gov (United States)

    Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda

    2011-01-01

    Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896

  2. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Science.gov (United States)

    Roedder, Silke; Sigdel, Tara; Hsieh, Szu-Chuan; Cheeseman, Jennifer; Metes, Diana; Macedo, Camila; Reed, Elaine F.; Gritsch, H. A.; Zeevi, Adriana; Shapiro, Ron; Kirk, Allan D.; Sarwal, Minnie M.

    2017-01-01

    Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR) still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB) samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (21 years) renal allograft recipients at the point of AR (n = 61) and absence of rejection (n = 94) for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection). Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression. PMID:29164120

  3. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  4. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  5. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  6. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  7. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport.

    Science.gov (United States)

    López-Errasquín, Elena; González-Jaén, M Teresa; Callejas, Carmen; Vázquez, Covadonga

    2006-09-01

    The major facilitator superfamily (MFS) is a ubiquitous group of proteins involved in the transport of a wide range of compounds, including toxins produced by fungal species. In this paper, a novel MFS encoding gene (Fusarium iron related gene or FIR1), which had shown an up-regulation in fumonisin-inducing conditions, has been identified and characterized. The deduced protein sequence, which predicted 14 transmembrane domains typical of MFS transporters and its phylogenetic relationships with representative members of MFS transporters suggested a possible function of FIR1 as a siderophore transporter. A real-time RT-PCR protocol has been developed to analyse the expression pattern of the FIR1 gene in relation to siderophore production. The results indicated that the synthesis of extracellular siderophores by F. verticillioides observed in absence of extracellular iron was repressed in iron-supplemented cultures and showed a good correspondence with FIR1 gene expression. However, the pattern of FIR1 gene expression observed suggested that this gene did not seem to be functionally related to fumonisin production.

  8. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Expression and characteristics of the gene encoding azoreductase from Rhodobacter sphaeroides AS1.1737.

    Science.gov (United States)

    Bin, Yan; Jiti, Zhou; Jing, Wang; Cuihong, Du; Hongman, Hou; Zhiyong, Song; Yongming, Bao

    2004-07-01

    A gene that encodes a protein with azoreductase activity was obtained by PCR amplification from Rhodobacter sphaeroides AS1.1737. The enzyme, with a molecular weight of 18.7 kD, was heterologously expressed in Escherichia coli and its azoreductase activity was characterized. Furthermore, the reduction mechanism of azo dyes catalyzed by the azoreductase was studied in detail. The presence of a hydrazo-intermediate was identified, which provided a convincing evidence for the assumption that azo dyes were degraded via an incomplete reduction stage.

  10. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    OpenAIRE

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any addit...

  11. Leuconostoc lactis beta-galactosidase is encoded by two overlapping genes.

    OpenAIRE

    David, S; Stevens, H.; van Riel, M.; Simons, G; de Vos, W M

    1992-01-01

    A 16-kb BamHI fragment of the lactose plasmid pNZ63 from Leuconostoc lactis NZ6009 was cloned in Escherichia coli MC1061 by using pACYC184 and was found to express a functional beta-galactosidase. Deletion and complementation analysis showed that the coding region for beta-galactosidase was located on a 5.8-kb SalI-BamHI fragment. Nucleotide sequence analysis demonstrated that this fragment contained two partially overlapping genes, lacL (1,878 bp) and lacM (963 bp), that could encode protein...

  12. Transfer and expression of the gene encoding a human myeloid membrane antigen (gp150).

    Science.gov (United States)

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Rettenmier, C W; Sherr, C J

    1985-02-01

    DNA from the human myeloid cell line HL-60 was cotransfected with the cloned thymidine kinase (tk) gene of herpes simplex virus into tk-deficient mouse L cells. tk-positive recipients expressing antigens detected on HL-60 cells were isolated with a fluorescence-activated cell sorter by use of a panel of monoclonal antibodies that detect epitopes on both normal and malignant myeloid cells. Independently sorted populations of transformed mouse cells showed concordant reactivities with four of the monoclonal antibodies in the panel (DU-HL60-4, MY7, MCS.2, and SJ-D1), which suggested that these antibodies reacted to products of a single human gene. A second round of DNA transfection and cell sorting was performed with donor DNA from primary transformants. Two different dominant selection systems were used to isolate secondary mouse L cell and NIH/3T3 cell transformants that coexpressed the same epitopes. Analysis of cellular DNA from secondary mouse cell subclones with a probe specific for human repetitive DNA sequences revealed a minimal human DNA complement containing a characteristic set of restriction fragments common to independently derived subclones. Two glycoproteins, of 130,000 (gp130) and 150,000 (gp150) mol wt, were specifically immunoprecipitated from metabolically labeled lysates of mouse cell transformants and were shown to contain [35S]methionine-labeled tryptic peptides identical to those of analogous glycoproteins expressed in the donor human myeloid cell line. Kinetic and biochemical analyses established that gp130 is a precursor that differs in its carbohydrate moiety from gp150, the mature form of the glycoprotein detected on the cell surface. The isolation of human gene sequences encoding gp150 in a mouse cell genetic background provides the possibility of molecularly cloning the gene and represents a general strategy for isolating human genes encoding differentiation-specific cell surface antigens.

  13. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  14. Genes encoding proteoglycans are associated with the risk of anterior cruciate ligament ruptures.

    Science.gov (United States)

    Mannion, Sasha; Mtintsilana, Asanda; Posthumus, Michael; van der Merwe, Willem; Hobbs, Hayden; Collins, Malcolm; September, Alison V

    2014-12-01

    Genetic variants within genes involved in fibrillogenesis have previously been implicated in anterior cruciate ligament (ACL) injury susceptibility. Proteoglycans also have important functions in fibrillogenesis and maintaining the structural integrity of ligaments. Genes encoding proteoglycans are plausible candidates to be investigated for associations with ACL injury susceptibility; polymorphisms within genes encoding the proteoglycans aggrecan (ACAN), biglycan (BGN), decorin (DCN), fibromodulin (FMOD) and lumican (LUM) were examined. A case-control genetic association study was conducted. 227 participants with surgically diagnosed ACL ruptures (ACL group) and 234 controls without any history of ACL injury were genotyped for 10 polymorphisms in 5 proteoglycan genes. Inferred haplotypes were constructed for specific regions. The G allele of ACAN rs1516797 was significantly under-represented in the controls (p=0.024; OR=0.72; 95% CI 0.55 to 0.96) compared with the ACL group. For DCN rs516115, the GG genotype was significantly over-represented in female controls (p=0.015; OR=9.231; 95%CI 1.16 to 73.01) compared with the ACL group and the AA genotype was significantly under-represented in controls (p=0.013; OR=0.33; 95% CI 0.14 to 0.78) compared with the female non-contact ACL injury subgroup. Haplotype analyses implicated regions overlapping ACAN (rs2351491 C>T-rs1042631 T>C-rs1516797 T>G), BGN (rs1126499 C>T-rs1042103 G>A) and LUM-DCN (rs2268578 T>C-rs13312816 A>T-rs516115 A>G) in ACL injury susceptibility. These independent associations and haplotype analyses suggest that regions within ACAN, BGN, DCN and a region spanning LUM-DCN are associated with ACL injury susceptibility. Taking into account the functions of these genes, it is reasonable to propose that genetic sequence variability within the genes encoding proteoglycans may potentially modulate the ligament fibril properties. Published by the BMJ Publishing Group Limited. For permission to use (where not

  15. A mutation in the gene encoding mitochondrial Mg²+ channel MRS2 results in demyelination in the rat.

    Directory of Open Access Journals (Sweden)

    Takashi Kuramoto

    2011-01-01

    Full Text Available The rat demyelination (dmy mutation serves as a unique model system to investigate the maintenance of myelin, because it provokes severe myelin breakdown in the central nervous system (CNS after normal postnatal completion of myelination. Here, we report the molecular characterization of this mutation and discuss the possible pathomechanisms underlying demyelination. By positional cloning, we found that a G-to-A transition, 177 bp downstream of exon 3 of the Mrs2 (MRS2 magnesium homeostasis factor (Saccharomyces cerevisiae gene, generated a novel splice acceptor site which resulted in functional inactivation of the mutant allele. Transgenic rescue with wild-type Mrs2-cDNA validated our findings. Mrs2 encodes an essential component of the major Mg²+ influx system in mitochondria of yeast as well as human cells. We showed that the dmy/dmy rats have major mitochondrial deficits with a markedly elevated lactic acid concentration in the cerebrospinal fluid, a 60% reduction in ATP, and increased numbers of mitochondria in the swollen cytoplasm of oligodendrocytes. MRS2-GFP recombinant BAC transgenic rats showed that MRS2 was dominantly expressed in neurons rather than oligodendrocytes and was ultrastructurally observed in the inner membrane of mitochondria. Our observations led to the conclusion that dmy/dmy rats suffer from a mitochondrial disease and that the maintenance of myelin has a different mechanism from its initial production. They also established that Mg²+ homeostasis in CNS mitochondria is essential for the maintenance of myelin.

  16. Hierarchical Control of Nitrite Respiration by Transcription Factors Encoded within Mobile Gene Clusters of Thermus thermophilus.

    Science.gov (United States)

    Alvarez, Laura; Quintáns, Nieves G; Blesa, Alba; Baquedano, Ignacio; Mencía, Mario; Bricio, Carlos; Berenguer, José

    2017-12-01

    Denitrification in Thermus thermophilus is encoded by the nitrate respiration conjugative element (NCE) and nitrite and nitric oxide respiration (nic) gene clusters. A tight coordination of each cluster's expression is required to maximize anaerobic growth, and to avoid toxicity by intermediates, especially nitric oxides (NO). Here, we study the control of the nitrite reductases (Nir) and NO reductases (Nor) upon horizontal acquisition of the NCE and nic clusters by a formerly aerobic host. Expression of the nic promoters PnirS, PnirJ, and PnorC, depends on the oxygen sensor DnrS and on the DnrT protein, both NCE-encoded. NsrR, a nic-encoded transcription factor with an iron-sulfur cluster, is also involved in Nir and Nor control. Deletion of nsrR decreased PnorC and PnirJ transcription, and activated PnirS under denitrification conditions, exhibiting a dual regulatory role never described before for members of the NsrR family. On the basis of these results, a regulatory hierarchy is proposed, in which under anoxia, there is a pre-activation of the nic promoters by DnrS and DnrT, and then NsrR leads to Nor induction and Nir repression, likely as a second stage of regulation that would require NO detection, thus avoiding accumulation of toxic levels of NO. The whole system appears to work in remarkable coordination to function only when the relevant nitrogen species are present inside the cell.

  17. Integrating the genetic and physical maps of Arabidopsis thaliana: identification of mapped alleles of cloned essential (EMB genes.

    Directory of Open Access Journals (Sweden)

    David Meinke

    Full Text Available The classical genetic map of Arabidopsis includes more than 130 genes with an embryo-defective (emb mutant phenotype. Many of these essential genes remain to be cloned. Hundreds of additional EMB genes have been cloned and catalogued (www.seedgenes.org but not mapped. To facilitate EMB gene identification and assess the current level of saturation, we updated the classical map, compared the physical and genetic locations of mapped loci, and performed allelism tests between mapped (but not cloned and cloned (but not mapped emb mutants with similar chromosome locations. Two hundred pairwise combinations of genes located on chromosomes 1 and 5 were tested and more than 1100 total crosses were screened. Sixteen of 51 mapped emb mutants examined were found to be disrupted in a known EMB gene. Alleles of a wide range of published EMB genes (YDA, GLA1, TIL1, AtASP38, AtDEK1, EMB506, DG1, OEP80 were discovered. Two EMS mutants isolated 30 years ago, T-DNA mutants with complex insertion sites, and a mutant with an atypical, embryo-specific phenotype were resolved. The frequency of allelism encountered was consistent with past estimates of 500 to 1000 EMB loci. New EMB genes identified among mapped T-DNA insertion mutants included CHC1, which is required for chromatin remodeling, and SHS1/AtBT1, which encodes a plastidial nucleotide transporter similar to the maize Brittle1 protein required for normal endosperm development. Two classical genetic markers (PY, ALB1 were identified based on similar map locations of known genes required for thiamine (THIC and chlorophyll (PDE166 biosynthesis. The alignment of genetic and physical maps presented here should facilitate the continued analysis of essential genes in Arabidopsis and further characterization of a broad spectrum of mutant phenotypes in a model plant.

  18. Modeling the fitness consequences of a cyanophage-encoded photosynthesis gene.

    Directory of Open Access Journals (Sweden)

    Jason G Bragg

    Full Text Available BACKGROUND: Phages infecting marine picocyanobacteria often carry a psbA gene, which encodes a homolog to the photosynthetic reaction center protein, D1. Host encoded D1 decays during phage infection in the light. Phage encoded D1 may help to maintain photosynthesis during the lytic cycle, which in turn could bolster the production of deoxynucleoside triphosphates (dNTPs for phage genome replication. METHODOLOGY/PRINCIPAL FINDINGS: To explore the consequences to a phage of encoding and expressing psbA, we derive a simple model of infection for a cyanophage/host pair--cyanophage P-SSP7 and Prochlorococcus MED4--for which pertinent laboratory data are available. We first use the model to describe phage genome replication and the kinetics of psbA expression by host and phage. We then examine the contribution of phage psbA expression to phage genome replication under constant low irradiance (25 microE m(-2 s(-1. We predict that while phage psbA expression could lead to an increase in the number of phage genomes produced during a lytic cycle of between 2.5 and 4.5% (depending on parameter values, this advantage can be nearly negated by the cost of psbA in elongating the phage genome. Under higher irradiance conditions that promote D1 degradation, however, phage psbA confers a greater advantage to phage genome replication. CONCLUSIONS/SIGNIFICANCE: These analyses illustrate how psbA may benefit phage in the dynamic ocean surface mixed layer.

  19. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci

    Directory of Open Access Journals (Sweden)

    N Perumal

    2016-01-01

    Full Text Available The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs and staphylococcal cassette chromosome mec (SCCmec elements among clinical isolates of methicillin-resistant staphylococci (MRS. Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6′-Ie-aph (2′′, aph (3′-IIIa and ant (4′-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6′-Ie-aph (2′′ (55.4% followed by aph (3′-IIIa (32.3% and ant (4′-Ia gene (9%. SCCmec type I (34% was predominant in this study. In conclusion, the aac (6′-Ie-aph (2′′ was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  20. Cloning and analysis of the DNA polymerase-encoding gene from Thermus caldophilus GK24.

    Science.gov (United States)

    Kwon, S T; Kim, J S; Park, J H; Kim, H K; Lee, D S

    1997-04-30

    The gene encoding Thermus caldophilus GK24 (Tca) DNA polymerase was cloned into Escherichia coli using the structural gene coding for Thermus aquaticus YT-1 (Taq) DNA polymerase as a hybridization probe. The nucleotide sequence of the cloned DNA was determined. The primary structure of the Tca DNA polymerase was deduced from the nucleotide sequence. The Tca DNA polymerase comprised 834 amino acid residues and its molecular mass was determined to be 93,810. On alignment of the whole amino acid sequence, Tca DNA polymerase showed a high sequence homology with the E. coli DNA polymerase I-like DNA polymerases, and 86% identity with Taq DNA polymerase, 38% with E. coli and Streptococcus pneumoniae (Spn) DNA polymerase I. An extremely high sequence identity was observed in the region containing the polymerase activity. The codon usage in the Tca DNA polymerase gene was in fact similar to the characteristic usages in the genes for proteins from bacteria of genus Thermus: the G+C content in the third position of the codons was as high as 93%. The Tca DNA polymerase gene was expressed under the control of tac promoter on a high copy plasmid, pTCA in E. coli.

  1. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937.

    Science.gov (United States)

    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N

    1995-06-01

    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease.

  2. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  3. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  4. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  5. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  7. The abnormal spindle-like, microcephaly-associated (ASPM) gene encodes a centrosomal protein.

    Science.gov (United States)

    Zhong, Xueyan; Liu, Limin; Zhao, Ailian; Pfeifer, Gerd P; Xu, Xingzhi

    2005-09-01

    Homozygous mutations in the abnormal spindle-like, microcephaly-associated ASPM gene are the leading cause of autosomal recessive primary microcephaly. ASPM is the putative human ortholog of the Drosophila melanogaster abnormal spindles gene (asp), which is essential for mitotic spindle function. Here, we report that downregulation of endogenous ASPM by siRNA decreases protein levels of endogenous BRCA1. ASPM localizes to the centrosome in interphase and to the spindle poles from prophase through telophase. These findings indicate that ASPM may be involved in mitotic spindle function, possibly, through regulation of BRCA1.

  8. Reconstruction of ancestral gene orders using probabilistic and gene encoding approaches.

    Directory of Open Access Journals (Sweden)

    Ning Yang

    Full Text Available Current tools used in the reconstruction of ancestral gene orders often fall into event-based and adjacency-based methods according to the principles they follow. Event-based methods such as GRAPPA are very accurate but with extremely high complexity, while more recent methods based on gene adjacencies such as InferCARsPro is relatively faster, but often produces an excessive number of chromosomes. This issue is mitigated by newer methods such as GapAdj, however it sacrifices a considerable portion of accuracy. We recently developed an adjacency-based method in the probabilistic framework called PMAG to infer ancestral gene orders. PMAG relies on calculating the conditional probabilities of gene adjacencies that are found in the leaf genomes using the Bayes' theorem. It uses a novel transition model which accounts for adjacency changes along the tree branches as well as a re-rooting procedure to prevent any information loss. In this paper, we improved PMAG with a new method to assemble gene adjacencies into valid gene orders, using an exact solver for traveling salesman problem (TSP to maximize the overall conditional probabilities. We conducted a series of simulation experiments using a wide range of configurations. The first set of experiments was to verify the effectiveness of our strategy of using the better transition model and re-rooting the tree under the targeted ancestral genome. PMAG was then thoroughly compared in terms of three measurements with its four major competitors including InferCARsPro, GapAdj, GASTS and SCJ in order to assess their performances. According to the results, PMAG demonstrates superior performance in terms of adjacency, distance and assembly accuracies, and yet achieves comparable running time, even all TSP instances were solved exactly. PMAG is available for free at http://phylo.cse.sc.edu.

  9. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    Directory of Open Access Journals (Sweden)

    Brandi L Gancarz

    Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  10. Variants within the 5'-flanking regions of bovine milk-protein-encoding genes. III. Genes encoding the Ca-sensitive caseins αs1, α s2 and β.

    Science.gov (United States)

    Schild, T A; Geldermann, H

    1996-10-01

    The 5'-flanking regions of the Ca-sensitive casein-encoding gene family were analysed for DNA variants by automated DNA sequencing of 13 cows belonging to seven breeds. About 1 kbp of each 5'-flanking region, including non-coding exon I, was amplified by PCR and sequenced bidirectionally. A total number of 34 variable sites (17 for the α s1, 10 for the α s2, and 7 for the β casein encoding gene) was identified. Variants were computer-analysed for location in putative regulatory sites in order to predict potential influences on gene expression.

  11. Essential roles for imuA′- and imuB-encoded accessory factors in DnaE2-dependent mutagenesis in Mycobacterium tuberculosis

    OpenAIRE

    Warner, Digby F.; Ndwandwe, Duduzile E.; Abrahams, Garth L.; Kana, Bavesh D.; Machowski, Edith E.; Venclovas, Česlovas; Mizrahi, Valerie

    2010-01-01

    In Mycobacterium tuberculosis (Mtb), damage-induced mutagenesis is dependent on the C-family DNA polymerase, DnaE2. Included with dnaE2 in the Mtb SOS regulon is a putative operon comprising Rv3395c, which encodes a protein of unknown function restricted primarily to actinomycetes, and Rv3394c, which is predicted to encode a Y-family DNA polymerase. These genes were previously identified as components of an imuA-imuB-dnaE2–type mutagenic cassette widespread among bacterial genomes. Here, we c...

  12. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  13. PAS3, a Saccharomyces cerevisiae Gene Encoding a Peroxisomal Integral Membrane Protein Essential for Peroxisome Biogenesis

    NARCIS (Netherlands)

    Höhfeld, Jörg; Veenhuis, Marten; Kunau, Wolf-H.

