
Sample records for erythroid transcription factor

  1. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)


    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  2. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.


    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  3. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway. (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang


    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  4. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail:


    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  5. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2). (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y


    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Larissa M., E-mail: [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others


    Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

  7. Omeprazole induces NAD(P)H quinone oxidoreductase 1 via aryl hydrocarbon receptor-independent mechanisms: Role of the transcription factor nuclear factor erythroid 2–related factor 2

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail:


    Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. - Highlights: • We investigated whether omeprazole induces NQO1 in human fetal lung cells. • Omeprazole induces the phase II enzyme, NQO1, in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of NQO1. • Omeprazole increases phosphoNrf2 (S40) protein expression in human fetal lung cells. • Nrf2 knockdown abrogates the induction of NQO1 by omeprazole in human lung cells.

  8. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.


    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  9. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation. (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S


    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  10. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.


    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  11. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon


    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  12. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)


    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  13. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions. (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu


    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  14. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely


    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  15. WRKY transcription factors (United States)

    Bakshi, Madhunita; Oelmüller, Ralf


    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  16. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice. (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D


    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  17. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway. (United States)

    Ha, Ae Wha; Kim, Woo Kyoung


    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  18. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I


    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  19. Transcription factors: normal and malignant development of blood cells

    National Research Council Canada - National Science Library

    Ravid, Katya; Licht, Jonathan


    ... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail:


    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun


    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  2. Erythroid-specific transcriptional changes in PBMCs from pulmonary hypertension patients.

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs is a powerful tool for the identification of surrogate markers involved in disease processes. The hypothesis tested in this study was that chronic exposure of PBMCs to a hypertensive environment in remodeled pulmonary vessels would be reflected by specific transcriptional changes in these cells.The transcript profiles of PBMCs from 30 idiopathic pulmonary arterial hypertension patients (IPAH, 19 patients with systemic sclerosis without pulmonary hypertension (SSc, 42 scleroderma-associated pulmonary arterial hypertensio patients (SSc-PAH, and 8 patients with SSc complicated by interstitial lung disease and pulmonary hypertension (SSc-PH-ILD were compared to the gene expression profiles of PBMCs from 41 healthy individuals. Multiple gene expression signatures were identified which could distinguish various disease groups from controls. One of these signatures, specific for erythrocyte maturation, is enriched specifically in patients with PH. This association was validated in multiple published datasets. The erythropoiesis signature was strongly correlated with hemodynamic measures of increasing disease severity in IPAH patients. No significant correlation of the same type was noted for SSc-PAH patients, this despite a clear signature enrichment within this group overall. These findings suggest an association of the erythropoiesis signature in PBMCs from patients with PH with a variable presentation among different subtypes of disease.In PH, the expansion of immature red blood cell precursors may constitute a response to the increasingly hypoxic conditions prevalent in this syndrome. A correlation of this erythrocyte signature with more severe hypertension cases may provide an important biomarker of disease progression.

  3. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer


    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.


    NARCIS (Netherlands)


    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  5. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru


    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  6. Transcriptional regulation by competing transcription factor modules.

    Directory of Open Access Journals (Sweden)

    Rutger Hermsen


    Full Text Available Gene regulatory networks lie at the heart of cellular computation. In these networks, intracellular and extracellular signals are integrated by transcription factors, which control the expression of transcription units by binding to cis-regulatory regions on the DNA. The designs of both eukaryotic and prokaryotic cis-regulatory regions are usually highly complex. They frequently consist of both repetitive and overlapping transcription factor binding sites. To unravel the design principles of these promoter architectures, we have designed in silico prokaryotic transcriptional logic gates with predefined input-output relations using an evolutionary algorithm. The resulting cis-regulatory designs are often composed of modules that consist of tandem arrays of binding sites to which the transcription factors bind cooperatively. Moreover, these modules often overlap with each other, leading to competition between them. Our analysis thus identifies a new signal integration motif that is based upon the interplay between intramodular cooperativity and intermodular competition. We show that this signal integration mechanism drastically enhances the capacity of cis-regulatory domains to integrate signals. Our results provide a possible explanation for the complexity of promoter architectures and could be used for the rational design of synthetic gene circuits.

  7. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.


    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  8. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin


    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...

  9. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2. (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan


    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K


    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail:; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail:


    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells. (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina


    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Transcription factor-based biosensor (United States)

    Dietrich, Jeffrey A; Keasling, Jay D


    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  14. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis. (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie


    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae). (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan


    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  16. Transcriptional control of megakaryocyte development. (United States)

    Goldfarb, A N


    Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.

  17. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation. (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique


    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio


    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  19. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers. (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata


    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  20. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.


    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  1. Survey and evaluation of mutations in the human KLF1 transcription unit. (United States)

    Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J


    Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.

  2. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... transcriptional networks by integrating exogenous and endogenous stimuli and regulating gene expression accordingly. Regulation of transcription factors and their activation is thus highly important to modulate the transcriptional programs and increase fitness of the plant in a given environment. Plant metabolism....... The biosynthetic machinery of GLS is governed by interplay of six MYB and three bHLH transcription factors. MYB28, MYB29 and MYB76 regulate methionine-derived GLS, and MYB51, MYB34 and MYB122 regulate tryptophan-derived GLS. The three bHLH transcription factors MYC2, MYC3 and MYC4 physically interact with all six...

  3. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain


    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  4. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  5. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria


    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  6. NAC transcription factors: structurally distinct, functionally diverse

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi A; Leggio, Leila Lo


    level and localization, and to the first indications of NAC participation in transcription factor networks. The recent determination of the DNA and protein binding NAC domain structure offers insight into the molecular functions of the protein family. Research into NAC transcription factors has......NAC proteins constitute one of the largest families of plant-specific transcription factors, and the family is present in a wide range of land plants. Here, we summarize the biological and molecular functions of the NAC family, paying particular attention to the intricate regulation of NAC protein...

  7. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam


    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  8. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P


    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  9. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice. (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D


    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  10. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia


    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  11. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)


    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  12. Natural antioxidants exhibit chemopreventive characteristics through the regulation of CNC b-Zip transcription factors in estrogen-induced breast carcinogenesis. (United States)

    Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K


    The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.

  13. Polyphenol Compound as a Transcription Factor Inhibitor. (United States)

    Park, Seyeon


    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).

  14. Runx transcription factors in neuronal development

    Directory of Open Access Journals (Sweden)

    Shiga Takashi


    Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.

  15. Mitochondrial transcription factor A protects human retinal ...

    African Journals Online (AJOL)

    Purpose: To investigate the impact of mitochondrial transcription factor A (TFAM), as a modulator of NF-κB, on proliferation of hypoxia-induced human retinal endothelial cell (HREC), and the probable mechanism. Methods: After exposure to hypoxia (1 % O2) for 5 days, cell proliferation and cell cycle of HREC were ...

  16. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park


    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  17. Cross-Family Transcription Factor Interactions

    NARCIS (Netherlands)

    Bemer, Marian; Dijk, van Aalt-Jan; Immink, Richard G.H.; Angenent, Gerco C.


    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger

  18. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail:


    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  19. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason


    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.


    Directory of Open Access Journals (Sweden)

    Danae eCampos-Melo


    Full Text Available The Nur transcription factors Nur77 (NGFI-B, NR4A1, Nurr1 (NR4A2 and Nor-1 (NR4A3 are a sub-family of orphan members of the nuclear receptor superfamily. These transcription factors are products of immediate early genes, whose expression is rapidly and transiently induced in the central nervous system by several types of stimuli. Nur factors are present throughout the hypothalamus-pituitary-adrenal axis where are prominently induced in response to stress. Drugs of abuse and stress also induce the expression of Nur factors in nuclei of the motivation/reward circuit of the brain, indicating their participation in the process of drug addiction and in non-hypothalamic responses to stress. Repeated use of addictive drugs and chronic stress induce long-lasting dysregulation of the brain motivation/reward circuit, due to reprogramming of gene expression and enduring alterations in neuronal function. Here, we review the data supporting that Nur transcription factors are key players in the molecular basis of the dysregulation of neuronal circuits involved in chronic stress and addiction.

  1. Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference. (United States)

    Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E


    Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.

  2. Adaptive evolution of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Berg Johannes


    Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

  3. Molecular analysis of the interaction between the hematopoietic master transcription factors GATA-1 and PU.1

    DEFF Research Database (Denmark)

    Liew, Chu Wai; Rand, Kasper Dyrberg; Simpson, Raina J Y


    GATA-1 and PU.1 are transcription factors that control erythroid and myeloid development, respectively. The two proteins have been shown to function in an antagonistic fashion, with GATA-1 repressing PU.1 activity during erythropoiesis and PU.1 repressing GATA-1 function during myelopoiesis. It has...... also become clear that this functional antagonism involves direct interactions between the two proteins. However, the molecular basis for these interactions is not known, and a number of inconsistencies exist in the literature. We have used a range of biophysical methods to define the molecular details...... of the GATA-1-PU.1 interaction. A combination of NMR titration data and extensive mutagenesis revealed that the PU.1-Ets domain and the GATA-1 C-terminal zinc finger (CF) form a low affinity interaction in which specific regions of each protein are implicated. Surprisingly, the interaction cannot be disrupted...

  4. Modulation of transcription factors by curcumin. (United States)

    Shishodia, Shishir; Singh, Tulika; Chaturvedi, Madan M


    Curcumin is the active ingredient of turmeric that has been consumed as a dietary spice for ages. Turmeric is widely used in traditional Indian medicine to cure biliary disorders, anorexia, cough, diabetic wounds, hepatic disorders, rheumatism, and sinusitis. Extensive investigation over the last five decades has indicated that curcumin reduces blood cholesterol, prevents low-density lipoprotein oxidation, inhibits platelet aggregation, suppresses thrombosis and myocardial infarction, suppresses symptoms associated with type II diabetes, rheumatoid arthritis, multiple sclerosis, and Alzheimer's disease, inhibits HIV replication, enhances wound healing, protects from liver injury, increases bile secretion, protects from cataract formation, and protects from pulmonary toxicity and fibrosis. Evidence indicates that the divergent effects of curcumin are dependent on its pleiotropic molecular effects. These include the regulation of signal transduction pathways and direct modulation of several enzymatic activities. Most of these signaling cascades lead to the activation of transcription factors. Curcumin has been found to modulate the activity of several key transcription factors and, in turn, the cellular expression profiles. Curcumin has been shown to elicit vital cellular responses such as cell cycle arrest, apoptosis, and differentiation by activating a cascade of molecular events. In this chapter, we briefly review the effects of curcumin on transcription factors NF-KB, AP-1, Egr-1, STATs, PPAR-gamma, beta-catenin, nrf2, EpRE, p53, CBP, and androgen receptor (AR) and AR-related cofactors giving major emphasis to the molecular mechanisms of its action.

