WorldWideScience

Sample records for essential gene encoding

  1. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  2. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  3. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  4. Essential Bacillus subtilis genes

    DEFF Research Database (Denmark)

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related...... to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...

  5. ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

    Science.gov (United States)

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-25

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

  6. ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

    Science.gov (United States)

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-01

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

  7. Protein-protein association and cellular localization of four essential gene products encoded by tellurite resistance-conferring cluster "ter" from pathogenic Escherichia coli.

    Science.gov (United States)

    Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan

    2013-12-01

    Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.

  8. Data on the presence or absence of genes encoding essential proteins for ochratoxin and fumonisin biosynthesis in Aspergillus niger and Aspergillus welwitschiae

    Directory of Open Access Journals (Sweden)

    Fernanda Pelisson Massi

    2016-06-01

    Full Text Available We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17% highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5% highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5% highlights strains harboring the fum8 gene. Profile 4 (28% highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, “Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae” [1].

  9. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  10. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  11. The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc)

    DEFF Research Database (Denmark)

    Abildgaard, Lone; Højberg, Ole; Schramm, Andreas

    2010-01-01

    Proliferation of Clostridium perfringens type A in the broiler intestinal tract is related to poor growth and litter quality, and can under certain conditions lead to the development of necrotic enteritis (NE), a severe gastrointestinal disease in broilers. The aim of the present study was to inv...... quantification of C. perfringens type A in broilers, a real-time PCR assay, targeting the α-toxin-encoding plc gene, was developed for use in ileal and caecal samples and was shown to be a fast and reliable alternative to conventional plate counting....

  12. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  13. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  14. Structure and expression of GSL1 and GSL2 genes encoding gibberellin stimulated-like proteins in diploid and highly heterozygous tetraploid potato reveals their highly conserved and essential status.

    Science.gov (United States)

    Meiyalaghan, Sathiyamoorthy; Thomson, Susan J; Fiers, Mark W E J; Barrell, Philippa J; Latimer, Julie M; Mohan, Sara; Jones, E Eirian; Conner, Anthony J; Jacobs, Jeanne M E

    2014-01-02

    -down expression of GSL1 and GSL2, coupled with the rare incidence of SNPs in these genes, suggests an essential role for this gene family. These features are consistent with the GSL protein family playing a role in several aspects of plant development in addition to plant defence against biotic stresses.

  15. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces

    Science.gov (United States)

    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire

    2014-01-01

    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only putative helicase-nuclease-encoding genes identified were homologous to M. tuberculosis adnAB genes. These genes are conserved as a single copy in all sequenced genomes of Streptomyces. The disruption of adnAB in Streptomyces ambofaciens and Streptomyces coelicolor could not be achieved unless an ectopic copy was provided, indicating that adnAB is essential for growth. Both adnA and adnB genes were shown to be inducible in response to DNA damage (mitomycin C) and to be independently transcribed. Introduction of S. ambofaciens adnAB genes in an E. coli recB mutant restored viability and resistance to UV light, suggesting that Streptomyces AdnAB could be a functional homologue of RecBCD and be involved in DNA damage resistance. PMID:24837284

  16. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  17. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  18. Genes essential for phototrophic growth by a purple alphaproteobacterium: Genes for phototrophic growth

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jianming [Key Lab of Applied Mycology, College of Life Sciences, Qingdao Agricultural University, Qingdao Shandong Province People' s Republic of China; Department of Microbiology, University of Washington, Seattle WA USA; Yin, Liang [Department of Microbiology, University of Washington, Seattle WA USA; Lessner, Faith H. [Department of Biological Sciences, University of Arkansas, Fayetteville AR USA; Nakayasu, Ernesto S. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Payne, Samuel H. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Fixen, Kathryn R. [Department of Microbiology, University of Washington, Seattle WA USA; Gallagher, Larry [Department of Genome Sciences, University of Washington, Seattle WA USA; Harwood, Caroline S. [Department of Microbiology, University of Washington, Seattle WA USA

    2017-07-24

    Anoxygenic purple phototrophic bacteria have served as important models for studies of photophosphorylation. The pigment-protein complexes responsible for converting light energy to ATP are relatively simple and these bacteria can grow heterotrophically under aerobic conditions, thus allowing for the study of mutants defective in photophosphorylation. In the past, genes responsible for anoxygenic phototrophic growth have been identified in a number of different bacterial species. Here we systematically studied the genetic basis for this metabolism by using Tn-seq to identify genes essential for the anaerobic growth of the purple bacterium Rhodopseudomonas palustris on acetate in light. We identified 171 genes required for growth in this condition, 35 of which are annotated as photosynthesis genes. Among these are a few new genes not previously shown to be essential for phototrophic growth. We verified the essentiality of many of the genes we identified by analyzing the phenotypes of mutants we generated by Tn mutagenesis that had altered pigmentation. We used directed mutagenesis to verify that the R. palustris NADH:quinone oxidoreductase complex IE is essential for phototrophic growth. As a complement to the genetic data, we carried out proteomics experiments in which we found that 429 proteins were present in significantly higher amounts in cells grown anaerobically in light compared to aerobically. Among these were proteins encoded by subset of the phototrophic growth-essential genes.

  19. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  20. Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

    Directory of Open Access Journals (Sweden)

    DasSarma Shiladitya

    2007-06-01

    Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten

  1. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    International Nuclear Information System (INIS)

    Salem, Tamer Z.; Zhang, Fengrui; Thiem, Suzanne M.

    2013-01-01

    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  2. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: smthiem@msu.edu [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)

    2013-01-20

    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  3. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  4. Molecular Characterization of the Genes pcaG and pcaH, Encoding Protocatechuate 3,4-Dioxygenase, Which Are Essential for Vanillin Catabolism in Pseudomonas sp. Strain HR199

    Science.gov (United States)

    Overhage, Jörg; Kresse, Andreas U.; Priefert, Horst; Sommer, Horst; Krammer, Gerhard; Rabenhorst, Jürgen; Steinbüchel, Alexander

    1999-01-01

    Pseudomonas sp. strain HR199 is able to utilize eugenol (4-allyl-2-methoxyphenol), vanillin (4-hydroxy-3-methoxybenzaldehyde), or protocatechuate as the sole carbon source for growth. Mutants of this strain which were impaired in the catabolism of vanillin but retained the ability to utilize eugenol or protocatechuate were obtained after nitrosoguanidine mutagenesis. One mutant (SK6169) was used as recipient of a Pseudomonas sp. strain HR199 genomic library in cosmid pVK100, and phenotypic complementation was achieved with a 5.8-kbp EcoRI fragment (E58). The amino acid sequences deduced from two corresponding open reading frames (ORF) identified on E58 revealed high degrees of homology to pcaG and pcaH, encoding the two subunits of protocatechuate 3,4-dioxygenase. Three additional ORF most probably encoded a 4-hydroxybenzoate 3-hydroxylase (PobA) and two putative regulatory proteins, which exhibited homology to PcaQ of Agrobacterium tumefaciens and PobR of Pseudomonas aeruginosa, respectively. Since mutant SK6169 was also complemented by a subfragment of E58 that harbored only pcaH, this mutant was most probably lacking a functional β subunit of the protocatechuate 3,4-dioxygenase. Since this mutant was still able to grow on protocatechuate and lacked protocatechuate 4,5-dioxygenase and protocatechuate 2,3-dioxygenase, the degradation had to be catalyzed by different enzymes. Two other mutants (SK6184 and SK6190), which were also impaired in the catabolism of vanillin, were not complemented by fragment E58. Since these mutants accumulated 3-carboxy muconolactone during cultivation on eugenol, they most probably exhibited a defect in a step of the catabolic pathway following the ortho cleavage. Moreover, in these mutants cyclization of 3-carboxymuconic acid seems to occur by a syn absolute stereochemical course, which is normally only observed for cis,cis-muconate lactonization in pseudomonads. In conclusion, vanillin is degraded through the ortho-cleavage pathway

  5. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  6. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  7. Two homologous genes, DCW1 (YKL046c) and DFG5, are essential for cell growth and encode glycosylphosphatidylinositol (GPI)-anchored membrane proteins required for cell wall biogenesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kitagaki, Hiroshi; Wu, Hong; Shimoi, Hitoshi; Ito, Kiyoshi

    2002-11-01

    The cell wall of Saccharomyces cerevisiae consists of glucan, chitin and various kinds of mannoproteins. Major parts of mannoproteins are synthesized as glycosylphosphatidylinositol (GPI)-anchored proteins and are then transferred to cell wall beta-1,6-glucan. A glycosyltransferase has been hypothesized to catalyse this transfer reaction. A database search revealed that the products of YKL046c and DFG5 are homologous to bacterial mannosidase. These genes are homologous to each other and have primary structures characteristic of GPI-anchored proteins. Although single disruptants of ykl046c and dfg5 were viable, ykl046cDelta was hypersensitive to a cell wall-digesting enzyme (zymolyase), suggesting that this gene is involved in cell wall biosynthesis. We therefore designated this gene as DCW1 (defective cell wall). A double disruptant of dcw1 and dfg5 was synthetically lethal, indicating that the functions of these gene products are redundant, and at least one of them is required for cell growth. Cells deficient in both Dcw1p and Dfg5p were round and large, had cell walls that contained an increased amount of chitin and secreted a major cell wall protein, Cwp1p, into the medium. Biochemical analyses showed that epitope-tagged Dcw1p is an N-glycosylated, GPI-anchored membrane protein and is localized in the membrane fraction including the cell surface. These results suggest that both Dcw1p and Dfg5p are GPI-anchored membrane proteins and are required for normal biosynthesis of the cell wall.

  8. Exploring the Optimal Strategy to Predict Essential Genes in Microbes

    Directory of Open Access Journals (Sweden)

    Yao Lu

    2011-12-01

    Full Text Available Accurately predicting essential genes is important in many aspects of biology, medicine and bioengineering. In previous research, we have developed a machine learning based integrative algorithm to predict essential genes in bacterial species. This algorithm lends itself to two approaches for predicting essential genes: learning the traits from known essential genes in the target organism, or transferring essential gene annotations from a closely related model organism. However, for an understudied microbe, each approach has its potential limitations. The first is constricted by the often small number of known essential genes. The second is limited by the availability of model organisms and by evolutionary distance. In this study, we aim to determine the optimal strategy for predicting essential genes by examining four microbes with well-characterized essential genes. Our results suggest that, unless the known essential genes are few, learning from the known essential genes in the target organism usually outperforms transferring essential gene annotations from a related model organism. In fact, the required number of known essential genes is surprisingly small to make accurate predictions. In prokaryotes, when the number of known essential genes is greater than 2% of total genes, this approach already comes close to its optimal performance. In eukaryotes, achieving the same best performance requires over 4% of total genes, reflecting the increased complexity of eukaryotic organisms. Combining the two approaches resulted in an increased performance when the known essential genes are few. Our investigation thus provides key information on accurately predicting essential genes and will greatly facilitate annotations of microbial genomes.

  9. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  10. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  11. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  12. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  13. Exploring the relationship between fractal features and bacterial essential genes

    International Nuclear Information System (INIS)

    Yu Yong-Ming; Yang Li-Cai; Zhao Lu-Lu; Liu Zhi-Ping; Zhou Qian

    2016-01-01

    Essential genes are indispensable for the survival of an organism in optimal conditions. Rapid and accurate identifications of new essential genes are of great theoretical and practical significance. Exploring features with predictive power is fundamental for this. Here, we calculate six fractal features from primary gene and protein sequences and then explore their relationship with gene essentiality by statistical analysis and machine learning-based methods. The models are applied to all the currently available identified genes in 27 bacteria from the database of essential genes (DEG). It is found that the fractal features of essential genes generally differ from those of non-essential genes. The fractal features are used to ascertain the parameters of two machine learning classifiers: Naïve Bayes and Random Forest. The area under the curve (AUC) of both classifiers show that each fractal feature is satisfactorily discriminative between essential genes and non-essential genes individually. And, although significant correlations exist among fractal features, gene essentiality can also be reliably predicted by various combinations of them. Thus, the fractal features analyzed in our study can be used not only to construct a good essentiality classifier alone, but also to be significant contributors for computational tools identifying essential genes. (paper)

  14. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  16. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  17. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  18. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  19. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  20. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  1. ORF18 is a transfactor that is essential for late gene transcription of a gammaherpesvirus.

    Science.gov (United States)

    Arumugaswami, Vaithilingaraja; Wu, Ting-Ting; Martinez-Guzman, DeeAnn; Jia, Qingmei; Deng, Hongyu; Reyes, Nichole; Sun, Ren

    2006-10-01

    Lytic replication of the tumor-associated human gammaherpesviruses Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus has important implications in pathogenesis and tumorigenesis. Herpesvirus lytic genes have been temporally classified as exhibiting immediate-early (IE), early, and late expression kinetics. Though the regulation of IE and early gene expression has been studied extensively, very little is known regarding the regulation of late gene expression. Late genes, which primarily encode virion structural proteins, require viral DNA replication for their expression. We have identified a murine gammaherpesvirus 68 (MHV-68) early lytic gene, ORF18, essential for viral replication. ORF18 is conserved in both beta- and gammaherpesviruses. By generating an MHV-68 ORF18-null virus, we characterized the stage of the virus lytic cascade that requires the function of ORF18. Gene expression profiling and quantitation of viral DNA synthesis of the ORF18-null virus revealed that the expression of early genes and viral DNA replication were not affected; however, the transcription of late genes was abolished. Hence, we have identified a gammaherpesvirus-encoded factor essential for the expression of late genes independently of viral DNA synthesis.

  2. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  3. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  4. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  5. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin

    2016-08-22

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  6. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin; Abd El Ghany, Moataz; Naeem, Raeece; Lee, Kok-Wei; Tan, Yung-Chie; Pain, Arnab; Nathan, Sheila

    2016-01-01

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  7. Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS

    Directory of Open Access Journals (Sweden)

    Yee-Chin Wong

    2016-08-01

    Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  8. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  9. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  10. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  11. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  12. Identification of an essential virulence gene of cyprinid herpesvirus 3.