    Saccharomyces cerevisiae pas3-mutants are described which conform the pas-phenotype recently reported for the peroxisomal assembly mutants pas1-1 and pas2 (Erdmann, R., M. Veenhuis, D. Mertens, and W.-H Kunau. 1989. Proc. Natl. Acad. Sci. USA. 86:5419-5423). The isolation of pas3-mutants enabled us

  14. TSHZ1-dependent gene regulation is essential for olfactory bulb development and olfaction.

    Science.gov (United States)

    Ragancokova, Daniela; Rocca, Elena; Oonk, Anne M M; Schulz, Herbert; Rohde, Elvira; Bednarsch, Jan; Feenstra, Ilse; Pennings, Ronald J E; Wende, Hagen; Garratt, Alistair N

    2014-03-01

    The olfactory bulb (OB) receives odor information from the olfactory epithelium and relays this to the olfactory cortex. Using a mouse model, we found that development and maturation of OB interneurons depends on the zinc finger homeodomain factor teashirt zinc finger family member 1 (TSHZ1). In mice lacking TSHZ1, neuroblasts exhibited a normal tangential migration to the OB; however, upon arrival to the OB, the neuroblasts were distributed aberrantly within the radial dimension, and many immature neuroblasts failed to exit the rostral migratory stream. Conditional deletion of Tshz1 in mice resulted in OB hypoplasia and severe olfactory deficits. We therefore investigated olfaction in human subjects from families with congenital aural atresia that were heterozygous for TSHZ1 loss-of-function mutations. These individuals displayed hyposmia, which is characterized by impaired odor discrimination and reduced olfactory sensitivity. Microarray analysis, in situ hybridization, and ChIP revealed that TSHZ1 bound to and regulated expression of the gene encoding prokineticin receptor 2 (PROKR2), a G protein–coupled receptor essential for OB development. Mutations in PROKR2 lead to Kallmann syndrome, characterized by anosmia and hypogonadotrophic hypogonadism. Our data indicate that TSHZ1 is a key regulator of mammalian OB development and function and controls the expression of molecules involved in human Kallmann syndrome.

  15. Generating a knockdown transgene against Drosophila heterochromatic Tim17b gene encoding mitochondrial translocase subunit.

    Directory of Open Access Journals (Sweden)

    Mikael Garabedian

    Full Text Available Heterochromatic regions of eukaryotic genomes contain multiple functional elements involved in chromosomal dynamics, as well as multiple housekeeping genes. Cytological and molecular peculiarities of heterochromatic loci complicate genetic studies based on standard approaches developed using euchromatic genes. Here, we report the development of an RNAi-based knockdown transgenic construct and red fluorescent reporter transgene for a small gene, Tim17b, which localizes in constitutive heterochromatin of Drosophila melanogaster third chromosome and encodes a mitochondrial translocase subunit. We demonstrate that Tim17b protein is required strictly for protein delivery to mitochondrial matrix. Knockdown of Tim17b completely disrupts functions of the mitochondrial translocase complex. Using fluorescent recovery after photobleaching assay, we show that Tim17b protein has a very stable localization in the membranes of the mitochondrial network and that its exchange rate is close to zero when compared with soluble proteins of mitochondrial matrix. These results confirm that we have developed comprehensive tools to study functions of heterochromatic Tim17b gene.

  16. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis.

    Science.gov (United States)

    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes

    2015-10-01

    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  17. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans.

    Science.gov (United States)

    Cernila, Bostjan; Cresnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress.

  18. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  19. NECC1, a candidate choriocarcinoma suppressor gene that encodes a homeodomain consensus motif.

    Science.gov (United States)

    Asanoma, Kazuo; Matsuda, Takao; Kondo, Haruhiko; Kato, Kiyoko; Kishino, Tatsuya; Niikawa, Norio; Wake, Norio; Kato, Hidenori

    2003-01-01

    We isolated a candidate choriocarcinoma suppressor gene from a PCR-based subtracted fragmentary cDNA library between normal placental villi and the choriocarcinoma cell line CC1. This gene comprises an open reading frame of 219 nt encoding 73 amino acids and contains a homeodomain as a consensus motif. This gene, designated NECC1 (not expressed in choriocarcinoma clone 1), is located on human chromosome 4q11-q12. NECC1 expression is ubiquitous in the brain, placenta, lung, smooth muscle, uterus, bladder, kidney, and spleen. Normal placental villi expressed NECC1, but all choriocarcinoma cell lines examined and most of the surgically removed choriocarcinoma tissue samples failed to express it. We transfected this gene into choriocarcinoma cell lines and observed remarkable alterations in cell morphology and suppression of in vivo tumorigenesis. Induction of CSH1 (chorionic somatomammotropin hormone 1) by NECC1 expression suggested differentiation of choriocarcinoma cells to syncytiotrophoblasts. Our results suggest that loss of NECC1 expression is involved in malignant conversion of placental trophoblasts.

  20. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  1. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  2. The orphan G-protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in lymphoid and neural tissues.

    Science.gov (United States)

    Raport, C J; Schweickart, V L; Eddy, R L; Shows, T B; Gray, P W

    1995-10-03

    A polymerase chain reaction (PCR) strategy with degenerate primers was used to identify novel G-protein-coupled receptor-encoding genes from human genomic DNA. One of the isolated clones, termed V28, showed high sequence similarity to the genes encoding human chemokine receptors for monocyte chemoattractant protein 1 (MCP-1) and macrophage inflammatory protein 1 alpha (MIP-1 alpha)/RANTES, and to the rat orphan receptor-encoding gene RBS11. When RNA was analyzed by Northern blot, V28 was found to be most highly expressed in neural and lymphoid tissues. Myeloid cell lines, particularly THP.1 cells, showed especially high expression of V28. We have mapped V28 to human chromosome 3p21-3pter, near the MIP-1 alpha/RANTES receptor-encoding gene.

  3. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  4. Construction of four double gene substitution human x bovine rotavirus reassortant vaccine candidates: each bears two outer capsid human rotavirus genes, one encoding P serotype 1A and the other encoding G serotype 1, 2, 3, or 4 specificity.

    Science.gov (United States)

    Hoshino, Y; Jones, R W; Chanock, R M; Kapikian, A Z

    1997-04-01

    Previously, four human x bovine rotavirus reassortant candidate vaccines, each of which derived ten genes from bovine rotavirus UK strain and only the outer capsid protein VP7-gene from human rotavirus strain D (G serotype 1), DS-1 (G serotype 2), P (G serotype 3), or ST3 (G serotype 4), were developed [Midthun et al., (1985): Journal of Virology 53:949-954; (1986): Journal of Clinical Microbiology 24:822-826]. Such human x bovine reassortant vaccines should theoretically provide antigenic coverage for the four epidemiologically most important VP7(G) serotypes 1, 2, 3, and 4. In an attempt to increase the antigenicity of VP7-based human x animal reassortant rotavirus vaccines which derive a single VP7-encoding gene from the human strain and the remaining ten genes from the animal strain, we generated double gene substitution reassortants. This was done by incorporating another protective antigen (VP4) of an epidemiologically important human rotavirus by crossing human rotavirus Wa strain (P serotype 1A), with each of the human x bovine single VP7-gene substitution rotavirus reassortants. In this way four separate double gene substitution rotavirus reassortants were generated. Each of these reassortants bears the VP4-encoding gene from human rotavirus Wa strain, the VP7-encoding gene from human rotavirus strain D, DS-1, P, or ST3, and the remaining nine genes from bovine rotavirus strain UK. The safety, antigenicity, and protective efficacy of individual components as well as combinations of strains are currently under evaluation.

  5. From mouse to human: evolutionary genomics analysis of human orthologs of essential genes.

    Directory of Open Access Journals (Sweden)

    Benjamin Georgi

    2013-05-01

    Full Text Available Understanding the core set of genes that are necessary for basic developmental functions is one of the central goals in biology. Studies in model organisms identified a significant fraction of essential genes through the analysis of null-mutations that lead to lethality. Recent large-scale next-generation sequencing efforts have provided unprecedented data on genetic variation in human. However, evolutionary and genomic characteristics of human essential genes have never been directly studied on a genome-wide scale. Here we use detailed phenotypic resources available for the mouse and deep genomics sequencing data from human populations to characterize patterns of genetic variation and mutational burden in a set of 2,472 human orthologs of known essential genes in the mouse. Consistent with the action of strong, purifying selection, these genes exhibit comparatively reduced levels of sequence variation, skew in allele frequency towards more rare, and exhibit increased conservation across the primate and rodent lineages relative to the remainder of genes in the genome. In individual genomes we observed ~12 rare mutations within essential genes predicted to be damaging. Consistent with the hypothesis that mutations in essential genes are risk factors for neurodevelopmental disease, we show that de novo variants in patients with Autism Spectrum Disorder are more likely to occur in this collection of genes. While incomplete, our set of human orthologs shows characteristics fully consistent with essential function in human and thus provides a resource to inform and facilitate interpretation of sequence data in studies of human disease.

  6. E-selectin gene in essential hypertension: a case-control study.

    Science.gov (United States)

    Srivastava, Kamna; Chandra, Sudhir; Narang, Rajiv; Bhatia, Jagriti; Saluja, Daman

    2018-01-01

    Hypertension is associated with endothelial cell dysfunction. E-selectin, an endothelial cell adhesion molecule, is specific for endothelial cell activation. Polymorphism in E-selectin gene has recently been identified among which Leu554Phe E-selectin gene polymorphism is least investigated in essential hypertension. This study reports the association of E-selectin gene Leu554Phe polymorphism and the expression of E-selectin gene in patients with essential hypertension. We analysed the Leu554Phe polymorphism and expression of E-selectin gene in 250 patients with essential hypertension and 250 normal healthy controls. Genotyping of Leu554Phe polymorphism was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), and the expression of E-selectin gene at mRNA and protein levels were carried out by real-time PCR and Western blot, respectively. A significant association of E-selectin genotypes (CT + TT) with essential hypertension (P E-selectin gene in patients with essential hypertension was ~12-fold higher as compared to control. We observed an elevated level of E-selectin protein expression (up to 1.9 times) in patients as compared to controls. A significant association of E-selectin (Leu554Phe) gene and increased expression of E-selectin gene at mRNA and protein levels in patients might be related to the genetic predisposition to develop essential hypertension. © 2017 Stichting European Society for Clinical Investigation Journal Foundation.

  7. Zebrafish yolk-specific not really started (nrs) gene is a vertebrate homolog of the Drosophila spinster gene and is essential for embryogenesis.

    Science.gov (United States)

    Young, Rodrigo M; Marty, Scott; Nakano, Yoshiro; Wang, Han; Yamamoto, Daisuke; Lin, Shuo; Allende, Miguel L

    2002-03-01

    By using retroviral insertional mutagenesis in zebrafish, we have identified a recessive lethal mutation in the not really started (nrs) gene. The nrs mutation disrupts a gene located in linkage group 3 that is highly homologous to the spinster gene identified in Drosophila and to spinster orthologs identified in mammals. In flies, spinster encodes a membrane protein involved in lysosomal metabolism and programmed cell death in the central nervous system and in the ovary. In nrs mutant fish embryos, we detect an opaque substance in the posterior yolk cell extension at approximately 1 day after fertilization. This material progressively accumulates and by 48 hr after fertilization fills the entire yolk. By day 3 of embryogenesis, mutant embryos are severely reduced in size compared with their wild-type siblings and they die a few hours later. By in situ hybridization, we show that the nrs mRNA is expressed in the yolk cell at the time the mutant phenotype becomes apparent. In wild-type embryos, nrs message is present maternally and zygotically throughout embryogenesis and is also detected in adult animals. In nrs homozygous mutant embryos, nrs transcripts are undetectable at the time the phenotype becomes apparent, indicating that the retroviral insertion has most likely abolished expression of the nrs gene. Finally, the nrs phenotype can be partially rescued by microinjection of nrs encoding DNA. These results suggest that the nrs mutation affects an essential gene encoding a putative membrane-bound protein expressed specifically in the yolk cell during zebrafish embryogenesis. Copyright 2002 Wiley-Liss, Inc.

  8. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    Energy Technology Data Exchange (ETDEWEB)

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J. [Univ. Hospital, Utrecht (Netherlands)] [and others

    1995-08-01

    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryotic expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.

  9. Virulence plasmid of Rhodococcus equi contains inducible gene family encoding secreted proteins.

    Science.gov (United States)

    Byrne, B A; Prescott, J F; Palmer, G H; Takai, S; Nicholson, V M; Alperin, D C; Hines, S A

    2001-02-01

    Rhodococcus equi causes severe pyogranulomatous pneumonia in foals. This facultative intracellular pathogen produces similar lesions in immunocompromised humans, particularly in AIDS patients. Virulent strains of R. equi bear a large plasmid that is required for intracellular survival within macrophages and for virulence in foals and mice. Only two plasmid-encoded proteins have been described previously; a 15- to 17-kDa surface protein designated virulence-associated protein A (VapA) and an antigenically related 20-kDa protein (herein designated VapB). These two proteins are not expressed by the same R. equi isolate. We describe here the substantial similarity between VapA and VapB. Moreover, we identify three additional genes carried on the virulence plasmid, vapC, -D, and -E, that are tandemly arranged downstream of vapA. These new genes are members of a gene family and encode proteins that are approximately 50% homologous to VapA, VapB, and each other. vapC, -D, and -E are found only in R. equi strains that express VapA and are highly conserved in VapA-positive isolates from both horses and humans. VapC, -D, and -E are secreted proteins coordinately regulated by temperature with VapA; the proteins are expressed when R. equi is cultured at 37 degrees C but not at 30 degrees C, a finding that is compatible with a role in virulence. As secreted proteins, VapC, -D, and -E may represent targets for the prevention of rhodococcal pneumonia. An immunologic study using VapA-specific antibodies and recombinant Vap proteins revealed no evidence of cross-reactivity despite extensive sequence similarity over the carboxy terminus of all four proteins.

  10. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  11. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  12. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  13. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    Science.gov (United States)

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-09-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  14. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    OpenAIRE

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-01-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  15. Pseudomonas aeruginosa LysR PA4203 regulator NmoR acts as a repressor of the PA4202 nmoA gene, encoding a nitronate monooxygenase

    DEFF Research Database (Denmark)

    Vercammen, Ken; Wei, Qing; Charlier, Daniel

    2015-01-01

    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic...... gene, encoding a quinone oxidoreductase, was the most highly upregulated gene in the nmoR deletion mutant, independently of MexT. Finally, deletion of the nmoA gene resulted in an increased sensitivity of the cells to 3-nitropropionic acid (3-NPA), confirming the role of the nitronate monooxygenase...

  16. High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae.

    Science.gov (United States)

    Liu, Xue; Gallay, Clement; Kjos, Morten; Domenech, Arnau; Slager, Jelle; van Kessel, Sebastiaan P; Knoops, Kèvin; Sorg, Robin A; Zhang, Jing-Ren; Veening, Jan-Willem

    2017-05-10

    Genome-wide screens have discovered a large set of essential genes in the opportunistic human pathogen Streptococcus pneumoniae However, the functions of many essential genes are still unknown, hampering vaccine development and drug discovery. Based on results from transposon sequencing (Tn-seq), we refined the list of essential genes in S. pneumoniae serotype 2 strain D39. Next, we created a knockdown library targeting 348 potentially essential genes by CRISPR interference (CRISPRi) and show a growth phenotype for 254 of them (73%). Using high-content microscopy screening, we searched for essential genes of unknown function with clear phenotypes in cell morphology upon CRISPRi-based depletion. We show that SPD_1416 and SPD_1417 (renamed to MurT and GatD, respectively) are essential for peptidoglycan synthesis, and that SPD_1198 and SPD_1197 (renamed to TarP and TarQ, respectively) are responsible for the polymerization of teichoic acid (TA) precursors. This knowledge enabled us to reconstruct the unique pneumococcal TA biosynthetic pathway. CRISPRi was also employed to unravel the role of the essential Clp-proteolytic system in regulation of competence development, and we show that ClpX is the essential ATPase responsible for ClpP-dependent repression of competence. The CRISPRi library provides a valuable tool for characterization of pneumococcal genes and pathways and revealed several promising antibiotic targets. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  17. Renin angiotensinogen system gene polymorphisms and essential hypertension among people of West African descent

    DEFF Research Database (Denmark)

    Reiter, L M; Christensen, D L; Gjesing, A P

    2016-01-01

    This systematic review investigates the high level of hypertension found among urban dwellers in West Africa and in the West African Diaspora in the Americas in relation to variants within the genes encoding the renin angiotensinogen system. For comparison, the results from the Caucasian populati......This systematic review investigates the high level of hypertension found among urban dwellers in West Africa and in the West African Diaspora in the Americas in relation to variants within the genes encoding the renin angiotensinogen system. For comparison, the results from the Caucasian...

  18. The clp1 gene of the mushroom Coprinus cinereus is essential for A-regulated sexual development.

    Science.gov (United States)

    Inada, K; Morimoto, Y; Arima, T; Murata, Y; Kamada, T

    2001-01-01

    Sexual development in the mushroom Coprinus cinereus is under the control of the A and B mating-type loci, both of which must be different for a compatible, dikaryotic mycelium to form between two parents. The A genes, encoding proteins with homeodomain motifs, regulate conjugate division of the two nuclei from each mating partner and promote the formation of clamp connections. The latter are hyphal configurations required for the maintenance of the nuclear status in the dikaryotic phase of basidiomycetes. The B genes encode pheromones and pheromone receptors. They regulate the cellular fusions that complete clamp connections during growth, as well as the nuclear migration required for dikaryosis. The AmutBmut strain (326) of C. cinereus, in which both A- and B-regulated pathways are constitutively activated by mutations, produces, without mating, dikaryon-like, fertile hyphae with clamp connections. In this study we isolated and characterized clampless1-1 (clp1-1), a mutation that blocks clamp formation, an essential step in A-regulated sexual development, in the AmutBmut background. A genomic DNA fragment that rescues the clp1-1 mutation was identified by transformations. Sequencing of the genomic DNA, together with RACE experiments, identified an ORF interrupted by one intron, encoding a novel protein of 365 amino acids. The clp1-1 mutant allele carries a deletion of four nucleotides, which is predicted to cause elimination of codon 128 and frameshifts thereafter. The clp1 transcript was normally detected only in the presence of the A protein heterodimer formed when homokaryons with compatible A genes were mated. Forced expression of clp1 by promoter replacements induced clamp development without the need for a compatible A gene combination. These results indicate that expression of clp1 is necessary and sufficient for induction of the A-regulated pathway that leads to clamp development. PMID:11139497

  19. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2015-10-16

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Cloning and expression of putative cytotonic enterotoxin-encoding genes from Aeromonas hydrophila.

    Science.gov (United States)

    Chopra, A K; Pham, R; Houston, C W

    1994-02-11

    A genomic library from a diarrheal isolate, SSU, of Aeromonas hydrophila was constructed in a cosmid vector, pHC79, and in bacteriophage lambda EMBL3. Cell lysates from various Escherichia coli clones containing the recombinant cosmid were examined for their ability to elongate Chinese hamster ovary (CHO) cells, which is a typical enterotoxic response. Based on restriction analysis, a 4.0-kb SalI DNA fragment from one of the clones that exhibited enterotoxic activity was subcloned into a bacteriophage T7 RNA polymerase/promoter hyperexpression system. The cell lysate from this E. coli [pSL24] clone caused CHO cells to elongate and revealed the presence of a major 35-kDa polypeptide by [35S]methionine labeling and sodium dodecyl sulfate (SDS)-polyacrylamide-gel electrophoresis (PAGE). The toxin was biologically heat labile, losing all activity within 20 min at 56 degrees C. In addition, another enterotoxin-producing clone, E. coli[pSBS32], was isolated from cosmid and lambda bacteriophage libraries. We localized this heat-stable (56 degrees C/20 min) enterotoxin to a 4.8-kb SalI-BamHI fragment. Both enterotoxins caused elevation of cyclic adenosine monophosphate (cAMP) in CHO cells. The DNA fragments encoding these enterotoxins did not hybridize with each other. However, a 4.8-kb SalI-BamHI DNA fragment encoding a heat-stable enterotoxin hybridized to a 3.5-kb BamHI DNA fragment of a plasmid, pHPC100, that contained a cytotonic enterotoxin-encoding gene isolated from A. trota. Our data suggest Aeromonas species produce different structural types of cytotonic enterotoxins that are functionally similar.