  5. Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Biaoru Li

    Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

  6. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro. (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J


    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  7. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares


    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  8. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients. (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele


    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  9. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo


    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  10. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species. (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J


    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells. (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin


    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  12. The evolution of WRKY transcription factors. (United States)

    Rinerson, Charles I; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Rushton, Paul J


    The availability of increasing numbers of sequenced genomes has necessitated a re-evaluation of the evolution of the WRKY transcription factor family. Modern day plants descended from a charophyte green alga that colonized the land between 430 and 470 million years ago. The first charophyte genome sequence from Klebsormidium flaccidum filled a gap in the available genome sequences in the plant kingdom between unicellular green algae that typically have 1-3 WRKY genes and mosses that contain 30-40. WRKY genes have been previously found in non-plant species but their occurrence has been difficult to explain. Only two WRKY genes are present in the Klebsormidium flaccidum genome and the presence of a Group IIb gene was unexpected because it had previously been thought that Group IIb WRKY genes first appeared in mosses. We found WRKY transcription factor genes outside of the plant lineage in some diplomonads, social amoebae, fungi incertae sedis, and amoebozoa. This patchy distribution suggests that lateral gene transfer is responsible. These lateral gene transfer events appear to pre-date the formation of the WRKY groups in flowering plants. Flowering plants contain proteins with domains typical for both resistance (R) proteins and WRKY transcription factors. R protein-WRKY genes have evolved numerous times in flowering plants, each type being restricted to specific flowering plant lineages. These chimeric proteins contain not only novel combinations of protein domains but also novel combinations and numbers of WRKY domains. Once formed, R protein WRKY genes may combine different components of signalling pathways that may either create new diversity in signalling or accelerate signalling by short circuiting signalling pathways. We propose that the evolution of WRKY transcription factors includes early lateral gene transfers to non-plant organisms and the occurrence of algal WRKY genes that have no counterparts in flowering plants. We propose two alternative hypotheses

  13. Fatty Acid–Regulated Transcription Factors in the Liver (United States)

    Jump, Donald B.; Tripathy, Sasmita; Depner, Christopher M.


    Fatty acid regulation of hepatic gene transcription was first reported in the early 1990s. Several transcription factors have been identified as targets of fatty acid regulation. This regulation is achieved by direct fatty acid binding to the transcription factor or by indirect mechanisms where fatty acids regulate signaling pathways controlling the expression of transcription factors or the phosphorylation, ubiquitination, or proteolytic cleavage of the transcription factor. Although dietary fatty acids are well-established regulators of hepatic transcription factors, emerging evidence indicates that endogenously generated fatty acids are equally important in controlling transcription factors in the context of glucose and lipid homeostasis. Our first goal in this review is to provide an up-to-date examination of the molecular and metabolic bases of fatty acid regulation of key transcription factors controlling hepatic metabolism. Our second goal is to link these mechanisms to nonalcoholic fatty liver disease (NAFLD), a growing health concern in the obese population. PMID:23528177

  14. Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana.

    NARCIS (Netherlands)

    Smet, De I.; Lau, S.; Ehrismann, J.S.; Axiotis, I.; Kolb, M.; Kientz, M.; Weijers, D.; Jürgens, G.


    In Arabidopsis thaliana, the phytohormone auxin is an important patterning agent during embryogenesis and post-embryonic development, exerting effects through transcriptional regulation. The main determinants of the transcriptional auxin response machinery are AUXIN RESPONSE FACTOR (ARF)

  15. A human transcription factor in search mode. (United States)

    Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos


    Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. A transcription factor for cold sensation!

    Directory of Open Access Journals (Sweden)

    Milbrandt Jeffrey


    Full Text Available Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral responses to noxious heat or mechanical stimuli were normal. Furthermore, behavioral responses remained reduced or blocked in NGFIB knockout mice even after repetitive application of cold stimuli. Our results provide strong evidence that the first transcription factor NGFIB determines the ability of animals to respond to cold stimulation.

  17. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.


    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  18. A dominant mutation in the gene encoding the erythroid transcription factor KLF1 causes a congenital dyserythropoietic anemia

    DEFF Research Database (Denmark)

    Arnaud, Lionel; Saison, Carole; Helias, Virginie


    The congenital dyserythropoietic anemias (CDAs) are inherited red blood cell disorders whose hallmarks are ineffective erythropoiesis, hemolysis, and morphological abnormalities of erythroblasts in bone marrow. We have identified a missense mutation in KLF1 of patients with a hitherto unclassified...

  19. Determination of specificity influencing residues for key transcription factor families

    DEFF Research Database (Denmark)

    Patel, Ronak Y.; Garde, Christian; Stormo, Gary D.


    Transcription factors (TFs) are major modulators of transcription and subsequent cellular processes. The binding of TFs to specific regulatory elements is governed by their specificity. Considering the gap between known TFs sequence and specificity, specificity prediction frameworks are highly de...

  20. DNA residence time is a regulatory factor of transcription repression (United States)

    Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette


    Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

  1. A deeper look into transcription regulatory code by preferred pair distance templates for transcription factor binding sites

    KAUST Repository

    Kulakovskiy, Ivan V.; Belostotsky, A. A.; Kasianov, Artem S.; Esipova, Natalia G.; Medvedeva, Yulia; Eliseeva, Irina A.; Makeev, Vsevolod J.


    Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding

  2. The aryl hydrocarbon receptor (AHR) transcription factor regulates megakaryocytic polyploidization. (United States)

    Lindsey, Stephan; Papoutsakis, Eleftherios T


    We propose that the aryl hydrocarbon receptor (AHR) is a novel transcriptional regulator of megakaryopoietic polyploidization. Functional evidence was obtained that AHR impacts in vivo megakaryocytic differentiation and maturation; compared to wild-type mice, AHR-null mice had lower platelet counts, fewer numbers of newly synthesized platelets, increased bleeding times and lower-ploidy megakaryocytes (Mks). AHR mRNA increased 3·6-fold during ex vivo megakaryocytic differentiation, but reduced or remained constant during parallel isogenic granulocytic or erythroid differentiation. We interrogated the role of AHR in megakaryopoiesis using a validated Mk model of megakaryopoiesis, the human megakaryoblastic leukaemia CHRF cell line. Upon CHRF Mk differentiation, AHR mRNA and protein levels increased, AHR protein shifted from the cytoplasm to the nucleus and AHR binding to its consensus DNA binding sequence increased. Protein and mRNA levels of the AHR transcriptional target HES1 also increased. Mk differentiation of CHRF cells where AHR or HES1 was knocked-down using RNAi resulted in lower ploidy distributions and cells that were incapable of reaching ploidy classes ≥16n. AHR knockdown also resulted in increased DNA synthesis of lower ploidy cells, without impacting apoptosis. Together, these data support a role for AHR in Mk polyploidization and in vivo platelet function, and warrant further detailed investigations. © 2011 Blackwell Publishing Ltd.

  3. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex. (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming


    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  4. The WRKY transcription factor family in Brachypodium distachyon. (United States)

    Tripathi, Prateek; Rabara, Roel C; Langum, Tanner J; Boken, Ashley K; Rushton, Deena L; Boomsma, Darius D; Rinerson, Charles I; Rabara, Jennifer; Reese, R Neil; Chen, Xianfeng; Rohila, Jai S; Rushton, Paul J


    A complete assembled genome sequence of wheat is not yet available. Therefore, model plant systems for wheat are very valuable. Brachypodium distachyon (Brachypodium) is such a system. The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating important agronomic traits. Studies of WRKY transcription factors in Brachypodium and wheat therefore promise to lead to new strategies for wheat improvement. We have identified and manually curated the WRKY transcription factor family from Brachypodium using a pipeline designed to identify all potential WRKY genes. 86 WRKY transcription factors were found, a total higher than all other current databases. We therefore propose that our numbering system (BdWRKY1-BdWRKY86) becomes the standard nomenclature. In the JGI v1.0 assembly of Brachypodium with the MIPS/JGI v1.0 annotation, nine of the transcription factors have no gene model and eleven gene models are probably incorrectly predicted. In total, twenty WRKY transcription factors (23.3%) do not appear to have accurate gene models. To facilitate use of our data, we have produced The Database of Brachypodium distachyon WRKY Transcription Factors. Each WRKY transcription factor has a gene page that includes predicted protein domains from MEME analyses. These conserved protein domains reflect possible input and output domains in signaling. The database also contains a BLAST search function where a large dataset of WRKY transcription factors, published genes, and an extensive set of wheat ESTs can be searched. We also produced a phylogram containing the WRKY transcription factor families from Brachypodium, rice, Arabidopsis, soybean, and Physcomitrella patens, together with published WRKY transcription factors from wheat. This phylogenetic tree provides evidence for orthologues, co-orthologues, and paralogues of Brachypodium WRKY transcription factors. The description of the WRKY transcription factor

  5. Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe. (United States)

    Chen, Huei-Mei; Rosebrock, Adam P; Khan, Sohail R; Futcher, Bruce; Leatherwood, Janet K


    In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

  6. Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe (United States)

    Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.


    In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674

  7. Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Huei-Mei Chen

    Full Text Available In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

  8. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  9. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)


    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  10. The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

    Czech Academy of Sciences Publication Activity Database

    Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.


    Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

  11. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. (United States)

    Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G


    The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.

  12. Transcription Factors in Heart: Promising Therapeutic Targets in Cardiac Hypertrophy


    Kohli, Shrey; Ahuja, Suchit; Rani, Vibha


    Regulation of gene expression is central to cell growth, differentiation and diseases. Context specific and signal dependent regulation of gene expression is achieved to a large part by transcription factors. Cardiac transcription factors regulate heart development and are also involved in stress regulation of the adult heart, which may lead to cardiac hypertrophy. Hypertrophy of cardiac myocytes is an outcome of the imbalance between prohypertrophic factors and anti-hypertrophic factors. Thi...

  13. Microarray-Based Identification of Transcription Factor Target Genes

    NARCIS (Netherlands)

    Gorte, M.; Horstman, A.; Page, R.B.; Heidstra, R.; Stromberg, A.; Boutilier, K.A.


    Microarray analysis is widely used to identify transcriptional changes associated with genetic perturbation or signaling events. Here we describe its application in the identification of plant transcription factor target genes with emphasis on the design of suitable DNA constructs for controlling TF

  14. Detecting Differential Transcription Factor Activity from ATAC-Seq Data

    Directory of Open Access Journals (Sweden)

    Ignacio J. Tripodi


    Full Text Available Transcription factors are managers of the cellular factory, and key components to many diseases. Many non-coding single nucleotide polymorphisms affect transcription factors, either by directly altering the protein or its functional activity at individual binding sites. Here we first briefly summarize high-throughput approaches to studying transcription factor activity. We then demonstrate, using published chromatin accessibility data (specifically ATAC-seq, that the genome-wide profile of TF recognition motifs relative to regions of open chromatin can determine the key transcription factor altered by a perturbation. Our method of determining which TFs are altered by a perturbation is simple, is quick to implement, and can be used when biological samples are limited. In the future, we envision that this method could be applied to determine which TFs show altered activity in response to a wide variety of drugs and diseases.

  15. TrSDB: a proteome database of transcription factors (United States)

    Hermoso, Antoni; Aguilar, Daniel; Aviles, Francesc X.; Querol, Enrique


    TrSDB—TranScout Database—( is a proteome database of eukaryotic transcription factors based upon predicted motifs by TranScout and data sources such as InterPro and Gene Ontology Annotation. Nine eukaryotic proteomes are included in the current version. Extensive and diverse information for each database entry, different analyses considering TranScout classification and similarity relationships are offered for research on transcription factors or gene expression. PMID:14681387

  16. SoyDB: a knowledge database of soybean transcription factors

    Directory of Open Access Journals (Sweden)

    Valliyodan Babu


    Full Text Available Abstract Background Transcription factors play the crucial rule of regulating gene expression and influence almost all biological processes. Systematically identifying and annotating transcription factors can greatly aid further understanding their functions and mechanisms. In this article, we present SoyDB, a user friendly database containing comprehensive knowledge of soybean transcription factors. Description The soybean genome was recently sequenced by the Department of Energy-Joint Genome Institute (DOE-JGI and is publicly available. Mining of this sequence identified 5,671 soybean genes as putative transcription factors. These genes were comprehensively annotated as an aid to the soybean research community. We developed SoyDB - a knowledge database for all the transcription factors in the soybean genome. The database contains protein sequences, predicted tertiary structures, putative DNA binding sites, domains, homologous templates in the Protein Data Bank (PDB, protein family classifications, multiple sequence alignments, consensus protein sequence motifs, web logo of each family, and web links to the soybean transcription factor database PlantTFDB, known EST sequences, and other general protein databases including Swiss-Prot, Gene Ontology, KEGG, EMBL, TAIR, InterPro, SMART, PROSITE, NCBI, and Pfam. The database can be accessed via an interactive and convenient web server, which supports full-text search, PSI-BLAST sequence search, database browsing by protein family, and automatic classification of a new protein sequence into one of 64 annotated transcription factor families by hidden Markov models. Conclusions A comprehensive soybean transcription factor database was constructed and made publicly accessible at

  17. Factor requirements for transcription in the Archaeon Sulfolobus shibatae. (United States)

    Qureshi, S A; Bell, S D; Jackson, S P


    Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.