    Science.gov (United States)

    Boutier, Maxime; Gao, Yuan; Vancsok, Catherine; Suárez, Nicolás M; Davison, Andrew J; Vanderplasschen, Alain

    2017-09-01

    The genus Cyprinivirus consists of a growing list of phylogenetically related viruses, some of which cause severe economic losses to the aquaculture industry. The archetypal member, cyprinid herpesvirus 3 (CyHV-3) causes mass mortalities worldwide in koi and common carp. A CyHV-3 mutant was described previously that is attenuated in vivo by a deletion affecting two genes (ORF56 and ORF57). The relative contributions of ORF56 and ORF57 to the safety and efficacy profile of this vaccine candidate have now been assessed by analysing viruses individually deleted for ORF56 or ORF57. Inoculation of these viruses into carp demonstrated that the absence of ORF56 did not affect virulence, whereas the absence of ORF57 led to an attenuation comparable to, though slightly less than, that of the doubly deleted virus. To demonstrate further the role of ORF57 as a key virulence factor, a mutant retaining the ORF57 region but unable to express the ORF57 protein was produced by inserting multiple in-frame stop codons into the coding region. Analysis of this virus in vivo revealed a safety and efficacy profile comparable to that of the doubly deleted virus. These findings show that ORF57 encodes an essential CyHV-3 virulence factor. They also indicate that ORF57 orthologues in other cypriniviruses may offer promising targets for the rational design of attenuated recombinant vaccines. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  14. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  15. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  16. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  17. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  18. Functional requirements for bacteriophage growth: gene essentiality and expression in mycobacteriophage Giles.

    Science.gov (United States)

    Dedrick, Rebekah M; Marinelli, Laura J; Newton, Gerald L; Pogliano, Kit; Pogliano, Joseph; Hatfull, Graham F

    2013-05-01

    Bacteriophages represent a majority of all life forms, and the vast, dynamic population with early origins is reflected in their enormous genetic diversity. A large number of bacteriophage genomes have been sequenced. They are replete with novel genes without known relatives. We know little about their functions, which genes are required for lytic growth, and how they are expressed. Furthermore, the diversity is such that even genes with required functions - such as virion proteins and repressors - cannot always be recognized. Here we describe a functional genomic dissection of mycobacteriophage Giles, in which the virion proteins are identified, genes required for lytic growth are determined, the repressor is identified, and the transcription patterns determined. We find that although all of the predicted phage genes are expressed either in lysogeny or in lytic growth, 45% of the predicted genes are non-essential for lytic growth. We also describe genes required for DNA replication, show that recombination is required for lytic growth, and that Giles encodes a novel repressor. RNAseq analysis reveals abundant expression of a small non-coding RNA in a lysogen and in late lytic growth, although it is non-essential for lytic growth and does not alter lysogeny. © 2013 Blackwell Publishing Ltd.

  19. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  20. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  1. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  2. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  3. WHITE PANICLE3, a Novel Nucleus-Encoded Mitochondrial Protein, Is Essential for Proper Development and Maintenance of Chloroplasts and Mitochondria in Rice

    Directory of Open Access Journals (Sweden)

    Hongchang Li

    2018-06-01

    Full Text Available Mitochondria and chloroplasts are interacting organelles that play important roles in plant development. In addition to a small number proteins encoded by their own genomes, the majority of mitochondrial and chloroplast proteins are encoded in the cell nucleus and imported into the organelle. As a consequence, coordination between mitochondria, chloroplasts, and the nucleus is of crucial importance to plant cells. Variegated mutants are chloroplast-defective mutants and are considered to be ideal models for studying the intercommunication between these organelles. Here, we report the isolation of WHITE PANICLE3 (WP3, a nuclear gene involved in variegation, from a naturally occurring white panicle rice mutant. Disrupted expression of WP3 in the mutant leads to severe developmental defects in both chloroplasts and mitochondria, and consequently causes the appearance of white-striped leaves and white panicles in the mutant plants. Further investigation showed that WP3 encodes a protein most likely targeted to mitochondria and is specifically expressed in rice panicles. Interestingly, we demonstrate that the recessive white-panicle phenotype in the wp3 mutant is inherited in a typical Mendelian manner, while the white-striped leaf phenotype in wp3 is maternally inherited. Our data collectively suggest that the nucleus-encoded mitochondrial protein, WP3, plays an essential role in the regulation of chloroplast development in rice panicles by maintaining functional mitochondria. Therefore, the wp3 mutant is an excellent model in which to explore the communication between the nucleus, mitochondria, and chloroplasts in plant cells.

  4. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  5. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  6. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  7. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  8. Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.

    Science.gov (United States)

    Lowe, A M; Deresiewicz, R L

    1999-01-01

    Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

  9. Information dimension analysis of bacterial essential and nonessential genes based on chaos game representation

    International Nuclear Information System (INIS)

    Zhou, Qian; Yu, Yong-ming

    2014-01-01

    Essential genes are indispensable for the survival of an organism. Investigating features associated with gene essentiality is fundamental to the prediction and identification of the essential genes. Selecting features associated with gene essentiality is fundamental to predict essential genes with computational techniques. We use fractal theory to make comparative analysis of essential and nonessential genes in bacteria. The information dimensions of essential genes and nonessential genes available in the DEG database for 27 bacteria are calculated based on their gene chaos game representations (CGRs). It is found that weak positive linear correlation exists between information dimension and gene length. Moreover, for genes of similar length, the average information dimension of essential genes is larger than that of nonessential genes. This indicates that essential genes show less regularity and higher complexity than nonessential genes. Our results show that for bacterium with a similar number of essential genes and nonessential genes, the CGR information dimension is helpful for the classification of essential genes and nonessential genes. Therefore, the gene CGR information dimension is very probably a useful gene feature for a genetic algorithm predicting essential genes. (paper)

  10. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  11. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  12. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  13. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  14. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  15. A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.

    Science.gov (United States)

    Rogalski, T M; Riddle, D L

    1988-01-01

    The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.

  16. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  17. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  18. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  19. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  20. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  1. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  2. Genomewide Identification of Essential Genes and Fitness Determinants of Streptococcus mutans UA159

    Science.gov (United States)

    Zeng, Lin; Culp, David J.

    2018-01-01

    ABSTRACT Transposon mutagenesis coupled with next-generation DNA sequencing (Tn-seq) is a powerful tool for discovering regions of the genome that are required for the survival of bacteria in different environments. We adapted this technique to the dental caries pathogen Streptococcus mutans UA159 and identified 11% of the genome as essential, with many genes encoding products required for replication, translation, lipid metabolism, and cell wall biogenesis. Comparison of the essential genome of S. mutans UA159 with those of selected other streptococci for which such information is available revealed several metabolic pathways and genes that are required in S. mutans, but not in some Streptococcus spp. We further identified genes that are essential for sustained growth in rich or defined medium, as well as for persistence in vivo in a rodent model of oral infection. Collectively, our results provide a novel and comprehensive view of the genes required for essential processes of S. mutans, many of which could represent potential targets for therapeutics. IMPORTANCE Tooth decay (dental caries) is a common cause of pain, impaired quality of life, and tooth loss in children and adults. It begins because of a compositional change in the microorganisms that colonize the tooth surface driven by repeated and sustained carbohydrate intake. Although several bacterial species are associated with tooth decay, Streptococcus mutans is the most common cause. Therefore, it is important to identify biological processes that contribute to the survival of S. mutans in the human mouth, with the aim of disrupting the processes with antimicrobial agents. We successfully applied Tn-seq to S. mutans, discovering genes that are required for survival, growth, and persistence, both in laboratory environments and in a mouse model of tooth decay. This work highlights new avenues for the control of an important human pathogen. PMID:29435491

  3. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  4. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  5. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  6. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  7. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  8. Combining Shigella Tn-seq data with gold-standard E. coli gene deletion data suggests rare transitions between essential and non-essential gene functionality.

    Science.gov (United States)

    Freed, Nikki E; Bumann, Dirk; Silander, Olin K

    2016-09-06

    Gene essentiality - whether or not a gene is necessary for cell growth - is a fundamental component of gene function. It is not well established how quickly gene essentiality can change, as few studies have compared empirical measures of essentiality between closely related organisms. Here we present the results of a Tn-seq experiment designed to detect essential protein coding genes in the bacterial pathogen Shigella flexneri 2a 2457T on a genome-wide scale. Superficial analysis of this data suggested that 481 protein-coding genes in this Shigella strain are critical for robust cellular growth on rich media. Comparison of this set of genes with a gold-standard data set of essential genes in the closely related Escherichia coli K12 BW25113 revealed that an excessive number of genes appeared essential in Shigella but non-essential in E. coli. Importantly, and in converse to this comparison, we found no genes that were essential in E. coli and non-essential in Shigella, implying that many genes were artefactually inferred as essential in Shigella. Controlling for such artefacts resulted in a much smaller set of discrepant genes. Among these, we identified three sets of functionally related genes, two of which have previously been implicated as critical for Shigella growth, but which are dispensable for E. coli growth. The data presented here highlight the small number of protein coding genes for which we have strong evidence that their essentiality status differs between the closely related bacterial taxa E. coli and Shigella. A set of genes involved in acetate utilization provides a canonical example. These results leave open the possibility of developing strain-specific antibiotic treatments targeting such differentially essential genes, but suggest that such opportunities may be rare in closely related bacteria.

  9. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  10. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  11. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  12. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  13. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  14. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  15. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  16. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  17. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  18. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host.

    Science.gov (United States)

    Purser, Joye E; Lawrenz, Matthew B; Caimano, Melissa J; Howell, Jerrilyn K; Radolf, Justin D; Norris, Steven J

    2003-05-01

    Borrelia burgdorferi, a spirochaete that causes Lyme borreliosis, contains 21 linear and circular plasmids thought to be important for survival in mammals or ticks. Our results demonstrate that the gene BBE22 encoding a nicotinamidase is capable of replacing the requirement for the 25 kb linear plasmid lp25 during mammalian infection. Transformation of B. burgdorferi lacking lp25 with a shuttle vector containing the lp25 gene BBE22 (pBBE22) restored infectivity in mice to a level comparable to that of wild-type Borrelia. This complementation also restored the growth and host adaptation of lp25-B. burgdorferi in dialysis membrane chambers (DMCs) implanted in rats. A single Cys to Ala conversion at the putative active site of BBE22 abrogated the ability of pBBE22 to re-establish infectivity or growth in DMCs. Additional Salmonella typhimurium complementation studies and enzymatic analysis demonstrated that the BBE22 gene product has nicotinamidase activity and is most probably required for the biosynthesis of NAD. These results indicate that some plasmid-encoded products fulfil physiological functions required in the enzootic cycle of pathogenic Borrelia.

  19. Robustness encoded across essential and accessory replicons of the ecologically versatile bacterium Sinorhizobium meliloti

    Science.gov (United States)

    Walker, Graham C.; Finan, Turlough M.; Mengoni, Alessio; Griffitts, Joel S.

    2018-01-01

    Bacterial genome evolution is characterized by gains, losses, and rearrangements of functional genetic segments. The extent to which large-scale genomic alterations influence genotype-phenotype relationships has not been investigated in a high-throughput manner. In the symbiotic soil bacterium Sinorhizobium meliloti, the genome is composed of a chromosome and two large extrachromosomal replicons (pSymA and pSymB, which together constitute 45% of the genome). Massively parallel transposon insertion sequencing (Tn-seq) was employed to evaluate the contributions of chromosomal genes to growth fitness in both the presence and absence of these extrachromosomal replicons. Ten percent of chromosomal genes from diverse functional categories are shown to genetically interact with pSymA and pSymB. These results demonstrate the pervasive robustness provided by the extrachromosomal replicons, which is further supported by constraint-based metabolic modeling. A comprehensive picture of core S. meliloti metabolism was generated through a Tn-seq-guided in silico metabolic network reconstruction, producing a core network encompassing 726 genes. This integrated approach facilitated functional assignments for previously uncharacterized genes, while also revealing that Tn-seq alone missed over a quarter of wild-type metabolism. This work highlights the many functional dependencies and epistatic relationships that may arise between bacterial replicons and across a genome, while also demonstrating how Tn-seq and metabolic modeling can be used together to yield insights not obtainable by either method alone. PMID:29672509

  20. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  1. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  2. The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation.

    Science.gov (United States)

    Miguel-Arribas, Andrés; Hao, Jian-An; Luque-Ortega, Juan R; Ramachandran, Gayetri; Val-Calvo, Jorge; Gago-Córdoba, César; González-Álvarez, Daniel; Abia, David; Alfonso, Carlos; Wu, Ling J; Meijer, Wilfried J J

    2017-01-01

    Bacterial conjugation is the process by which a conjugative element (CE) is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer ( oriT ), where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis . We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1 LS20 and aux2 LS20 , and which we show are essential for conjugation. Both Aux1 LS20 and Aux2 LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1 LS20 and Aux2 LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriT LS20 , although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1 LS20 and/or Aux2 LS20 are located upstream of almost 400 relaxase genes of the Rel LS20 family (MOB L ) of relaxases. Thus, Aux1 LS20 and Aux2 LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

  3. The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation

    Directory of Open Access Journals (Sweden)

    Andrés Miguel-Arribas

    2017-11-01

    Full Text Available Bacterial conjugation is the process by which a conjugative element (CE is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer (oriT, where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis. We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1LS20 and aux2LS20, and which we show are essential for conjugation. Both Aux1LS20 and Aux2LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1LS20 and Aux2LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriTLS20, although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1LS20 and/or Aux2LS20 are located upstream of almost 400 relaxase genes of the RelLS20 family (MOBL of relaxases. Thus, Aux1LS20 and Aux2LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

  4. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  5. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  6. The essential function of B. subtilis RNase III is to silence foreign toxin genes.