  1. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...

  2. A fungal conserved gene from the basidiomycete Hebeloma cylindrosporum is essential for efficient ectomycorrhiza formation.

    Science.gov (United States)

    Doré, Jeanne; Marmeisse, Roland; Combier, Jean-Philippe; Gay, Gilles

    2014-10-01

    We used Agrobacterium-mediated insertional mutagenesis to identify genes in the ectomycorrhizal fungus Hebeloma cylindrosporum that are essential for efficient mycorrhiza formation. One of the mutants presented a dramatically reduced ability to form ectomycorrhizas when grown in the presence of Pinus pinaster. It failed to form mycorrhizas in the presence of glucose at 0.5 g liter(-1), a condition favorable for mycorrhiza formation by the wild-type strain. However, it formed few mycorrhizas when glucose was replaced by fructose or when glucose concentration was increased to 1 g liter(-1). Scanning electron microscopy examination of these mycorrhizas revealed that this mutant was unable to differentiate true fungal sheath and Hartig net. Molecular analyses showed that the single-copy disrupting T-DNA was integrated 6,884 bp downstream from the start codon, of an open reading frame potentially encoding a 3,096-amino-acid-long protein. This gene, which we named HcMycE1, has orthologs in numerous fungi as well as different other eukaryotic microorganisms. RNAi inactivation of HcMycE1 in the wild-type strain also led to a mycorrhizal defect, demonstrating that the nonmycorrhizal phenotype of the mutant was due to mutagenic T-DNA integration in HcMycE1. In the wild-type strain colonizing P. pinaster roots, HcMycE1 was transiently upregulated before symbiotic structure differentiation. Together with the inability of the mutant to differentiate these structures, this suggests that HcMycE1 plays a crucial role upstream of the fungal sheath and Hartig net differentiation. This study provides the first characterization of a fungal mutant altered in mycorrhizal ability.

  3. Identification and Functional Analysis of the erh1+ Gene Encoding Enhancer of Rudimentary Homolog from the Fission Yeast Schizosaccharomyces pombe

    Science.gov (United States)

    Krzyzanowski, Marek K.; Kozlowska, Ewa; Kozlowski, Piotr

    2012-01-01

    The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S. japonicus), but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol), inhibiting DNA replication (hydroxyurea), and destabilizing the plasma membrane (SDS); this hypersensitivity can be abolished by expression of S. pombe erh1+ and, to a lesser extent, S. japonicus erh1+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation. PMID:23145069

  4. Identification and functional analysis of the erh1(+ gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Marek K Krzyzanowski

    Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  5. Design and evaluation of novel primers for the detection of genes encoding diverse enzymes of methylotrophy and autotrophy.

    Science.gov (United States)

    Hung, Wei-Lian; Wade, William G; Chen, Yin; Kelly, Donovan P; Wood, Ann P

    2012-01-01

    The phylogenetic significance of the diversity of key enzymes of methylotrophic and autotrophic metabolism is discussed. Primers for these key enzymes were designed using gene sequences encoding methanol dehydrogenase (mxaF; using subsets from database sequences for 22 Bacteria), hydroxypyruvate reductase (hpr; 36 sequences), methylamine dehydrogenase (mauA; 12 sequences), methanesulfonate monooxygenase (msmA; four sequences), and the ccbL and cbbM genes of ribulose bisphosphate carboxylase (26 and 23 sequences). These were effective in amplifying the correct gene products for the target genes in reference organisms and in test organisms not previously shown to contain the genes, as well as in some methylotrophic Proteobacteria isolated from the human mouth. The availability of the new primers increases the probability of detecting diverse examples of the genes encoding these key enzymes both in natural populations and in isolated bacterial strains.

  6. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  7. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  8. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  9. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  10. Mutations Affecting Light Regulation of Nuclear Genes Encoding Chloroplast Glyceraldehyde-3-Phosphate Dehydrogenase in Arabidopsis1

    Science.gov (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che

    2002-01-01

    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome. PMID:12428012

  11. Mutations affecting light regulation of nuclear genes encoding chloroplast glyceraldehyde-3-phosphate dehydrogenase in Arabidopsis.

    Science.gov (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che

    2002-11-01

    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome.

  12. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  13. Analysis of a polygalacturonase gene of Ustilago maydis and characterization of the encoded enzyme.

    Science.gov (United States)

    Castruita-Domínguez, José P; González-Hernández, Sandra E; Polaina, Julio; Flores-Villavicencio, Lérida L; Alvarez-Vargas, Aurelio; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Leal-Morales, Carlos A

    2014-05-01

    Ustilago maydis is a pathogenic fungus that produces the corn smut. It is a biotrophic parasite that depends on living plant tissues for its proliferation and development. Polygalacturonases are secreted by pathogens to solubilize the plant cell-wall and are required for pathogen virulence. In this paper, we report the isolation of a U. maydis polygalacturonase gene (Pgu1) and the functional and structural characterization of the encoded enzyme. The U. maydis Pgu1 gene is expressed when the fungus is grown in liquid culture media containing different carbon sources. In plant tissue, the expression increased as a function of incubation time. Pgu1 gene expression was detected during plant infection around 10 days post-infection with U. maydis FB-D12 strain in combination with teliospore formation. Synthesis and secretion of active recombinant PGU1 were achieved using Pichia pastoris, the purified enzyme had a optimum temperature of 34 °C, optimum pH of 4.5, a Km of 57.84 g/L for polygalacturonic acid, and a Vmax of 28.9 µg/min mg. Structural models of PGU1 based on homologous enzymes yielded a typical right-handed β-helix fold of pectinolytic enzymes classified in the glycosyl hydrolases family 28, and the U. maydis PGU1 is related with endo rather than exo polygalacturonases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  15. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells.

    Science.gov (United States)

    Sateriale, Adam; Miller, Peter; Huston, Christopher D

    2016-04-01

    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Calcium-activated potassium (BK) channels are encoded by duplicate slo1 genes in teleost fishes.

    Science.gov (United States)

    Rohmann, Kevin N; Deitcher, David L; Bass, Andrew H

    2009-07-01

    Calcium-activated, large conductance potassium (BK) channels in tetrapods are encoded by a single slo1 gene, which undergoes extensive alternative splicing. Alternative splicing generates a high level of functional diversity in BK channels that contributes to the wide range of frequencies electrically tuned by the inner ear hair cells of many tetrapods. To date, the role of BK channels in hearing among teleost fishes has not been investigated at the molecular level, although teleosts account for approximately half of all extant vertebrate species. We identified slo1 genes in teleost and nonteleost fishes using polymerase chain reaction and genetic sequence databases. In contrast to tetrapods, all teleosts examined were found to express duplicate slo1 genes in the central nervous system, whereas nonteleosts that diverged prior to the teleost whole-genome duplication event express a single slo1 gene. Phylogenetic analyses further revealed that whereas other slo1 duplicates were the result of a single duplication event, an independent duplication occurred in a basal teleost (Anguilla rostrata) following the slo1 duplication in teleosts. A third, independent slo1 duplication (autotetraploidization) occurred in salmonids. Comparison of teleost slo1 genomic sequences to their tetrapod orthologue revealed a reduced number of alternative splice sites in both slo1 co-orthologues. For the teleost Porichthys notatus, a focal study species that vocalizes with maximal spectral energy in the range electrically tuned by BK channels in the inner ear, peripheral tissues show the expression of either one (e.g., vocal muscle) or both (e.g., inner ear) slo1 paralogues with important implications for both auditory and vocal physiology. Additional loss of expression of one slo1 paralogue in nonneural tissues in P. notatus suggests that slo1 duplicates were retained via subfunctionalization. Together, the results predict that teleost fish achieve a diversity of BK channel subfunction via

  17. Triple subcellular targeting of isopentenyl diphosphate isomerases encoded by a single gene.

    Science.gov (United States)

    Guirimand, Grégory; Guihur, Anthony; Phillips, Michael A; Oudin, Audrey; Glévarec, Gaëlle; Mahroug, Samira; Melin, Céline; Papon, Nicolas; Clastre, Marc; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Rodríguez-Concepción, Manuel; Burlat, Vincent; Courdavault, Vincent

    2012-11-01

    Isopentenyl diphosphate isomerase (IDI) is a key enzyme of the isoprenoid pathway, catalyzing the interconversion of isopentenyl diphosphate and dimethylallyl diphosphate, the universal precursors of all isoprenoids. In plants, several subcellular compartments, including cytosol/ER, peroxisomes, mitochondria and plastids, are involved in isoprenoid biosynthesis. Here, we report on the unique triple targeting of two Catharanthus roseus IDI isoforms encoded by a single gene (CrIDI1). The triple localization of CrIDI1 in mitochondria, plastids and peroxisomes is explained by alternative transcription initiation of CrIDI1, by the specificity of a bifunctional N-terminal mitochondria/plastid transit peptide and by the presence of a C-terminal peroxisomal targeting signal. Moreover, bimolecular fluorescence complementation assays revealed self-interactions suggesting that the IDI likely acts as a multimer in vivo.

  18. Chromosomal location of the genes encoding complement components C5 and factor H in the mouse

    DEFF Research Database (Denmark)

    D'Eustachio, P; Kristensen, Torsten; Wetsel, R A

    1986-01-01

    Complementary DNA probes corresponding to the factor H and C5 polypeptides have been used to determine the chromosomal localizations of these two complement components. Both probes revealed complex and polymorphic arrays of DNA fragments in Southern blot analysis of mouse genomic DNA. Following...... to chromosome 1 or chromosome 3. Following the inheritance of DNA restriction fragment-length polymorphisms revealed by the probes in recombinant inbred mouse strains allowed the factor H-associated fragments to be mapped to Sas-1 on chromosome 1, and the C5-associated fragments to be mapped to Hc. Analysis...... of three-point crosses, in turn, placed the latter locus 19 cM distal to Sd on chromosome 2. We have designated the two loci Cfh and C5, respectively. This genetic analysis raises the possibility that C5 and factor H are both encoded by complex loci composed of distinct structural and regulatory genes....

  19. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  20. MED resulting from recessively inherited mutations in the gene encoding calcium-activated nucleotidase CANT1.

    Science.gov (United States)

    Balasubramanian, Karthika; Li, Bing; Krakow, Deborah; Nevarez, Lisette; Ho, Patric J; Ainsworth, Julia A; Nickerson, Deborah A; Bamshad, Michael J; Immken, LaDonna; Lachman, Ralph S; Cohn, Daniel H

    2017-09-01

    Multiple Epiphyseal Dysplasia (MED) is a relatively mild skeletal dysplasia characterized by mild short stature, joint pain, and early-onset osteoarthropathy. Dominantly inherited mutations in COMP, MATN3, COL9A1, COL9A2, and COL9A3, and recessively inherited mutations in SLC26A2, account for the molecular basis of disease in about 80-85% of the cases. In two families with recurrent MED of an unknown molecular basis, we used exome sequencing and candidate gene analysis to identify homozygosity for recessively inherited missense mutations in CANT1, which encodes calcium-activated nucleotidase 1. The MED phenotype is thus allelic to the more severe Desbuquois dysplasia phenotype and the results identify CANT1 as a second locus for recessively inherited MED. © 2017 Wiley Periodicals, Inc.

  1. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. Stable disruption of ethanol production by deletion of the genes encoding alcohol dehydrogenase isozymes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ida, Yoshihiro; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi

    2012-02-01

    We analyzed the effects of the deletions of genes encoding alcohol dehydrogenase (ADH) isozymes of Saccharomyces cerevisiae. The decrease in ethanol production by ADH1 deletion alone could be partially compensated by the upregulation of other isozyme genes, while the deletion of all known ADH isozyme genes stably disrupted ethanol production. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Cloning and overexpression in Escherichia coli of the genes encoding NAD-dependent alcohol dehydrogenase from two Sulfolobus species.

    Science.gov (United States)

    Cannio, R; Fiorentino, G; Carpinelli, P; Rossi, M; Bartolucci, S

    1996-01-01

    The gene adh encoding a NAD-dependent alcohol dehydrogenase from the novel strain RC3 of Sulfolobus sp. was cloned and sequenced. Both the adh gene from Sulfolobus sp. strain RC3 and the alcohol dehydrogenase gene from Sulfolobus solfataricus (DSM 1617) were expressed at a high level in Escherichia coli, and the recombinant enzymes were purified, characterized, and compared. Only a few amino acid replacements were responsible for the different kinetic and physicochemical features investigated. PMID:8550434

  5. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  6. The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein.

    Science.gov (United States)

    Kouprina, Natalay; Pavlicek, Adam; Collins, N Keith; Nakano, Megumi; Noskov, Vladimir N; Ohzeki, Jun-Ichirou; Mochida, Ganeshwaran H; Risinger, John I; Goldsmith, Paul; Gunsior, Michelle; Solomon, Greg; Gersch, William; Kim, Jung-Hyun; Barrett, J Carl; Walsh, Christopher A; Jurka, Jerzy; Masumoto, Hiroshi; Larionov, Vladimir

    2005-08-01

    The most common cause of primary autosomal recessive microcephaly (MCPH) appears to be mutations in the ASPM gene which is involved in the regulation of neurogenesis. The predicted gene product contains two putative N-terminal calponin-homology (CH) domains and a block of putative calmodulin-binding IQ domains common in actin binding cytoskeletal and signaling proteins. Previous studies in mouse suggest that ASPM is preferentially expressed in the developing brain. Our analyses reveal that ASPM is widely expressed in fetal and adult tissues and upregulated in malignant cells. Several alternatively spliced variants encoding putative ASPM isoforms with different numbers of IQ motifs were identified. The major ASPM transcript contains 81 IQ domains, most of which are organized into a higher order repeat (HOR) structure. Another prominent spliced form contains an in-frame deletion of exon 18 and encodes 14 IQ domains not organized into a HOR. This variant is conserved in mouse. Other spliced variants lacking both CH domains and a part of the IQ motifs were also detected, suggesting the existence of isoforms with potentially different functions. To elucidate the biochemical function of human ASPM, we developed peptide specific antibodies to the N- and C-termini of ASPM. In a western analysis of proteins from cultured human and mouse cells, the antibodies detected bands with mobilities corresponding to the predicted ASPM isoforms. Immunostaining of cultured human cells with antibodies revealed that ASPM is localized in the spindle poles during mitosis. This finding suggests that MCPH is the consequence of an impairment in mitotic spindle regulation in cortical progenitors due to mutations in ASPM.

  7. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  8. The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2

    OpenAIRE

    Landis, Gary; Kelley, Richard; Spradling, Allan C.; Tower, John

    1997-01-01

    Lethal alleles of the Drosophila k43 gene result in small or missing imaginal discs, greatly reduced mitotic index, and fragmented and abnormally condensed chromosomes. A female-sterile allele of k43 specifically reduces chorion gene amplification in ovarian follicle cells. k43 was cloned by chromosomal walking, and the identification of the k43 gene was confirmed by phenotypic rescue and sequence analysis of mutant alleles. The sequence analyses reveal that the k43 gene encodes the Drosophil...

  9. Association of polymorphism of CYP2D6 and CYP2C9 genes encoding P-450 proteins of cytochrome with arterial hypertension

    Directory of Open Access Journals (Sweden)

    Saratsev A.V.

    2012-12-01

    Full Text Available Gene polymorphisms of cytochrome P-450 CYP2 encoding proteins of cytochrome P-450 are essential forantihy-pertensive drugs metabolism. Purpose: We study the associations of functionally defective allele variants of CYP2D6 gene and CYP2C9 gene with the degree of arterial hypertension (AH. Materials and methods: Samples of DNA of leukocytes of blood of 150 patients with AH without the associated clinical conditions (56% of women at the age of 20-59 years have been investigated. For the study of polymorphism of genes the pharmacogenetic biochip developed in the Institute of Molecular Biology n.a. V. A. Engelgardt has been used. Comparison of frequencies of occurrence of signs has been carried out on the basis of chi-square criterion. Results: It has been revealed that homozygotes by mutant A1075C, C430T alleles of CYP2C9gene and G1934A of CYP2D6 gene have been significantly more common among patients with hypertension III (p=0.01. Conclusion: The research works on genes of system of P-450 cytochrome have important clinical value for rationalization of pharmacotherapy of hypertension. The increased frequency of occurrence of mutant allele of CYP2D6 and CYP2C9 genes in patients with hypertension III requires special attention to the problem of efficiency and safety of application of hypotensive drugs for the patients.

  10. Identification and characterization of a helicase-like protein encoded by a Thermus siphoviridae phage 4 gene.

    Science.gov (United States)

    Zhang, Qi; Li, Qiupeng; Ji, Xiuling; Hong, Wei; Dong, Zhiyang; Wei, Yunlin; Lin, Lianbing

    2014-05-01

    DNA helicases are essential motor proteins that unwind duplex DNA to yield the transient single-stranded DNA intermediates required for replication, recombination, and repair. As laboratory model strains of thermostable bacteria, the roles of Thermus have been studied and discussed extensively. In this study, one gene (ORF42) encoding a helicase-like protein of TSP4 (Thermus Siphoviridae phage 4) was identified and characterized. The results showed that ORF42 protein shared a higher homology to the DnaB helicases of Thermus bacteriophages P74-26 and P24-46. DNA helicase assay and atomic force microscopy (AFM) revealed that ORF42 protein was an Mg(2+)-dependent helicase with ATPase activity and involved in DNA unwinding. These evidences indicated that ORF42 protein, homologue of DnaB, probably acts as a helicase in TSP4. This study will not only contribute to explore the co-evolution of Thermus phages and their hosts but also shed a new light on the "arm-race" pattern between Thermus and its predator (TSP4), providing a basis for the theoretical investigations of new generation bacteriophage therapy.

  11. The FBPase Encoding Gene glpX Is Required for Gluconeogenesis, Bacterial Proliferation and Division In Vivo of Mycobacterium marinum.

    Science.gov (United States)

    Tong, Jingfeng; Meng, Lu; Wang, Xinwei; Liu, Lixia; Lyu, Liangdong; Wang, Chuan; Li, Yang; Gao, Qian; Yang, Chen; Niu, Chen

    2016-01-01

    Lipids have been identified as important carbon sources for Mycobacterium tuberculosis (Mtb) to utilize in vivo. Thus gluconeogenesis bears a key role for Mtb to survive and replicate in host. A rate-limiting enzyme of gluconeogenesis, fructose 1, 6-bisphosphatase (FBPase) is encoded by the gene glpX. The functions of glpX were studied in M. marinum, a closely related species to Mtb. The glpX deletion strain (ΔglpX) displayed altered gluconeogenesis, attenuated virulence, and altered bacterial proliferation. Metabolic profiles indicate an accumulation of the FBPase substrate, fructose 1, 6-bisphosphate (FBP) and altered gluconeogenic flux when ΔglpX is cultivated in a gluconeogenic carbon substrate, acetate. In both macrophages and zebrafish, the proliferation of ΔglpX was halted, resulting in dramatically attenuated virulence. Intracellular ΔglpX exhibited an elongated morphology, which was also observed when ΔglpX was grown in a gluconeogenic carbon source. This elongated morphology is also supported by the observation of unseparated multi-nucleoid cell, indicating that a complete mycobacterial division in vivo is correlated with intact gluconeogenesis. Together, our results indicate that glpX has essential functions in gluconeogenesis, and plays an indispensable role in bacterial proliferation in vivo and virulence of M. marinum.

  12. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  13. Identification of Antithrombin-Modulating Genes. Role of LARGE, a Gene Encoding a Bifunctional Glycosyltransferase, in the Secretion of Proteins?

    Science.gov (United States)

    de la Morena-Barrio, María Eugenia; Buil, Alfonso; Antón, Ana Isabel; Martínez-Martínez, Irene; Miñano, Antonia; Gutiérrez-Gallego, Ricardo; Navarro-Fernández, José; Aguila, Sonia; Souto, Juan Carlos; Vicente, Vicente; Soria, José Manuel; Corral, Javier

    2013-01-01

    The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families). Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02). Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins. PMID:23705025

  14. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene.