  18. Potential Role of Activating Transcription Factor 5 during Osteogenesis

    Directory of Open Access Journals (Sweden)

    Luisa Vicari


    Full Text Available Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2, encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  19. Potential Role of Activating Transcription Factor 5 during Osteogenesis. (United States)

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo


    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  20. Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion

    Directory of Open Access Journals (Sweden)

    Sandra Capellera-Garcia


    Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.

  1. Radiation activation of transcription factors in mammalian cells

    International Nuclear Information System (INIS)

    Kraemer, M.; Stein, B.; Mai, S.; Kunz, E.; Koenig, H.; Ponta, H.; Herrlich, P.; Rahmsdorf, H.J.; Loferer, H.; Grunicke, H.H.


    In mammalian cells radiation induces the enhanced transcription of several genes. The cis acting elements in the control region of inducible genes have been delimited by site directed mutagenesis. Several different elements have been found in different genes. They do not only activate gene transcription in response to radiation but also in response to growth factors and to tumor promoter phorbol esters. The transcription factors binding to these elements are present also in non-irradiated cells, but their DNA binding activity and their transactivating capability is increased upon irradiation. The signal chain linking the primary radiation induced signal (damaged DNA) to the activation of transcription factors involves the action of (a) protein kinase(s). (orig.)

  2. Modulation of DNA binding by gene-specific transcription factors. (United States)

    Schleif, Robert F


    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  3. Functional Profiling of Transcription Factor Genes in Neurospora crassa

    Directory of Open Access Journals (Sweden)

    Alexander J. Carrillo


    Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.

  4. Cyclin D3 interacts with human activating transcription factor 5 and potentiates its transcription activity

    International Nuclear Information System (INIS)

    Liu Wenjin; Sun Maoyun; Jiang Jianhai; Shen Xiaoyun; Sun Qing; Liu Weicheng; Shen Hailian; Gu Jianxin


    The Cyclin D3 protein is a member of the D-type cyclins. Besides serving as cell cycle regulators, D-type cyclins have been reported to be able to interact with several transcription factors and modulate their transcriptional activations. Here we report that human activating transcription factor 5 (hATF5) is a new interacting partner of Cyclin D3. The interaction was confirmed by in vivo coimmunoprecipitation and in vitro binding analysis. Neither interaction between Cyclin D1 and hATF5 nor interaction between Cyclin D2 and hATF5 was observed. Confocal microscopy analysis showed that Cyclin D3 could colocalize with hATF5 in the nuclear region. Cyclin D3 could potentiate hATF5 transcriptional activity independently of its Cdk4 partner. But Cyclin D1 and Cyclin D2 had no effect on hATF5 transcriptional activity. These data provide a new clue to understand the new role of Cyclin D3 as a transcriptional regulator

  5. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription* (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.


    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  6. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription. (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I


    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  7. BACH transcription factors in innate and adaptive immunity. (United States)

    Igarashi, Kazuhiko; Kurosaki, Tomohiro; Roychoudhuri, Rahul


    BTB and CNC homology (BACH) proteins are transcriptional repressors of the basic region leucine zipper (bZIP) transcription factor family. Recent studies indicate widespread roles of BACH proteins in controlling the development and function of the innate and adaptive immune systems, including the differentiation of effector and memory cells of the B and T cell lineages, CD4 + regulatory T cells and macrophages. Here, we emphasize similarities at a molecular level in the cell-type-specific activities of BACH factors, proposing that competitive interactions of BACH proteins with transcriptional activators of the bZIP family form a common mechanistic theme underlying their diverse actions. The findings contribute to a general understanding of how transcriptional repressors shape lineage commitment and cell-type-specific functions through repression of alternative lineage programmes.

  8. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation. (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali


    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  9. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf


    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at and © The Author(s) 2010.

  10. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf; Schmeier, Sebastian; Bajic, Vladimir B.


    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at and © The Author(s) 2010.

  11. Emerging Functions of Transcription Factors in Malaria Parasite

    Directory of Open Access Journals (Sweden)

    Renu Tuteja


    Full Text Available Transcription is a process by which the genetic information stored in DNA is converted into mRNA by enzymes known as RNA polymerase. Bacteria use only one RNA polymerase to transcribe all of its genes while eukaryotes contain three RNA polymerases to transcribe the variety of eukaryotic genes. RNA polymerase also requires other factors/proteins to produce the transcript. These factors generally termed as transcription factors (TFs are either associated directly with RNA polymerase or add in building the actual transcription apparatus. TFs are the most common tools that our cells use to control gene expression. Plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. It shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in P. falciparum somehow differ from those of other eukaryotes. In this article we describe the studies on the main TFs such as myb protein, high mobility group protein and ApiA2 family proteins from malaria parasite. These studies show that these TFs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.

  12. A transcription factor for cold sensation!


    Kim, Susan J; Qu, Zhican; Milbrandt, Jeffrey; Zhuo, Min


    Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB) to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral respons...

  13. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats. (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong


    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  14. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren


    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  15. NAC Transcription Factors in Stress Responses and Senescence

    DEFF Research Database (Denmark)

    O'Shea, Charlotte

    Plant-specific NAM/ATAF/CUC (NAC) transcription factors have recently received considerable attention due to their significant roles in plant development and stress signalling. This interest has resulted in a number of physiological, genetic and cell biological studies of their functions. Some...... of these studies have also revealed emerging gene regulatory networks and protein-protein interaction networks. However, structural studies relating structure to function are lagging behind. Structure-function analysis of the NAC transcription factors has therefore been the main focus of this PhD thesis...... not involve significant folding-upon-binding but fuzziness or an extended ANAC046 region. The ANAC046 regulatory domain functions as an entropic chain with a bait for interactions with for example RCD1. RCD1 interacts with transcription factors from several different families, and the large stress...

  16. Transcription factor trapping by RNA in gene regulatory elements. (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A


    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  17. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation


    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny


    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...

  18. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  19. Transcription factor binding sites prediction based on modified nucleosomes.

    Directory of Open Access Journals (Sweden)

    Mohammad Talebzadeh

    Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method

  20. Uncovering Transcriptional Regulatory Networks by Sparse Bayesian Factor Model

    Directory of Open Access Journals (Sweden)

    Qi Yuan(Alan


    Full Text Available Abstract The problem of uncovering transcriptional regulation by transcription factors (TFs based on microarray data is considered. A novel Bayesian sparse correlated rectified factor model (BSCRFM is proposed that models the unknown TF protein level activity, the correlated regulations between TFs, and the sparse nature of TF-regulated genes. The model admits prior knowledge from existing database regarding TF-regulated target genes based on a sparse prior and through a developed Gibbs sampling algorithm, a context-specific transcriptional regulatory network specific to the experimental condition of the microarray data can be obtained. The proposed model and the Gibbs sampling algorithm were evaluated on the simulated systems, and results demonstrated the validity and effectiveness of the proposed approach. The proposed model was then applied to the breast cancer microarray data of patients with Estrogen Receptor positive ( status and Estrogen Receptor negative ( status, respectively.

  1. Inhibition of factor-dependent transcription termination in ...

    Indian Academy of Sciences (India)

    Inhibition of factor-dependent transcription termination in Escherichia coli might relieve xenogene silencing by abrogating. H-NS-DNA interactions in vivo. DEEPTI CHANDRAPRAKASH and ASWIN SAI NARAIN SESHASAYEE. Chromatin immunoprecipitation. MG1655 hns::3xFLAG cells were grown in liquid LB me-.

  2. Regulation of archicortical arealization by the transcription factor Zbtb20

    DEFF Research Database (Denmark)

    Rosenthal, Eva Helga; Tonchev, Anton B; Stoykova, Anastassia


    The molecular mechanisms of regionalization of the medial pallium (MP), the anlage of the hippocampus, and transitional (cingulate and retrosplenial) cortices are largely unknown. Previous analyses have outlined an important role of the transcription factor (TF) Zbtb20 for hippocampal CA1 field...

  3. Control of cellulose biosynthesis by overexpression of a transcription factor

    Energy Technology Data Exchange (ETDEWEB)

    Han, Kyung-Hwan; Ko, Jae-Heung; Kim, Won-Chan; Kim; , Joo-Yeol


    The invention relates to the over-expression of a transcription factor selected from the group consisting of MYB46, HAM1, HAM2, MYB112, WRKY11, ERF6, and any combination thereof in a plant, which can modulate and thereby modulating the cellulose content of the plant.

  4. WRKY transcription factor superfamily: Structure, origin and functions

    African Journals Online (AJOL)

    terminal ends contain the WRKYGQR amino acid sequence and a zinc-finger motif. WRKY transcription factors can regulate the expression of target genes that contain the W-box elements (C/T)TGAC(C/T) in the promoter regions by specifically ...

  5. Transcriptional factor influence on OTA production and the quelling ...

    African Journals Online (AJOL)

    This study determined the influence of some transcriptional factors on ochratoxin A production as well as investigates the quelling attributes of some designed siRNA on the OTA producing Aspergillus section Nigri using standard recommended techniques. Results obtained following comparison of the pks gene promoter ...

  6. Posttranslational modifications of Forkhead box O transcription factors

    NARCIS (Netherlands)

    Horst, Aart Arno van der


    FOXO transcription factors play an important role in essential biological processes such as differentiation, proliferation, apoptosis, DNA repair, metabolism and stress resistance. Phosphorylation is the modification that was first found on FOXOs and much of the subsequent studies focused on this

  7. Distinct patterns of epigenetic marks and transcription factor binding ...

    Indian Academy of Sciences (India)

    Distinct patterns of epigenetic marks and transcription factor binding sites across promoters of sense-intronic long noncoding RNAs. Sourav Ghosh, Satish Sati, Shantanu Sengupta and Vinod Scaria. J. Genet. 94, 17–25. Gencode V9 lncRNA gene : 11004. Known lncRNA : 1175. Novel lncRNA : 5898. Putative lncRNA :.

  8. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  9. Incorporating evolution of transcription factor binding sites into ...

    Indian Academy of Sciences (India)


    Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.

  10. Molecular architecture of transcription factor hotspots in early adipogenesis

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Baek, Songjoon; Rabiee, Atefeh


    motif on chromatin, and we suggest that this may be a general mechanism for integrating external signals on chromatin. Furthermore, we find evidence of extensive recruitment of transcription factors to hotspots through alternative mechanisms not involving their known motifs and demonstrate...