    Directory of Open Access Journals (Sweden)

    Sylvain Durand

    Full Text Available RNase III-related enzymes play key roles in cleaving double-stranded RNA in many biological systems. Among the best-known are RNase III itself, involved in ribosomal RNA maturation and mRNA turnover in bacteria, and Drosha and Dicer, which play critical roles in the production of micro (mi-RNAs and small interfering (si-RNAs in eukaryotes. Although RNase III has important cellular functions in bacteria, its gene is generally not essential, with the remarkable exception of that of Bacillus subtilis. Here we show that the essential role of RNase III in this organism is to protect it from the expression of toxin genes borne by two prophages, Skin and SPβ, through antisense RNA. Thus, while a growing number of organisms that use RNase III or its homologs as part of a viral defense mechanism, B. subtilis requires RNase III for viral accommodation to the point where the presence of the enzyme is essential for cell survival. We identify txpA and yonT as the two toxin-encoding mRNAs of Skin and SPβ that are sensitive to RNase III. We further explore the mechanism of RNase III-mediated decay of the txpA mRNA when paired to its antisense RNA RatA, both in vivo and in vitro.

  7. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  8. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  9. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  10. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  11. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  12. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  13. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  14. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  15. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  16. Patterns of evolutionary conservation of essential genes correlate with their compensability.

    Directory of Open Access Journals (Sweden)

    Tobias Bergmiller

    2012-06-01

    Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.

  17. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  18. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  19. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  20. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  1. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  2. Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.

    Science.gov (United States)

    Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin

    2016-04-01

    Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.

  3. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  4. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  5. Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

    Science.gov (United States)

    Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

    2010-06-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

  6. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  7. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  8. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  9. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  10. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  11. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  12. Biosynthesis of Essential Polyunsaturated Fatty Acids in Wheat Triggered by Expression of Artificial Gene

    Directory of Open Access Journals (Sweden)

    Daniel Mihálik

    2015-12-01

    Full Text Available The artificial gene D6D encoding the enzyme ∆6desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T0 and T1 generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%–0.32% (v/v of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T1 generation as well as in immature and mature grains of the T2 generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%–1.40% (v/v and 0%–1.53% (v/v from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat.

  13. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  14. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  15. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  16. The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

    Science.gov (United States)

    Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

    1998-03-01

    Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

  17. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  18. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  19. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  20. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  1. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  2. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  3. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  4. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  5. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  6. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  7. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  8. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  9. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  10. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  11. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  12. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  13. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  14. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  15. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  17. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  18. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  19. Polyamines are essential for virulence in Salmonella enterica serovar Gallinarum despite evolutionary decay of polyamine biosynthesis genes

    DEFF Research Database (Denmark)

    Schroll, Casper; Christensen, Jens P.; Christensen, Henrik

    2014-01-01

    . Typhi and S. Gallinarum and happened through independent events. The remaining polyamine biosynthesis pathway was found to be essential for oral infection with S. Gallinarum since single and double mutants in speB and speE, encoding the pathways from agmatine to putrescine and from putrescine...... to putrescine. The first pathway is not active in S. Gallinarum and S. Typhi, and this prompted us to investigate the importance of polyamines for virulence in S. Gallinarum. Bioinformatic analysis of all sequenced genomes of Salmonella revealed that pseudogene formation of the speC gene was exclusive for S...

  20. Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Shan Goh

    Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

  1. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  2. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  3. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  4. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  5. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  6. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  7. Predicting Essential Genes and Proteins Based on Machine Learning and Network Topological Features: A Comprehensive Review

    Science.gov (United States)

    Zhang, Xue; Acencio, Marcio Luis; Lemke, Ney

    2016-01-01

    Essential proteins/genes are indispensable to the survival or reproduction of an organism, and the deletion of such essential proteins will result in lethality or infertility. The identification of essential genes is very important not only for understanding the minimal requirements for survival of an organism, but also for finding human disease genes and new drug targets. Experimental methods for identifying essential genes are costly, time-consuming, and laborious. With the accumulation of sequenced genomes data and high-throughput experimental data, many computational methods for identifying essential proteins are proposed, which are useful complements to experimental methods. In this review, we show the state-of-the-art methods for identifying essential genes and proteins based on machine learning and network topological features, point out the progress and limitations of current methods, and discuss the challenges and directions for further research. PMID:27014079

  8. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  9. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  10. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  11. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  12. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  13. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  14. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  15. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  16. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  17. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  18. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    Directory of Open Access Journals (Sweden)

    Brandi L Gancarz

    Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  19. A mutation in the gene encoding mitochondrial Mg²+ channel MRS2 results in demyelination in the rat.

    Directory of Open Access Journals (Sweden)

    Takashi Kuramoto

    2011-01-01

    Full Text Available The rat demyelination (dmy mutation serves as a unique model system to investigate the maintenance of myelin, because it provokes severe myelin breakdown in the central nervous system (CNS after normal postnatal completion of myelination. Here, we report the molecular characterization of this mutation and discuss the possible pathomechanisms underlying demyelination. By positional cloning, we found that a G-to-A transition, 177 bp downstream of exon 3 of the Mrs2 (MRS2 magnesium homeostasis factor (Saccharomyces cerevisiae gene, generated a novel splice acceptor site which resulted in functional inactivation of the mutant allele. Transgenic rescue with wild-type Mrs2-cDNA validated our findings. Mrs2 encodes an essential component of the major Mg²+ influx system in mitochondria of yeast as well as human cells. We showed that the dmy/dmy rats have major mitochondrial deficits with a markedly elevated lactic acid concentration in the cerebrospinal fluid, a 60% reduction in ATP, and increased numbers of mitochondria in the swollen cytoplasm of oligodendrocytes. MRS2-GFP recombinant BAC transgenic rats showed that MRS2 was dominantly expressed in neurons rather than oligodendrocytes and was ultrastructurally observed in the inner membrane of mitochondria. Our observations led to the conclusion that dmy/dmy rats suffer from a mitochondrial disease and that the maintenance of myelin has a different mechanism from its initial production. They also established that Mg²+ homeostasis in CNS mitochondria is essential for the maintenance of myelin.

  20. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  1. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  2. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  3. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  4. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  5. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  6. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  7. A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.

    Science.gov (United States)

    Zhang, Zhong-Lin; Shin, Margaret; Zou, Xiaolu; Huang, Jianzhi; Ho, Tun-hua David; Shen, Qingxi J

    2009-05-01

    Abscisic acid (ABA) and gibberellins (GAs) control several developmental processes including seed maturation, dormancy, and germination. The antagonism of these two hormones is well-documented. However, recent data from transcription profiling studies indicate that they can function as agonists in regulating the expression of many genes although the underlying mechanism is unclear. Here we report a rice WRKY gene, OsWRKY24, which encodes a protein that functions as a negative regulator of both GA and ABA signaling. Overexpression of OsWRKY24 via particle bombardment-mediated transient expression in aleurone cells represses the expression of two reporter constructs: the beta-glucuronidase gene driven by the GA-inducible Amy32b alpha-amylase promoter (Amy32b-GUS) and the ABA-inducible HVA22 promoter (HVA22-GUS). OsWRKY24 is unlikely a general repressor because it has little effect on the expression of the luciferase reporter gene driven by a constitutive ubiquitin promoter (UBI-Luciferase). As to the GA signaling, OsWRKY24 differs from OsWRKY51 and -71, two negative regulators specifically function in the GA signaling pathway, in several ways. First, OsWRKY24 contains two WRKY domains while OsWRKY51 and -71 have only one; both WRKY domains are essential for the full repressing activity of OsWRKY24. Second, binding of OsWRKY24 to the Amy32b promoter appears to involve sequences in addition to the TGAC cores of the W-boxes. Third, unlike OsWRKY71, OsWRKY24 is stable upon GA treatment. Together, these data demonstrate that OsWRKY24 is a novel type of transcriptional repressor that inhibits both GA and ABA signaling.

  8. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  9. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  10. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  12. Genetic Disruption of the Sh3pxd2a Gene Reveals an Essential Role in Mouse Development and the Existence of a Novel Isoform of Tks5

    OpenAIRE

    Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A.; Díaz, Begoña

    2014-01-01

    Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulte...

  13. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  14. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  15. Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

    Science.gov (United States)

    Firnhaber, Christopher; Hammarlund, Marc

    2013-11-01

    Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

  16. Mutations in genes encoding condensin complex proteins cause microcephaly through decatenation failure at mitosis.

    Science.gov (United States)

    Martin, Carol-Anne; Murray, Jennie E; Carroll, Paula; Leitch, Andrea; Mackenzie, Karen J; Halachev, Mihail; Fetit, Ahmed E; Keith, Charlotte; Bicknell, Louise S; Fluteau, Adeline; Gautier, Philippe; Hall, Emma A; Joss, Shelagh; Soares, Gabriela; Silva, João; Bober, Michael B; Duker, Angela; Wise, Carol A; Quigley, Alan J; Phadke, Shubha R; Wood, Andrew J; Vagnarelli, Paola; Jackson, Andrew P

    2016-10-01

    Compaction of chromosomes is essential for accurate segregation of the genome during mitosis. In vertebrates, two condensin complexes ensure timely chromosome condensation, sister chromatid disentanglement, and maintenance of mitotic chromosome structure. Here, we report that biallelic mutations in NCAPD2, NCAPH, or NCAPD3, encoding subunits of these complexes, cause microcephaly. In addition, hypomorphic Ncaph2 mice have significantly reduced brain size, with frequent anaphase chromatin bridge formation observed in apical neural progenitors during neurogenesis. Such DNA bridges also arise in condensin-deficient patient cells, where they are the consequence of failed sister chromatid disentanglement during chromosome compaction. This results in chromosome segregation errors, leading to micronucleus formation and increased aneuploidy in daughter cells. These findings establish "condensinopathies" as microcephalic disorders, with decatenation failure as an additional disease mechanism for microcephaly, implicating mitotic chromosome condensation as a key process ensuring mammalian cerebral cortex size. © 2016 Martin et al.; Published by Cold Spring Harbor Laboratory Press.

  17. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. kurtz, a novel nonvisual arrestin, is an essential neural gene in Drosophila.

    OpenAIRE

    Roman, G; He, J; Davis, R L

    2000-01-01

    The kurtz gene encodes a novel nonvisual arrestin. krz is located at the most-distal end of the chromosome 3R, the third gene in from the telomere. krz is expressed throughout development. During early embryogenesis, krz is expressed ubiquitously and later is localized to the central nervous system, maxillary cirri, and antennal sensory organs. In late third instar larvae, krz message is detected in the fat bodies, the ventral portion of the thoracic-abdominal ganglia, the deuterocerebrum, th...

  19. The fixABCX genes in Rhodospirillum rubrum encode a putative membrane complex participating in electron transfer to nitrogenase.

    Science.gov (United States)

    Edgren, Tomas; Nordlund, Stefan

    2004-04-01

    In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.

  20. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    Science.gov (United States)

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-01-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

  1. Identification and functional analysis of the erh1(+ gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Marek K Krzyzanowski

    Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  2. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    Science.gov (United States)

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-04-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

  3. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  4. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  5. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  6. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  7. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  8. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  9. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  10. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  11. Mouse Y-Encoded Transcription Factor Zfy2 Is Essential for Sperm Head Remodelling and Sperm Tail Development

    NARCIS (Netherlands)

    Vernet, Nadege; Mahadevaiah, Shantha K.; Decarpentrie, Fanny; Longepied, Guy; de Rooij, Dirk G.; Burgoyne, Paul S.; Mitchell, Michael J.

    2016-01-01

    A previous study indicated that genetic information encoded on the mouse Y chromosome short arm (Yp) is required for efficient completion of the second meiotic division (that generates haploid round spermatids), restructuring of the sperm head, and development of the sperm tail. Using mouse models

  12. Significance of calcium binding, tyrosine phosphorylation, and lysine trimethylation for the essential function of calmodulin in vertebrate cells analyzed in a novel gene replacement system

    DEFF Research Database (Denmark)

    Panina, Svetlana; Stephan, Alexander; la Cour, Jonas Marstrand

    2012-01-01

    Calmodulin (CaM) was shown to be essential for survival of lower eukaryotes by gene deletion experiments. So far, no CaM gene deletion was reported in higher eukaryotes. In vertebrates, CaM is expressed from several genes, which encode an identical protein, making it difficult to generate a model...... system to study the effect ofCaMgene deletion. Here, we present a novel genetic system based on the chicken DT40 cell line, in which the two functional CaM genes were deleted and one allele replaced with a CaM transgene that can be artificially regulated.Weshow that CaM is essential for survival...

  13. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  14. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  15. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  16. Analysis of gene essentiality in Escherichia coli across strains and growth conditions

    DEFF Research Database (Denmark)

    Bonde, Ida; Lennen, Rebecca; Cardoso, Joao

    are either essential or detrimental for growth in the test condition in question. In this study the TN-Seq method was used to investigate the differences in gene essentiality between four laboratory strains of E.coli subjected to four different growth conditions to investigate the reason for the differences...

  17. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Domestication process of the goat revealed by an analysis of the nearly complete mitochondrial protein-encoding genes.

    Directory of Open Access Journals (Sweden)

    Koh Nomura

    Full Text Available Goats (Capra hircus are one of the oldest domesticated species, and they are kept all over the world as an essential resource for meat, milk, and fiber. Although recent archeological and molecular biological studies suggested that they originated in West Asia, their domestication processes such as the timing of population expansion and the dynamics of their selection pressures are little known. With the aim of addressing these issues, the nearly complete mitochondrial protein-encoding genes were determined from East, Southeast, and South Asian populations. Our coalescent time estimations suggest that the timing of their major population expansions was in the Late Pleistocene and significantly predates the beginning of their domestication in the Neolithic era (≈10,000 years ago. The ω (ratio of non-synonymous rate/synonymous substitution rate for each lineage was also estimated. We found that the ω of the globally distributed haplogroup A which is inherited by more than 90% of goats examined, turned out to be extremely low, suggesting that they are under severe selection pressure probably due to their large population size. Conversely, the ω of the Asian-specific haplogroup B inherited by about 5% of goats was relatively high. Although recent molecular studies suggest that domestication of animals may tend to relax selective constraints, the opposite pattern observed in our goat mitochondrial genome data indicates the process of domestication is more complex than may be presently appreciated and cannot be explained only by a simple relaxation model.