    Science.gov (United States)

    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja

    2014-08-08

    Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this potential. Importantly, an industrial lactic acid producing process utilising yeast has already been implemented. Utilisation of D-xylose in addition to D-glucose in production of biochemicals such as lactic acid by microbial fermentation would be beneficial, as it would allow lignocellulosic raw materials to be utilised in the production processes. The yeast Candida sonorensis, which naturally metabolises D-xylose, was genetically modified to produce L-lactic acid from D-xylose by integrating the gene encoding L-lactic acid dehydrogenase (ldhL) from Lactobacillus helveticus into its genome. In microaerobic, CaCO3-buffered conditions a C. sonorensis ldhL transformant having two copies of the ldhL gene produced 31 g l-1 lactic acid from 50 g l-1 D-xylose free of ethanol.Anaerobic production of lactic acid from D-xylose was assessed after introducing an alternative pathway of D-xylose metabolism, i.e. by adding a xylose isomerase encoded by XYLA from Piromyces sp. alone or together with the xylulokinase encoding gene XKS1 from Saccharomyces cerevisiae. Strains were further modified by deletion of the endogenous xylose reductase encoding gene, alone or together with the xylitol dehydrogenase encoding gene. Strains of C. sonorensis expressing xylose isomerase produced L-lactic acid from D-xylose in anaerobic conditions. The highest anaerobic L-lactic acid production (8.5 g l-1) was observed in strains in which both the xylose reductase and xylitol dehydrogenase encoding genes had been

  15. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

    Science.gov (United States)

    Adewoye, L O; Worobec, E A

    2000-08-08

    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

  16. All genes encoding enzymes participating in melatonin biosynthesis in the chicken pineal gland are transcribed rhythmically.

    Science.gov (United States)

    Adamska, I; Marhelava, K; Walkiewicz, D; Kedzierska, U; Markowska, M; Majewski, P M

    2016-08-01

    Our recent research on the pineal gland of young chickens confirmed that three genes encoding enzymes involved in pineal melatonin biosynthesis, tryptophan hydroxylase 1 (Tph1), arylalkylamine-N-acetyltransferase (Aanat) and acetylserotonin O-methyltransferase (Asmt), are transcribed rhythmically under light:dark (L:D) 12:12 conditions in vivo. Additionally, in the pineal gland of maturing chickens, the dopa decarboxylase (Ddc) gene is transcribed rhythmically at a specific stage of the developmental process. Therefore, the aim of the present study was to verify whether all of these genes are transcribed rhythmically in vivo under constant darkness (D:D) and in pinealocyte cultures under both L:D and D:D. Experiments were performed on chickens maintained under L:D 12:12 conditions. Chickens at 15 days of age were divided into two groups; chickens from the first group remained under the same conditions, whereas those from the second group were kept in darkness. Subsequently, 16-day-old animals were sacrificed every 2 hours over a 24-h period. For the in vitro experiments, 16-day-old chickens were sacrificed at ZT 6, and their pineal glands were isolated. Pineal cultures were maintained for up to two days in L:D conditions. Then, the pinealocyte cultures were divided into two groups: the first remained under L:D conditions, whereas the second was transferred to D:D conditions. Pinealocytes were subsequently collected every 2 hours over a 24-h period. Transcription was evaluated using the RT-qPCR method, and the rhythm percentage was calculated through Cosinor analysis. The mRNA levels of all genes examined were rhythmic under all conditions. Moreover, in silico analysis of the promoters of all of the genes examined revealed the presence of enhancer box sequences in all of the promoters as well as DBP/E4BP4 binding elements in the promoters of Tph1 and Asmt. This suggests that these genes may all be regulated transcriptionally by the molecular clock mechanism and may

  17. Significance of calcium binding, tyrosine phosphorylation, and lysine trimethylation for the essential function of calmodulin in vertebrate cells analyzed in a novel gene replacement system

    DEFF Research Database (Denmark)

    Panina, Svetlana; Stephan, Alexander; la Cour, Jonas Marstrand

    2012-01-01

    system to study the effect ofCaMgene deletion. Here, we present a novel genetic system based on the chicken DT40 cell line, in which the two functional CaM genes were deleted and one allele replaced with a CaM transgene that can be artificially regulated.Weshow that CaM is essential for survival......Calmodulin (CaM) was shown to be essential for survival of lower eukaryotes by gene deletion experiments. So far, no CaM gene deletion was reported in higher eukaryotes. In vertebrates, CaM is expressed from several genes, which encode an identical protein, making it difficult to generate a model...

  18. Diversification and molecular evolution of ATOH8, a gene encoding a bHLH transcription factor.

    Directory of Open Access Journals (Sweden)

    Jingchen Chen

    Full Text Available ATOH8 is a bHLH domain transcription factor implicated in the development of the nervous system, kidney, pancreas, retina and muscle. In the present study, we collected sequence of ATOH8 orthologues from 18 vertebrate species and 24 invertebrate species. The reconstruction of ATOH8 phylogeny and sequence analysis showed that this gene underwent notable divergences during evolution. For those vertebrate species investigated, we analyzed the gene structure and regulatory elements of ATOH8. We found that the bHLH domain of vertebrate ATOH8 was highly conserved. Mammals retained some specific amino acids in contrast to the non-mammalian orthologues. Mammals also developed another potential isoform, verified by a human expressed sequence tag (EST. Comparative genomic analyses of the regulatory elements revealed a replacement of the ancestral TATA box by CpG-islands in the eutherian mammals and an evolutionary tendency for TATA box reduction in vertebrates in general. We furthermore identified the region of the effective promoter of human ATOH8 which could drive the expression of EGFP reporter in the chicken embryo. In the opossum, both the coding region and regulatory elements of ATOH8 have some special features, such as the unique extended C-terminus encoded by the third exon and absence of both CpG islands and TATA elements in the regulatory region. Our gene mapping data showed that in human, ATOH8 was hosted in one chromosome which is a fusion product of two orthologous chromosomes in non-human primates. This unique chromosomal environment of human ATOH8 probably subjects its expression to the regulation at chromosomal level. We deduce that the great interspecific differences found in both ATOH8 gene sequence and its regulatory elements might be significant for the fine regulation of its spatiotemporal expression and roles of ATOH8, thus orchestrating its function in different tissues and organisms.

  19. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  20. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  1. [Essential genes, minimal genome and synthetic cell of bacteria: a review].

    Science.gov (United States)

    Qiu, Dongru

    2012-05-01

    Single-cell prokaryotes represent a simple and primitive cellular life form. The identification of the essential genes of bacteria and the minimal genome for the free-living cellular life could provide insights into the origin, evolution, and essence of life forms. The principles, methodology, and recent progresses in the identification of essential genes and minimal genome and the creation of synthetic cells are reviewed and particularly the strategies for creating the minimal genome and the potential applications are introduced.

  2. Transcriptome profile of yeast reveals the essential role of PMA2 and uncharacterized gene YBR056W-A (MNC1) in adaptation to toxic manganese concentration.

    Science.gov (United States)

    Andreeva, N; Kulakovskaya, E; Zvonarev, A; Penin, A; Eliseeva, I; Teterina, A; Lando, A; Kulakovskiy, I V; Kulakovskaya, T

    2017-02-22

    Adaptation of S. cerevisiae to toxic concentrations of manganese provides a physiological model of heavy metal homeostasis. Transcriptome analysis of adapted yeast cells reveals upregulation of cell wall and plasma membrane proteins including membrane transporters. The gene expression in adapted cells differs from that of cells under short-term toxic metal stress. Among the most significantly upregulated genes are PMA2, encoding an ortholog of Pma1 H(+)-ATPase of the plasma membrane, and YBR056W-A, encoding a putative membrane protein Mnc1 that belongs to the CYSTM family and presumably chelates manganese at the cell surface. We demonstrate that these genes are essential for the adaptation to toxic manganese concentration and propose an extended scheme of manganese detoxification in yeast.

  3. The apeE Gene of Salmonella typhimurium Encodes an Outer Membrane Esterase Not Present in Escherichia coli

    OpenAIRE

    Carinato, Maria E.; Collin-Osdoby, Patricia; Yang, Xioming; Knox, Tina M.; Conlin, Christopher A.; Miller, Charles G.

    1998-01-01

    Salmonella typhimurium apeR mutations lead to overproduction of an outer membrane-associated N-acetyl phenylalanine β-naphthyl ester-cleaving esterase that is encoded by the apeE gene (P. Collin-Osdoby and C. G. Miller, Mol. Gen. Genet. 243:674–680, 1994). This paper reports the cloning and nucleotide sequencing of the S. typhimurium apeE gene as well as some properties of the esterase that it encodes. The predicted product of apeE is a 69.9-kDa protein which is processed to a 67-kDa species ...

  4. Capturing Uncertainty by Modeling Local Transposon Insertion Frequencies Improves Discrimination of Essential Genes.

    Science.gov (United States)

    DeJesus, Michael A; Ioerger, Thomas R

    2015-01-01

    Transposon mutagenesis experiments enable the identification of essential genes in bacteria. Deep-sequencing of mutant libraries provides a large amount of high-resolution data on essentiality. Statistical methods developed to analyze this data have traditionally assumed that the probability of observing a transposon insertion is the same across the genome. This assumption, however, is inconsistent with the observed insertion frequencies from transposon mutant libraries of M. tuberculosis. We propose a modified Binomial model of essentiality that can characterize the insertion probability of individual genes in which we allow local variation in the background insertion frequency in different non-essential regions of the genome. Using the Metropolis-Hastings algorithm, samples of the posterior insertion probabilities were obtained for each gene, and the probability of each gene being essential is estimated. We compared our predictions to those of previous methods and show that, by taking into consideration local insertion frequencies, our method is capable of making more conservative predictions that better match what is experimentally known about essential and non-essential genes.

  5. Analysis of gene essentiality in Escherichia coli across strains and growth conditions

    DEFF Research Database (Denmark)

    Bonde, Ida; Lennen, Rebecca; Cardoso, Joao

    are either essential or detrimental for growth in the test condition in question. In this study the TN-Seq method was used to investigate the differences in gene essentiality between four laboratory strains of E.coli subjected to four different growth conditions to investigate the reason for the differences...

  6. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  7. Glyceraldehyde-3-Phosphate Dehydrogenase-Encoding Gene as a Useful Taxonomic Tool for Staphylococcus spp.

    Science.gov (United States)

    Yugueros, Javier; Temprano, Alejandro; Berzal, Beatriz; Sánchez, María; Hernanz, Carmen; Luengo, José María; Naharro, Germán

    2000-01-01

    The gap gene of Staphylococcus aureus, encoding glyceraldehyde-3-phosphate dehydrogenase, was used as a target to amplify a 933-bp DNA fragment by PCR with a pair of primers 26 and 25 nucleotides in length. PCR products, detected by agarose gel electrophoresis, were also amplified from 12 Staphylococcus spp. analyzed previously. Hybridization with an internal 279-bp DNA fragment probe was positive in all PCR-positive samples. No PCR products were amplified when other gram-positive and gram-negative bacterial genera were analyzed using the same pair of primers. AluI digestion of PCR-generated products gave 12 different restriction fragment length polymorphism (RFLP) patterns, one for each species analyzed. However, we could detect two intraspecies RFLP patterns in Staphylococcus epidermidis, Staphylococcus hominis, and Staphylococcus simulans which were different from the other species. An identical RFLP pattern was observed for 112 S. aureus isolates from humans, cows, and sheep. The sensitivity of the PCR assays was very high, with a detection limit for S. aureus cells of 20 CFU when cells were suspended in saline. PCR amplification of the gap gene has the potential for rapid identification of at least 12 species belonging to the genus Staphylococcus, as it is highly specific. PMID:11101563

  8. [Detection of Leishmania spp. based on the gene encoding HSP20].

    Science.gov (United States)

    Montalvo, Ana M; Fraga, Jorge; Rodríguez, Omaira; Blanco, Orestes; Llanos-Cuentas, Alejandro; García, Ana L; Valencia, Braulio M; Muskus, Carlos; Van der Auwera, Gert; Requena, José M

    2014-01-01

    Explore a new target for molecular diagnosis of Leishmania. We evaluated the utility of the gene that encodes the heat shock protein 20-kDa (Hsp20) for detecting Leishmania by polymerase chain reaction (PCR). PCR was normalized and analytical parameters were determined, as well as the validity and diagnostic accuracy, and concordance with the PCR - 18S. PCR-Hsp20 with DNA was obtained from a group of clinical samples from different sources. The analytical parameters were adequate. The sensitivity obtained was 86% and the specificity was 100%. The concordance with the reference method was good (κ = 0.731), which supports its potential use for diagnosis. The possibility of subsequent identification of the species by sequencing the amplified product gives an additional advantage. The usefulness of this gene as a new target for the detection of Leishmania was demonstrated. Because of its potential, it is recommended to improve the sensitivity of the method and to evaluate it in different endemic regions.

  9. Cloning and analysis of the DNA polymerase-encoding gene from Thermus filiformis.

    Science.gov (United States)

    Jung, S E; Choi, J J; Kim, H K; Kwon, S T

    1997-12-31

    The gene encoding Thermus filiformis (Tfi) DNA polymerase was cloned and its nucleotide sequence was determined. The primary structure of Tfi DNA polymerase was deduced from its nucleotide sequence. Tfi DNA polymerase is comprised of 833 amino acid residues and its molecular mass was determined to be 93,890 Da. The deduced amino acid sequence of Tfi DNA polymerase showed a high sequence homology to E. coli DNA polymerase I-like DNA polymerases: 78.5% homology to Taq DNA polymerase, 78.4% to Tca DNA polymerase, and 41.8% to E. coli DNA polymerase I. An extremely high sequence identity was observed in the region containing polymerase activity. The G + C content of the coding region for the Tfi DNA polymerase gene was 68.5%, which was higher than that of the chromosomal DNA (65%). The G + C contents in the first, second, and third positions of the codons used were 71.8%, 40.9%, and 92.7% respectively. Codon usage in Tfi DNA polymerase was heavily biased towards the use of G + C in the third position. Rare codons with U or A as the third base were sometimes used to avoid using GA(A/T) TC and TCGA sequences, as they are recognition sites for the restriction endonucleases TfiI and TaqI.

  10. Cotton PRP5 gene encoding a proline-rich protein is involved in fiber development.

    Science.gov (United States)

    Xu, Wen-Liang; Zhang, De-Jing; Wu, Yan-Feng; Qin, Li-Xia; Huang, Geng-Qing; Li, Juan; Li, Long; Li, Xue-Bao

    2013-07-01

    Proline-rich proteins contribute to cell wall structure of specific cell types and are involved in plant growth and development. In this study, a fiber-specific gene, GhPRP5, encoding a proline-rich protein was functionally characterized in cotton. GhPRP5 promoter directed GUS expression only in trichomes of both transgenic Arabidopsis and tobacco plants. The transgenic Arabidopsis plants with overexpressing GhPRP5 displayed reduced cell growth, resulting in smaller cell size and consequently plant dwarfs, in comparison with wild type plants. In contrast, knock-down of GhPRP5 expression by RNA interference in cotton enhanced fiber development. The fiber length of transgenic cotton plants was longer than that of wild type. In addition, some genes involved in fiber elongation and wall biosynthesis of cotton were up-regulated or down-regulated in the transgenic cotton plants owing to suppression of GhPRP5. Collectively, these data suggested that GhPRP5 protein as a negative regulator participates in modulating fiber development of cotton.

  11. Cloning, mapping and nucleotide sequencing of a gene encoding a universal stress protein in Escherichia coli.

    Science.gov (United States)

    Nyström, T; Neidhardt, F C

    1992-11-01

    The response of non-differentiating bacteria to nutrient starvation is complex and includes the sequential synthesis of starvation-inducible proteins. Although starvation for different individual nutrients generally provokes unique and individual patterns of protein expression, some starvation stimulons share member proteins. Two-dimensional polyacrylamide gel electrophoresis revealed that the synthesis of a small (13.5 kDa) cytoplasmic protein in Escherichia coli was greatly increased during growth inhibition caused by the exhaustion of any of a variety of nutrients (carbon, nitrogen, phosphate, sulphate, required amino acid) or by the presence of a variety of toxic agents including heavy metals, oxidants, acids and antibiotics. To determine further the mode of regulation of the protein designated UspA (universal stress protein A) we cloned the gene encoding the protein by the technique of reverse genetics. We isolated the protein from a preparative two-dimensional polyacrylamide gel, determined its N-terminal amino acid sequence, and used this sequence to construct a degenerate oligonucleotide probe. Two phages of the Kohara library were found to contain the gene which then was subcloned from the DNA in the overlapping region of these two clones. The amino acid sequence, deduced from the nucleotide sequence of the uspA gene, shows no significant homology with any other known protein. The uspA gene maps at 77 min on the E. coli W3110 chromosome, and is transcribed in a clockwise direction. The increase in the level of UspA during growth arrest was found to be primarily a result of transcriptional activation of the corresponding gene. The induction was independent of the RelA/SpoT, RpoH, KatF, OmpR, AppY, Lrp, PhoB and H-NS proteins during stress conditions that are known to induce or activate these global regulators. The -10 and -35 regions upstream of the transcriptional start site of the uspA gene are characteristic of a sigma 70-dependent promoter.

  12. The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast.

    Directory of Open Access Journals (Sweden)

    Alessandra Chesi

    Full Text Available YPK9 (Yeast PARK9; also known as YOR291W is a non-essential yeast gene predicted by sequence to encode a transmembrane P-type transport ATPase. However, its substrate specificity is unknown. Mutations in the human homolog of YPK9, ATP13A2/PARK9, have been linked to genetic forms of early onset parkinsonism. We previously described a strong genetic interaction between Ypk9 and another Parkinson's disease (PD protein α-synuclein in multiple model systems, and a role for Ypk9 in manganese detoxification in yeast. In humans, environmental exposure to toxic levels of manganese causes a syndrome similar to PD and is thus an environmental risk factor for the disease. How manganese contributes to neurodegeneration is poorly understood. Here we describe multiple genome-wide screens in yeast aimed at defining the cellular function of Ypk9 and the mechanisms by which it protects cells from manganese toxicity. In physiological conditions, we found that Ypk9 genetically interacts with essential genes involved in cellular trafficking and the cell cycle. Deletion of Ypk9 sensitizes yeast cells to exposure to excess manganese. Using a library of non-essential gene deletions, we screened for additional genes involved in tolerance to excess manganese exposure, discovering several novel pathways involved in manganese homeostasis. We defined the dependence of the deletion strain phenotypes in the presence of manganese on Ypk9, and found that Ypk9 deletion modifies the manganese tolerance of only a subset of strains. These results confirm a role for Ypk9 in manganese homeostasis and illuminates cellular pathways and biological processes in which Ypk9 likely functions.

  13. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  14. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  15. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome.

    Science.gov (United States)

    Frank, Valeska; den Hollander, Anneke I; Brüchle, Nadina Ortiz; Zonneveld, Marijke N; Nürnberg, Gudrun; Becker, Christian; Du Bois, Gabriele; Kendziorra, Heide; Roosing, Susanne; Senderek, Jan; Nürnberg, Peter; Cremers, Frans P M; Zerres, Klaus; Bergmann, Carsten

    2008-01-01

    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the list of ciliary disorders (ciliopathies). By positional cloning in a distantly related multiplex family, we mapped a novel locus for MKS to a 3-Mb interval on 12q21. Sequencing of the CEP290 gene located in the minimal critical region showed a homozygous 1-bp deletion supposed to lead to loss of function of the encoded centrosomal protein CEP290/nephrocystin-6. CEP290 is thought to be involved in chromosome segregation and localizes to cilia, centrosomes, and the nucleus. Subsequent analysis of another consanguineous multiplex family revealed homozygous haplotypes and the same frameshift mutation. Our findings add to the increasing body of evidence that ciliopathies can cause a broad spectrum of disease phenotypes, and pleiotropic effects of CEP290 mutations range from single organ involvement with isolated Leber congenital amaurosis to Joubert syndrome and lethal early embryonic multisystemic malformations in Meckel-Gruber syndrome. We compiled clinical and genetic data of all patients with CEP290 mutations described so far. No clear-cut genotype-phenotype correlations were apparent as almost all mutations are nonsense, frameshift, or splice-site changes and scattered throughout the gene irrespective of the patients' phenotypes. Conclusively, other factors than the type and location of CEP290 mutations may underlie phenotypic variability. (c) 2007 Wiley-Liss, Inc.

  16. The occurrence of subtilase-cytotoxin-encoding genes in environmental Escherichia coli isolated from a Northern California estuary.