  11. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors. (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko


    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' ( © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Structural Fingerprints of Transcription Factor Binding Site Regions

    Directory of Open Access Journals (Sweden)

    Peter Willett


    Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

  13. Hydrogen peroxide sensing, signaling and regulation of transcription factors

    Directory of Open Access Journals (Sweden)

    H. Susana Marinho


    Full Text Available The regulatory mechanisms by which hydrogen peroxide (H2O2 modulates the activity of transcription factors in bacteria (OxyR and PerR, lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4 and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1 are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1 synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for

  14. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers. (United States)

    Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O


    This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.

  15. The effects of Mucuna pruriens on the renal oxidative stress and transcription factors in high-fructose-fed rats. (United States)

    Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim


    In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Transcription factor interplay in T helper cell differentiation (United States)

    Evans, Catherine M.


    The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity. PMID:23878131

  17. Transcription factor interplay in T helper cell differentiation. (United States)

    Evans, Catherine M; Jenner, Richard G


    The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity.

  18. Effects of cytosine methylation on transcription factor binding sites

    KAUST Repository

    Medvedeva, Yulia A


    Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.

  19. Screening Driving Transcription Factors in the Processing of Gastric Cancer

    Directory of Open Access Journals (Sweden)

    Guangzhong Xu


    Full Text Available Background. Construction of the transcriptional regulatory network can provide additional clues on the regulatory mechanisms and therapeutic applications in gastric cancer. Methods. Gene expression profiles of gastric cancer were downloaded from GEO database for integrated analysis. All of DEGs were analyzed by GO enrichment and KEGG pathway enrichment. Transcription factors were further identified and then a global transcriptional regulatory network was constructed. Results. By integrated analysis of the six eligible datasets (340 cases and 43 controls, a bunch of 2327 DEGs were identified, including 2100 upregulated and 227 downregulated DEGs. Functional enrichment analysis of DEGs showed that digestion was a significantly enriched GO term for biological process. Moreover, there were two important enriched KEGG pathways: cell cycle and homologous recombination. Furthermore, a total of 70 differentially expressed TFs were identified and the transcriptional regulatory network was constructed, which consisted of 566 TF-target interactions. The top ten TFs regulating most downstream target genes were BRCA1, ARID3A, EHF, SOX10, ZNF263, FOXL1, FEV, GATA3, FOXC1, and FOXD1. Most of them were involved in the carcinogenesis of gastric cancer. Conclusion. The transcriptional regulatory network can help researchers to further clarify the underlying regulatory mechanisms of gastric cancer tumorigenesis.

  20. Functionally significant, rare transcription factor variants in tetralogy of Fallot.

    Directory of Open Access Journals (Sweden)

    Ana Töpf

    Full Text Available Rare variants in certain transcription factors involved in cardiac development cause Mendelian forms of congenital heart disease. The purpose of this study was to systematically assess the frequency of rare transcription factor variants in sporadic patients with the cardiac outflow tract malformation tetralogy of Fallot (TOF.We sequenced the coding, 5'UTR, and 3'UTR regions of twelve transcription factor genes implicated in cardiac outflow tract development (NKX2.5, GATA4, ISL1, TBX20, MEF2C, BOP/SMYD1, HAND2, FOXC1, FOXC2, FOXH, FOXA2 and TBX1 in 93 non-syndromic, non-Mendelian TOF cases. We also analysed Illumina Human 660W-Quad SNP Array data for copy number variants in these genes; none were detected. Four of the rare variants detected have previously been shown to affect transactivation in in vitro reporter assays: FOXC1 p.P297S, FOXC2 p.Q444R, FOXH1 p.S113T and TBX1 p.P43_G61del PPPPRYDPCAAAAPGAPGP. Two further rare variants, HAND2 p.A25_A26insAA and FOXC1 p.G378_G380delGGG, A488_491delAAAA, affected transactivation in in vitro reporter assays. Each of these six functionally significant variants was present in a single patient in the heterozygous state; each of the four for which parental samples were available were maternally inherited. Thus in the 93 TOF cases we identified six functionally significant mutations in the secondary heart field transcriptional network.This study indicates that rare genetic variants in the secondary heart field transcriptional network with functional effects on protein function occur in 3-13% of patients with TOF. This is the first report of a functionally significant HAND2 mutation in a patient with congenital heart disease.

  1. Cdk phosphorylation of the Ste11 transcription factor constrains differentiation-specific transcription to G1

    DEFF Research Database (Denmark)

    Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle


    Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... Cdk activity is low. In the remaining part of the cell cycle, Ste11 becomes Cdk-phosphorylated at Thr 82 (T82), which inhibits its DNA-binding activity. Since the ste11 gene is autoregulated and the Ste11 protein is highly unstable, this Cdk switch rapidly extinguishes Ste11 activity when cells enter...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...

  2. A role for the transcription factor HEY1 in glioblastoma

    DEFF Research Database (Denmark)

    Hulleman, Esther; Quarto, Micaela; Vernell, Richard


    Glioblastoma multiforme (GBM), the highest-grade glioma, is the most frequent tumour of the brain with a very poor prognosis and limited therapeutic options. Although little is known about the molecular mechanisms that underlie glioblastoma formation, a number of signal transduction routes......, such as the Notch and Ras signalling pathways, seem to play an important role in the formation of GBM. In the present study, we show by in situ hybridization on primary tumour material that the transcription factor HEY1, a target of the Notch signalling pathway, is specifically upregulated in glioma...... and that expression of HEY1 in GBM correlates with tumour-grade and survival. In addition, we show by chromatin immunoprecipitations, luciferase assays and Northern blot experiments that HEY1 is a bona fide target of the E2F family of transcription factors, connecting the Ras and Notch signalling pathways. Finally...

  3. Transcription factors as readers and effectors of DNA methylation. (United States)

    Zhu, Heng; Wang, Guohua; Qian, Jiang


    Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

  4. Regulation of basophil and mast cell development by transcription factors

    Directory of Open Access Journals (Sweden)

    Haruka Sasaki


    Full Text Available Basophils and mast cells play important roles in host defense against parasitic infections and allergic responses. Several progenitor populations, either shared or specific, for basophils and/or mast cells have been identified, thus elucidating the developmental pathways of these cells. Multiple transcription factors essential for their development and the relationships between them have been also revealed. For example, IRF8 induces GATA2 expression to promote the generation of both basophils and mast cells. The STAT5-GATA2 axis induces C/EBPα and MITF expression, facilitating the differentiation into basophils and mast cells, respectively. In addition, C/EBPα and MITF mutually suppress each other's expression. This review provides an overview of recent advances in our understanding of how transcription factors regulate the development of basophils and mast cells.

  5. A transcription factor active on the epidermal growth factor receptor gene

    International Nuclear Information System (INIS)

    Kageyama, R.; Merlino, G.T.; Pastan, I.


    The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR

  6. Transcription factors for modification of lignin content in plants (United States)

    Wang, Huanzhong; Chen, Fang; Dixon, Richard A.


    The invention provides methods for modifying lignin, cellulose, xylan, and hemicellulose content in plants, and for achieving ectopic lignification and, for instance, secondary cell wall synthesis in pith cells, by altered regulation of a WRKY transcription factor. Nucleic acid constructs for altered WRKY-TF expression are described. Transgenic plants are provided that comprise modified pith cell walls, and lignin, cellulose, and hemicellulose content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops.

  7. The WRKY Transcription Factor Genes in Lotus japonicus


    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun


    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (...

  8. WRKY Transcription Factors: Key Components in Abscisic Acid Signaling (United States)


    networks that take inputs from numerous stimuli and that they are involved in mediating responses to numerous phytohormones including salicylic acid ... jasmonic acid , ABA and GA. These roles in multiple signalling pathways may in turn partly explain the pleiotropic effects commonly seen when TF genes are...Review article WRKY transcription factors: key components in abscisic acid signalling Deena L. Rushton1, Prateek Tripathi1, Roel C. Rabara1, Jun Lin1

  9. Transcription Factor Zbtb20 Controls Regional Specification of Mammalian Archicortex

    DEFF Research Database (Denmark)

    Rosenthal, Eva Helga


    Combinatorial expression of sets of transcription factors (TFs) along the mammalian cortex controls its subdivision into functional areas. Unlike neocortex, only few recent data suggest genetic mechanisms controlling the regionalization of the archicortex. TF Emx2 plays a crucial role in patterning...... later on becoming restricted exclusively to postmitotic neurons of hippocampus (Hi) proper, dentate gyrus (DG), and two transitory zones, subiculum (S) and retrosplenial cortex (Rsp). Analysis of Zbtb20-/- mice revealed altered cortical patterning at the border between neocortex and archicortex...

  10. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim


    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  11. Specification of jaw identity by the Hand2 transcription factor (United States)

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko


    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  12. A systems biology approach to transcription factor binding site prediction.

    Directory of Open Access Journals (Sweden)

    Xiang Zhou


    Full Text Available The elucidation of mammalian transcriptional regulatory networks holds great promise for both basic and translational research and remains one the greatest challenges to systems biology. Recent reverse engineering methods deduce regulatory interactions from large-scale mRNA expression profiles and cross-species conserved regulatory regions in DNA. Technical challenges faced by these methods include distinguishing between direct and indirect interactions, associating transcription regulators with predicted transcription factor binding sites (TFBSs, identifying non-linearly conserved binding sites across species, and providing realistic accuracy estimates.We address these challenges by closely integrating proven methods for regulatory network reverse engineering from mRNA expression data, linearly and non-linearly conserved regulatory region discovery, and TFBS evaluation and discovery. Using an extensive test set of high-likelihood interactions, which we collected in order to provide realistic prediction-accuracy estimates, we show that a careful integration of these methods leads to significant improvements in prediction accuracy. To verify our methods, we biochemically validated TFBS predictions made for both transcription factors (TFs and co-factors; we validated binding site predictions made using a known E2F1 DNA-binding motif on E2F1 predicted promoter targets, known E2F1 and JUND motifs on JUND predicted promoter targets, and a de novo discovered motif for BCL6 on BCL6 predicted promoter targets. Finally, to demonstrate accuracy of prediction using an external dataset, we showed that sites matching predicted motifs for ZNF263 are significantly enriched in recent ZNF263 ChIP-seq data.Using an integrative framework, we were able to address technical challenges faced by state of the art network reverse engineering methods, leading to significant improvement in direct-interaction detection and TFBS-discovery accuracy. We estimated the accuracy

  13. Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6

    Directory of Open Access Journals (Sweden)

    Nina Kerres


    Full Text Available The transcription factor BCL6 is a known driver of oncogenesis in lymphoid malignancies, including diffuse large B cell lymphoma (DLBCL. Disruption of its interaction with transcriptional repressors interferes with the oncogenic effects of BCL6. We used a structure-based drug design to develop highly potent compounds that block this interaction. A subset of these inhibitors also causes rapid ubiquitylation and degradation of BCL6 in cells. These compounds display significantly stronger induction of expression of BCL6-repressed genes and anti-proliferative effects than compounds that merely inhibit co-repressor interactions. This work establishes the BTB domain as a highly druggable structure, paving the way for the use of other members of this protein family as drug targets. The magnitude of effects elicited by this class of BCL6-degrading compounds exceeds that of our equipotent non-degrading inhibitors, suggesting opportunities for the development of BCL6-based lymphoma therapeutics.

  14. Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities (United States)

    Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.


    Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552

  15. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival. (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A


    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  16. Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe


    Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.


    In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription ...