  19. The FBPase Encoding Gene glpX Is Required for Gluconeogenesis, Bacterial Proliferation and Division In Vivo of Mycobacterium marinum.

    Science.gov (United States)

    Tong, Jingfeng; Meng, Lu; Wang, Xinwei; Liu, Lixia; Lyu, Liangdong; Wang, Chuan; Li, Yang; Gao, Qian; Yang, Chen; Niu, Chen

    2016-01-01

    Lipids have been identified as important carbon sources for Mycobacterium tuberculosis (Mtb) to utilize in vivo. Thus gluconeogenesis bears a key role for Mtb to survive and replicate in host. A rate-limiting enzyme of gluconeogenesis, fructose 1, 6-bisphosphatase (FBPase) is encoded by the gene glpX. The functions of glpX were studied in M. marinum, a closely related species to Mtb. The glpX deletion strain (ΔglpX) displayed altered gluconeogenesis, attenuated virulence, and altered bacterial proliferation. Metabolic profiles indicate an accumulation of the FBPase substrate, fructose 1, 6-bisphosphate (FBP) and altered gluconeogenic flux when ΔglpX is cultivated in a gluconeogenic carbon substrate, acetate. In both macrophages and zebrafish, the proliferation of ΔglpX was halted, resulting in dramatically attenuated virulence. Intracellular ΔglpX exhibited an elongated morphology, which was also observed when ΔglpX was grown in a gluconeogenic carbon source. This elongated morphology is also supported by the observation of unseparated multi-nucleoid cell, indicating that a complete mycobacterial division in vivo is correlated with intact gluconeogenesis. Together, our results indicate that glpX has essential functions in gluconeogenesis, and plays an indispensable role in bacterial proliferation in vivo and virulence of M. marinum.

  20. The last step of syringyl monolignol biosynthesis in angiosperms is regulated by a novel gene encoding sinapyl alcohol dehydrogenase.

    Science.gov (United States)

    Li, L; Cheng, X F; Leshkevich, J; Umezawa, T; Harding, S A; Chiang, V L

    2001-07-01

    Cinnamyl alcohol dehydrogenase (CAD; EC 1.1.1.195) has been thought to mediate the reduction of both coniferaldehyde and sinapaldehyde into guaiacyl and syringyl monolignols in angiosperms. Here, we report the isolation of a novel aspen gene (PtSAD) encoding sinapyl alcohol dehydrogenase (SAD), which is phylogenetically distinct from aspen CAD (PtCAD). Liquid chromatography-mass spectrometry-based enzyme functional analysis and substrate level-controlled enzyme kinetics consistently demonstrated that PtSAD is sinapaldehyde specific and that PtCAD is coniferaldehyde specific. The enzymatic efficiency of PtSAD for sinapaldehyde was approximately 60 times greater than that of PtCAD. These data suggest that in addition to CAD, discrete SAD function is essential to the biosynthesis of syringyl monolignol in angiosperms. In aspen stem primary tissues, PtCAD was immunolocalized exclusively to xylem elements in which only guaiacyl lignin was deposited, whereas PtSAD was abundant in syringyl lignin-enriched phloem fiber cells. In the developing secondary stem xylem, PtCAD was most conspicuous in guaiacyl lignin-enriched vessels, but PtSAD was nearly absent from these elements and was conspicuous in fiber cells. In the context of additional protein immunolocalization and lignin histochemistry, these results suggest that the distinct CAD and SAD functions are linked spatiotemporally to the differential biosynthesis of guaiacyl and syringyl lignins in different cell types. SAD is required for the biosynthesis of syringyl lignin in angiosperms.

  1. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  2. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  3. The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast.

    Directory of Open Access Journals (Sweden)

    Alessandra Chesi

    Full Text Available YPK9 (Yeast PARK9; also known as YOR291W is a non-essential yeast gene predicted by sequence to encode a transmembrane P-type transport ATPase. However, its substrate specificity is unknown. Mutations in the human homolog of YPK9, ATP13A2/PARK9, have been linked to genetic forms of early onset parkinsonism. We previously described a strong genetic interaction between Ypk9 and another Parkinson's disease (PD protein α-synuclein in multiple model systems, and a role for Ypk9 in manganese detoxification in yeast. In humans, environmental exposure to toxic levels of manganese causes a syndrome similar to PD and is thus an environmental risk factor for the disease. How manganese contributes to neurodegeneration is poorly understood. Here we describe multiple genome-wide screens in yeast aimed at defining the cellular function of Ypk9 and the mechanisms by which it protects cells from manganese toxicity. In physiological conditions, we found that Ypk9 genetically interacts with essential genes involved in cellular trafficking and the cell cycle. Deletion of Ypk9 sensitizes yeast cells to exposure to excess manganese. Using a library of non-essential gene deletions, we screened for additional genes involved in tolerance to excess manganese exposure, discovering several novel pathways involved in manganese homeostasis. We defined the dependence of the deletion strain phenotypes in the presence of manganese on Ypk9, and found that Ypk9 deletion modifies the manganese tolerance of only a subset of strains. These results confirm a role for Ypk9 in manganese homeostasis and illuminates cellular pathways and biological processes in which Ypk9 likely functions.

  4. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  5. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  6. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  7. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  8. Blue ghosts: a new method for isolating amber mutants defective in essential genes of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S; Brickman, E R; Beckwith, J

    1981-01-01

    We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...

  9. From essential to persistent genes: a functional approach to constructing synthetic life

    DEFF Research Database (Denmark)

    Acevedo-Rocha, Carlos G.; Fang, Gang; Schmidt, Markus

    2013-01-01

    A central undertaking in synthetic biology (SB) is the quest for the ‘minimal genome’. However, ‘minimal sets’ of essential genes are strongly context-dependent and, in all prokaryotic genomes sequenced to date, not a single protein-coding gene is entirely conserved. Furthermore, a lack...

  10. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  11. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  12. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  13. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  14. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  15. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  16. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  17. Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH

    Directory of Open Access Journals (Sweden)

    Burgis Timothy A

    2009-07-01

    Full Text Available Abstract Background In recent years there has been an increasing problem with Staphylococcus aureus strains that are resistant to treatment with existing antibiotics. An important starting point for the development of new antimicrobial drugs is the identification of "essential" genes that are important for bacterial survival and growth. Results We have developed a robust microarray and PCR-based method, Transposon-Mediated Differential Hybridisation (TMDH, that uses novel bioinformatics to identify transposon inserts in genome-wide libraries. Following a microarray-based screen, genes lacking transposon inserts are re-tested using a PCR and sequencing-based approach. We carried out a TMDH analysis of the S. aureus genome using a large random mariner transposon library of around a million mutants, and identified a total of 351 S. aureus genes important for survival and growth in culture. A comparison with the essential gene list experimentally derived for Bacillus subtilis highlighted interesting differences in both pathways and individual genes. Conclusion We have determined the first comprehensive list of S. aureus essential genes. This should act as a useful starting point for the identification of potential targets for novel antimicrobial compounds. The TMDH methodology we have developed is generic and could be applied to identify essential genes in other bacterial pathogens.

  18. Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

    Science.gov (United States)

    Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

    2010-01-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

  19. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  20. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  1. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  2. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  3. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  4. Identifying essential genes in bacterial metabolic networks with machine learning methods

    Science.gov (United States)

    2010-01-01

    Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628

  5. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  6. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  7. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  9. New genes often acquire male-specific functions but rarely become essential in Drosophila.

    Science.gov (United States)

    Kondo, Shu; Vedanayagam, Jeffrey; Mohammed, Jaaved; Eizadshenass, Sogol; Kan, Lijuan; Pang, Nan; Aradhya, Rajaguru; Siepel, Adam; Steinhauer, Josefa; Lai, Eric C

    2017-09-15

    Relatively little is known about the in vivo functions of newly emerging genes, especially in metazoans. Although prior RNAi studies reported prevalent lethality among young gene knockdowns, our phylogenomic analyses reveal that young Drosophila genes are frequently restricted to the nonessential male reproductive system. We performed large-scale CRISPR/Cas9 mutagenesis of "conserved, essential" and "young, RNAi-lethal" genes and broadly confirmed the lethality of the former but the viability of the latter. Nevertheless, certain young gene mutants exhibit defective spermatogenesis and/or male sterility. Moreover, we detected widespread signatures of positive selection on young male-biased genes. Thus, young genes have a preferential impact on male reproductive system function. © 2017 Kondo et al.; Published by Cold Spring Harbor Laboratory Press.

  10. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  13. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  14. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  15. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  16. Essential gene disruptions reveal complex relationships between phenotypic robustness, pleiotropy, and fitness

    Science.gov (United States)

    Bauer, Christopher R; Li, Shuang; Siegal, Mark L

    2015-01-01

    The concept of robustness in biology has gained much attention recently, but a mechanistic understanding of how genetic networks regulate phenotypic variation has remained elusive. One approach to understand the genetic architecture of variability has been to analyze dispensable gene deletions in model organisms; however, the most important genes cannot be deleted. Here, we have utilized two systems in yeast whereby essential genes have been altered to reduce expression. Using high-throughput microscopy and image analysis, we have characterized a large number of morphological phenotypes, and their associated variation, for the majority of essential genes in yeast. Our results indicate that phenotypic robustness is more highly dependent upon the expression of essential genes than on the presence of dispensable genes. Morphological robustness appears to be a general property of a genotype that is closely related to pleiotropy. While the fitness profile across a range of expression levels is idiosyncratic to each gene, the global pattern indicates that there is a window in which phenotypic variation can be released before fitness effects are observable. PMID:25609648

  17. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  18. Increased burden of deleterious variants in essential genes in autism spectrum disorder.

    Science.gov (United States)

    Ji, Xiao; Kember, Rachel L; Brown, Christopher D; Bućan, Maja

    2016-12-27

    Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication, and repetitive behavior. It is estimated that hundreds of genes contribute to ASD. We asked if genes with a strong effect on survival and fitness contribute to ASD risk. Human orthologs of genes with an essential role in pre- and postnatal development in the mouse [essential genes (EGs)] are enriched for disease genes and under strong purifying selection relative to human orthologs of mouse genes with a known nonlethal phenotype [nonessential genes (NEGs)]. This intolerance to deleterious mutations, commonly observed haploinsufficiency, and the importance of EGs in development suggest a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. With a comprehensive catalog of 3,915 mammalian EGs, we provide compelling evidence for a stronger contribution of EGs to ASD risk compared with NEGs. By examining the exonic de novo and inherited variants from 1,781 ASD quartet families, we show a significantly higher burden of damaging mutations in EGs in ASD probands compared with their non-ASD siblings. The analysis of EGs in the developing brain identified clusters of coexpressed EGs implicated in ASD. Finally, we suggest a high-priority list of 29 EGs with potential ASD risk as targets for future functional and behavioral studies. Overall, we show that large-scale studies of gene function in model organisms provide a powerful approach for prioritization of genes and pathogenic variants identified by sequencing studies of human disease.

  19. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  20. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  1. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  2. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  3. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  4. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  5. An Approach for Predicting Essential Genes Using Multiple Homology Mapping and Machine Learning Algorithms.

    Science.gov (United States)

    Hua, Hong-Li; Zhang, Fa-Zhan; Labena, Abraham Alemayehu; Dong, Chuan; Jin, Yan-Ting; Guo, Feng-Biao

    Investigation of essential genes is significant to comprehend the minimal gene sets of cell and discover potential drug targets. In this study, a novel approach based on multiple homology mapping and machine learning method was introduced to predict essential genes. We focused on 25 bacteria which have characterized essential genes. The predictions yielded the highest area under receiver operating characteristic (ROC) curve (AUC) of 0.9716 through tenfold cross-validation test. Proper features were utilized to construct models to make predictions in distantly related bacteria. The accuracy of predictions was evaluated via the consistency of predictions and known essential genes of target species. The highest AUC of 0.9552 and average AUC of 0.8314 were achieved when making predictions across organisms. An independent dataset from Synechococcus elongatus , which was released recently, was obtained for further assessment of the performance of our model. The AUC score of predictions is 0.7855, which is higher than other methods. This research presents that features obtained by homology mapping uniquely can achieve quite great or even better results than those integrated features. Meanwhile, the work indicates that machine learning-based method can assign more efficient weight coefficients than using empirical formula based on biological knowledge.

  6. Expression pattern of a nuclear encoded mitochondrial arginine-ornithine translocator gene from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Schneider Anja

    2003-01-01

    Full Text Available Abstract Background Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. Results High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2 of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. Conclusion AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.

  7. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  8. Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

    Science.gov (United States)

    Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

    2018-06-01

    Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

  9. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  10. Cardiac-enriched BAF chromatin-remodeling complex subunit Baf60c regulates gene expression programs essential for heart development and function

    Directory of Open Access Journals (Sweden)

    Xin Sun

    2018-01-01

    Full Text Available How chromatin-remodeling complexes modulate gene networks to control organ-specific properties is not well understood. For example, Baf60c (Smarcd3 encodes a cardiac-enriched subunit of the SWI/SNF-like BAF chromatin complex, but its role in heart development is not fully understood. We found that constitutive loss of Baf60c leads to embryonic cardiac hypoplasia and pronounced cardiac dysfunction. Conditional deletion of Baf60c in cardiomyocytes resulted in postnatal dilated cardiomyopathy with impaired contractile function. Baf60c regulates a gene expression program that includes genes encoding contractile proteins, modulators of sarcomere function, and cardiac metabolic genes. Many of the genes deregulated in Baf60c null embryos are targets of the MEF2/SRF co-factor Myocardin (MYOCD. In a yeast two-hybrid screen, we identified MYOCD as a BAF60c interacting factor; we showed that BAF60c and MYOCD directly and functionally interact. We conclude that Baf60c is essential for coordinating a program of gene expression that regulates the fundamental functional properties of cardiomyocytes.