    Science.gov (United States)

    Pereira, Maria das Graças C; Byrne, Barbara A; Nguyen, Trân B H; Lewis, David J; Atwill, E Robert

    2013-06-01

    The presence of subtilase-cytotoxin-encoding genes was determined in 397 environmental Escherichia coli strains isolated from water, suspended solids, and sediments sampled from different hydrological and environmental conditions in a California estuary. A total of 7 strains (1.76%) were found to harbor subtilase-cytotoxin-encoding genes. Using primers targeting subA only, we generated PCR amplicons from 2 strains; while using primers targeting the 3' end of SubA downstream to the 5' end of SubB, amplicons of 232 bp were generated from 5 additional strains. The 556 bp subA sequences were almost identical to that in the subtilase-cytotoxin-positive strain ED 591 (98%), while subAB sequences of 2 non-Shiga-toxigenic strains revealed 100% similarity with the Shiga-toxigenic E. coli O113:H21 strain 98NK2 that was isolated from an outbreak of hemolytic uremic syndrome. Additionally, the serogroup O113:H21 was present in this collection of environmental E. coli, and it was found to harbor stx2d, hra1 that encodes the heat resistant agglutinin 1, and a subAB sequence similar to that in the non-Shiga-toxigenic E. coli subtilase cytotoxin strain ED 591. To further understand potential health risks posed by strains encoding SubAB, future epidemiological studies should consider screening isolates for subAB regardless of the presence of Shiga-toxin-encoding genes.

  17. A shotgun antisense approach to the identification of novel essential genes in Pseudomonas aeruginosa.

    Science.gov (United States)

    Rusmini, Ruggero; Vecchietti, Davide; Macchi, Raffaella; Vidal-Aroca, Faustino; Bertoni, Giovanni

    2014-02-05

    Antibiotics in current use target a surprisingly small number of cellular functions: cell wall, DNA, RNA, and protein biosynthesis. Targeting of novel essential pathways is expected to play an important role in the discovery of new antibacterial agents against bacterial pathogens, such as Pseudomonas aeruginosa, that are difficult to control because of their ability to develop resistance, often multiple, to all current classes of clinical antibiotics. We aimed to identify novel essential genes in P. aeruginosa by shotgun antisense screening. This technique was developed in Staphylococcus aureus and, following a period of limited success in Gram-negative bacteria, has recently been used effectively in Escherichia coli. To also target low expressed essential genes, we included some variant steps that were expected to overcome the non-stringent regulation of the promoter carried by the expression vector used for the shotgun antisense libraries. Our antisense screenings identified 33 growth-impairing single-locus genomic inserts that allowed us to generate a list of 28 "essential-for-growth" genes: five were "classical" essential genes involved in DNA replication, transcription, translation, and cell division; seven were already reported as essential in other bacteria; and 16 were "novel" essential genes with no homologs reported to have an essential role in other bacterial species. Interestingly, the essential genes in our panel were suggested to take part in a broader range of cellular functions than those currently targeted by extant antibiotics, namely protein secretion, biosynthesis of cofactors, prosthetic groups and carriers, energy metabolism, central intermediary metabolism, transport of small molecules, translation, post-translational modification, non-ribosomal peptide synthesis, lipopolysaccharide synthesis/modification, and transcription regulation. This study also identified 43 growth-impairing inserts carrying multiple loci targeting 105 genes, of which

  18. Distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins in Mekong river sediments in Vietnam.

    Science.gov (United States)

    Kobayashi, Takeshi; Suehiro, Fujiyo; Cach Tuyen, Bui; Suzuki, Satoru

    2007-03-01

    We investigated the distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins (RPPs) in river and channel sediments of the Mekong Delta in Vietnam. The sediment samples were taken from nine sites in the Hau River in southern Vietnam and from 1 site in a channel in Can Tho City in May 2004 using an Ekman-Birge sediment surface sampler. The RPP genes were amplified using PCR with DNA templates obtained directly from the sediments. The tet(M), tet(S), and tet(W) genes were detected by PCR in most sediment samples. Denaturing gradient gel electrophoresis analysis of these genes and sequencing of the resulting bands showed that tet(S) and tet(W) had only one genotype each, but that tet(M) had at least two, which were tentatively called type 1 and type 2. Type 1 tet(M) was identical to the gene encoded in various plasmids and transposons of gram-positive and gram-negative bacteria, and type 2tet(M) was similar to the gene encoded in Tn1545 of Enterococcus faecalis (99% identity, 170 bp/171 bp). This study showed that various RPP genes were widely distributed in the river and channel sediments of the Mekong Delta.

  19. Blue ghosts: a new method for isolating amber mutants defective in essential genes of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S; Brickman, E R; Beckwith, J

    1981-01-01

    We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...

  20. Mutagenesis of the gene encoding cytochrome c550 of Paracoccus denitrificans and analysis of the resultant physiological effects.

    OpenAIRE

    Van Spanning, R J; Wansell, C; Harms, N; Oltmann, L F; Stouthamer, A H

    1990-01-01

    By using synthetic oligonucleotides, the gene encoding soluble cytochrome c550 was isolated from a genomic bank of Paracoccus denitrificans. The nucleotide sequence of the gene was determined, and the deduced amino acid sequence of the mature protein was found to be similar to the primary structure of purified cytochrome c550 except for the presence of seven additional amino acid residues at the C terminus. At the N terminus of the primary structure was found an additional stretch of 19 amino...

  1. The ARG9 Gene Encodes the Plastid-Resident N-Acetyl Ornithine Aminotransferase in the Green Alga Chlamydomonas reinhardtii▿

    OpenAIRE

    Remacle, Claire; Cline, Sara; Boutaffala, Layla; Gabilly, Stéphane; Larosa, Véronique; Barbieri, M. Rosario; Coosemans, Nadine; Hamel, Patrice P.

    2009-01-01

    Here we report the characterization of the Chlamydomonas reinhardtii gene ARG9, encoding the plastid resident N-acetyl ornithine aminotransferase, which is involved in arginine synthesis. Integration of an engineered ARG9 cassette in the plastid chromosome of the nuclear arg9 mutant restores arginine prototrophy. This suggests that ARG9 could be used as a new selectable marker for plastid transformation.

  2. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7.

    Science.gov (United States)

    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K; Kimura, Y; Imada, C; Okami, Y; Inamori, Y

    1995-01-01

    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase. PMID:7574618

  3. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7.

    OpenAIRE

    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K.; Kimura, Y.; Imada, C; Okami, Y; Inamori, Y

    1995-01-01

    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase.

  4. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  5. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  6. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus : the DAMAGE study

    NARCIS (Netherlands)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V.; van't Riet, Esther; van Haeften, Timon W.; Arp, Pascal A.; Hansen, Torben; Kremer, Dennis; Groenewoud, Marlous J.; van Hove, Els C.; Romijn, Johannes A.; Smit, Jan W. A.; Nijpels, Giel; Heine, Robert J.; Uitterlinden, Andre G.; Pedersen, Oluf; Slagboom, P. Eline; Maassen, Johannes A.; Hofker, Marten H.; 't Hart, Leen M.; Dekker, Jacqueline M.

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes

  7. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  8. Polyamines are essential for virulence in Salmonella enterica serovar Gallinarum despite evolutionary decay of polyamine biosynthesis genes

    DEFF Research Database (Denmark)

    Schroll, Casper; Christensen, Jens P.; Christensen, Henrik

    2014-01-01

    -specificity coincides with accumulation of pseudogenes, indicating adaptation of host-restricted serovars to their narrow niches. Polyamines are small cationic amines and in Salmonella they can be synthesized through two alternative pathways directly from l-ornithine to putrescine and from l-arginine via agmatine...... to putrescine. The first pathway is not active in S. Gallinarum and S. Typhi, and this prompted us to investigate the importance of polyamines for virulence in S. Gallinarum. Bioinformatic analysis of all sequenced genomes of Salmonella revealed that pseudogene formation of the speC gene was exclusive for S....... Typhi and S. Gallinarum and happened through independent events. The remaining polyamine biosynthesis pathway was found to be essential for oral infection with S. Gallinarum since single and double mutants in speB and speE, encoding the pathways from agmatine to putrescine and from putrescine...

  9. 55.2, a phage T4 ORFan gene, encodes an inhibitor of Escherichia coli topoisomerase I and increases phage fitness.

    Directory of Open Access Journals (Sweden)

    Yves Mattenberger

    Full Text Available Topoisomerases are enzymes that alter the topological properties of DNA. Phage T4 encodes its own topoisomerase but it can also utilize host-encoded topoisomerases. Here we characterized 55.2, a phage T4 predicted ORF of unknown function. High levels of expression of the cloned 55.2 gene are toxic in E. coli. This toxicity is suppressed either by increased topoisomerase I expression or by partial inactivation of the ATPase subunit of the DNA gyrase. Interestingly, very low-level expression of 55.2, which is non-lethal to wild type E. coli, prevents the growth of a deletion mutant of the topoisomerase I (topA gene. In vitro, gp55.2 binds DNA and blocks specifically the relaxation of negatively supercoiled DNA by topoisomerase I. In vivo, expression of gp55.2 at low non-toxic levels alters the steady state DNA supercoiling of a reporter plasmid. Although 55.2 is not an essential gene, competition experiments indicate that it is required for optimal phage growth. We propose that the role of gp55.2 is to subtly modulate host topoisomerase I activity during infection to insure optimal T4 phage yield.

  10. The genome of the mustard leaf beetle encodes two active xylanases originally acquired from bacteria through horizontal gene transfer.

    Science.gov (United States)

    Pauchet, Yannick; Heckel, David G

    2013-07-22

    The primary plant cell wall comprises the most abundant polysaccharides on the Earth and represents a rich source of energy for organisms which have evolved the ability to digest them. Enzymes able to degrade plant cell wall polysaccharides are widely distributed in micro-organisms but are generally absent in animals, although their presence in insects, especially phytophagous beetles from the superfamilies Chrysomeloidea and Curculionoidea, has recently begun to be appreciated. The observed patchy distribution of endogenous genes encoding these enzymes in animals has raised questions about their evolutionary origins. Recent evidence suggests that endogenous plant cell wall degrading enzymes-encoding genes have been acquired by animals through a mechanism known as horizontal gene transfer (HGT). HGT describes how genetic material is moved by means other than vertical inheritance from a parent to an offspring. Here, we provide evidence that the mustard leaf beetle, Phaedon cochleariae, possesses in its genome genes encoding active xylanases from the glycoside hydrolase family 11 (GH11). We also provide evidence that these genes were originally acquired by P. cochleariae from a species of gammaproteobacteria through HGT. This represents the first example of the presence of genes from the GH11 family in animals.

  11. Transcript accumulation from the rpoS gene encoding a stationary-phase sigma factor in Pseudomonas chlororaphis strain O6 is regulated by the polyphosphate kinase gene.

    Science.gov (United States)

    Kim, H J; Yang, K Y; Cho, B H; Kim, K Y; Lee, M C; Kim, Y H; Anderson, A J; Kim, Y C

    2007-03-01

    Polyphosphate levels are modulated by the actions of polyphosphate kinase, encoded by ppk, and exopolyphosphatase, encoded by ppx. The genes ppk and ppx are adjacent to each other in the genome of the root colonizer, Pseudomonas chlororaphis O6. A ppk-deficient mutant was more sensitive to oxidative stress than the wild-type and the ppx mutant. Transcripts from ppx increased as cultures matured from mid- to late-logarithmic and stationary phases, whereas abundance was greater for ppk in the late-logarithmic phase than in the stationary phase. Transcript accumulation from the rpoS gene, encoding the stationary-phase sigma factor RpoS, was decreased in the mid- and late-logarithmic and stationary phases in the ppk mutant. Thus, ppk regulates rpoS transcript accumulation in P. chlororaphis 06. However, mutations in either the ppk or ppx genes had no effect on induction of systemic resistance in plants colonized by P. chlororaphis O6.

  12. Efficient antibody diversification by gene conversion in vivo in the absence of selection for V(D)J-encoded determinants.

    Science.gov (United States)

    Sayegh, C E; Drury, G; Ratcliffe, M J

    1999-11-15

    Antibody diversification in the bursa of Fabricius occurs by gene conversion: pseudogene-derived sequences replace homologous sequences in rearranged immunoglobulin genes. Bursal cells expressing a truncated immunoglobulin mu heavy chain, introduced by retroviral gene transfer, bypass normal requirements for endogenous surface immunoglobulin expression. Immunoglobulin light chain rearrangements in such cells undergo gene conversion under conditions where the products are not selected based on their ability to encode a functional protein. The efficiency with which gene conversion maintains a productive reading frame exceeds 97% under such non-selective conditions. By analysis of donor pseudogene usage we demonstrate that bursal cell development is not driven by a restricted set of antigenic specificities. We further demonstrate that gene conversion can restore a productive reading frame to out-of-frame VJ(L) junctions, providing a rationale for the elimination of cells containing non-productive VJ(L) rearrangements prior to the onset of gene conversion in normal bursal cell development.

  13. The Etl-1 gene encodes a nuclear protein differentially expressed during early mouse development.

    Science.gov (United States)

    Schoor, M; Schuster-Gossler, K; Gossler, A

    1993-07-01

    Recently, we isolated a novel mouse gene, Etl-1 (Enhancer-trap-locus-1), whose deduced amino acid sequence shows in its C-terminal portion striking homology to the brahma protein (BRM), a transcriptional regulator of homeotic genes in Drosophila, and to SNF2/SWI2, a transcriptional regulator of various genes in Saccharomyces cerevisiae. Here we report the generation of antibodies against the Etl-1 gene product (ETL-1) and describe the subcellular localization as well as the expression and distribution of the ETL-1 protein during mouse pre- and early post-implantation development. ETL-1 is a nuclear protein and is expressed in a biphasic manner during early embryogenesis. Moderate levels of ETL-1 were detected in unfertilized and fertilized eggs but in the latter the protein was not concentrated in the pronuclei and seemed evenly distributed throughout the cytoplasm. In two-cell embryos nuclear ETL-1 protein accumulated transiently and levels decreased during subsequent cleavage development. After the morula stage, ETL-1 levels increased again; in blastocysts high levels of ETL-1 were present in inner cell mass cells whereas trophectoderm cells contained little or no ETL-1. During subsequent development essentially all cell types except parietal endoderm and trophoblast cells contained high levels of ETL-1. Our results imply that nuclear ETL-1 is dispensable for the progression to the two cell stage, and suggest that during cleavage ETL-1 might be needed at the onset of embryonic transcription. In blastocysts ETL-1 function might be specifically required in cells of the inner cell mass and later in most cells of the embryo proper and extraembryonic ectoderm lineage.

  14. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  15. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  16. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  17. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  18. The rice FISH BONE gene encodes a tryptophan aminotransferase, which affects pleiotropic auxin-related processes.

    Science.gov (United States)

    Yoshikawa, Takanori; Ito, Momoyo; Sumikura, Tsuyoshi; Nakayama, Akira; Nishimura, Takeshi; Kitano, Hidemi; Yamaguchi, Isomaro; Koshiba, Tomokazu; Hibara, Ken-Ichiro; Nagato, Yasuo; Itoh, Jun-Ichi

    2014-06-01

    Auxin is a fundamental plant hormone and its localization within organs plays pivotal roles in plant growth and development. Analysis of many Arabidopsis mutants that were defective in auxin biosynthesis revealed that the indole-3-pyruvic acid (IPA) pathway, catalyzed by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) and YUCCA (YUC) families, is the major biosynthetic pathway of indole-3-acetic acid (IAA). In contrast, little information is known about the molecular mechanisms of auxin biosynthesis in rice. In this study, we identified a auxin-related rice mutant, fish bone (fib). FIB encodes an orthologue of TAA genes and loss of FIB function resulted in pleiotropic abnormal phenotypes, such as small leaves with large lamina joint angles, abnormal vascular development, small panicles, abnormal organ identity and defects in root development, together with a reduction in internal IAA levels. Moreover, we found that auxin sensitivity and polar transport activity were altered in the fib mutant. From these results, we suggest that FIB plays a pivotal role in IAA biosynthesis in rice and that auxin biosynthesis, transport and sensitivity are closely interrelated. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  19. The Arabidopsis DELAYED DEHISCENCE1 Gene Encodes an Enzyme in the Jasmonic Acid Synthesis Pathway

    Science.gov (United States)

    Sanders, Paul M.; Lee, Pei Yun; Biesgen, Christian; Boone, James D.; Beals, Thomas P.; Weiler, Elmar W.; Goldberg, Robert B.

    2000-01-01

    delayed dehiscence1 is an Arabidopsis T-DNA mutant in which anthers release pollen grains too late for pollination to occur. The delayed dehiscence1 defect is caused by a delay in the stomium degeneration program. The gene disrupted in delayed dehiscence1 encodes 12-oxophytodienoate reductase, an enzyme in the jasmonic acid biosynthesis pathway. We rescued the mutant phenotype by exogenous application of jasmonic acid and obtained seed set from previously male-sterile plants. In situ hybridization studies showed that during the early stages of floral development, DELAYED DEHISCENCE1 mRNA accumulated within all floral organs. Later, DELAYED DEHISCENCE1 mRNA accumulated specifically within the pistil, petals, and stamen filaments. DELAYED DEHISCENCE1 mRNA was not detected in the stomium and septum cells of the anther that are involved in pollen release. The T-DNA insertion in delayed dehiscence1 eliminated both DELAYED DEHISCENCE1 mRNA accumulation and 12-oxophytodienoate reductase activity. These experiments suggest that jasmonic acid signaling plays a role in controlling the time of anther dehiscence within the flower. PMID:10899973

  20. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  1. The Mesodermal Expression of rolling stone (rost) Is Essential for Myoblast Fusion in Drosophila and Encodes a Potential Transmembrane Protein

    OpenAIRE

    Paululat, Achim; Goubeaud, Anette; Damm, Christine; Knirr, Stefan; Burchard, Susanne; Renkawitz-Pohl, Renate

    1997-01-01

    In homozygous rolling stone embryos, the fusion of myoblasts to syncytial myotubes is diminished. Nevertheless, the visceral mesoderm, the heart mesoderm, and few somatic muscles are properly formed. Thus, we postulate a central role of rolling stone for the fusion process within the somatic mesoderm. We have cloned the rolling stone gene, and the deduced protein sequence is in accordance with a transmembrane protein, which agrees with the enrichment of Rost in the membrane fraction of Drosop...

  2. The mesodermal expression of rolling stone (rost) is essential for myoblast fusion in Drosophila and encodes a potential transmembrane protein.

    Science.gov (United States)

    Paululat, A; Goubeaud, A; Damm, C; Knirr, S; Burchard, S; Renkawitz-Pohl, R

    1997-07-28

    In homozygous rolling stone embryos, the fusion of myoblasts to syncytial myotubes is diminished. Nevertheless, the visceral mesoderm, the heart mesoderm, and few somatic muscles are properly formed. Thus, we postulate a central role of rolling stone for the fusion process within the somatic mesoderm. We have cloned the rolling stone gene, and the deduced protein sequence is in accordance with a transmembrane protein, which agrees with the enrichment of Rost in the membrane fraction of Drosophila embryos. No homologous genes have been described so far. rolling stone is expressed in the embryonic nervous system and cells of the somatic mesoderm, most notable in muscle founder cells. To elucidate the function of rolling stone for myoblast fusion, we applied a knock-out strategy. The expression of an antisense rolling stone transcript specifically within the mesoderm of wild-type embryos results in fusion defects of myoblasts, proving that the rolling stone expression in the mesoderm is responsible for the rolling stone phenotype. We suggest that rolling stone is a member of a group of genes that are necessary for the fusion process during myogenesis.