  17. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    International Nuclear Information System (INIS)

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim


    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations

  18. Enhanceosomes as integrators of hypoxia inducible factor (HIF) and other transcription factors in the hypoxic transcriptional response. (United States)

    Pawlus, Matthew R; Hu, Cheng-Jun


    Hypoxia is a prevalent attribute of the solid tumor microenvironment that promotes the expression of genes through posttranslational modifications and stabilization of alpha subunits (HIF1α and HIF2α) of hypoxia-inducible factors (HIFs). Despite significant similarities, HIF1 (HIF1α/ARNT) and HIF2 (HIF2α/ARNT) activate common as well as unique target genes and exhibit different functions in cancer biology. More surprisingly, accumulating data indicates that the HIF1- and/or HIF2-mediated hypoxia responses can be oncogenic as well as tumor suppressive. While the role of HIF in the hypoxia response is well established, recent data support the concept that HIF is necessary, but not sufficient for the hypoxic response. Other transcription factors that are activated by hypoxia are also required for the HIF-mediated hypoxia response. HIFs, other transcription factors, co-factors and RNA poll II recruited by HIF and other transcription factors form multifactorial enhanceosome complexes on the promoters of HIF target genes to activate hypoxia inducible genes. Importantly, HIF1 or HIF2 requires distinct partners in activating HIF1 or HIF2 target genes. Because HIF enhanceosome formation is required for the gene activation and distinct functions of HIF1 and HIF2 in tumor biology, disruption of the HIF1 or HIF2 specific enhanceosome complex may prove to be a beneficial strategy in tumor treatment in which tumor growth is specifically dependent upon HIF1 or HIF2 activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. NAC transcription factor JUNGBRUNNEN1 enhances drought tolerance in tomato

    KAUST Repository

    Thirumalaikumar, Venkatesh P.


    Water deficit (drought stress) massively restricts plant growth and the yield of crops; reducing the deleterious effects of drought is therefore of high agricultural relevance. Drought triggers diverse cellular processes including the inhibition of photosynthesis, the accumulation of cell-damaging reactive oxygen species, and gene expression reprogramming, besides others. Transcription factors (TF) are central regulators of transcriptional reprogramming and expression of many TF genes is affected by drought, including members of the NAC family. Here, we identify the NAC factor JUNGBRUNNEN1 (JUB1) as a regulator of drought tolerance in tomato (Solanum lycopersicum). Expression of tomato JUB1 (SlJUB1) is enhanced by various abiotic stresses, including drought. Inhibiting SlJUB1 by virus-induced gene silencing drastically lowers drought tolerance concomitant with an increase in ion leakage, an elevation of hydrogen peroxide (H2 O2 ) levels, and a decrease of the expression of various drought-responsive genes. In contrast, overexpression of AtJUB1 from Arabidopsis thaliana increases drought tolerance in tomato, alongside with a higher relative leaf water content during drought and reduced H2 O2 levels. AtJUB1 was previously shown to stimulate expression of DREB2A, a TF involved in drought responses, and of the DELLA genes GAI and RGL1. We show here that SlJUB1 similarly controls the expression of the tomato orthologs SlDREB1, SlDREB2, and SlDELLA. Furthermore, AtJUB1 directly binds to the promoters of SlDREB1, SlDREB2 and SlDELLA in tomato. Our study highlights JUB1 as a transcriptional regulator of drought tolerance and suggests considerable conservation of the abiotic stress-related gene regulatory networks controlled by this NAC factor between Arabidopsis and tomato. This article is protected by copyright. All rights reserved.

  20. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay. (United States)

    Yousaf, Nasim; Gould, David


    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  1. Regulation of Specialized Metabolism by WRKY Transcription Factors (United States)

    Schluttenhofer, Craig; Yuan, Ling


    WRKY transcription factors (TFs) are well known for regulating plant abiotic and biotic stress tolerance. However, much less is known about how WRKY TFs affect plant-specialized metabolism. Analysis of WRKY TFs regulating the production of specialized metabolites emphasizes the values of the family outside of traditionally accepted roles in stress tolerance. WRKYs with conserved roles across plant species seem to be essential in regulating specialized metabolism. Overall, the WRKY family plays an essential role in regulating the biosynthesis of important pharmaceutical, aromatherapy, biofuel, and industrial components, warranting considerable attention in the forthcoming years. PMID:25501946

  2. Signatures of DNA target selectivity by ETS transcription factors. (United States)

    Poon, Gregory M K; Kim, Hye Mi


    The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.

  3. Transcription factor NF-kB as a potential biomarker for oxidative stress

    NARCIS (Netherlands)

    Berg, R. van den; Haenen, G.R.M.M.; Berg, H. van den; Bast, A.


    There is increasing interest in the involvement of transcription factors, such as of the transcription factor NF-κB (nuclear factor-κB), in the pathogenesis of various diseases. NF-κB is involved in the control of the transcription of a variety of cellular genes that regulate the inflammatory

  4. RNA binding specificity of Ebola virus transcription factor VP30. (United States)

    Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K


    The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

  5. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    David G. Johnson


    Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.

  6. Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

    DEFF Research Database (Denmark)

    Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien


    Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....

  7. Mutations and binding sites of human transcription factors

    KAUST Repository

    Kamanu, Frederick Kinyua


    Mutations in any genome may lead to phenotype characteristics that determine ability of an individual to cope with adaptation to environmental challenges. In studies of human biology, among the most interesting ones are phenotype characteristics that determine responses to drug treatments, response to infections, or predisposition to specific inherited diseases. Most of the research in this field has been focused on the studies of mutation effects on the final gene products, peptides, and their alterations. Considerably less attention was given to the mutations that may affect regulatory mechanism(s) of gene expression, although these may also affect the phenotype characteristics. In this study we make a pilot analysis of mutations observed in the regulatory regions of 24,667 human RefSeq genes. Our study reveals that out of eight studied mutation types, insertions are the only one that in a statistically significant manner alters predicted transcription factor binding sites (TFBSs). We also find that 25 families of TFBSs have been altered by mutations in a statistically significant manner in the promoter regions we considered. Moreover, we find that the related transcription factors are, for example, prominent in processes related to intracellular signaling; cell fate; morphogenesis of organs and epithelium; development of urogenital system, epithelium, and tube; neuron fate commitment. Our study highlights the significance of studying mutations within the genes regulatory regions and opens way for further detailed investigations on this topic, particularly on the downstream affected pathways. 2012 Kamanu, Medvedeva, Schaefer, Jankovic, Archer and Bajic.

  8. Targeting HOX and PBX transcription factors in ovarian cancer

    International Nuclear Information System (INIS)

    Morgan, Richard; Plowright, Lynn; Harrington, Kevin J; Michael, Agnieszka; Pandha, Hardev S


    Ovarian cancer still has a relatively poor prognosis due to the frequent occurrence of drug resistance, making the identification of new therapeutic targets an important goal. We have studied the role of HOX genes in the survival and proliferation of ovarian cancer cells. These are a family of homeodomain-containing transcription factors that determine cell and tissue identity in the early embryo, and have an anti-apoptotic role in a number of malignancies including lung and renal cancer. We used QPCR to determine HOX gene expression in normal ovary and in the ovarian cancer cell lines SK-OV3 and OV-90. We used a short peptide, HXR9, to disrupt the formation of HOX/PBX dimers and alter transcriptional regulation by HOX proteins. In this study we show that the ovarian cancer derived line SK-OV3, but not OV-90, exhibits highly dysregulated expression of members of the HOX gene family. Disrupting the interaction between HOX proteins and their co-factor PBX induces apoptosis in SK-OV3 cells and retards tumour growth in vivo. HOX/PBX binding is a potential target in ovarian cancer

  9. Transcription elongation factor GreA has functional chaperone activity. (United States)

    Li, Kun; Jiang, Tianyi; Yu, Bo; Wang, Limin; Gao, Chao; Ma, Cuiqing; Xu, Ping; Ma, Yanhe


    Bacterial GreA is an indispensable factor in the RNA polymerase elongation complex. It plays multiple roles in transcriptional elongation, and may be implicated in resistance to various stresses. In this study, we show that Escherichia coli GreA inhibits aggregation of several substrate proteins under heat shock condition. GreA can also effectively promote the refolding of denatured proteins. These facts reveal that GreA has chaperone activity. Distinct from many molecular chaperones, GreA does not form stable complexes with unfolded substrates. GreA overexpression confers the host cells with enhanced resistance to heat shock and oxidative stress. Moreover, GreA expression in the greA/greB double mutant could suppress the temperature-sensitive phenotype, and dramatically alleviate the in vivo protein aggregation. The results suggest that bacterial GreA may act as chaperone in vivo. These results suggest that GreA, in addition to its function as a transcription factor, is involved in protection of cellular proteins against aggregation.

  10. DAF-16/FOXO Transcription Factor in Aging and Longevity. (United States)

    Sun, Xiaojuan; Chen, Wei-Dong; Wang, Yan-Dong


    Aging is associated with age-related diseases and an increase susceptibility of cancer. Dissecting the molecular mechanisms that underlie aging and longevity would contribute to implications for preventing and treating the age-dependent diseases or cancers. Multiple signaling pathways such as the insulin/IGF-1 signaling pathway, TOR signaling, AMPK pathway, JNK pathway and germline signaling have been found to be involved in aging and longevity. And DAF-16/FOXO, as a key transcription factor, could integrate different signals from these pathways to modulate aging, and longevity via shuttling from cytoplasm to nucleus. Hence, understanding how DAF-16/FOXO functions will be pivotal to illustrate the processes of aging and longevity. Here, we summarized how DAF-16/FOXO receives signals from these pathways to affect aging and longevity. We also briefly discussed the transcriptional regulation and posttranslational modifications of DAF-16/FOXO, its co-factors as well as its potential downstream targets participating in lifespan according to the published data in C. elegans and in mammals, and in most cases, we may focus on the studies in C. elegans which has been considered to be a very good animal model for longevity research.

  11. Prediction of nucleosome positioning based on transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Xianfu Yi

    Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.

  12. Small-Molecule Inhibitors of the SOX18 Transcription Factor. (United States)

    Fontaine, Frank; Overman, Jeroen; Moustaqil, Mehdi; Mamidyala, Sreeman; Salim, Angela; Narasimhan, Kamesh; Prokoph, Nina; Robertson, Avril A B; Lua, Linda; Alexandrov, Kirill; Koopman, Peter; Capon, Robert J; Sierecki, Emma; Gambin, Yann; Jauch, Ralf; Cooper, Matthew A; Zuegg, Johannes; Francois, Mathias


    Pharmacological modulation of transcription factors (TFs) has only met little success over the past four decades. This is mostly due to standard drug discovery approaches centered on blocking protein/DNA binding or interfering with post-translational modifications. Recent advances in the field of TF biology have revealed a central role of protein-protein interaction in their mode of action. In an attempt to modulate the activity of SOX18 TF, a known regulator of vascular growth in development and disease, we screened a marine extract library for potential small-molecule inhibitors. We identified two compounds, which inspired a series of synthetic SOX18 inhibitors, able to interfere with the SOX18 HMG DNA-binding domain, and to disrupt HMG-dependent protein-protein interaction with RBPJ. These compounds also perturbed SOX18 transcriptional activity in a cell-based reporter gene system. This approach may prove useful in developing a new class of anti-angiogenic compounds based on the inhibition of TF activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. The forkhead transcription factor FoxY regulates Nanos. (United States)

    Song, Jia L; Wessel, Gary M


    FoxY is a member of the forkhead transcription factor family that appeared enriched in the presumptive germ line of sea urchins (Ransick et al. Dev Biol 2002;246:132). Here, we test the hypothesis that FoxY is involved in germ line determination in this animal. We found two splice forms of FoxY that share the same DNA-binding domain, but vary in the carboxy-terminal trans-activation/repression domain. Both forms of the FoxY protein are present in the egg and in the early embryo, and their mRNAs accumulate to their highest levels in the small micromeres and adjacent non-skeletogenic mesoderm. Knockdown of FoxY resulted in a dramatic decrease in Nanos mRNA and protein levels as well as a loss of coelomic pouches in 2-week-old larvae. Our results indicate that FoxY positively regulates Nanos at the transcriptional level and is essential for reproductive potential in this organism. Copyright © 2012 Wiley Periodicals, Inc.