  11. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  12. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  13. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  14. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  15. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  16. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  17. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  18. RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

    Directory of Open Access Journals (Sweden)

    Bo Liu

    Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

  19. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  20. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  1. Comparative genomics of Mycoplasma: analysis of conserved essential genes and diversity of the pan-genome.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Mycoplasma, the smallest self-replicating organism with a minimal metabolism and little genomic redundancy, is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. This study employs comparative evolutionary analysis of twenty Mycoplasma genomes to gain an improved understanding of essential genes. By analyzing the core genome of mycoplasmas, we finally revealed the conserved essential genes set for mycoplasma survival. Further analysis showed that the core genome set has many characteristics in common with experimentally identified essential genes. Several key genes, which are related to DNA replication and repair and can be disrupted in transposon mutagenesis studies, may be critical for bacteria survival especially over long period natural selection. Phylogenomic reconstructions based on 3,355 homologous groups allowed robust estimation of phylogenetic relatedness among mycoplasma strains. To obtain deeper insight into the relative roles of molecular evolution in pathogen adaptation to their hosts, we also analyzed the positive selection pressures on particular sites and lineages. There appears to be an approximate correlation between the divergence of species and the level of positive selection detected in corresponding lineages.

  2. An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes.

    Science.gov (United States)

    Kofoed, Megan; Milbury, Karissa L; Chiang, Jennifer H; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C

    2015-07-14

    Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. Copyright © 2015 Kofoed et al.

  3. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  4. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren

    2010-04-01

    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  5. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  6. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  7. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  8. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.

    Science.gov (United States)

    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie

    2015-11-27

    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  10. Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues.

    Science.gov (United States)

    Pei, Wuhong; Xu, Lisha; Huang, Sunny C; Pettie, Kade; Idol, Jennifer; Rissone, Alberto; Jimenez, Erin; Sinclair, Jason W; Slevin, Claire; Varshney, Gaurav K; Jones, MaryPat; Carrington, Blake; Bishop, Kevin; Huang, Haigen; Sood, Raman; Lin, Shuo; Burgess, Shawn M

    2018-01-01

    Regenerative medicine holds great promise for both degenerative diseases and traumatic tissue injury which represent significant challenges to the health care system. Hearing loss, which affects hundreds of millions of people worldwide, is caused primarily by a permanent loss of the mechanosensory receptors of the inner ear known as hair cells. This failure to regenerate hair cells after loss is limited to mammals, while all other non-mammalian vertebrates tested were able to completely regenerate these mechanosensory receptors after injury. To understand the mechanism of hair cell regeneration and its association with regeneration of other tissues, we performed a guided mutagenesis screen using zebrafish lateral line hair cells as a screening platform to identify genes that are essential for hair cell regeneration, and further investigated how genes essential for hair cell regeneration were involved in the regeneration of other tissues. We created genetic mutations either by retroviral insertion or CRISPR/Cas9 approaches, and developed a high-throughput screening pipeline for analyzing hair cell development and regeneration. We screened 254 gene mutations and identified 7 genes specifically affecting hair cell regeneration. These hair cell regeneration genes fell into distinct and somewhat surprising functional categories. By examining the regeneration of caudal fin and liver, we found these hair cell regeneration genes often also affected other types of tissue regeneration. Therefore, our results demonstrate guided screening is an effective approach to discover regeneration candidates, and hair cell regeneration is associated with other tissue regeneration.

  11. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  12. Prediction of essential proteins based on subcellular localization and gene expression correlation.

    Science.gov (United States)

    Fan, Yetian; Tang, Xiwei; Hu, Xiaohua; Wu, Wei; Ping, Qing

    2017-12-01

    Essential proteins are indispensable to the survival and development process of living organisms. To understand the functional mechanisms of essential proteins, which can be applied to the analysis of disease and design of drugs, it is important to identify essential proteins from a set of proteins first. As traditional experimental methods designed to test out essential proteins are usually expensive and laborious, computational methods, which utilize biological and topological features of proteins, have attracted more attention in recent years. Protein-protein interaction networks, together with other biological data, have been explored to improve the performance of essential protein prediction. The proposed method SCP is evaluated on Saccharomyces cerevisiae datasets and compared with five other methods. The results show that our method SCP outperforms the other five methods in terms of accuracy of essential protein prediction. In this paper, we propose a novel algorithm named SCP, which combines the ranking by a modified PageRank algorithm based on subcellular compartments information, with the ranking by Pearson correlation coefficient (PCC) calculated from gene expression data. Experiments show that subcellular localization information is promising in boosting essential protein prediction.

  13. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  14. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  15. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  16. Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality.

    Science.gov (United States)

    Liberati, Nicole T; Urbach, Jonathan M; Thurber, Tara K; Wu, Gang; Ausubel, Frederick M

    2008-01-01

    Putative essential genes can be identified by comparing orthologs not disrupted in multiple near-saturated transposon insertion mutation libraries in related strains of the same bacterial species. Methods for identifying all orthologs between two bacterial strains and putative essential orthologs are described. In addition, protocols detailing near-saturation transposon insertion mutagenesis of bacteria are presented, including (1) conjugation-mediated mutagenesis, (2) automated colony picking and liquid handling of mutant cultures, and (3) arbitrary polymerase chain reaction amplification and sequencing of genomic DNA adjacent to transposon insertion sites.

  17. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  18. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  19. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  20. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  1. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  2. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  3. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  4. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  5. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  6. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  7. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  8. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  9. The Physiological and Biochemical Mechanisms Providing the Increased Constitutive Cold Resistance in the Potato Plants, Expressing the Yeast SUC2 Gene Encoding Apoplastic Invertase

    Directory of Open Access Journals (Sweden)

    A.N. Deryabin

    2016-05-01

    Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.

  10. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  11. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  12. The Popeye domain containing genes: essential elements in heart rate control.

    Science.gov (United States)

    Schindler, Roland F; Poon, Kar Lai; Simrick, Subreena; Brand, Thomas

    2012-12-01

    The Popeye domain containing (Popdc) gene family displays preferential expression in skeletal muscle and heart. Only recently a significant gain in the understanding of the function of Popdc genes in the heart has been obtained. The Popdc genes encode membrane proteins harboring an evolutionary conserved Popeye domain, which functions as a binding domain for cyclic adenosine monophosphate (cAMP). Popdc proteins interact with the two-pore channel TREK-1 and enhance its current. This protein interaction is modulated by cAMP. Null mutations of members of the Popdc gene family in zebrafish and mouse are associated with severe cardiac arrhythmia phenotypes. While in zebrafish an atrioventricular block was prevalent, in mouse a stress-induced sinus bradycardia was observed, which was due to the presence of sinus pauses. Moreover, the phenotype develops in an age-dependent manner, being absent in the young animal and becoming increasingly severe, as the animals grow older. This phenotype is reminiscent of the sick sinus syndrome (SSS), which affects mostly the elderly and is characterized by the poor ability of the cardiac pacemaker to adapt the heart rate to the physiological demand. While being a prevalent disease, which is responsible for a large fraction of pacemaker implantations in Western countries, SSS is poorly understood at the molecular level. It is therefore expected that the study of the molecular basis of the stress-induced bradycardia in Popdc mice will shed new light on the etiology of pacemaker disease.

  13. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  14. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  15. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  16. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  17. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  18. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  19. Towards the prediction of essential genes by integration of network topology, cellular localization and biological process information

    Directory of Open Access Journals (Sweden)

    Lemke Ney

    2009-09-01

    Full Text Available Abstract Background The identification of essential genes is important for the understanding of the minimal requirements for cellular life and for practical purposes, such as drug design. However, the experimental techniques for essential genes discovery are labor-intensive and time-consuming. Considering these experimental constraints, a computational approach capable of accurately predicting essential genes would be of great value. We therefore present here a machine learning-based computational approach relying on network topological features, cellular localization and biological process information for prediction of essential genes. Results We constructed a decision tree-based meta-classifier and trained it on datasets with individual and grouped attributes-network topological features, cellular compartments and biological processes-to generate various predictors of essential genes. We showed that the predictors with better performances are those generated by datasets with integrated attributes. Using the predictor with all attributes, i.e., network topological features, cellular compartments and biological processes, we obtained the best predictor of essential genes that was then used to classify yeast genes with unknown essentiality status. Finally, we generated decision trees by training the J48 algorithm on datasets with all network topological features, cellular localization and biological process information to discover cellular rules for essentiality. We found that the number of protein physical interactions, the nuclear localization of proteins and the number of regulating transcription factors are the most important factors determining gene essentiality. Conclusion We were able to demonstrate that network topological features, cellular localization and biological process information are reliable predictors of essential genes. Moreover, by constructing decision trees based on these data, we could discover cellular rules governing

  20. A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

    Science.gov (United States)

    Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

    2017-02-01

    Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.

  1. A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

    Science.gov (United States)

    Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

    2015-07-28

    West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  3. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  4. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  6. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  7. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  8. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  9. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  11. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  12. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  13. Drosophila melanogaster cellular repressor of E1A-stimulated genes is a lysosomal protein essential for fly development.

    Science.gov (United States)

    Kowalewski-Nimmerfall, Elisabeth; Schähs, Philipp; Maresch, Daniel; Rendic, Dubravko; Krämer, Helmut; Mach, Lukas

    2014-12-01

    Mammalian cellular repressor of E1A-stimulated genes is a lysosomal glycoprotein implicated in cellular growth and differentiation. The genome of the fruit fly Drosophila melanogaster encodes a putative orthologue (dCREG), suggesting evolutionarily conserved physiological functions of this protein. In D. melanogaster S2 cells, dCREG was found to localize in lysosomes. Further studies revealed that intracellular dCREG is subject of proteolytic maturation. Processing and turnover could be substantially reduced by RNAi-mediated silencing of cathepsin L. In contrast to mammalian cells, lysosomal delivery of dCREG does not depend on its carbohydrate moiety. Furthermore, depletion of the putative D. melanogaster lysosomal sorting receptor lysosomal enzyme receptor protein did not compromise cellular retention of dCREG. We also investigated the developmental consequences of dCREG ablation in whole D. melanogaster flies. Ubiquitous depletion of dCREG proved lethal at the late pupal stage once a knock-down efficiency of >95% was achieved. These results demonstrate that dCREG is essential for proper completion of fly development. Copyright © 2014. Published by Elsevier B.V.

  14. Nonribosomal Peptide Synthetase Genes pesL and pes1 Are Essential for Fumigaclavine C Production in Aspergillus fumigatus

    DEFF Research Database (Denmark)

    O'Hanlon, Karen A.; Gallagher, Lorna; Schrettl, Markus

    2012-01-01

    The identity of metabolites encoded by the majority of nonribosomal peptide synthetases in the opportunistic pathogen, Aspergillus fumigatus, remains outstanding. We found that the nonribosomal peptide (NRP) synthetases PesL and Pes1 were essential for fumigaclavine C biosynthesis, the end produc...

  15. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  16. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  17. Polyamines are essential for virulence in Salmonella enterica serovar Gallinarum despite evolutionary decay of polyamine biosynthesis genes.

    Science.gov (United States)

    Schroll, Casper; Christensen, Jens P; Christensen, Henrik; Pors, Susanne E; Thorndahl, Lotte; Jensen, Peter R; Olsen, John E; Jelsbak, Lotte

    2014-05-14

    Serovars of Salmonella enterica exhibit different host-specificities where some have broad host-ranges and others, like S. Gallinarum and S. Typhi, are host-specific for poultry and humans, respectively. With the recent availability of whole genome sequences it has been reported that host-specificity coincides with accumulation of pseudogenes, indicating adaptation of host-restricted serovars to their narrow niches. Polyamines are small cationic amines and in Salmonella they can be synthesized through two alternative pathways directly from l-ornithine to putrescine and from l-arginine via agmatine to putrescine. The first pathway is not active in S. Gallinarum and S. Typhi, and this prompted us to investigate the importance of polyamines for virulence in S. Gallinarum. Bioinformatic analysis of all sequenced genomes of Salmonella revealed that pseudogene formation of the speC gene was exclusive for S. Typhi and S. Gallinarum and happened through independent events. The remaining polyamine biosynthesis pathway was found to be essential for oral infection with S. Gallinarum since single and double mutants in speB and speE, encoding the pathways from agmatine to putrescine and from putrescine to spermidine, were attenuated. In contrast, speB was dispensable after intraperitoneal challenge, suggesting that putrescine was less important for the systemic phase of the disease. In support of this hypothesis, a ΔspeE;ΔpotCD mutant, unable to synthesize and import spermidine, but with retained ability to import and synthesize putrescine, was attenuated after intraperitoneal infection. We therefore conclude that polyamines are essential for virulence of S. Gallinarum. Furthermore, our results point to distinct roles for putrescine and spermidine during systemic infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Generation of human iPSCs from an essential thrombocythemia patient carrying a V501L mutation in the MPL gene.

    Science.gov (United States)

    Liu, Senquan; Ye, Zhaohui; Gao, Yongxing; He, Chaoxia; Williams, Donna W; Moliterno, Alison; Spivak, Jerry; Huang, He; Cheng, Linzhao

    2017-01-01

    Activating point mutations in the MPL gene encoding the thrombopoietin receptor are found in 3%-10% of essential thrombocythemia (ET) and myelofibrosis patients. Here, we report the derivation of induced pluripotent stem cells (iPSCs) from an ET patient with a heterozygous MPL V501L mutation. Peripheral blood CD34 + progenitor cells were reprogrammed by transient plasmid expression of OCT4, SOX2, KLF4, c-MYC plus BCL2L1 (BCL-xL) genes. The derived line M494 carries a MPL V501L mutation, displays typical iPSC morphology and characteristics, are pluripotent and karyotypically normal. Upon differentiation, the iPSCs are able to differentiate into cells derived from three germ layers. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  20. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  1. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Directory of Open Access Journals (Sweden)

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  2. Angiotensin II type 1 receptor (A1166C gene polymorphism and essential hypertension in Egyptian population

    Directory of Open Access Journals (Sweden)

    Marium M. Shamaa

    2016-09-01

    Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used for the analysis of A1166C polymorphism of ATR1 genes in peripheral blood samples of all patients and controls. The results revealed that there was a positive risk of developing EH when having the T allele whether in homozygous or heterozygous state. From this work, it was concluded that there was an association between ATR1 (A1166C gene polymorphism and the risk of developing EH.