  3. Chromatin regulation and gene centrality are essential for controlling fitness pleiotropy in yeast.

    Directory of Open Access Journals (Sweden)

    Linqi Zhou

    2009-11-01

    Full Text Available There are a wide range of phenotypes that are due to loss-of-function or null mutations. Previously, the functions of gene products that distinguish essential from nonessential genes were characterized. However, the functions of products of non-essential genes that contribute to fitness remain minimally understood.Using data from Saccharomyces cerevisiae, we investigated several gene characteristics, which we are able to measure, that are significantly associated with a gene's fitness pleiotropy. Fitness pleiotropy is a measurement of the gene's importance to fitness. These characteristics include: 1 whether the gene's product functions in chromatin regulation, 2 whether the regulation of the gene is influenced by chromatin state, measured by chromatin regulation effect (CRE, 3 whether the gene's product functions as a transcription factor (TF and the number of genes a TF regulates, 4 whether the gene contains TATA-box, and 5 whether the gene's product is central in a protein interaction network. Partial correlation analysis was used to study how these characteristics interact to influence fitness pleiotropy. We show that all five characteristics that were measured are statistically significantly associated with fitness pleiotropy. However, fitness pleiotropy is not associated with the presence of TATA-box when CRE is controlled. In particular, two characteristics: 1 whether the regulation of a gene is more likely to be influenced by chromatin state, and 2 whether the gene product is central in a protein interaction network measured by the number of protein interactions were found to play the most important roles affecting a gene's fitness pleiotropy.These findings highlight the significance of both epigenetic gene regulation and protein interaction networks in influencing the fitness pleiotropy.

  4. Expression pattern of a nuclear encoded mitochondrial arginine-ornithine translocator gene from Arabidopsis.

    Science.gov (United States)

    Catoni, Elisabetta; Desimone, Marcelo; Hilpert, Melanie; Wipf, Daniel; Kunze, Reinhard; Schneider, Anja; Flügge, Ulf-Ingo; Schumacher, Karin; Frommer, Wolf B

    2003-01-07

    Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF) essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2) of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.

  5. Expression pattern of a nuclear encoded mitochondrial arginine-ornithine translocator gene from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Schneider Anja

    2003-01-01

    Full Text Available Abstract Background Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. Results High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2 of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. Conclusion AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.

  6. Hypersensitive Response of Plasmid-Encoded AHL Synthase Gene to Lifestyle and Nutrient by Ensifer adhaerens X097

    Directory of Open Access Journals (Sweden)

    Yanhua Zeng

    2017-06-01

    Full Text Available It is known that some bacteria, especially members of the family Rhizobiaceae, have multiple N-acyl homoserine lactones (AHL synthase genes and produce multiple AHL signals. However, how bacteria selectively utilize these multiple genes and signals to cope with changing environments is poorly understood. Ensifer adhaerens is an important microorganism in terms of biotechnology, ecology and evolutionary. In this study, we investigated the AHL-based QS system of E. adhaerens X097 and its response to different lifestyles or nutrients. Draft genome sequence data indicated that X097 harbored three distinct AHL synthase genes (ensI1, 2, 3 and seven luxR homologs, which was different from other E. adhaerens strains. In vitro expression indicated that plasmid-encoded ensI1 and ensI2 directed production of multiple AHLs, while chromosome-encoded ensI3 only directed production of C14-HSL. Predicted three dimensional structure of EnsI3 was quite different from that of EnsI1 and EnsI2. X097 produced different AHL profiles in Luria-Bertani (LB and NFB medium, under biofilm and planktonic lifestyle, respectively. Notably, expression of ensI1 and ensI2 but not ensI3 is hypersensitive to different lifestyles and nutrients. The hypersensitive response of plasmid-encoded AHL synthase genes to different culture conditions may shed a light on the phylogenetic development of AHL synthase genes in Rhizobiaceae family.

  7. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  8. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  9. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  10. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    . In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...... feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases...... only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based...

  11. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  12. Predominance of a versatile-peroxidase-encoding gene, mnp4, as demonstrated by gene replacement via a gene targeting system for Pleurotus ostreatus.

    Science.gov (United States)

    Salame, Tomer M; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded; Hadar, Yitzhak

    2012-08-01

    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn(2+)-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn(2+)-dependent and Mn(2+)-independent peroxidase activity under Mn(2+)-deficient culture conditions.

  13. Predominance of a Versatile-Peroxidase-Encoding Gene, mnp4, as Demonstrated by Gene Replacement via a Gene Targeting System for Pleurotus ostreatus

    Science.gov (United States)

    Salame, Tomer M.; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded

    2012-01-01

    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient culture conditions. PMID:22636004

  14. In search of essentiality: Mollicute-specific genes shared by twelve genomes

    Directory of Open Access Journals (Sweden)

    Rangel Celso Souza

    2007-01-01

    Full Text Available Mollicutes are cell wall-less bacteria with a genome characterized by its small size. Chromosomal rearrangements help these organisms evade host immune surveillance and hence cause disease. Our goal was to determine genes shared by Mollicutes genomes using the bidirectional best hit methodology. The twelve studied Mollicutes share 210 genes, most of which (> 60% fall into the following COG categories: translation, ribosomal structure and biogenesis; DNA replication, recombination and repair; nucleotide transport and metabolism and energy production and conversion. Thirty Mollicute-specific genes were identified, 22 of them previously described as essential genes in Mycoplasma genitalium.

  15. The habenulo-raphe serotonergic circuit encodes an aversive expectation value essential for adaptive active avoidance of danger.

    Science.gov (United States)

    Amo, Ryunosuke; Fredes, Felipe; Kinoshita, Masae; Aoki, Ryo; Aizawa, Hidenori; Agetsuma, Masakazu; Aoki, Tazu; Shiraki, Toshiyuki; Kakinuma, Hisaya; Matsuda, Masaru; Yamazaki, Masako; Takahoko, Mikako; Tsuboi, Takashi; Higashijima, Shin-ichi; Miyasaka, Nobuhiko; Koide, Tetsuya; Yabuki, Yoichi; Yoshihara, Yoshihiro; Fukai, Tomoki; Okamoto, Hitoshi

    2014-12-03

    Anticipation of danger at first elicits panic in animals, but later it helps them to avoid the real threat adaptively. In zebrafish, as fish experience more and more danger, neurons in the ventral habenula (vHb) showed tonic increase in the activity to the presented cue and activated serotonergic neurons in the median raphe (MR). This neuronal activity could represent the expectation of a dangerous outcome and be used for comparison with a real outcome when the fish is learning how to escape from a dangerous to a safer environment. Indeed, inhibiting synaptic transmission from vHb to MR impaired adaptive avoidance learning, while panic behavior induced by classical fear conditioning remained intact. Furthermore, artificially triggering this negative outcome expectation signal by optogenetic stimulation of vHb neurons evoked place avoidance behavior. Thus, vHb-MR circuit is essential for representing the level of expected danger and behavioral programming to adaptively avoid potential hazard. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  17. Expression of the gapA gene encoding glyceraldehyde-3-phosphate dehydrogenase of Corynebacterium glutamicum is regulated by the global regulator SugR.

    Science.gov (United States)

    Toyoda, Koichi; Teramoto, Haruhiko; Inui, Masayuki; Yukawa, Hideaki

    2008-11-01

    Regulation of expression of the gapA gene encoding glyceraldehyde-3-phosphate dehydrogenase essential for glycolysis in Corynebacterium glutamicum was studied. We applied DNA affinity beads to isolate proteins binding to the promoter region of the gapA gene and obtained SugR, which has been shown to be a repressor of pts genes involved in sugar transport system. The results of electrophoretic mobility shift assays revealed that SugR specifically bound to the gapA promoter and the consensus sequence TGTTTG in the promoter region was required for its binding. We examined expression of the gapA gene in a sugR deletion mutant. Effect of mutation in the SugR binding site on gapA-lacZ fusion expression was also examined. These assays revealed that SugR acts as a negative transcriptional regulator of the gapA gene in the absence of sugar, and repression by SugR is alleviated in the presence of sugar, i.e., fructose and sucrose. Fructose-1-phosphate and fructose-1,6-bisphosphate revealed negative effects on binding of SugR to the gapA promoter, indicating that the sugar metabolites are involved in the derepression of gapA expression.

  18. Plasmid selection in Escherichia coli using an endogenous essential gene marker

    Directory of Open Access Journals (Sweden)

    Good Liam

    2008-08-01

    Full Text Available Abstract Background Antibiotic resistance genes are widely used for selection of recombinant bacteria, but their use risks contributing to the spread of antibiotic resistance. In particular, the practice is inappropriate for some intrinsically resistant bacteria and in vaccine production, and costly for industrial scale production. Non-antibiotic systems are available, but require mutant host strains, defined media or expensive reagents. An unexplored concept is over-expression of a host essential gene to enable selection in the presence of a chemical inhibitor of the gene product. To test this idea in E. coli, we used the growth essential target gene fabI as the plasmid-borne marker and the biocide triclosan as the selective agent. Results The new cloning vector, pFab, enabled selection by triclosan at 1 μM. Interestingly, pFab out-performed the parent pUC19-ampicillin system in cell growth, plasmid stability and plasmid yield. Also, pFab was toxic to host cells in a way that was reversed by triclosan. Therefore, pFab and triclosan are toxic when used alone but in combination they enhance growth and plasmid production through a gene-inhibitor interaction. Conclusion The fabI-triclosan model system provides an alternative plasmid selection method based on essential gene over-expression, without the use of antibiotic-resistance genes and conventional antibiotics.

  19. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.

    Science.gov (United States)

    Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-08-15

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Nucleotide variants of genes encoding components of the Wnt signalling pathway and the risk of non-syndromic tooth agenesis.

    Science.gov (United States)

    Mostowska, A; Biedziak, B; Zadurska, M; Dunin-Wilczynska, I; Lianeri, M; Jagodzinski, P P

    2013-11-01

    Tooth agenesis is one of the most common dental anomalies, with a complex and not yet fully elucidated aetiology. Given the crucial role of the Wnt signalling pathway during tooth development, the purpose of this study was to determine whether nucleotide variants of genes encoding components of this signalling pathway might be associated with hypodontia and oligodontia in the Polish population. A set of 34 single nucleotide polymorphism (SNPs) in 13 WNT and WNT-related genes were analyzed in a group of 157 patients with tooth agenesis and a properly matched control group (n = 430). In addition, direct sequencing was performed to detect mutations in the MSX1, PAX9 and WNT10A genes. Both single-marker and haplotype analyses showed highly significant association between SNPs in the WNT10A gene and the risk for tooth agenesis. Moreover, nine pathogenic mutations within the coding region of the WNT10A gene were identified in 26 out of 42 (62%) tested patients. One novel heterozygous mutation was identified in the PAX9 gene. Borderline association with the risk of non-syndromic tooth agenesis was also observed for the APC, CTNNB1, DVL2 and WNT11 polymorphisms. In conclusion, nucleotide variants of genes encoding important components of the Wnt signalling pathway might influence the risk of tooth agenesis. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The Aspergillus niger (ficuum) aphA gene encodes a pH 6.0-optimum acid phosphatase.

    Science.gov (United States)

    Mullaney, E J; Daly, C B; Ehrlich, K C; Ullah, A H

    1995-08-30

    We have used the Aspergillus niger (An) aphA gene as a probe and cloned the A. ficuum (Af) SRRC 265 gene encoding an extracellular pH 6.0-optimum acid phosphatase (APase6) from a genomic library. The identity of the Af aphA gene was confirmed and its nucleotide (nt) sequence verified by comparing its deduced amino acid (aa) sequence to that of purified Af APase6. A comparison of the nt sequences of the An and Af genes suggested that errors were made in the previously reported An aphA sequence. Several regions of the An aphA were resequenced and the mistakes corrected. With its nt sequence corrected, the An aphA is nearly identical to the cloned Af gene encoding APase6, and in 90.4% agreement in the coding regions. Both genes have three conserved introns and when translated, both nt sequences code for a polypeptide of 614 aa. There is now evidence that the two cloned genes are homologous and code for acid phosphatases that are 96% identical.

  2. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  3. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  4. AMD-associated genes encoding stress-activated MAPK pathway constituents are identified by interval-based enrichment analysis.

    Directory of Open Access Journals (Sweden)

    John Paul SanGiovanni

    Full Text Available PURPOSE: To determine whether common DNA sequence variants within groups of genes encoding elements of stress-activated mitogen-activated protein kinase (MAPK signaling pathways are, in aggregate, associated with advanced AMD (AAMD. METHODS: We used meta-regression and exact testing methods to identify AAMD-associated SNPs in 1177 people with AAMD and 1024 AMD-free elderly peers from 3 large-scale genotyping projects on the molecular genetics of AMD. SNPs spanning independent AAMD-associated genomic intervals were examined with a multi-locus-testing method (INRICH for enrichment within five sets of genes encoding constituents of stress-activated MAPK signaling cascades. RESULTS: Four-of-five pathway gene sets showed enrichment with AAMD-associated SNPs; findings persisted after adjustment for multiple testing in two. Strongest enrichment signals (P = 0.006 existed in a c-Jun N-terminal kinase (JNK/MAPK cascade (Science Signaling, STKE CMP_10827. In this pathway, seven independent AAMD-associated regions were resident in 6 of 25 genes examined. These included sequence variants in: 1 three MAP kinase kinase kinases (MAP3K4, MAP3K5, MAP3K9 that phosphorylate and activate the MAP kinase kinases MAP2K4 and MAP2K7 (molecules that phosphorylate threonine and tyrosine residues within the activation loop of JNK; 2 a target of MAP2K7 (JNK3A1 that activates complexes involved in transcriptional regulation of stress related genes influencing cell proliferation, apoptosis, motility, metabolism and DNA repair; and 3 NR2C2, a transcription factor activated by JNK1A1 (a drugable molecule influencing retinal cell viability in model systems. We also observed AAMD-related sequence variants resident in genes encoding PPP3CA (a drugable molecule that inactivates MAP3K5, and two genes (TGFB2, TGFBR2 encoding factors involved in MAPK sensing of growth factors/cytokines. CONCLUSIONS: Linkage disequilibrium (LD-independent genomic enrichment analysis yielded

  5. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others

    1995-01-01

    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  6. The POLARIS gene of Arabidopsis encodes a predicted peptide required for correct root growth and leaf vascular patterning.

    Science.gov (United States)

    Casson, Stuart A; Chilley, Paul M; Topping, Jennifer F; Evans, I Marta; Souter, Martin A; Lindsey, Keith

    2002-08-01

    The POLARIS (PLS) gene of Arabidopsis was identified as a promoter trap transgenic line, showing beta-glucuronidase fusion gene expression predominantly in the embryonic and seedling root, with low expression in aerial parts. Cloning of the PLS locus revealed that the promoter trap T-DNA had inserted into a short open reading frame (ORF). Rapid amplification of cDNA ends PCR, RNA gel blot analysis, and RNase protection assays showed that the PLS ORF is located within a short ( approximately 500 nucleotides) auxin-inducible transcript and encodes a predicted polypeptide of 36 amino acid residues. pls mutants exhibit a short-root phenotype and reduced vascularization of leaves. pls roots are hyperresponsive to exogenous cytokinins and show increased expression of the cytokinin-inducible gene ARR5/IBC6 compared with the wild type. pls seedlings also are less responsive to the growth-inhibitory effects of exogenous auxin and show reduced expression of the auxin-inducible gene IAA1 compared with the wild type. The PLS peptide-encoding region of the cDNA partially complements the pls mutation and requires the PLS ORF ATG for activity, demonstrating the functionality of the peptide-encoding ORF. Ectopic expression of the PLS ORF reduces root growth inhibition by exogenous cytokinins and increases leaf vascularization. We propose that PLS is required for correct auxin-cytokinin homeostasis to modulate root growth and leaf vascular patterning.

  7. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena.

    Science.gov (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia

    2010-07-01

    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  8. The Retrovirus pol Gene Encodes a Product Required for DNA Integration: Identification of a Retrovirus int Locus

    Science.gov (United States)

    Panganiban, Antonito T.; Temin, Howard M.

    1984-12-01

    We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.

  9. Identification of genes encoding hypothetical proteins in open-reading frame expressed sequence tags from mammalian stages of Trypanosoma cruzi.

    Science.gov (United States)

    Martins, C; Reis-Cunha, J L; Silva, M N; Pereira, E G; Pappas, G J; Bartholomeu, D C; Zingales, B

    2011-01-01

    Approximately 50% of the predicted protein-coding genes of the Trypanosoma cruzi CL Brener strain are annotated as hypothetical or conserved hypothetical proteins. To further characterize these genes, we generated 1161 open-reading frame expressed sequence tags (ORESTES) from the mammalian stages of the VL10 human strain. Sequence clustering resulted in 435 clusters, consisting of 339 singletons and 96 contigs. Significant matches to the T. cruzi predicted gene database were found for ~94% contigs and ~69% singletons. These included genes encoding surface proteins, known to be intensely expressed in the parasite mammalian stages and implicated in host cell invasion and/or immune evasion mechanisms. Among 151 contigs and singletons with similarity to predicted hypothetical protein-coding genes and conserved hypothetical protein-coding genes, 83% showed no match with T. cruzi EST and/or proteome databases. These ORESTES are the first experimental evidence that the corresponding genes are in fact transcribed. Sequences with no significant match were searched against several T. cruzi and National Center for Biotechnology Information non-redundant sequence databases. The ORESTES analysis indicated that 124 predicted conserved hypothetical protein-coding genes and 27 predicted hypothetical protein-coding genes annotated in the CL Brener genome are transcribed in the VL10 mammalian stages. Six ORESTES annotated as hypothetical protein-coding genes showing no match to EST and/or proteome databases were confirmed by Northern blot in VL10. The generation of this set of ORESTES complements the T. cruzi genome annotation and suggests new stage-regulated genes encoding hypothetical proteins.

  10. Identification and functional analysis of the genes encoding Δ6-desaturase from Ribes nigrum†

    Science.gov (United States)

    Song, Li-Ying; Lu, Wan-Xiang; Hu, Jun; Zhang, Yan; Yin, Wei-Bo; Chen, Yu-Hong; Hao, Shan-Ting; Wang, Bai-Lin; Wang, Richard R-C; Hu, Zan-Min

    2010-01-01

    Gamma-linolenic acid (γ-linolenic acid, GLA; C18:3 Δ6, 9, 12) belongs to the omega-6 family and exists primarily in several plant oils, such as evening primrose oil, blackcurrant oil, and borage oil. Δ6-desaturase is a key enzyme involved in the synthesis of GLA. There have been no previous reports on the genes encoding Δ6-desaturase in blackcurrant (Ribes nigrum L.). In this research, five nearly identical copies of Δ6-desaturase gene-like sequences, named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E, were isolated from blackcurrant. Heterologous expression in Saccharomyces cerevisiae and/or Arabidopsis thaliana confirmed that RnD6C/D/E were Δ6-desaturases that could use both α-linolenic acids (ALA; C18:3 Δ9,12,15) and linoleic acid (LA; C18:2 Δ9,12) precursors in vivo, whereas RnD8A/B were Δ8-sphlingolipid desaturases. Expression of GFP tagged with RnD6C/D/E showed that blackcurrant Δ6-desaturases were located in the mitochondrion (MIT) in yeast and the endoplasmic reticulum (ER) in tobacco. GC-MS results showed that blackcurrant accumulated GLA and octadecatetraenoic acids (OTA; C18:4 Δ6,9,12,15) mainly in seeds and a little in other organs and tissues. RT-PCR results showed that RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level only in seeds, leading to the accumulation of GLA and OTA in seeds. This research provides new insights to our understanding of GLA synthesis and accumulation in plants and the evolutionary relationship of this class of desaturases, and new clues as to the amino acid determinants which define precise enzyme activity. PMID:20231328

  11. Identification and functional analysis of the genes encoding Delta6-desaturase from Ribes nigrum.

    Science.gov (United States)

    Song, Li-Ying; Lu, Wan-Xiang; Hu, Jun; Zhang, Yan; Yin, Wei-Bo; Chen, Yu-Hong; Hao, Shan-Ting; Wang, Bai-Lin; Wang, Richard R-C; Hu, Zan-Min

    2010-06-01

    Gamma-linolenic acid (gamma-linolenic acid, GLA; C18:3 Delta(6, 9, 12)) belongs to the omega-6 family and exists primarily in several plant oils, such as evening primrose oil, blackcurrant oil, and borage oil. Delta(6)-desaturase is a key enzyme involved in the synthesis of GLA. There have been no previous reports on the genes encoding Delta(6)-desaturase in blackcurrant (Ribes nigrum L.). In this research, five nearly identical copies of Delta(6)-desaturase gene-like sequences, named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E, were isolated from blackcurrant. Heterologous expression in Saccharomyces cerevisiae and/or Arabidopsis thaliana confirmed that RnD6C/D/E were Delta(6)-desaturases that could use both alpha-linolenic acids (ALA; C18:3 Delta(9,12,15)) and linoleic acid (LA; C18:2 Delta(9,12)) precursors in vivo, whereas RnD8A/B were Delta(8)-sphingolipid desaturases. Expression of GFP tagged with RnD6C/D/E showed that blackcurrant Delta(6)-desaturases were located in the mitochondrion (MIT) in yeast and the endoplasmic reticulum (ER) in tobacco. GC-MS results showed that blackcurrant accumulated GLA and octadecatetraenoic acids (OTA; C18:4 Delta(6,9,12,15)) mainly in seeds and a little in other organs and tissues. RT-PCR results showed that RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level only in seeds, leading to the accumulation of GLA and OTA in seeds. This research provides new insights to our understanding of GLA synthesis and accumulation in plants and the evolutionary relationship of this class of desaturases, and new clues as to the amino acid determinants which define precise enzyme activity.