  14. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription. (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M


    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  15. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee


    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  16. Isolation and mass spectrometry of transcription factor complexes. (United States)

    Sebastiaan Winkler, G; Lacomis, Lynne; Philip, John; Erdjument-Bromage, Hediye; Svejstrup, Jesper Q; Tempst, Paul


    Protocols are described that enable the isolation of novel proteins associated with a known protein and the subsequent identification of these proteins by mass spectrometry. We review the basics of nanosample handling and of two complementary approaches to mass analysis, and provide protocols for the entire process. The protein isolation procedure is rapid and based on two high-affinity chromatography steps. The method does not require previous knowledge of complex composition or activity and permits subsequent biochemical characterization of the isolated factor. As an example, we provide the procedures used to isolate and analyze yeast Elongator, a histone acetyltransferase complex important for transcript elongation, which led to the identification of three novel subunits.

  17. Ets transcription factor GABP controls T cell homeostasis and immunity. (United States)

    Luo, Chong T; Osmanbeyoglu, Hatice U; Do, Mytrang H; Bivona, Michael R; Toure, Ahmed; Kang, Davina; Xie, Yuchen; Leslie, Christina S; Li, Ming O


    Peripheral T cells are maintained in the absence of vigorous stimuli, and respond to antigenic stimulation by initiating cell cycle progression and functional differentiation. Here we show that depletion of the Ets family transcription factor GA-binding protein (GABP) in T cells impairs T-cell homeostasis. In addition, GABP is critically required for antigen-stimulated T-cell responses in vitro and in vivo. Transcriptome and genome-wide GABP-binding site analyses identify GABP direct targets encoding proteins involved in cellular redox balance and DNA replication, including the Mcm replicative helicases. These findings show that GABP has a nonredundant role in the control of T-cell homeostasis and immunity.

  18. Activating transcription factor 3 regulates immune and metabolic homeostasis. (United States)

    Rynes, Jan; Donohoe, Colin D; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek; Uhlirova, Mirka


    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins.

  19. Fundamental Design Principles for Transcription-Factor-Based Metabolite Biosensors. (United States)

    Mannan, Ahmad A; Liu, Di; Zhang, Fuzhong; Oyarzún, Diego A


    Metabolite biosensors are central to current efforts toward precision engineering of metabolism. Although most research has focused on building new biosensors, their tunability remains poorly understood and is fundamental for their broad applicability. Here we asked how genetic modifications shape the dose-response curve of biosensors based on metabolite-responsive transcription factors. Using the lac system in Escherichia coli as a model system, we built promoter libraries with variable operator sites that reveal interdependencies between biosensor dynamic range and response threshold. We developed a phenomenological theory to quantify such design constraints in biosensors with various architectures and tunable parameters. Our theory reveals a maximal achievable dynamic range and exposes tunable parameters for orthogonal control of dynamic range and response threshold. Our work sheds light on fundamental limits of synthetic biology designs and provides quantitative guidelines for biosensor design in applications such as dynamic pathway control, strain optimization, and real-time monitoring of metabolism.

  20. Jasmonate-responsive transcription factors regulating plant secondary metabolism. (United States)

    Zhou, Meiliang; Memelink, Johan


    Plants produce a large variety of secondary metabolites including alkaloids, glucosinolates, terpenoids and phenylpropanoids. These compounds play key roles in plant-environment interactions and many of them have pharmacological activity in humans. Jasmonates (JAs) are plant hormones which induce biosynthesis of many secondary metabolites. JAs-responsive transcription factors (TFs) that regulate the JAs-induced accumulation of secondary metabolites belong to different families including AP2/ERF, bHLH, MYB and WRKY. Here, we give an overview of the types and functions of TFs that have been identified in JAs-induced secondary metabolite biosynthesis, and highlight their similarities and differences in regulating various biosynthetic pathways. We review major recent developments regarding JAs-responsive TFs mediating secondary metabolite biosynthesis, and provide suggestions for further studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  2. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.


    Hurst, H C; Masson, N; Jones, N C; Lee, K A


    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We...

  3. Inhibition of enterovirus 71 entry by transcription factor XBP1

    Energy Technology Data Exchange (ETDEWEB)

    Jheng, Jia-Rong; Lin, Chiou-Yan [Department of Biochemistry and Research Center for Emerging Viral Infections, Chang Gung University, 259 Wen-Hwa First Road, Kweishan, Taoyuan 333, Taiwan (China); Horng, Jim-Tong, E-mail: [Department of Biochemistry and Research Center for Emerging Viral Infections, Chang Gung University, 259 Wen-Hwa First Road, Kweishan, Taoyuan 333, Taiwan (China); Lau, Kean Seng [Department of Biochemistry and Research Center for Emerging Viral Infections, Chang Gung University, 259 Wen-Hwa First Road, Kweishan, Taoyuan 333, Taiwan (China)


    Highlights: Black-Right-Pointing-Pointer IRE1 was activated but no XBP1 splicing was detected during enterovirus 71 infection. Black-Right-Pointing-Pointer XBP1 was subject to translational shutoff by enterovirus 71-induced eIF4G cleavage. Black-Right-Pointing-Pointer The uptake of UV-irradiated virus was decreased in XBP1-overexpressing cells. -- Abstract: Inositol-requiring enzyme 1 (IRE1) plays an important role in the endoplasmic reticulum (ER), or unfolded protein, stress response by activating its downstream transcription factor X-box-binding protein 1 (XBP1). We demonstrated previously that enterovirus 71 (EV71) upregulated XBP1 mRNA levels but did not activate spliced XBP1 (XBP1s) mRNA or its downstream target genes, EDEM and chaperones. In this study, we investigated further this regulatory mechanism and found that IRE1 was phosphorylated and activated after EV71 infection, whereas its downstream XBP1s protein level decreased. We also found that XBP1s was not cleaved directly by 2A{sup pro}, but that cleavage of eukaryotic translation initiation factor 4G by the EV71 2A{sup pro} protein may contribute to the decrease in XBP1s expression. Knockdown of XBP1 increased viral protein expression, and the synthesis of EV71 viral protein and the production of EV71 viral particles were inhibited in XBP1-overexpressing RD cells. When incubated with replication-deficient and UV-irradiated EV71, XBP1-overexpressing RD cells exhibited reduced viral RNA levels, suggesting that the inhibition of XBP1s by viral infection may underlie viral entry, which is required for viral replication. Our findings are the first indication of the ability of XBP1 to inhibit viral entry, possibly via its transcriptional activity in regulating molecules in the endocytic machinery.

  4. Inhibition of enterovirus 71 entry by transcription factor XBP1

    International Nuclear Information System (INIS)

    Jheng, Jia-Rong; Lin, Chiou-Yan; Horng, Jim-Tong; Lau, Kean Seng


    Highlights: ► IRE1 was activated but no XBP1 splicing was detected during enterovirus 71 infection. ► XBP1 was subject to translational shutoff by enterovirus 71-induced eIF4G cleavage. ► The uptake of UV-irradiated virus was decreased in XBP1-overexpressing cells. -- Abstract: Inositol-requiring enzyme 1 (IRE1) plays an important role in the endoplasmic reticulum (ER), or unfolded protein, stress response by activating its downstream transcription factor X-box-binding protein 1 (XBP1). We demonstrated previously that enterovirus 71 (EV71) upregulated XBP1 mRNA levels but did not activate spliced XBP1 (XBP1s) mRNA or its downstream target genes, EDEM and chaperones. In this study, we investigated further this regulatory mechanism and found that IRE1 was phosphorylated and activated after EV71 infection, whereas its downstream XBP1s protein level decreased. We also found that XBP1s was not cleaved directly by 2A pro , but that cleavage of eukaryotic translation initiation factor 4G by the EV71 2A pro protein may contribute to the decrease in XBP1s expression. Knockdown of XBP1 increased viral protein expression, and the synthesis of EV71 viral protein and the production of EV71 viral particles were inhibited in XBP1-overexpressing RD cells. When incubated with replication-deficient and UV-irradiated EV71, XBP1-overexpressing RD cells exhibited reduced viral RNA levels, suggesting that the inhibition of XBP1s by viral infection may underlie viral entry, which is required for viral replication. Our findings are the first indication of the ability of XBP1 to inhibit viral entry, possibly via its transcriptional activity in regulating molecules in the endocytic machinery.

  5. Comprehensive Behavioral Analysis of Activating Transcription Factor 5-Deficient Mice

    Directory of Open Access Journals (Sweden)

    Mariko Umemura


    Full Text Available Activating transcription factor 5 (ATF5 is a member of the CREB/ATF family of basic leucine zipper transcription factors. We previously reported that ATF5-deficient (ATF5-/- mice demonstrated abnormal olfactory bulb development due to impaired interneuron supply. Furthermore, ATF5-/- mice were less aggressive than ATF5+/+ mice. Although ATF5 is widely expressed in the brain, and involved in the regulation of proliferation and development of neurons, the physiological role of ATF5 in the higher brain remains unknown. Our objective was to investigate the physiological role of ATF5 in the higher brain. We performed a comprehensive behavioral analysis using ATF5-/- mice and wild type littermates. ATF5-/- mice exhibited abnormal locomotor activity in the open field test. They also exhibited abnormal anxiety-like behavior in the light/dark transition test and open field test. Furthermore, ATF5-/- mice displayed reduced social interaction in the Crawley’s social interaction test and increased pain sensitivity in the hot plate test compared with wild type. Finally, behavioral flexibility was reduced in the T-maze test in ATF5-/- mice compared with wild type. In addition, we demonstrated that ATF5-/- mice display disturbances of monoamine neurotransmitter levels in several brain regions. These results indicate that ATF5 deficiency elicits abnormal behaviors and the disturbance of monoamine neurotransmitter levels in the brain. The behavioral abnormalities of ATF5-/- mice may be due to the disturbance of monoamine levels. Taken together, these findings suggest that ATF5-/- mice may be a unique animal model of some psychiatric disorders.

  6. GATA transcription factors in testicular adrenal rest tumours

    Directory of Open Access Journals (Sweden)

    Manon Engels


    Full Text Available Testicular adrenal rest tumours (TARTs are benign adrenal-like testicular tumours that frequently occur in male patients with congenital adrenal hyperplasia. Recently, GATA transcription factors have been linked to the development of TARTs in mice. The aim of our study was to determine GATA expression in human TARTs and other steroidogenic tissues. We determined GATA expression in TARTs (n = 16, Leydig cell tumours (LCTs; n = 7, adrenal (foetal (n = 6 + adult (n = 10 and testis (foetal (n = 13 + adult (n = 8. We found testis-like GATA4, and adrenal-like GATA3 and GATA6 gene expressions by qPCR in human TARTs, indicating mixed testicular and adrenal characteristics of TARTs. Currently, no marker is available to discriminate TARTs from LCTs, leading to misdiagnosis and incorrect treatment. GATA3 and GATA6 mRNAs exhibited excellent discriminative power (area under the curve of 0.908 and 0.816, respectively, while immunohistochemistry did not. GATA genes contain several CREB-binding sites and incubation with 0.1 mM dibutyryl cAMP for 4 h stimulated GATA3, GATA4 and GATA6 expressions in a human foetal testis cell line (hs181.tes. Incubation of adrenocortical cells (H295RA with ACTH, however, did not induce GATA expression in vitro. Although ACTH did not dysregulate GATA expression in the only human ACTH-sensitive in vitro model available, our results do suggest that aberrant expression of GATA transcription factors in human TARTs might be involved in TART formation.