  3. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp.

    Science.gov (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel

    2014-03-15

    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Divergent mechanisms underlie Smad4-mediated positive regulation of the three genes encoding the basement membrane component laminin-332 (laminin-5)

    International Nuclear Information System (INIS)

    Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard

    2008-01-01

    Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the

  5. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  6. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  7. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  8. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  9. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  10. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  11. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  12. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    International Nuclear Information System (INIS)

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

    1991-01-01

    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  13. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  14. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  15. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  16. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Science.gov (United States)

    Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A; Díaz, Begoña

    2014-01-01

    Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  17. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Directory of Open Access Journals (Sweden)

    Pilar Cejudo-Martin

    Full Text Available Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  18. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  19. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  20. Thioredoxin-2 (TRX-2) is an essential gene regulating mitochondria-dependent apoptosis.

    Science.gov (United States)

    Tanaka, Toru; Hosoi, Fumihito; Yamaguchi-Iwai, Yuko; Nakamura, Hajime; Masutani, Hiroshi; Ueda, Shugo; Nishiyama, Akira; Takeda, Shunichi; Wada, Hiromi; Spyrou, Giannis; Yodoi, Junji

    2002-04-02

    Thioredoxin-2 (Trx-2) is a mitochondria-specific member of the thioredoxin superfamily. Mitochondria have a crucial role in the signal transduction for apoptosis. To investigate the biological significance of Trx-2, we cloned chicken TRX-2 cDNA and generated clones of the conditional Trx-2-deficient cells using chicken B-cell line, DT40. Here we show that TRX-2 is an essential gene and that Trx-2-deficient cells undergo apoptosis upon repression of the TRX-2 transgene, showing an accumulation of intracellular reactive oxygen species (ROS). Cytochrome c is released from mitochondria, while caspase-9 and caspase-3, but not caspase-8, are activated upon inhibition of the TRX-2 transgene. In addition, Trx-2 and cytochrome c are co-immunoprecipitated in an in vitro assay. These results suggest that mitochondrial Trx-2 is essential for cell viability, playing a crucial role in the scavenging ROS in mitochondria and regulating the mitochondrial apoptosis signaling pathway.

  1. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  2. A highly divergent gene cluster in honey bees encodes a novel silk family

    OpenAIRE

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

  3. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  4. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  5. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  6. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  7. Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

    2018-07-01

    The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

  8. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    the rice rgMT gene in transgenic yeast and Arabidopsis is implicated in improving their tolerance for .... possible by the use of a microscope with UV optics that ... Abiotic stress factors that induced the expression of the ..... Arabidopsis mutant.

  9. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan

    2014-12-01

    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  10. Molecular cloning and expression of gene encoding aromatic amino acid decarboxylase in 'Vidal blanc' grape berries.

    Science.gov (United States)

    Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming

    2012-04-01

    The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.

  11. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  12. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  13. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  14. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  15. Synthetic lethality between gene defects affecting a single non-essential molecular pathway with reversible steps.

    Directory of Open Access Journals (Sweden)

    Andrei Zinovyev

    2013-04-01

    Full Text Available Systematic analysis of synthetic lethality (SL constitutes a critical tool for systems biology to decipher molecular pathways. The most accepted mechanistic explanation of SL is that the two genes function in parallel, mutually compensatory pathways, known as between-pathway SL. However, recent genome-wide analyses in yeast identified a significant number of within-pathway negative genetic interactions. The molecular mechanisms leading to within-pathway SL are not fully understood. Here, we propose a novel mechanism leading to within-pathway SL involving two genes functioning in a single non-essential pathway. This type of SL termed within-reversible-pathway SL involves reversible pathway steps, catalyzed by different enzymes in the forward and backward directions, and kinetic trapping of a potentially toxic intermediate. Experimental data with recombinational DNA repair genes validate the concept. Mathematical modeling recapitulates the possibility of kinetic trapping and revealed the potential contributions of synthetic, dosage-lethal interactions in such a genetic system as well as the possibility of within-pathway positive masking interactions. Analysis of yeast gene interaction and pathway data suggests broad applicability of this novel concept. These observations extend the canonical interpretation of synthetic-lethal or synthetic-sick interactions with direct implications to reconstruct molecular pathways and improve therapeutic approaches to diseases such as cancer.

  16. Anther-preferential expressing gene PMR is essential for the mitosis of pollen development in rice.

    Science.gov (United States)

    Liu, Yaqin; Xu, Ya; Ling, Sheng; Liu, Shasha; Yao, Jialing

    2017-06-01

    Phenotype identification, expression examination, and function prediction declared that the anther-preferential expressing gene PMR may participate in regulation of male gametophyte development in rice. Male germline development in flowering plants produces the pair of sperm cells for double fertilization and the pollen mitosis is a key process of it. Although the structural features of male gametophyte have been defined, the molecular mechanisms regulating the mitotic cell cycle are not well elucidated in rice. Here, we reported an anther-preferential expressing gene in rice, PMR (Pollen Mitosis Relative), playing an essential role in male gametogenesis. When PMR gene was suppressed via RNAi, the mitosis of microspore was severely damaged, and the plants formed unmatured pollens containing only one or two nucleuses at the anthesis, ultimately leading to serious reduction of pollen fertility and seed-setting. The CRISPR mutants, pmr-1 and pmr-2, both showed the similar defects as the PMR-RNAi lines. Further analysis revealed that PMR together with its co-expressing genes were liable to participate in the regulation of DNA metabolism in the nucleus, and affected the activities of some enzymes related to the cell cycle. We finally discussed that unknown protein PMR contained the PHD, SWIB and Plus-3 domains and they might have coordinating functions in regulation pathway of the pollen mitosis in rice.

  17. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island.

    Science.gov (United States)

    Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-10-01

    Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

  18. The CXCR2 Gene Polymorphism Is Associated with Stroke in Patients with Essential Hypertension

    Directory of Open Access Journals (Sweden)

    Yanina R. Timasheva

    2015-10-01

    Full Text Available Hypertension is the major risk factor for stroke, and genetic factors contribute to its development. Inflammation has been hypothesized to be the key link between blood pressure elevation and stroke. We performed an analysis of the association between inflammatory mediator gene polymorphisms and the incidence of stroke in patients with essential hypertension (EH. The study group consisted of 625 individuals (296 patients with noncomplicated EH, 71 hypertensive patients with ischemic stroke, and 258 control subjects. Both patients and controls were ethnic Tatars originating from the Republic of Bashkortostan (Russian Federation. The analysis has shown that the risk of ischemic stroke was associated with the CXCR2 rs1126579 polymorphism. Our results indicate that among patients with EH, the heterozygous genotype carriers had a higher risk of stroke (OR = 1.72, 95% CI 1.01-2.92, whereas the CXCR2*C/C genotype was protective against stroke (OR = 0.32, 95% CI 0.12-0.83. As shown by the gene-gene interaction analysis, the CXCR2 rs1126579 polymorphism was also present in all genotype/allele combinations associated with the risk of stroke. Genetic patterns associated with stroke also included polymorphisms in the CCL2, CCL18, CX3CR1, CCR5, and CXCL8(IL8 genes, although no association between these loci and stroke was detected by individual analysis.

  19. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  20. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  1. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  2. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  3. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu

    2016-09-01

    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  4. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  5. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  6. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  7. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  8. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    Science.gov (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  9. The Cremeomycin Biosynthetic Gene Cluster Encodes a Pathway for Diazo Formation.

    Science.gov (United States)

    Waldman, Abraham J; Pechersky, Yakov; Wang, Peng; Wang, Jennifer X; Balskus, Emily P

    2015-10-12

    Diazo groups are found in a range of natural products that possess potent biological activities. Despite longstanding interest in these metabolites, diazo group biosynthesis is not well understood, in part because of difficulties in identifying specific genes linked to diazo formation. Here we describe the discovery of the gene cluster that produces the o-diazoquinone natural product cremeomycin and its heterologous expression in Streptomyces lividans. We used stable isotope feeding experiments and in vitro characterization of biosynthetic enzymes to decipher the order of events in this pathway and establish that diazo construction involves late-stage N-N bond formation. This work represents the first successful production of a diazo-containing metabolite in a heterologous host, experimentally linking a set of genes with diazo formation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

    Directory of Open Access Journals (Sweden)

    Se Chang Park

    2013-01-01

    Full Text Available Cyprinid herpes virus 3 (CyHV-3 diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio. Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116 of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116. In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

  11. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

    Science.gov (United States)

    Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

    2013-01-01

    Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

  12. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum

    Science.gov (United States)

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes

    2012-01-01

    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784

  13. ZCURVE 3.0: identify prokaryotic genes with higher accuracy as well as automatically and accurately select essential genes.

    Science.gov (United States)

    Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao

    2015-07-01

    In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. ZCURVE 3.0: identify prokaryotic genes with higher accuracy as well as automatically and accurately select essential genes

    Science.gov (United States)

    Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao

    2015-01-01

    In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. PMID:25977299

  15. Transformation of pickling cucumber with chitinase-encoding genes using Agrobacterium tumefaciens.

    Science.gov (United States)

    Raharjo, S H; Hernandez, M O; Zhang, Y Y; Punja, Z K

    1996-04-01

    Transformation of cucumber cv. Endeavor was attempted using three Agrobacterium tumefaciens strains (a supervirulent leucinopine type, an octopine type and a nopaline type), each harbouring one of three binary vectors which contained an acidic chitinase gene from petunia, and basic chitinase genes from tobacco and bean, respectively, driven by the CaMV 35S promoter. Petiole explants were inoculated with a bacterial suspension (10(8) cells·ml(-1)), cocultivated for 48-96 h and placed on Murashige and Skoog (MS) medium with 5.0 μM each of 2,4-D and BA, 50 mg·l(-1) kanamycin and 500 mg·l(-1) carbenicillin. The frequency of embryogenic callus formation ranged from 0 to 12%, depending on strains/vectors used and length of cocultivation, with the highest being obtained using the leucinopine strain with petunia acidic chitinase gene. The kanamycin-resistant embryogenic calli were used to initiate suspension cultures (in liquid MS medium with 1.0/1.0 μM 2,4-D/BA, 50 mg·l(-1) kanamycin) for multiplication of embryogenic cell aggregates. Upon plating of cell aggregates onto solid MS medium with 1.0/1.0 μM NAA/BA and 50 mg·l(-1) kanamycin, calli continued to grow and later differentiated into plantlets. Transformation by the leucinopine strain and all three vectors was confirmed by PCR amplification of the NPT II gene in transgenic calli and plants, in addition to Southern analysis. Expression of the acidic chitinase gene (from petunia) and both basic chitinase genes (from tobacco and bean) in different transgenic cucumber lines was confirmed by Western analyses.

  16. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy.

    Science.gov (United States)

    O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F

    2011-07-01

    To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

  17. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger

    NARCIS (Netherlands)

    Vries, de R.P.; Vondervoort, van de P.J.I.; Hendriks, L.; Belt, van de M.; Visser, J.

    2002-01-01

    The !-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR.

  18. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  19. 6-Desaturase-Like Encoding Gene Introduction in Catfish (Clarias gariepinus

    Directory of Open Access Journals (Sweden)

    Anny Hary Ayu

    2017-11-01

    Full Text Available African catfish (Clarias gariepinus is one of the economically valuable aquaculture fish species in Indonesia. This research was aimed to produce F0 transgenic catfish carrying masou salmon Δ6-desaturase-like (OmΔ6FAD gene. The Δ6-desaturase enzyme is involved in highly unsaturated fatty acid biosynthesis. Transgenic catfish was produced by sperm-mediated gene transfer using electroporation method. In this study, as the first step, sperms were electroporated with three different OmΔ6FAD concentration (25, 50, and 100 µg mL-1 to have the highest sperm viability after electroporation (125 V/cm, pulse frequency 5 times, pulse length 30 millisecond, pulse interval 0.1 second. The highest sperm viability and sperm carrying OmΔ6FAD were obtain at 100 µg mL-1. This concentration was then used to produce F0 transgenic catfish in the second step. Sperm motility, sperm viability, fertilization rate, hatching rate, and larval survival at 14 days after hatching were the same as the controls (p>0.05. Genomic DNA was extracted from caudal fin and then used as template to identify transgenic F0 by PCR method using specific primer for OmΔ6FAD gene. The PCR result showed that 53.84% of F0 carried OmΔ6FAD gene. The result of fatty acid analysis showed that EPA and DHA contents of F0 transgenic fish and non-transgenic fish were similar.   Keywords: catfish, Δ6-desaturase-like gene, fatty acids, electroporation

  20. Amino acid transporter genes are essential for FLO11-dependent and FLO11-independent biofilm formation and invasive growth in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rasmus Torbensen

    Full Text Available Amino acids can induce yeast cell adhesion but how amino acids are sensed and signal the modulation of the FLO adhesion genes is not clear. We discovered that the budding yeast Saccharomyces cerevisiae CEN.PK evolved invasive growth ability under prolonged nitrogen limitation. Such invasive mutants were used to identify amino acid transporters as regulators of FLO11 and invasive growth. One invasive mutant had elevated levels of FLO11 mRNA and a Q320STOP mutation in the SFL1 gene that encodes a protein kinase A pathway regulated repressor of FLO11. Glutamine-transporter genes DIP5 and GNP1 were essential for FLO11 expression, invasive growth and biofilm formation in this mutant. Invasive growth relied on known regulators of FLO11 and the Ssy1-Ptr3-Ssy5 complex that controls DIP5 and GNP1, suggesting that Dip5 and Gnp1 operates downstream of the Ssy1-Ptr3-Ssy5 complex for regulation of FLO11 expression in a protein kinase A dependent manner. The role of Dip5 and Gnp1 appears to be conserved in the S. cerevisiae strain ∑1278b since the dip5 gnp1 ∑1278b mutant showed no invasive phenotype. Secondly, the amino acid transporter gene GAP1 was found to influence invasive growth through FLO11 as well as other FLO genes. Cells carrying a dominant loss-of-function PTR3(647::CWNKNPLSSIN allele had increased transcription of the adhesion genes FLO1, 5, 9, 10, 11 and the amino acid transporter gene GAP1. Deletion of GAP1 caused loss of FLO11 expression and invasive growth. However, deletions of FLO11 and genes encoding components of the mitogen-activated protein kinase pathway or the protein kinase A pathway were not sufficient to abolish invasive growth, suggesting involvement of other FLO genes and alternative pathways. Increased intracellular amino acid pools in the PTR3(647::CWNKNPLSSIN-containing strain opens the possibility that Gap1 regulates the FLO genes through alteration of the amino acid pool sizes.