  12. From essential to persistent genes: a functional approach to constructing synthetic life

    DEFF Research Database (Denmark)

    Acevedo-Rocha, Carlos G.; Fang, Gang; Schmidt, Markus

    2013-01-01

    A central undertaking in synthetic biology (SB) is the quest for the ‘minimal genome’. However, ‘minimal sets’ of essential genes are strongly context-dependent and, in all prokaryotic genomes sequenced to date, not a single protein-coding gene is entirely conserved. Furthermore, a lack of consen......A central undertaking in synthetic biology (SB) is the quest for the ‘minimal genome’. However, ‘minimal sets’ of essential genes are strongly context-dependent and, in all prokaryotic genomes sequenced to date, not a single protein-coding gene is entirely conserved. Furthermore, a lack...... for engineering cells and for creating cellular life-like forms in SB....

  13. Overexpression of genes encoding glycolytic enzymes in Corynebacterium glutamicum enhances glucose metabolism and alanine production under oxygen deprivation conditions.

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki; Yukawa, Hideaki

    2012-06-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159-165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD(+) ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses.

  14. Impact of improving dietary amino acid balance for lactating sows on efficiency of dietary amino acid utilization and transcript abundance of genes encoding lysine transporters in mammary tissue.

    Science.gov (United States)

    Huber, L; de Lange, C F M; Ernst, C W; Krogh, U; Trottier, N L

    2016-11-01

    Lactating multiparous Yorkshire sows ( = 64) were used in 2 experiments to test the hypothesis that reducing dietary CP intake and improving AA balance through crystalline AA (CAA) supplementation improves apparent dietary AA utilization efficiency for milk production and increases transcript abundance of genes encoding Lys transporter proteins in mammary tissue. In Exp. 1, 40 sows were assigned to 1 of 4 diets: 1) high CP (HCP; 16.0% CP, as-fed basis; analyzed concentration), 2) medium-high CP (MHCP; 15.7% CP), 3) medium-low CP (MLCP; 14.3% CP), and 4) low CP (LCP; 13.2% CP). The HCP diet was formulated using soybean meal and corn as the only Lys sources. The reduced-CP diets contained CAA to meet estimated requirements for essential AA that became progressively limiting with reduction in CP concentration, that is, Lys, Ile, Met + Cys, Thr, Trp, and Val. Dietary standardized ileal digestible (SID) Lys concentration was 80% of the estimated requirement. In Exp. 2, 24 sows were assigned to the HCP or LCP diets. In Exp. 1, blood samples were postprandially collected 15 h on d 3, 7, 14, and 18 of lactation and utilization efficiency of dietary AA for milk production was calculated during early (d 3 to 7) and peak (d 14 to 18) lactation. Efficiency values were estimated from daily SID AA intakes and milk AA yield, with corrections for maternal AA requirement for maintenance and AA contribution from body protein losses. In Exp. 2, mammary tissue was biopsied on d 4 and 14 of lactation to determine the mRNA abundance of genes encoding Lys transporter proteins. In peak lactation, Lys, Thr, Trp, and Val utilization efficiency increased with decreasing dietary CP (linear for Trp and Val, < 0.05; in sows fed the MHCP diet vs. sows fed the HCP diet for Lys and Thr, < 0.05). Total essential and nonessential 15-h postprandial serum AA concentrations increased with decreasing dietary CP (linear, = 0.09 and < 0.05, respectively), suggesting increased maternal body protein

  15. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  16. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  17. Cloning and characterization of SmZF1, a gene encoding a Schistosoma mansoni zinc finger protein

    Directory of Open Access Journals (Sweden)

    Souza Paulo R Eleutério de

    2001-01-01

    Full Text Available The zinc finger motifs (Cys2His2 are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

  18. The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation

    Science.gov (United States)

    Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

    2014-01-01

    The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468

  19. Effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells

    Directory of Open Access Journals (Sweden)

    O. H. Minchenko

    2016-06-01

    Full Text Available We have studied the effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells under the inhibition of IRE1 (inositol requiring enzyme-1, which controls cell proliferation and tumor growth as a central mediator of endoplasmic reticulum stress. It was shown that hypoxia down-regulated gene expression of malate dehydrogenase 2 (MDH2, malic enzyme 2 (ME2, mitochondrial aspartate aminotransferase (GOT2, and subunit B of succinate dehydrogenase (SDHB in control (transfected by empty vector glioma cells in a gene specific manner. At the same time, the expression level of mitochondrial NADP+-dependent isocitrate dehydrogenase 2 (IDH2 and subunit D of succinate dehydrogenase (SDHD genes in these cells does not significantly change in hypoxic conditions. It was also shown that the inhibition of ІRE1 signaling enzyme function in U87 glioma cells decreases the effect of hypoxia on the expression of ME2, GOT2, and SDHB genes and introduces the sensitivity of IDH2 gene to hypoxia. Furthermore, the expression of all studied genes depends on IRE1-mediated endoplasmic reticulum stress signaling in gene specific manner, because ІRE1 knockdown significantly decreases their expression in normoxic conditions, except for IDH2 gene, which expression level is strongly up-regulated. Therefore, changes in the expression level of nuclear genes encoding ME2, MDH2, IDH2, SDHB, SDHD, and GOT2 proteins possibly reflect metabolic reprogramming of mitochondria by hypoxia and IRE1-mediated endoplasmic reticulum stress signaling and correlate with suppression of glioma cell proliferation under inhibition of the IRE1 enzyme function.

  20. Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases.

    OpenAIRE

    Watanabe, T.; Oyanagi, W; K. Suzuki(Kyoto University); Ohnishi, K.; Tanaka, H.

    1992-01-01

    The gene (chiD) encoding the precursor of chitinase D was found to be located immediately upstream of the chiA gene, encoding chitinase A1, which is a key enzyme in the chitinase system of Bacillus circulans WL-12. Sequencing analysis revealed that the deduced polypeptide encoded by the chiD gene was 488 amino acids long and the distance between the coding regions of the chiA and chiD genes was 103 bp. Remarkable similarity was observed between the N-terminal one-third of chitinase D and the ...

  1. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme......-linked immunosorbent assay (ELISA) approach. Overall, the truncated amino acid sequences showed close similarity (> 98% at the amino acid level) to previously reported sequences from chicken-derived C. perfringens isolates. Variations were however observed in 23 out of 379 aa positions leading to the definition of 26...

  2. Multiple sulfatase deficiency is caused by mutations in the gene encoding the human C(alpha)-formylglycine generating enzyme.

    Science.gov (United States)

    Dierks, Thomas; Schmidt, Bernhard; Borissenko, Ljudmila V; Peng, Jianhe; Preusser, Andrea; Mariappan, Malaiyalam; von Figura, Kurt

    2003-05-16

    C(alpha)-formylglycine (FGly) is the catalytic residue in the active site of eukaryotic sulfatases. It is posttranslationally generated from a cysteine in the endoplasmic reticulum. The genetic defect of FGly formation causes multiple sulfatase deficiency (MSD), a lysosomal storage disorder. We purified the FGly generating enzyme (FGE) and identified its gene and nine mutations in seven MSD patients. In patient fibroblasts, the activity of sulfatases is partially restored by transduction of FGE encoding cDNA, but not by cDNA carrying an MSD mutation. The gene encoding FGE is highly conserved among pro- and eukaryotes and has a paralog of unknown function in vertebrates. FGE is localized in the endoplasmic reticulum and is predicted to have a tripartite domain structure.

  3. Cartilage tissue formation from dedifferentiated chondrocytes by codelivery of BMP-2 and SOX-9 genes encoding bicistronic vector.

    Science.gov (United States)

    Cha, Byung-Hyun; Kim, Jae-Hwan; Kang, Sun-Woong; Do, Hyun-Jin; Jang, Ju-Woong; Choi, Yon Rak; Park, Hansoo; Kim, Byung-Soo; Lee, Soo-Hong

    2013-01-01

    Articular cartilage, when damaged by degenerative disease or trauma, has limited ability for self-repair. Recently, many trials have demonstrated that gene therapy combined with tissue engineering techniques would be a promising approach for cartilage regeneration. Bone morphogenetic protein 2 (BMP-2) is an important signal for upregulation of osteogenesis and chondrogenesis of stem cells. Sex-determining region Y box gene 9 (SOX-9) has also been reported as one of the key transcription factors for chondrogenesis. We hypothesized that codelivery of BMP-2 and SOX-9 genes would result in improved efficiency of recovery of normal chondrogenic properties in dedifferentiated chondrocytes. To this aim, we constructed a bicistronic vector encoding the BMP-2 and SOX-9 genes linked to the "self-cleaving" 2A peptide sequence. After gene delivery to dedifferentiated chondrocytes using a microporator transfection system, we confirmed over 65% delivery efficiency of the BMP-2 and SOX-9 genes. According to RT-PCR analysis and Alcian blue staining, simultaneous delivery of BMP-2/SOX-9 resulted in significantly increased expression of chondrogenesis-related markers (type II collagen and aggrecan) and GAG matrix formation compared with individual delivery of the BMP-2 or SOX-9 gene. Six weeks after in vivo transplantation, BMP-2/SOX-9 genes also showed a significant increase in cartilage formation compared with the BMP-2 or SOX-9 gene. These results demonstrate that codelivery of two chondrogenic lineage-determining genes can enhance normal chondrogenic properties of dedifferentiated chondrocytes followed by improved cartilage formation.

  4. Biosynthesis of Actinorhodin and Related Antibiotics: Discovery of Alternative Routes for Quinone Formation Encoded in the act Gene Cluster

    National Research Council Canada - National Science Library

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-01-01

    .... Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  5. Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control.

    OpenAIRE

    Yamagishi, M.; Matsushima, H; Wada, A.; Sakagami, M.; Fujita, N.; Ishihama, A

    1993-01-01

    Ribosome modulation factor (RMF) is a protein specifically associated with 100S ribosome dimers which start to accumulate in Escherichia coli cells upon growth transition from exponential to stationary phase. The structural gene, rmf, encoding the 55 amino acid residues RMF protein has been cloned from the 21.8 min region of the E. coli genome and sequenced. While rmf was silent in rapidly growing exponential phase cells, a high level of transcription took place concomitantly with the growth ...

  6. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.

    OpenAIRE

    Kashiwagi, K; Miyamoto, S; Suzuki, F; Kobayashi, H; Igarashi, K

    1992-01-01

    Excretion of putrescine from Escherichia coli was assessed by measuring its uptake into inside-out membrane vesicles. The vesicles were prepared from wild-type E. coli or E. coli transformed with plasmids containing one of the three polyamine transport systems. The results indicate that excretion of putrescine is catalyzed by the putrescine transport protein, encoded by the potE gene located at 16 min on the E. coli chromosome. Loading of ornithine (or lysine) inside the vesicles was essentia...

  7. [Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

    Science.gov (United States)

    Bukowski, Karol; Woźniak, Katarzyna

    2017-10-12

    Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(1). This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  8. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics

    OpenAIRE

    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan

    2011-01-01

    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown wheth...

  9. Aggregatibacter actinomycetemcomitans QseBC is activated by catecholamines and iron and regulates genes encoding proteins associated with anaerobic respiration and metabolism.

    Science.gov (United States)

    Weigel, W A; Demuth, D R; Torres-Escobar, A; Juárez-Rodríguez, M D

    2015-10-01

    Aggregatibacter actinomycetemcomitans QseBC regulates its own expression and is essential for biofilm growth and virulence. However, the signal that activates the QseC sensor has not been identified and the qseBC regulon has not been defined. In this study, we show that QseC is activated by catecholamine hormones and iron but not by either component alone. Activation of QseC requires an EYRDD motif in the periplasmic domain of the sensor and site-specific mutations in EYRDD or the deletion of the periplasmic domain inhibits catecholamine/iron-dependent induction of the ygiW-qseBC operon. Catecholamine/iron-dependent induction of transcription also requires interaction of the QseB response regulator with its binding site in the ygiW-qseBC promoter. Whole genome microarrays were used to compare gene expression profiles of A. actinomycetemcomitans grown in a chemically defined medium with and without catecholamine and iron supplementation. Approximately 11.5% of the A. actinomycetemcomitans genome was differentially expressed by at least two-fold upon exposure to catecholamines and iron. The expression of ferritin was strongly induced, suggesting that intracellular iron storage capacity is increased upon QseBC activation. Consistent with this, genes encoding iron binding and transport proteins were down-regulated by QseBC. Strikingly, 57% of the QseBC up-regulated genes (56/99) encode proteins associated with anaerobic metabolism and respiration. Most of these up-regulated genes were recently reported to be induced during in vivo growth of A. actinomycetemcomitans. These results suggest that detection of catecholamines and iron by QseBC may alter the cellular metabolism of A. actinomycetemcomitans for increased fitness and growth in an anaerobic host environment. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Isolation and analysis of a gene encoding alpha-glucuronidase, an enzyme with a novel primary structure involved in the breakdown of xylan.

    Science.gov (United States)

    Ruile, P; Winterhalter, C; Liebl, W

    1997-01-01

    This is the first report describing the analysis of a gene encoding an alpha-glucuronidase, an enzyme essential for the complete breakdown of substituted xylans. A DNA fragment that carries the gene for alpha-glucuronidase was isolated from chromosomal DNA of the hyperthermophilic bacterium Thermotoga maritima MSB8. The alpha-glucuronidase gene (aguA) was identified and characterized with the aid of nucleotide sequence analysis, deletion experiments and expression studies in Escherichia coli, and the start of the coding region was defined by amino-terminal sequencing of the purified recombinant enzyme. The aguA gene encodes a 674-amino-acid, largely hydrophilic polypeptide with a calculated molecular mass of 78593 Da. The alpha-glucuronidase of T. maritima has a novel primary structure with no significant similarity to any other known amino acid sequence. The recombinant enzyme was purified to homogeneity as judged by SDS-PAGE. Gel filtration analysis at low salt concentrations revealed a high apparent molecular mass (> 630 kDa) for the recombinant enzyme, but the oligomeric structure changed upon variation of the ionic strength or the pH, yielding hexameric and/or dimeric forms which were also enzymatically active. The enzyme hydrolysed 2-O-(4-O-methyl-alpha-D-glucopyranosyluronic acid)-D-xylobiose (MeGlcAX2) to xylobiose and 4-O-methylglucuronic acid. The K(m) for MeGlcAX2 was 0.95 mM. The pH optimum was 6.3. Maximum activity was measured at 85 degrees C, about 25 degrees C or more above the values reported for all other alpha-glucuronidases known to date. When incubated at 55-75 degrees C, the enzyme suffered partial inactivation, but thereafter the residual activity remained nearly constant for several days.

  11. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Bijlsma, Jetta J. E.; Burghout, Peter; Moosterman, Tomas G.; Bootsma, Flester J.; de Jong, Anne; Hermans, Peter W. M.; Kuipers, Oscar P.; Kloosterman, Tomas G.; Bootsma, Hester J.

    Streptococcus pneumoniae is a major cause of serious infections such as pneumonia and meningitis in both children and adults worldwide. Here, we describe the development of a high-throughput, genome-wide technique, genomic array footprinting (GAF), for the identification of genes essential for this

  12. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae.

    NARCIS (Netherlands)

    Bijlsma, J.J.; Burghout, P.J.; Kloosterman, T.G.; Bootsma, H.J.; Jong, A. de.; Hermans, P.W.M.; Kuipers, O.P.

    2007-01-01

    Streptococcus pneumoniae is a major cause of serious infections such as pneumonia and meningitis in both children and adults worldwide. Here, we describe the development of a high-throughput, genome-wide technique, genomic array footprinting (GAF), for the identification of genes essential for this

  13. The Flavin-Containing Monooxygenase 3 Gene and Essential Hypertension: The Joint Effect of Polymorphism E158K and Cigarette Smoking on Disease Susceptibility

    Science.gov (United States)

    Bushueva, Olga; Solodilova, Maria; Churnosov, Mikhail; Ivanov, Vladimir; Polonikov, Alexey

    2014-01-01

    Gene encoding flavin-containing monooxygenase 3 (FMO3), a microsomal antioxidant defense enzyme, has been suggested to contribute to essential hypertension (EH). The present study was designed to investigate whether common functional polymorphism E158K (rs2266782) of the FMO3 gene is associated with EH susceptibility in a Russian population. A total of 2 995 unrelated subjects from Kursk (1 362 EH patients and 843 healthy controls) and Belgorod (357 EH patients and 422 population controls) regions of Central Russia were recruited for this study. DNA samples from all study participants were genotyped for the FMO3 gene polymorphism through PCR followed by RFLP analysis. We found that the polymorphism E158K is associated with increased risk of essential hypertension in both discovery population from Kursk region (OR 1.36 95% CI 1.09–1.69, P = 0.01) and replication population from Belgorod region (OR 1.54 95% CI 1.07–1.89, P = 0.02) after adjustment for gender and age using logistic regression analysis. Further analysis showed that the increased hypertension risk in carriers of genotype 158KK gene occurred in cigarette smokers, whereas nonsmoker carriers of this genotype did not show the disease risk. This is the first study reporting the association of the FMO3 gene polymorphism and the risk of essential hypertension. PMID:25243081

  14. The UmGcn5 gene encoding histone acetyltransferase from Ustilago maydis is involved in dimorphism and virulence.

    Science.gov (United States)

    González-Prieto, Juan Manuel; Rosas-Quijano, Raymundo; Domínguez, Angel; Ruiz-Herrera, José

    2014-10-01

    We isolated a gene encoding a histone acetyltransferase from Ustilago maydis (DC.) Cda., which is orthologous to the Saccharomyces cerevisiae GCN5 gene. The gene was isolated from genomic clones identified by their specific hybridization to a gene fragment obtained by the polymerase chain reaction (PCR). This gene (Umgcn5; um05168) contains an open reading frame (ORF) of 1421bp that encodes a putative protein of 473 amino acids with a Mr. of 52.6kDa. The protein exhibits a high degree of homology with histone acetyltransferases from different organisms. Null a2b2 ΔUmgcn5 mutants were constructed by substitution of the region encoding the catalytic site with a hygromycin B resistance cassette. Null a1b1 ΔUmgcn5 mutants were isolated from genetic crosses of a2b2 ΔUmgcn5 and a1b1 wild-type strains in maize. Mutants displayed a slight reduction in growth rate under different conditions, and were more sensitive than the wild type to stress conditions, but more important, they grew as long mycelial cells, and formed fuzz-like colonies under all conditions where wild-type strains grew in the yeast-like morphology and formed smooth colonies. This phenotype was not reverted by cAMP addition. Mutants were not virulent to maize plants, and were unable to form teliospores. These phenotypic alterations of the mutants were reverted by their transformation with the wild-type gene. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Role of the host-selective ACT-toxin synthesis gene ACTTS2 encoding an enoyl-reductase in pathogenicity of the tangerine pathotype of Alternaria alternata.