  7. Regulation of Memory Formation by the Transcription Factor XBP1

    Directory of Open Access Journals (Sweden)

    Gabriela Martínez


    Full Text Available Contextual memory formation relies on the induction of new genes in the hippocampus. A polymorphism in the promoter of the transcription factor XBP1 was identified as a risk factor for Alzheimer’s disease and bipolar disorders. XBP1 is a major regulator of the unfolded protein response (UPR, mediating adaptation to endoplasmic reticulum (ER stress. Using a phenotypic screen, we uncovered an unexpected function of XBP1 in cognition and behavior. Mice lacking XBP1 in the nervous system showed specific impairment of contextual memory formation and long-term potentiation (LTP, whereas neuronal XBP1s overexpression improved performance in memory tasks. Gene expression analysis revealed that XBP1 regulates a group of memory-related genes, highlighting brain-derived neurotrophic factor (BDNF, a key component in memory consolidation. Overexpression of BDNF in the hippocampus reversed the XBP1-deficient phenotype. Our study revealed an unanticipated function of XBP1 in cognitive processes that is apparently unrelated to its role in ER stress.

  8. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita


    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  9. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    International Nuclear Information System (INIS)

    Lim, Kihong; Chang, Hyo-Ihl


    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  10. A regulating element essential for PDGFRA transcription is recognized by neural tube defect-associated PRX homeobox transcription factors

    NARCIS (Netherlands)

    Joosten, Paul H. L. J.; Toepoel, Mascha; van Oosterhout, Dirk; Afink, Gijs B.; van Zoelen, Everardus J. J.


    We have previously shown that deregulated expression of the platelet-derived growth factor alpha-receptor (PDGFRA) can be associated with neural tube defects (NTDs) in both men and mice. In the present study, we have investigated the transcription factors that control the up-regulation of PDGFRA

  11. Transcription factor PIF4 controls the thermosensory activation of flowering

    KAUST Repository

    Kumar, S. Vinod; Lucyshyn, Doris; Jaeger, Katja E.; Aló s, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P.; Wigge, Philip A.


    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. © 2012 Macmillan Publishers Limited. All rights reserved.

  12. Complex Interdependence Regulates Heterotypic Transcription Factor Distribution and Coordinates Cardiogenesis. (United States)

    Luna-Zurita, Luis; Stirnimann, Christian U; Glatt, Sebastian; Kaynak, Bogac L; Thomas, Sean; Baudin, Florence; Samee, Md Abul Hassan; He, Daniel; Small, Eric M; Mileikovsky, Maria; Nagy, Andras; Holloway, Alisha K; Pollard, Katherine S; Müller, Christoph W; Bruneau, Benoit G


    Transcription factors (TFs) are thought to function with partners to achieve specificity and precise quantitative outputs. In the developing heart, heterotypic TF interactions, such as between the T-box TF TBX5 and the homeodomain TF NKX2-5, have been proposed as a mechanism for human congenital heart defects. We report extensive and complex interdependent genomic occupancy of TBX5, NKX2-5, and the zinc finger TF GATA4 coordinately controlling cardiac gene expression, differentiation, and morphogenesis. Interdependent binding serves not only to co-regulate gene expression but also to prevent TFs from distributing to ectopic loci and activate lineage-inappropriate genes. We define preferential motif arrangements for TBX5 and NKX2-5 cooperative binding sites, supported at the atomic level by their co-crystal structure bound to DNA, revealing a direct interaction between the two factors and induced DNA bending. Complex interdependent binding mechanisms reveal tightly regulated TF genomic distribution and define a combinatorial logic for heterotypic TF regulation of differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Transcription factor PIF4 controls the thermosensory activation of flowering

    KAUST Repository

    Kumar, S. Vinod


    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. © 2012 Macmillan Publishers Limited. All rights reserved.

  14. Problem-Solving Test: The Mechanism of Transcription Termination by the Rho Factor (United States)

    Szeberenyi, Jozsef


    Transcription termination comes in two forms in "E. coli" cells. Rho-dependent termination requires the binding of a termination protein called Rho factor to the transcriptional machinery at the terminator region, whereas Rho-independent termination is achieved by conformational changes in the transcript itself. This article presents a test…

  15. Physical interactions among plant MADS-box transcription factors and their biological relevance

    NARCIS (Netherlands)

    Nougalli Tonaco, I.A.


    The biological interpretation of the genome starts from transcription, and many different signaling pathways are integrated at this level. Transcription factors play a central role in the transcription process, because they select the down-stream genes and determine their spatial and temporal

  16. Distinct mechanisms of nuclear accumulation regulate the functional consequence of E2F transcription factors

    NARCIS (Netherlands)

    Allen, K.E.; Luna, S. de la; Kerkhoven, R.M.; Bernards, R.A.; Thangue, N.B. La


    Transcription factor E2F plays an important role in coordinating and integrating early cell cycle progression with the transcription apparatus. It is known that physiological E2F arises when a member of two families of proteins, E2F and DP, interact as E2F/DP heterodimers and that transcriptional

  17. Genome-wide investigation of transcription factors provides insights into transcriptional regulation in Plutella xylostella. (United States)

    Zhao, Qian; Ma, Dongna; Huang, Yuping; He, Weiyi; Li, Yiying; Vasseur, Liette; You, Minsheng


    Transcription factors (TFs), which play a vital role in regulating gene expression, are prevalent in all organisms and characterization of them may provide important clues for understanding regulation in vivo. The present study reports a genome-wide investigation of TFs in the diamondback moth, Plutella xylostella (L.), a worldwide pest of crucifers. A total of 940 TFs distributed among 133 families were identified. Phylogenetic analysis of insect species showed that some of these families were found to have expanded during the evolution of P. xylostella or Lepidoptera. RNA-seq analysis showed that some of the TF families, such as zinc fingers, homeobox, bZIP, bHLH, and MADF_DNA_bdg genes, were highly expressed in certain tissues including midgut, salivary glands, fat body, and hemocytes, with an obvious sex-biased expression pattern. In addition, a number of TFs showed significant differences in expression between insecticide susceptible and resistant strains, suggesting that these TFs play a role in regulating genes related to insecticide resistance. Finally, we identified an expansion of the HOX cluster in Lepidoptera, which might be related to Lepidoptera-specific evolution. Knockout of this cluster using CRISPR/Cas9 showed that the egg cannot hatch, indicating that this cluster may be related to egg development and maturation. This is the first comprehensive study on identifying and characterizing TFs in P. xylostella. Our results suggest that some TF families are expanded in the P. xylostella genome, and these TFs may have important biological roles in growth, development, sexual dimorphism, and resistance to insecticides. The present work provides a solid foundation for understanding regulation via TFs in P. xylostella and insights into the evolution of the P. xylostella genome.

  18. Transcription factor HBP1 is a direct anti-cancer target of transcription factor FOXO1 in invasive oral cancer. (United States)

    Chan, Chien-Yi; Huang, Shih-Yi; Sheu, Jim Jinn-Chyuan; Roth, Mendel M; Chou, I-Tai; Lien, Chia-Hsien; Lee, Ming-Fen; Huang, Chun-Yin


    Either FOXO1 or HBP1 transcription factor is a downstream effector of the PI3K/Akt pathway and associated with tumorigenesis. However, the relationship between FOXO1 and HBP1 in oral cancer remains unclear. Analysis of 30 oral tumor specimens revealed that mean mRNA levels of both FOXO1 and HBP1 in non-invasive and invasive oral tumors were found to be significantly lower than that of the control tissues, and the status of low FOXO1 and HBP1 (oral tumors. To investigate if HBP1 is a direct transcription target of FOXO1, we searched potential FOXO1 binding sites in the HBP1 promoter using the MAPPER Search Engine, and two putative FOXO1 binding sites located in the HBP1 promoter -132 to -125 bp and -343 to -336 bp were predicted. These binding sites were then confirmed by both reporter gene assays and the in cellulo ChIP assay. In addition, Akt activity manipulated by PI3K inhibitor LY294002 or Akt mutants was shown to negatively affect FOXO1-mediated HBP1 promoter activation and gene expression. Last, the biological significance of the FOXO1-HBP1 axis in oral cancer malignancy was evaluated in cell growth, colony formation, and invasiveness. The results indicated that HBP1 knockdown potently promoted malignant phenotypes of oral cancer and the suppressive effect of FOXO1 on cell growth, colony formation, and invasion was alleviated upon HBP1 knockdown in invasive oral cancer cells. Taken together, our data provide evidence for HBP1 as a direct downstream target of FOXO1 in oral cancer malignancy.

  19. Hacking an Algal Transcription Factor for Lipid Biosynthesis. (United States)

    Chen, Xiulai; Hu, Guipeng; Liu, Liming


    Transcriptional engineering is a viable means for engineering microalgae to produce lipid, but it often results in a trade-off between production and growth. A recent study shows that engineering a single transcriptional regulator enables efficient carbon partitioning to lipid biosynthesis with high biomass productivity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.


    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A


    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...

  1. DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. (research article)

    NARCIS (Netherlands)

    L. Schaeffer; R. Roy (Richard); S. Humbert; V. Moncollin; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); P. Chambon; J-M. Egly (Jean-Marc)


    textabstractThe human BTF2 basic transcription factor (also called TFIIH), which is similar to the delta factor in rat and factor b in yeast, is required for class II gene transcription. A strand displacement assay was used to show that highly purified preparation of BTF2 had an adenosine

  2. Single molecule transcription factor dynamics in the syncytial Drosophila embryo (United States)

    Darzacq, Xavier

    During early development in the Drosophila embryo, cell fates are determined over the course of just 2 hours with exquisite spatio-temoral precision. One of the key regulators of this process is the transcription factor Bicoid which forms a concentration gradient across the long axis of the embryo. Although Bicoids' primary role is activation at the anterior, where concentrations are highest, it is also known to play a role in the posterior where there are only 100s of molecules per nucleus. Understanding how Bicoid can find its target at such low concentrations has remained intractable, largely due to the inability to perform single molecule imaging in the context of the developing embryo. Here we use lattice light sheet microscopy to overcome the technical barriers of sample thickness and auto-fluorescence to characterize the single molecule dynamics of Bicoid. We find that off-rates do not vary across the embryo and that instead the on-rates are modulated through the formation of clusters that enrich local concentration. This data is contrary to the current concentration dependent model of Bicoid function since local concentration within the nucleus is now a regulated parameter and suggests a previously unknown mechanism for regulation at extremely low concentrations.

  3. Bivariate Genomic Footprinting Detects Changes in Transcription Factor Activity

    Directory of Open Access Journals (Sweden)

    Songjoon Baek


    Full Text Available In response to activating signals, transcription factors (TFs bind DNA and regulate gene expression. TF binding can be measured by protection of the bound sequence from DNase digestion (i.e., footprint. Here, we report that 80% of TF binding motifs do not show a measurable footprint, partly because of a variable cleavage pattern within the motif sequence. To more faithfully portray the effect of TFs on chromatin, we developed an algorithm that captures two TF-dependent effects on chromatin accessibility: footprinting and motif-flanking accessibility. The algorithm, termed bivariate genomic footprinting (BaGFoot, efficiently detects TF activity. BaGFoot is robust to different accessibility assays (DNase-seq, ATAC-seq, all examined peak-calling programs, and a variety of cut bias correction approaches. BaGFoot reliably predicts TF binding and provides valuable information regarding the TFs affecting chromatin accessibility in various biological systems and following various biological events, including in cases where an absolute footprint cannot be determined.