  1. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    International Nuclear Information System (INIS)

    Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.

    2013-01-01

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species

  2. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    Energy Technology Data Exchange (ETDEWEB)

    Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)

    2013-10-15

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.

  3. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  4. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  6. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  7. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Science.gov (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  8. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

    Science.gov (United States)

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-07-01

    Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

  9. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

    Science.gov (United States)

    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

    2010-07-01

    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  10. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    International Nuclear Information System (INIS)

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  11. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  12. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

    Science.gov (United States)

    Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

    2004-02-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

  13. Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

    International Nuclear Information System (INIS)

    Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

    1990-01-01

    An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

  14. Detection and characterisation of genes encoding antibiotic resistance in the cultivable oral microflora.

    OpenAIRE

    Villedieu, A.

    2006-01-01

    The emergence of antibiotic-resistant bacteria has become a major threat to public health. The increased use of antibiotics has selected for the dissemination of antibiotic resistance genes between organisms from different species and different genera. There is a large body of evidence that the indigenous microbiota can act as a reservoir of antibiotic-resistant bacteria. However little is known about the molecular basis for this in bacteria from the oral cavity. Therefore the aim of this wor...

  15. Antisense expression of a gene encoding a calcium-binding protein ...

    Indian Academy of Sciences (India)

    PRAKASH

    using the transgenic approach. The transformation of ... methods using EhCaBP or AtCaM3 gene-specific primers in ... acetone) was added, mixed and incubated for 15–18 h in the dark at .... as expected from the design of the AtCaM3 antisense construct .... Thus, there seems to be a positive qualitative correlation between ...

  16. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    Ge Shimei; Xie Baoen; Chen Sanfeng

    2006-01-01

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

  17. A large gene family in fission yeast encodes spore killers that subvert Mendel’s law

    Science.gov (United States)

    Hu, Wen; Jiang, Zhao-Di; Suo, Fang; Zheng, Jin-Xin; He, Wan-Zhong; Du, Li-Lin

    2017-01-01

    Spore killers in fungi are selfish genetic elements that distort Mendelian segregation in their favor. It remains unclear how many species harbor them and how diverse their mechanisms are. Here, we discover two spore killers from a natural isolate of the fission yeast Schizosaccharomyces pombe. Both killers belong to the previously uncharacterized wtf gene family with 25 members in the reference genome. These two killers act in strain-background-independent and genome-location-independent manners to perturb the maturation of spores not inheriting them. Spores carrying one killer are protected from its killing effect but not that of the other killer. The killing and protecting activities can be uncoupled by mutation. The numbers and sequences of wtf genes vary considerably between S. pombe isolates, indicating rapid divergence. We propose that wtf genes contribute to the extensive intraspecific reproductive isolation in S. pombe, and represent ideal models for understanding how segregation-distorting elements act and evolve. DOI: http://dx.doi.org/10.7554/eLife.26057.001 PMID:28631610

  18. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  19. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

    2013-04-01

    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  20. Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

    Science.gov (United States)

    Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

    2013-01-01

    Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

  1. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  2. Preparation of a recombinant adenoviral encoding human NIS gene and its specific expression in cardiomyocytes

    International Nuclear Information System (INIS)

    Wang Lihua; Zhang Miao; Guo Rui; Shi Shuo; Li Biao

    2012-01-01

    Objective: To construct a recombinant adenovirus vector containing the human NIS gene with the myosin light chain-2(MLC-2v) gene as the promoter and evaluate its specific expression and feasibility as a reporter gene in cardiomyocytes. Methods: MLC-2v promoter and NIS were subcloned into an adenovirus shuttle vector, and forwarded by homologous recombination in the bacteria BJ5183 containing AdEasy-1 plasmid. Positive recombinant adenovirus vector was selected, packaged and amplified in the HEK293 cells to obtain recombinant adenovirus Ad-MLC-NIS. Ad-cytomegalovirus (CMV)-NIS with cytomegalovirus as the promoter, Ad-MLC without NIS and Ad-NIS without promoter were constructed as the controls. Cardiomyocytes and non-cardiomyocytes were then infected by the adenovirus. The protein expression was tested by Western blot analysis. The function and features of NIS protein were evaluated by dynamic iodide uptake and NaClO 4 iodine uptake inhibition test in vitro. The viability and proliferation of cardiomyocytes after adenovirus transfection and radioiodine incubation were checked by trypan blue staining. Results: Recombinant NIS adenovirus was successfully constructed. Western blot analysis showed that the NIS protein was highly expressed in cardiomyocytes transfected with Ad-MLC-NIS, and all cells transfected with Ad-CMV-NIS. However, in non-cardiomyocytes transfected with Ad-MLC-NIS, little NIS protein was detected. Dynamic iodine uptake tests showed that the peaks of iodide uptake of the three different cell lines (H9C2, A549, U87 cell) transfected with Ad-MLC-NIS were 5844.0, 833.6 and 846.0 counts · min -1 , respectively. The iodide uptake function of H9C2 was inhibited by NaClO 4 . There was almost no change in cell viability and proliferation when the MOI was 100. Conclusions: Ad-MLC-NIS allows myocardial specific expression of an external gene, and the cardiomyocytes with NIS expression are capable of iodine uptake. Further research of NIS as a reporter gene in

  3. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  4. Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

    Directory of Open Access Journals (Sweden)

    GangQiang Li

    Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

  5. Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes

    Directory of Open Access Journals (Sweden)

    Valentina Monistero

    2018-06-01

    Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.

  6. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  7. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    Energy Technology Data Exchange (ETDEWEB)

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.

    1988-03-01

    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  8. Mining predicted essential genes of Brugia malayi for nematode drug targets.

    Directory of Open Access Journals (Sweden)

    Sanjay Kumar

    Full Text Available We report results from the first genome-wide application of a rational drug target selection methodology to a metazoan pathogen genome, the completed draft sequence of Brugia malayi, a parasitic nematode responsible for human lymphatic filariasis. More than 1.5 billion people worldwide are at risk of contracting lymphatic filariasis and onchocerciasis, a related filarial disease. Drug treatments for filariasis have not changed significantly in over 20 years, and with the risk of resistance rising, there is an urgent need for the development of new anti-filarial drug therapies. The recent publication of the draft genomic sequence for B. malayi enables a genome-wide search for new drug targets. However, there is no functional genomics data in B. malayi to guide the selection of potential drug targets. To circumvent this problem, we have utilized the free-living model nematode Caenorhabditis elegans as a surrogate for B. malayi. Sequence comparisons between the two genomes allow us to map C. elegans orthologs to B. malayi genes. Using these orthology mappings and by incorporating the extensive genomic and functional genomic data, including genome-wide RNAi screens, that already exist for C. elegans, we identify potentially essential genes in B. malayi. Further incorporation of human host genome sequence data and a custom algorithm for prioritization enables us to collect and rank nearly 600 drug target candidates. Previously identified potential drug targets cluster near the top of our prioritized list, lending credibility to our methodology. Over-represented Gene Ontology terms, predicted InterPro domains, and RNAi phenotypes of C. elegans orthologs associated with the potential target pool are identified. By virtue of the selection procedure, the potential B. malayi drug targets highlight components of key processes in nematode biology such as central metabolism, molting and regulation of gene expression.

  9. Accessory Gene Regulator-1 Locus Is Essential for Virulence and Pathogenesis of Clostridium difficile

    Directory of Open Access Journals (Sweden)

    Charles Darkoh

    2016-08-01

    Full Text Available Clostridium difficile infection (CDI is responsible for most of the definable cases of antibiotic- and hospital-associated diarrhea worldwide and is a frequent cause of morbidity and mortality in older patients. C. difficile, a multidrug-resistant anaerobic pathogen, causes disease by producing toxins A and B, which are controlled by an accessory gene regulator (Agr quorum signaling system. Some C. difficile strains encode two Agr loci in their genomes, designated agr1 and agr2. The agr1 locus is present in all of the C. difficile strains sequenced to date, whereas the agr2 locus is present in a few strains. The functional roles of agr1 and agr2 in C. difficile toxin regulation and pathogenesis were unknown until now. Using allelic exchange, we deleted components of both agr loci and examined the mutants for toxin production and virulence. The results showed that the agr1 mutant cannot produce toxins A and B; toxin production can be restored by complementation with wild-type agr1. Furthermore, the agr1 mutant is able to colonize but unable to cause disease in a murine CDI model. These findings have profound implications for CDI treatment because we have uncovered a promising therapeutic target for the development of nonantibiotic drugs to treat this life-threatening emerging pathogen by targeting the toxins directly responsible for disease.

  10. Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

    Science.gov (United States)

    Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

    2017-01-01

    Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

  11. Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

    Directory of Open Access Journals (Sweden)

    Deyana Gencheva Hristova

    2018-03-01

    Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

  12. Expression of the gene encoding the ghrelin receptor in rats selected for differential alcohol preference.

    Science.gov (United States)

    Landgren, Sara; Engel, Jörgen A; Hyytiä, Petri; Zetterberg, Henrik; Blennow, Kaj; Jerlhag, Elisabet

    2011-08-01

    The mechanisms involved in alcohol use disorder, a chronic relapsing brain disorder, are complex and involve various signalling systems in the brain. Recently, the orexigenic peptide ghrelin was shown to be required for alcohol-induced reward, an effect mediated via ghrelin receptors, GHS-R1A, at the level of the cholinergic-dopaminergic reward link. Moreover, ghrelin increases and GHR-R1A antagonists reduce moderate alcohol consumption in mice, and a single nucleotide polymorphism in the GHS-R1A gene has been associated with high alcohol consumption in humans. Therefore, GHS-R1A gene expression and alcohol intake were investigated in high, AA (Alko, Alcohol), versus low, ANA (Alko, Non-Alcohol), alcohol consuming rats as well as in Wistar rats. In the AA and ANA rats plasma ghrelin levels were also measured. GHS-R1A gene expression was increased in AA compared to ANA rats in nucleus accumbens, ventral tegmental area, amygdala, prefrontal cortex and hippocampus. A similar trend was observed in the ventral tegmental area of Wistar rats consuming high amounts of alcohol. Furthermore, the AA rats had significantly smaller reduction of plasma ghrelin levels over time, after several weeks of alcohol exposure, than had the ANA rats. The present study provides further evidence for that the ghrelin signalling system, in particular at the level of the mesocortocolimbic dopamine system, is involved in alcohol consumption, and thus possibly contributes to alcohol use disorder. Therefore the GHS-R1A may constitute a novel candidate for development of new treatment strategies for alcohol dependence. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Human PTCHD3 nulls: rare copy number and sequence variants suggest a non-essential gene

    Directory of Open Access Journals (Sweden)

    Lionel Anath C

    2011-03-01

    Full Text Available Abstract Background Copy number variations (CNVs can contribute to variable degrees of fitness and/or disease predisposition. Recent studies show that at least 1% of any given genome is copy number variable when compared to the human reference sequence assembly. Homozygous deletions (or CNV nulls that are found in the normal population are of particular interest because they may serve to define non-essential genes in human biology. Results In a genomic screen investigating CNV in Autism Spectrum Disorders (ASDs we detected a heterozygous deletion on chromosome 10p12.1, spanning the Patched-domain containing 3 (PTCHD3 gene, at a frequency of ~1.4% (6/427. This finding seemed interesting, given recent discoveries on the role of another Patched-domain containing gene (PTCHD1 in ASD. Screening of another 177 ASD probands yielded two additional heterozygous deletions bringing the frequency to 1.3% (8/604. The deletion was found at a frequency of ~0.73% (27/3,695 in combined control population from North America and Northern Europe predominately of European ancestry. Screening of the human genome diversity panel (HGDP-CEPH covering worldwide populations yielded deletions in 7/1,043 unrelated individuals and those detected were confined to individuals of European/Mediterranean/Middle Eastern ancestry. Breakpoint mapping yielded an identical 102,624 bp deletion in all cases and controls tested, suggesting a common ancestral event. Interestingly, this CNV occurs at a break of synteny between humans and mouse. Considering all data, however, no significant association of these rare PTCHD3 deletions with ASD was observed. Notwithstanding, our RNA expression studies detected PTCHD3 in several tissues, and a novel shorter isoform for PTCHD3 was characterized. Expression in transfected COS-7 cells showed PTCHD3 isoforms colocalize with calnexin in the endoplasmic reticulum. The presence of a patched (Ptc domain suggested a role for PTCHD3 in various biological

  14. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  15. Bcmimp1, a Botrytis cinerea gene transiently expressed in planta, encodes a mitochondrial protein

    Directory of Open Access Journals (Sweden)

    David eBenito-Pescador

    2016-02-01

    Full Text Available Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of ROS, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.