    Science.gov (United States)

    Ajiro, Naoya; Miyamoto, Yoko; Masunaka, Akira; Tsuge, Takashi; Yamamoto, Mikihiro; Ohtani, Kouhei; Fukumoto, Takeshi; Gomi, Kenji; Peever, Tobin L; Izumi, Yuriko; Tada, Yasuomi; Akimitsu, Kazuya

    2010-02-01

    ABSTRACT The tangerine pathotype of Alternaria alternata produces host-selective ACT-toxin and causes Alternaria brown spot disease of tangerines and tangerine hybrids. Sequence analysis of a genomic BAC clone identified a previously uncharacterized portion of the ACT-toxin biosynthesis gene cluster (ACTT). A 1,034-bp gene encoding a putative enoyl-reductase was identified by using rapid amplification of cDNA ends and polymerase chain reaction and designated ACTTS2. Genomic Southern blots demonstrated that ACTTS2 is present only in ACT-toxin producers and is carried on a 1.9 Mb conditionally dispensable chromosome by the tangerine pathotype. Targeted gene disruption of ACTTS2 led to a reduction in ACT-toxin production and pathogenicity, and transcriptional knockdown of ACTTS2 using RNA silencing resulted in complete loss of ACT-toxin production and pathogenicity. These results indicate that ACTTS2 is an essential gene for ACT-toxin biosynthesis in the tangerine pathotype of A. alternata and is required for pathogenicity of this fungus.

  16. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  17. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...... Sp1 sites that confer significantly increased transcription potentially leading to rapid drug metabolism. This CES1A2 haplotype has previously been reported to be common among Asians. Using polymerase chain reaction followed by sequencing, the present study examined variation in the promoter and 5...

  18. Functional analysis of the protein encoded by the virulence gene psvA of Pseudomonas syringae pv. eriobotryae

    OpenAIRE

    Kamiunten, Hiroshi; Sakamaki, Ikuko; Matsuo, Mitsuhiro

    2011-01-01

    The Pseudomonas syringae pv. eriobotryae (Pse) virulence gene psvA, (2193 bp), has been isolated but not been functionally characterized. The psvA gene was divided into two parts; the N-terninal region (psvAN, nucleotides (nt) 1-1386), and the C-terminal region (psvAC, nt 1387-2193). Functional analysis of the proteins encoded by psvAN and psvAC was carried out. The PsvAC shows sequence similarity to the Ulp1 endopeptidase family, which includes small ubiquitin-like modifier (SUMO) proteases....

  19. Characterization of high-level expression and sequencing of the Escherichia coli K-12 cynS gene encoding cyanase.

    OpenAIRE

    Sung, Y C; Anderson, P M; Fuchs, J A

    1987-01-01

    Restriction fragments containing the gene encoding cyanase, cynS, without its transcriptional regulatory sequences were placed downstream of lac and tac promoters in various pUC derivatives to maximize production of cyanase. Plasmid pSJ105, which contains the cynS gene and an upstream open reading frame, gave the highest expression of cyanase. Approximately 50% of the total soluble protein in stationary-phase cultures of a lac-deleted strain containing plasmid pSJ105 was cyanase. The inserted...

  20. Comparative genomics of Mycoplasma: analysis of conserved essential genes and diversity of the pan-genome.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Mycoplasma, the smallest self-replicating organism with a minimal metabolism and little genomic redundancy, is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. This study employs comparative evolutionary analysis of twenty Mycoplasma genomes to gain an improved understanding of essential genes. By analyzing the core genome of mycoplasmas, we finally revealed the conserved essential genes set for mycoplasma survival. Further analysis showed that the core genome set has many characteristics in common with experimentally identified essential genes. Several key genes, which are related to DNA replication and repair and can be disrupted in transposon mutagenesis studies, may be critical for bacteria survival especially over long period natural selection. Phylogenomic reconstructions based on 3,355 homologous groups allowed robust estimation of phylogenetic relatedness among mycoplasma strains. To obtain deeper insight into the relative roles of molecular evolution in pathogen adaptation to their hosts, we also analyzed the positive selection pressures on particular sites and lineages. There appears to be an approximate correlation between the divergence of species and the level of positive selection detected in corresponding lineages.

  1. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  2. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, Henrik; Galili, G; Knudsen, S

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance the...... as observed in T0 seeds. It is concluded that the aspartate family pathway may be genetically engineered by the introduction of genes coding for feed-back-insensitive enzymes, preferentially giving elevated levels of lysine and methionine.......In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8...

  3. The yeast Dekkera bruxellensis genome contains two orthologs of the ARO10 gene encoding for phenylpyruvate decarboxylase.

    Science.gov (United States)

    de Souza Liberal, Anna Theresa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante; Simões, Diogo Ardaillon; de Morais, Marcos Antonio

    2012-07-01

    The yeast Dekkera bruxellensis possesses important physiological traits that enable it to grow in industrial environments as either spoiling yeast of wine production or a fermenting strain used for lambic beer, or fermenting yeast in the bioethanol production process. In this work, in silico analysis of the Dekkera genome database allowed the identification of two paralogous genes encoding for phenylpyruvate decarboxylase (DbARO10) that represents a unique trait among the hemiascomycetes. The molecular analysis of the theoretical protein confirmed its protein identity. Upon cultivation of the cell in medium containing phenylpyruvate, both increases in gene expression and in phenylpyruvate decarboxylase activity were observed. Both genes were differentially expressed depending on the culture condition and the type of metabolism, which indicated the difference in the biological function of their corresponding proteins. The importance of the duplicated DbARO10 genes in the D. bruxellensis genome was discussed and represents the first effort to understand the production of flavor by this yeast.

  4. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  5. A family of genes encoding zona pellucida (ZP) domain proteins is expressed in various epithelial tissues during Drosophila embryogenesis.

    Science.gov (United States)

    Jaźwińska, Anna; Affolter, Markus

    2004-07-01

    Zona pellucida (ZP) domain proteins have been identified in various species from worms to humans. Most of the characterized ZP family members are secreted or remain anchored to the plasma membrane where they play a structural role and/or act as receptors. In humans, several ZP proteins attracted attention because of their abundant expression in certain organs and their relation to various diseases. Here, we compare the molecular architecture and embryonic expression pattern of the 18 genes encoding ZP proteins in Drosophila melanogaster. Only five of these genes have been genetically characterized. All ZP genes are expressed in the embryo in epithelial tissues, such as the foregut, the hindgut, the Malpighian tubules, the salivary glands, the tracheal system, sensory organs and epidermis. Five genes are expressed during oogenesis; two of them are transcribed in the follicular epithelium, but not in the germ line cells.

  6. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren

    2010-04-01

    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  7. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  8. Fructose 2,6-bisphosphate is essential for glucose-regulated gene transcription of glucose-6-phosphatase and other ChREBP target genes in hepatocytes.

    Science.gov (United States)

    Arden, Catherine; Tudhope, Susan J; Petrie, John L; Al-Oanzi, Ziad H; Cullen, Kirsty S; Lange, Alex J; Towle, Howard C; Agius, Loranne

    2012-04-01

    Glucose metabolism in the liver activates the transcription of various genes encoding enzymes of glycolysis and lipogenesis and also G6pc (glucose-6-phosphatase). Allosteric mechanisms involving glucose 6-phosphate or xylulose 5-phosphate and covalent modification of ChREBP (carbohydrate-response element-binding protein) have been implicated in this mechanism. However, evidence supporting an essential role for a specific metabolite or pathway in hepatocytes remains equivocal. By using diverse substrates and inhibitors and a kinase-deficient bisphosphatase-active variant of the bifunctional enzyme PFK2/FBP2 (6-phosphofructo-2-kinase-fructose-2,6-bisphosphatase), we demonstrate an essential role for fructose 2,6-bisphosphate in the induction of G6pc and other ChREBP target genes by glucose. Selective depletion of fructose 2,6-bisphosphate inhibits glucose-induced recruitment of ChREBP to the G6pc promoter and also induction of G6pc by xylitol and gluconeogenic precursors. The requirement for fructose 2,6-bisphosphate for ChREBP recruitment to the promoter does not exclude the involvement of additional metabolites acting either co-ordinately or at downstream sites. Glucose raises fructose 2,6-bisphosphate levels in hepatocytes by reversing the phosphorylation of PFK2/FBP2 at Ser32, but also independently of Ser32 dephosphorylation. This supports a role for the bifunctional enzyme as the phosphometabolite sensor and for its product, fructose 2,6-bisphosphate, as the metabolic signal for substrate-regulated ChREBP-mediated expression of G6pc and other ChREBP target genes.

  9. Prediction of essential proteins based on subcellular localization and gene expression correlation.

    Science.gov (United States)

    Fan, Yetian; Tang, Xiwei; Hu, Xiaohua; Wu, Wei; Ping, Qing

    2017-12-01

    Essential proteins are indispensable to the survival and development process of living organisms. To understand the functional mechanisms of essential proteins, which can be applied to the analysis of disease and design of drugs, it is important to identify essential proteins from a set of proteins first. As traditional experimental methods designed to test out essential proteins are usually expensive and laborious, computational methods, which utilize biological and topological features of proteins, have attracted more attention in recent years. Protein-protein interaction networks, together with other biological data, have been explored to improve the performance of essential protein prediction. The proposed method SCP is evaluated on Saccharomyces cerevisiae datasets and compared with five other methods. The results show that our method SCP outperforms the other five methods in terms of accuracy of essential protein prediction. In this paper, we propose a novel algorithm named SCP, which combines the ranking by a modified PageRank algorithm based on subcellular compartments information, with the ranking by Pearson correlation coefficient (PCC) calculated from gene expression data. Experiments show that subcellular localization information is promising in boosting essential protein prediction.

  10. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  11. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species.

    Science.gov (United States)

    Lescat, Mathilde; Hoede, Claire; Clermont, Olivier; Garry, Louis; Darlu, Pierre; Tuffery, Pierre; Denamur, Erick; Picard, Bertrand

    2009-12-29

    Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. We identified the gene encoding esterase B as the acetyl-esterase gene (aes) using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR) strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  12. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant № 14-04-00173.

  13. MicroRNAs tend to synergistically control expression of genes encoding extensively-expressed proteins in humans

    Directory of Open Access Journals (Sweden)

    Xue Chen

    2017-08-01

    Full Text Available Considering complicated microRNA (miRNA biogenesis and action mechanisms, it was thought so high energy-consuming for a cell to afford simultaneous over-expression of many miRNAs. Thus it prompts that an alternative miRNA regulation pattern on protein-encoding genes must exist, which has characteristics of energy-saving and precise protein output. In this study, expression tendency of proteins encoded by miRNAs’ target genes was evaluated in human organ scale, followed by quantitative assessment of miRNA synergism. Expression tendency analysis suggests that universally expressed proteins (UEPs tend to physically interact in clusters and participate in fundamental biological activities whereas disorderly expressed proteins (DEPs are inclined to relatively independently execute organ-specific functions. Consistent with this, miRNAs that mainly target UEP-encoding mRNAs, such as miR-21, tend to collaboratively or even synergistically act with other miRNAs in fine-tuning protein output. Synergistic gene regulation may maximize miRNAs’ efficiency with less dependence on miRNAs’ abundance and overcome the deficiency that targeting plenty of genes by single miRNA makes miRNA-mediated regulation high-throughput but insufficient due to target gene dilution effect. Furthermore, our in vitro experiment verified that merely 25 nM transfection of miR-21 be sufficient to influence the overall state of various human cells. Thus miR-21 was identified as a hub in synergistic miRNA–miRNA interaction network. Our findings suggest that synergistic miRNA–miRNA interaction is an important endogenous miRNA regulation mode, which ensures adequate potency of miRNAs at low abundance, especially those implicated in fundamental biological regulation.

  14. The p10 gene of Bombyx mori nucleopolyhedrosis virus encodes a ...

    Indian Academy of Sciences (India)

    In baculovirus-based high-level expression of cloned foreign genes, the viral very late gene promoters of polyhedrin (polh) and p10 are extensively exploited. Here we report the cloning and characterization of the p10 gene from a local isolate of Bombyx mori nucleopolyhedrosis virus (BmNPV). The gene harbours a 213-bp ...

  15. Risk conferred by FokI polymorphism of vitamin D receptor (VDR) gene for essential hypertension.

    Science.gov (United States)

    Swapna, N; Vamsi, U Mohana; Usha, G; Padma, T

    2011-09-01

    The vitamin D receptor (VDR) gene serves as a good candidate gene for susceptibility to several diseases. The gene has a critical role in regulating the renin-angiotensin system (RAS) influencing the regulation of blood pressure. Hence determining the association of VDR polymorphisms with essential hypertension is expected to help in the evaluation of risk for the condition. The aim of this study was to evaluate association between VDRFok I polymorphism and genetic susceptibility to essential hypertension. Two hundred and eighty clinically diagnosed hypertensive patients and 200 normotensive healthy controls were analyzed for Fok I (T/C) [rs2228570] polymorphism by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Genotype distribution and allele frequencies in patients and controls, and odds ratios (ORs) were calculated to predict the risk for developing hypertension by the individuals of different genotypes. The genotype distribution and allele frequencies of Fok I (T/C) [rs2228570] VDR polymorphism differed significantly between patients and controls (χ(2) of 18.0; 2 degrees of freedom; P = 0.000). FF genotype and allele F were at significantly greater risk for developing hypertension and the risk was elevated for both the sexes, cases with positive family history and habit of smoking. Our data suggest that VDR gene Fok I polymorphism is associated with the risk of developing essential hypertension.

  16. Effective identification of essential proteins based on priori knowledge, network topology and gene expressions.

    Science.gov (United States)

    Li, Min; Zheng, Ruiqing; Zhang, Hanhui; Wang, Jianxin; Pan, Yi

    2014-06-01

    Identification of essential proteins is very important for understanding the minimal requirements for cellular life and also necessary for a series of practical applications, such as drug design. With the advances in high throughput technologies, a large number of protein-protein interactions are available, which makes it possible to detect proteins' essentialities from the network level. Considering that most species already have a number of known essential proteins, we proposed a new priori knowledge-based scheme to discover new essential proteins from protein interaction networks. Based on the new scheme, two essential protein discovery algorithms, CPPK and CEPPK, were developed. CPPK predicts new essential proteins based on network topology and CEPPK detects new essential proteins by integrating network topology and gene expressions. The performances of CPPK and CEPPK were validated based on the protein interaction network of Saccharomyces cerevisiae. The experimental results showed that the priori knowledge of known essential proteins was effective for improving the predicted precision. The predicted precisions of CPPK and CEPPK clearly exceeded that of the other 10 previously proposed essential protein discovery methods: Degree Centrality (DC), Betweenness Centrality (BC), Closeness Centrality (CC), Subgraph Centrality (SC), Eigenvector Centrality (EC), Information Centrality (IC), Bottle Neck (BN), Density of Maximum Neighborhood Component (DMNC), Local Average Connectivity-based method (LAC), and Network Centrality (NC). Especially, CPPK achieved 40% improvement in precision over BC, CC, SC, EC, and BN, and CEPPK performed even better. CEPPK was also compared to four other methods (EPC, ORFL, PeC, and CoEWC) which were not node centralities and CEPPK was showed to achieve the best results. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality.

    Science.gov (United States)

    Liberati, Nicole T; Urbach, Jonathan M; Thurber, Tara K; Wu, Gang; Ausubel, Frederick M

    2008-01-01

    Putative essential genes can be identified by comparing orthologs not disrupted in multiple near-saturated transposon insertion mutation libraries in related strains of the same bacterial species. Methods for identifying all orthologs between two bacterial strains and putative essential orthologs are described. In addition, protocols detailing near-saturation transposon insertion mutagenesis of bacteria are presented, including (1) conjugation-mediated mutagenesis, (2) automated colony picking and liquid handling of mutant cultures, and (3) arbitrary polymerase chain reaction amplification and sequencing of genomic DNA adjacent to transposon insertion sites.

  18. Locus heterogeneity disease genes encode proteins with high interconnectivity in the human protein interaction network

    Directory of Open Access Journals (Sweden)

    Benjamin eKeith

    2014-12-01

    Full Text Available Mutations in genes potentially lead to a number of genetic diseases with differing severity. These disease genes have been the focus of research in recent years showing that the disease gene population as a whole is not homogeneous, and can be categorised according to their interactions. Locus heterogeneity describes a single disorder caused by mutations in different genes each acting individually to cause the same disease. Using datasets of experimentally derived human disease genes and protein interactions, we created a protein interaction network to investigate the relationships between the products of genes associated with a disease displaying locus heterogeneity, and use network parameters to suggest properties that distinguish these disease genes from the overall disease gene population. Through the manual curation of known causative genes of 100 diseases displaying locus heterogeneity and 397 single-gene Mendelian disorders, we use network parameters to show that our locus heterogeneity network displays distinct properties from the global disease network and a Mendelian network. Using the global human proteome, through random simulation of the network we show that heterogeneous genes display significant interconnectivity. Further topological analysis of this network revealed clustering of locus heterogeneity genes that cause identical disorders, indicating that these disease genes are involved in similar biological processes. We then use this information to suggest novel genes that may also contribute to diseases with locus heterogeneity.

  19. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Science.gov (United States)

    Busk, Peter K; Lange, Mette; Pilgaard, Bo; Lange, Lene

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  20. Isolation of an osmotic stress- and abscisic acid-induced gene encoding an acidic endochitinase from Lycopersicon chilense.

    Science.gov (United States)

    Chen, R D; Yu, L X; Greer, A F; Cheriti, H; Tabaeizadeh, Z

    1994-10-28

    We have identified one osmotic stress- and abscisic acid-responsive member of the endochitinase (EC 3.2.1.14) gene family from leaves of drought-stressed Lycopersicon chilense plants, a natural inhabitant of extremely arid regions in South America. The 966-bp full-length cDNA (designated pcht28) encodes an acidic chitinase precursor with an amino-terminal signal peptide. The mature protein is predicted to have 229 amino acid residues with a relative molecular mass of 24,943 and pI value of 6.2. Sequence analysis revealed that pcht28 has a high degree of homology with class II chitinases (EC 3.2.1.14) from tomato and tobacco. Expression of the pcht28 protein in Escherichia coli verified that it is indeed a chitinase. Northern blot analysis indicated that this gene has evolved a different pattern of expression from that of other family members reported thus far. It is highly induced by both osmotic stress and the plant hormone abscisic acid. Southern blot analysis of genomic DNA suggested that the pcht28-related genes may form a small multigene family in this species. The efficiency of induction of the gene by drought stress, in leaves and stems, is significantly higher in L. chilense than in the cultivated tomato. It is speculated that, besides its general defensive function, the pcht28-encoded chitinase may play a particular role in plant development or in protecting plants from pathogen attack during water stress.

  1. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  2. The Escherichia coli Serogroup O1 and O2 Lipopolysaccharides Are Encoded by Multiple O-antigen Gene Clusters

    Science.gov (United States)

    Delannoy, Sabine; Beutin, Lothar; Mariani-Kurkdjian, Patricia; Fleiss, Aubin; Bonacorsi, Stéphane; Fach, Patrick

    2017-01-01

    Escherichia coli strains belonging to serogroups O1 and O2 are frequently associated with human infections, especially extra-intestinal infections such as bloodstream infections or urinary tract infections. These strains can be associated with a large array of flagellar antigens. Because of their frequency and clinical importance, a reliable detection of E. coli O1 and O2 strains and also the frequently associated K1 capsule is important for diagnosis and source attribution of E. coli infections in humans and animals. By sequencing the O-antigen clusters of various O1 and O2 strains we showed that the serogroups O1 and O2 are encoded by different sets of O-antigen encoding genes and identified potentially new O-groups. We developed qPCR-assays to detect the various O1 and O2 variants and the K1-encoding gene. These qPCR assays proved to be 100% sensitive and 100% specific and could be valuable tools for the investigations of zoonotic and food-borne infection of humans with O1 and O2 extra-intestinal (ExPEC) or Shiga toxin-producing E. coli (STEC) strains. PMID:28224115

  3. A Cooperia punctata gene family encoding 14 kDa excretory-secretory antigens conserved for trichostrongyloid nematodes.

    Science.gov (United States)

    Yatsuda, A P; De Vries, E; Vieira Bressan, M C; Eysker, M

    2001-12-01

    A polymorphic set of 14 kDa excretory-secretory (E-S) antigen-encoding cDNAs, with similarity to a previously characterized 15 kDa E-S antigen of Haemonchus contortus, was cloned from Cooperia punctata. Five cDNAs encoding predicted proteins of 70-80% identity were sequenced. Genomic analyses of individuals proved the existence of three 14 kDa E-S antigen-encoding genes, excluding that the differences reflected polymorphisms between individuals in a population. Southern blots indicated the presence of additional members of this gene family. Thus, despite the fact that heterologously expressed C. punctata 14 kDa E-S products are shown to be recognized by immune sera, potential pitfalls in the development of a recombinant vaccine are presented by this genetic diversity. Vaccine design could be further rationalized by knowledge of