  16. Brain transcriptional stability upon prion protein-encoding gene invalidation in zygotic or adult mouse

    Directory of Open Access Journals (Sweden)

    Béringue Vincent

    2010-07-01

    Full Text Available Abstract Background The physiological function of the prion protein remains largely elusive while its key role in prion infection has been expansively documented. To potentially assess this conundrum, we performed a comparative transcriptomic analysis of the brain of wild-type mice with that of transgenic mice invalidated at this locus either at the zygotic or at the adult stages. Results Only subtle transcriptomic differences resulting from the Prnp knockout could be evidenced, beside Prnp itself, in the analyzed adult brains following microarray analysis of 24 109 mouse genes and QPCR assessment of some of the putatively marginally modulated loci. When performed at the adult stage, neuronal Prnp disruption appeared to sequentially induce a response to an oxidative stress and a remodeling of the nervous system. However, these events involved only a limited number of genes, expression levels of which were only slightly modified and not always confirmed by RT-qPCR. If not, the qPCR obtained data suggested even less pronounced differences. Conclusions These results suggest that the physiological function of PrP is redundant at the adult stage or important for only a small subset of the brain cell population under classical breeding conditions. Following its early reported embryonic developmental regulation, this lack of response could also imply that PrP has a more detrimental role during mouse embryogenesis and that potential transient compensatory mechanisms have to be searched for at the time this locus becomes transcriptionally activated.

  17. Prokaryotic Expression of Rice Ospgip1 Gene and Bioinformatic Analysis of Encoded Product

    Directory of Open Access Journals (Sweden)

    Xi-jun CHEN

    2011-12-01

    Full Text Available Using the reference sequences of pgip genes in GenBank, a fragment of 930 bp covering the open reading frame (ORF of rice Ospgip1 (Oryza sativa polygalacturonase-inhibiting protein 1 was amplified. The prokaryotic expression product of the gene inhibited the growth of Rhizoctonia solani, the causal agent of rice sheath blight, and reduced its polygalacturonase activity. Bioinformatic analysis showed that OsPGIP1 is a hydrophobic protein with a molecular weight of 32.8 kDa and an isoelectric point (pI of 7.26. The protein is mainly located in the cell wall of rice, and its signal peptide cleavage site is located between the 17th and 18th amino acids. There are four cysteines in both the N- and C-termini of the deduced protein, which can form three disulfide bonds (between the 56th and 63rd, the 278th and 298th, and the 300th and 308th amino acids. The protein has a typical leucine-rich repeat (LRR domain, and its secondary structure comprises α-helices, β-sheets and irregular coils. Compared with polygalacturonase-inhibiting proteins (PGIPs from other plants, the 7th LRR is absent in OsPGIP1. The nine LRRs could form a cleft that might associate with proteins from pathogenic fungi, such as polygalacturonase.

  18. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    Science.gov (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  19. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

    DEFF Research Database (Denmark)

    Molzen, T E; Burghout, P; Bootsma, H J

    2010-01-01

    Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

  20. Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis

    Directory of Open Access Journals (Sweden)

    Jun Ueda

    2017-01-01

    Full Text Available Cellular differentiation is associated with dynamic chromatin remodeling in establishing a cell-type-specific epigenomic landscape. Here, we find that mouse testis-specific and replication-dependent histone H3 variant H3t is essential for very early stages of spermatogenesis. H3t gene deficiency leads to azoospermia because of the loss of haploid germ cells. When differentiating spermatogonia emerge in normal spermatogenesis, H3t appears and replaces the canonical H3 proteins. Structural and biochemical analyses reveal that H3t-containing nucleosomes are more flexible than the canonical nucleosomes. Thus, by incorporating H3t into the genome during spermatogonial differentiation, male germ cells are able to enter meiosis and beyond.

  1. Regulation of Msx genes by a Bmp gradient is essential for neural crest specification.

    Science.gov (United States)

    Tribulo, Celeste; Aybar, Manuel J; Nguyen, Vu H; Mullins, Mary C; Mayor, Roberto

    2003-12-01

    genetic cascade. In order to study the hierarchical relationship between msx1 and snail/slug we performed several rescue experiments using dominant negatives for these genes. The rescuing activity by snail and slug on neural crest development of the msx1 dominant negative, together with the inability of msx1 to rescue the dominant negatives of slug and snail strongly argue that msx1 is upstream of snail and slug in the genetic cascade that specifies the neural crest in the ectoderm. We propose a model where a gradient of Bmp activity specifies the expression of Msx genes in the neural folds, and that this expression is essential for the early specification of the neural crest.

  2. A Cluster of Five Genes Essential for the Utilization of Dihydroxamate Xenosiderophores in Synechocystis sp. PCC 6803.

    Science.gov (United States)

    Obando S, Tobias A; Babykin, Michael M; Zinchenko, Vladislav V

    2018-05-21

    The unicellular freshwater cyanobacterium Synechocystis sp. PCC 6803 is capable of using dihydroxamate xenosiderophores, either ferric schizokinen (FeSK) or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in the TonB-dependent manner. The fecCDEB1-schT gene cluster encoding a siderophore transport system that is involved in the utilization of FeSK and SAV in Synechocystis sp. PCC 6803 was identified. The gene schT encodes TonB-dependent outer membrane transporter, whereas the remaining four genes encode the ABC-type transporter FecB1CDE formed by the periplasmic binding protein FecB1, the transmembrane permease proteins FecC and FecD, and the ATPase FecE. Inactivation of any of these genes resulted in the inability of cells to utilize FeSK and SAV. Our data strongly suggest that Synechocystis sp. PCC 6803 can readily internalize Fe-siderophores via the classic TonB-dependent transport system.

  3. The Aspergillus uvsH gene encodes a product homologous to yeast RAD18 and Neurospora UVS-2.

    Science.gov (United States)

    Yoon, J H; Lee, B J; Kang, H S

    1995-07-28

    The uvsH DNA repair gene of Aspergillus nidulans has been cloned by complementation of the uvsH77 mutation with a cosmid library containing genomic DNA inserts from a wild-type strain. Methylmethane sulfonate (MMS)-resistant transformants were obtained on medium containing 0.01% MMS, to which uvsH mutants exhibit high sensitivity. Retransformation of uvsH77 mutants with the rescued cosmids from the MMS-resistant transformants resulted in restoration of both UV and MMS resistance to wild-type levels. Nucleotide sequence analysis of the genomic DNA and cDNA of the uvsH gene shows that it has an open reading frame (ORF) of 1329 bp, interrupted by two introns of 51 and 61 bp. A 2.4 kb transcript of the uvsH gene was detected by Northern blot analysis. Primer extension analysis revealed that transcription starts at 31 bp upstream from the translation initiation codon. This gene encodes a predicted polypeptide of 443 amino acids, which has two unique zinc finger motifs. The proposed polypeptide displays 39% identity to the Neurospora crassa UVS-2 protein and 24% identity to the Saccharomyces cerevisiae RAD18 protein. The sequence similarity is particularly high in three domains. One zinc finger (RING finger) motif is located in the first domain close to the N-terminus. The other zinc finger motif is in the second domain. In the third domain, the mutation sites in both the uvsH77 and uvsH304 alleles were identified.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    Science.gov (United States)

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  5. Single nucleotide polymorphism in gene encoding transcription factor Prep1 is associated with HIV-1-associated dementia.

    Directory of Open Access Journals (Sweden)

    Sebastiaan M Bol

    Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.

  6. Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

    Directory of Open Access Journals (Sweden)

    Xiangqi Zhang

    2013-07-01

    Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

  7. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  8. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  9. Common variants of the genes encoding erythropoietin and its receptor modulate cognitive performance in schizophrenia

    DEFF Research Database (Denmark)

    Kästner, Anne; Grube, Sabrina; El-Kordi, Ahmed

    2012-01-01

    -term memory readouts, with one particular combination of genotypes superior to all others (p 800), these associations were confirmed. A matching preclinical study with mice demonstrated cognitive processing speed and memory enhanced upon transgenic......Erythropoietin (EPO) improves cognitive performance in clinical studies and rodent experiments. We hypothesized that an intrinsic role of EPO for cognition exists, with particular relevance in situations of cognitive decline, which is reflected by associations of EPO and EPO receptor (EPOR......) genotypes with cognitive functions. To prove this hypothesis, schizophrenic patients (N > 1000) were genotyped for 5' upstream-located gene variants, EPO SNP rs1617640 (T/G) and EPORSTR(GA)(n). Associations of these variants were obtained for cognitive processing speed, fine motor skills and short...

  10. Food and human gut as reservoirs of transferable antibiotic resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Jean-Marc eRolain

    2013-06-01

    Full Text Available The increase and spread of antibiotic resistance (AR over the past decade in human pathogens has become a worldwide health concern. Recent genomic and metagenomic studies in humans, animals, in food and in the environment have led to the discovery of a huge reservoir of AR genes called the resistome that could be mobilized and transferred from these sources to human pathogens. AR is a natural phenomenon developed by bacteria to protect antibiotic-producing bacteria from their own products and also to increase their survival in highly competitive microbial environments. Although antibiotics are used extensively in humans and animals, there is also considerable usage of antibiotics in agriculture, especially in animal feeds and aquaculture. The aim of this review is to give an overview of the sources of AR and the use of antibiotics in these reservoirs as selectors for emergence of AR bacteria in humans via the food chain.

  11. A Complementary Bioinformatics Approach to Identify Potential Plant Cell Wall Glycosyltransferase-Encoding Genes

    DEFF Research Database (Denmark)

    Egelund, Jack; Skjøt, Michael; Geshi, Naomi

    2004-01-01

    Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...

  12. The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase

    Science.gov (United States)

    Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.

    2009-01-01

    Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826

  13. Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    M Shanthi

    2012-01-01

    Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

  14. Renin-Angiotensin System Genes Polymorphisms and Essential Hypertension in Burkina Faso, West Africa

    Directory of Open Access Journals (Sweden)

    Daméhan Tchelougou

    2015-01-01

    Full Text Available Objective. This study aimed to investigate the association between three polymorphisms of renin-angiotensin system and the essential hypertension in the population of Burkina Faso. Methodology. This was a case-control study including 202 cases and 204 matched controls subjects. The polymorphisms were identified by a classical and a real-time PCR. Results. The AGT 235M/T and AT1R 1166A/C polymorphisms were not associated with the hypertension while the genotype frequencies of the ACE I/D polymorphism between patients and controls (DD: 66.83% and 35.78%, ID: 28.22% and 50.98%, II: 4.95% and 13.24%, resp. were significantly different (p < 10−4. The genotype DD of ACE gene (OR = 3.40, p < 0.0001, the increasing age (OR = 3.83, p < 0.0001, obesity (OR = 4.84, p < 0.0001, dyslipidemia (OR = 3.43, p = 0.021, and alcohol intake (OR = 2.76, p < 0.0001 were identified as the independent risk factors for hypertension by multinomial logistic regression. Conclusion. The DD genotype of the ACE gene is involved in susceptibility to hypertension. Further investigations are needed to better monitor and provide individualized care for hypertensive patients.

  15. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  16. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  17. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  18. The milkweed pod1 gene encodes a KANADI protein that is required for abaxial/adaxial patterning in maize leaves.

    Science.gov (United States)

    Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah

    2008-08-01

    Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues.

  19. Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

    2013-04-01

    The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

  20. The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

    Science.gov (United States)

    Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

    2017-07-01

    The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  2. E-selectin gene polymorphisms and essential hypertension in Asian population: an updated meta-analysis.

    Directory of Open Access Journals (Sweden)

    Gaojun Cai

    Full Text Available Epidemiological studies have shown that E-selectin gene polymorphisms (A561C and C1839T may be associated with essential hypertension (EH, but the results are conflicting in different ethnic populations. Thus, we performed this meta-analysis to investigate a more authentic association between E-selectin gene polymorphisms and the risk of EH.We searched the relevant studies for the present meta-analysis from the following electronic databases: PubMed, Embase, Cochrane Library, Google Scholar, Web of Science, Wanfang Data, and China National Knowledge Infrastructure (CNKI. Odds ratios (OR with 95% confidence interval (CI were used to evaluate the strength of the association between E-selectin gene polymorphisms and EH susceptibility. The pooled ORs were performed for dominant model, allelic model and recessive model. The publication bias was examined by Begg's funnel plots and Egger's test.A total of eleven studies met the inclusion criteria. All studies came from Asians. Ten studies (12 cohorts evaluated the A561C polymorphism and EH risk, including 2,813 cases and 2,817 controls. The pooled OR was 2.280 (95%CI: 1.893-2.748, P<0.001 in dominant model, 5.284 (95%CI: 2.679-10.420, P<0.001 in recessive model and 2.359 (95%CI: 1.981-2.808, P = 0.001 in allelic model. Four studies (six cohorts evaluated C1839T polymorphism and EH risk, including 1,700 cases and 1,681 controls. The pooled OR was 0.785 (95%CI: 0.627-0.983, P = 0.035 in dominant model, 1.250 (95%CI: 0.336-4.652, P = 0.739 in recessive model and 0.805 (95%CI: 0.649-0.999, P = 0.049 in allelic model.The current meta-analysis concludes that the C allele of E-selectin A561C gene polymorphism might increase the EH risk in Asian population, whereas the T allele of E-selectin C1839T gene polymorphism might decrease the EH risk.

  3. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

    Science.gov (United States)

    Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

    2016-01-01

    Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

  4. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  5. Role of the pathotype-specific ACRTS1 gene encoding a hydroxylase involved in the biosynthesis of host-selective ACR-toxin in the rough lemon pathotype of Alternaria alternata.

    Science.gov (United States)

    Izumi, Yuriko; Kamei, Eri; Miyamoto, Yoko; Ohtani, Kouhei; Masunaka, Akira; Fukumoto, Takeshi; Gomi, Kenji; Tada, Yasuomi; Ichimura, Kazuya; Peever, Tobin L; Akimitsu, Kazuya

    2012-08-01

    The rough lemon pathotype of Alternaria alternata produces host-selective ACR-toxin and causes Alternaria leaf spot disease of the rootstock species rough lemon (Citrus jambhiri) and Rangpur lime (C. limonia). Genes controlling toxin production were localized to a 1.5-Mb chromosome carrying the ACR-toxin biosynthesis gene cluster (ACRT) in the genome of the rough lemon pathotype. A genomic BAC clone containing a portion of the ACRT cluster was sequenced which allowed identification of three open reading frames present only in the genomes of ACR-to