  4. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis (United States)

    Rynes, Jan; Donohoe, Colin D.; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek


    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins. PMID:22851689

  5. WRKY transcription factor genes in wild rice Oryza nivara. (United States)

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J


    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  6. WRKY transcription factors in plant responses to stresses. (United States)

    Jiang, Jingjing; Ma, Shenghui; Ye, Nenghui; Jiang, Ming; Cao, Jiashu; Zhang, Jianhua


    The WRKY gene family is among the largest families of transcription factors (TFs) in higher plants. By regulating the plant hormone signal transduction pathway, these TFs play critical roles in some plant processes in response to biotic and abiotic stress. Various bodies of research have demonstrated the important biological functions of WRKY TFs in plant response to different kinds of biotic and abiotic stresses and working mechanisms. However, very little summarization has been done to review their research progress. Not just important TFs function in plant response to biotic and abiotic stresses, WRKY also participates in carbohydrate synthesis, senescence, development, and secondary metabolites synthesis. WRKY proteins can bind to W-box (TGACC (A/T)) in the promoter of its target genes and activate or repress the expression of downstream genes to regulate their stress response. Moreover, WRKY proteins can interact with other TFs to regulate plant defensive responses. In the present review, we focus on the structural characteristics of WRKY TFs and the research progress on their functions in plant responses to a variety of stresses. © 2016 Institute of Botany, Chinese Academy of Sciences.

  7. The WRKY Transcription Factor Genes in Lotus japonicus. (United States)

    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun


    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (LjWRKY) genes can be classified into three groups (I-III). Investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6. Researchers previously believed that group II and III WRKY domains were derived from the C-terminal WRKY domain of group I. Our results suggest that some WRKY genes in group II originated from the N-terminal domain of group I WRKY genes. Additional evidence to support this hypothesis was obtained by Medicago truncatula WRKY (MtWRKY) protein motif analysis. We found that LjWRKY and MtWRKY group III genes are under purifying selection, suggesting that WRKY genes will become increasingly structured and functionally conserved.

  8. Reprogramming with Small Molecules instead of Exogenous Transcription Factors

    Directory of Open Access Journals (Sweden)

    Tongxiang Lin


    Full Text Available Induced pluripotent stem cells (iPSCs could be employed in the creation of patient-specific stem cells, which could subsequently be used in various basic and clinical applications. However, current iPSC methodologies present significant hidden risks with respect to genetic mutations and abnormal expression which are a barrier in realizing the full potential of iPSCs. A chemical approach is thought to be a promising strategy for safety and efficiency of iPSC generation. Many small molecules have been identified that can be used in place of exogenous transcription factors and significantly improve iPSC reprogramming efficiency and quality. Recent studies have shown that the use of small molecules results in the generation of chemically induced pluripotent stem cells from mouse embryonic fibroblast cells. These studies might lead to new areas of stem cell research and medical applications, not only human iPSC by chemicals alone, but also safe generation of somatic stem cells for cell based clinical trials and other researches. In this paper, we have reviewed the recent advances in small molecule approaches for the generation of iPSCs.

  9. SoxC transcription factors in retinal development and regeneration

    Directory of Open Access Journals (Sweden)

    Kun-Che Chang


    Full Text Available Glaucoma and other optic neuropathies result in optic nerve degeneration and the loss of retinal ganglion cells (RGCs through complex signaling pathways. Although the mechanisms that regulate RGC development remain unclear, uncovering novel developmental pathways may support new strategies to regenerate the optic nerve or replace RGCs. Here we review recent studies that provide strong evidence that the Sry-related high-mobility-group C (SoxC subfamily of transcription factors (TFs are necessary and sufficient for axon guidance and RGC fate specification. These findings also uncover novel SoxC-dependent mechanisms that serve as master regulators during important steps of RGC development. For example, we review work showing that SoxC TFs regulate RGC axon guidance and direction through the optic chiasm towards their appropriate targets in the brain. We also review work demonstrating that Sox11 subcellular localization is, in part, controlled through small ubiquitin-like post-translational modifier (SUMO and suggest compensatory cross-talk between Sox4 and Sox11. Furthermore, Sox4 overexpression is shown to positively drive RGC differentiation in human induced pluripotent stem cells (hiPSCs. Finally, we discuss how these findings may contribute to the advancement of regenerative and cell-based therapies to treat glaucoma and other optic nerve neuropathies.

  10. Embryonic transcription factor SOX9 drives breast cancer endocrine resistance. (United States)

    Jeselsohn, Rinath; Cornwell, MacIntosh; Pun, Matthew; Buchwalter, Gilles; Nguyen, Mai; Bango, Clyde; Huang, Ying; Kuang, Yanan; Paweletz, Cloud; Fu, Xiaoyong; Nardone, Agostina; De Angelis, Carmine; Detre, Simone; Dodson, Andrew; Mohammed, Hisham; Carroll, Jason S; Bowden, Michaela; Rao, Prakash; Long, Henry W; Li, Fugen; Dowsett, Mitchell; Schiff, Rachel; Brown, Myles


    The estrogen receptor (ER) drives the growth of most luminal breast cancers and is the primary target of endocrine therapy. Although ER blockade with drugs such as tamoxifen is very effective, a major clinical limitation is the development of endocrine resistance especially in the setting of metastatic disease. Preclinical and clinical observations suggest that even following the development of endocrine resistance, ER signaling continues to exert a pivotal role in tumor progression in the majority of cases. Through the analysis of the ER cistrome in tamoxifen-resistant breast cancer cells, we have uncovered a role for an RUNX2-ER complex that stimulates the transcription of a set of genes, including most notably the stem cell factor SOX9, that promote proliferation and a metastatic phenotype. We show that up-regulation of SOX9 is sufficient to cause relative endocrine resistance. The gain of SOX9 as an ER-regulated gene associated with tamoxifen resistance was validated in a unique set of clinical samples supporting the need for the development of improved ER antagonists.

  11. Transcriptional activation of Mina by Sp1/3 factors. (United States)

    Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark


    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

  12. Development of a Transcription Factor-Based Lactam Biosensor

    DEFF Research Database (Denmark)

    Zhang, Jingwei; Barajas, Jesus F.; Burdu, Mehmet


    Lactams are an important class of commodity chemicals used in the manufacture of nylons, with millions of tons produced every year. Biological production of lactams could be greatly improved by high-throughput sensors for lactam biosynthesis. To identify biosensors of lactams, we applied a chemoi......Lactams are an important class of commodity chemicals used in the manufacture of nylons, with millions of tons produced every year. Biological production of lactams could be greatly improved by high-throughput sensors for lactam biosynthesis. To identify biosensors of lactams, we applied...... a chemoinformatic approach inspired by small molecule drug discovery. We define this approach as analogue generation toward catabolizable chemicals or AGTC. We discovered a lactam biosensor based on the ChnR/Pb transcription factor-promoter pair. The microbial biosensor is capable of sensing ε-caprolactam, Î......´-valerolactam, and butyrolactam in a dose-dependent manner. The biosensor has sufficient specificity to discriminate against lactam biosynthetic intermediates and therefore could potentially be applied for high-throughput metabolic engineering for industrially important high titer lactam biosynthesis....

  13. RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors

    KAUST Repository

    Piatek, Agnieszka Anna


    Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3

  14. RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors

    KAUST Repository

    Piatek, Agnieszka Anna; Ali, Zahir; Baazim, Hatoon; Li, Lixin; Abulfaraj, Aala A.; Alshareef, Sahar; Aouida, Mustapha; Mahfouz, Magdy M.


    Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3

  15. Controllability analysis of transcriptional regulatory networks reveals circular control patterns among transcription factors

    DEFF Research Database (Denmark)

    Österlund, Tobias; Bordel, Sergio; Nielsen, Jens


    % for the human network. The high controllability (low number of drivers needed to control the system) in yeast, mouse and human is due to the presence of internal loops in their regulatory networks where the TFs regulate each other in a circular fashion. We refer to these internal loops as circular control...... motifs (CCM). The E. coli transcriptional regulatory network, which does not have any CCMs, shows a hierarchical structure of the transcriptional regulatory network in contrast to the eukaryal networks. The presence of CCMs also has influence on the stability of these networks, as the presence of cycles...

  16. A hanging drop culture method to study terminal erythroid differentiation. (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak


    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  17. The transcription factor ATF3 is upregulated during chondrocyte differentiation and represses cyclin D1 and A gene transcription

    Directory of Open Access Journals (Sweden)

    James Claudine G


    Full Text Available Abstract Background Coordinated chondrocyte proliferation and differentiation are required for normal endochondral bone growth. Transcription factors binding to the cyclicAMP response element (CRE are known to regulate these processes. One member of this family, Activating Tanscription Factor 3 (ATF3, is expressed during skeletogenesis and acts as a transcriptional repressor, but the function of this protein in chondrogenesis is unknown. Results Here we demonstrate that Atf3 mRNA levels increase during mouse chondrocyte differentiation in vitro and in vivo. In addition, Atf3 mRNA levels are increased in response to cytochalasin D treatment, an inducer of chondrocyte maturation. This is accompanied by increased Atf3 promoter activity in cytochalasin D-treated chondrocytes. We had shown earlier that transcription of the cell cycle genes cyclin D1 and cyclin A in chondrocytes is dependent on CREs. Here we demonstrate that overexpression of ATF3 in primary mouse chondrocytes results in reduced transcription of both genes, as well as decreased activity of a CRE reporter plasmid. Repression of cyclin A transcription by ATF3 required the CRE in the cyclin A promoter. In parallel, ATF3 overexpression reduces the activity of a SOX9-dependent promoter and increases the activity of a RUNX2-dependent promoter. Conclusion Our data suggest that transcriptional induction of the Atf3 gene in maturing chondrocytes results in down-regulation of cyclin D1 and cyclin A expression as well as activation of RUNX2-dependent transcription. Therefore, ATF3 induction appears to facilitate cell cycle exit and terminal differentiation of chondrocytes.

  18. Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

    DEFF Research Database (Denmark)

    Fang, Xin; Sastry, Anand; Mih, Nathan


    Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN-probably the best characterized TRN-several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predi...

  19. Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

    Directory of Open Access Journals (Sweden)

    David Warrilow

    Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

  20. Factor requirements for transcription in the Archaeon Sulfolobus shibatae.


    Qureshi, S A; Bell, S D; Jackson, S P


    Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is h...

  1. A mechanistic overview of herbal medicine and botanical compounds to target transcriptional factors in Breast cancer. (United States)

    Zhao, Yingke; Liu, Yue


    The abnormalities of transcription factors, such as NF-κB, STAT, estrogen receptor, play a critical role in the initiation and progression of breast cancer. Due to the limitation of current treatment, transcription factors could be promising therapeutic targets, which have received close attention. In this review, we introduced herbal medicines, as well as botanical compounds that had been verified with anti-tumor properties via regulating transcription factors. Herbs, compounds, as well as formulae reported with various transcriptional targets, were summarized thoroughly, to provide implication for the future research on basic experiment and clinical application. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. The WRKY transcription factor family and senescence in switchgrass. (United States)

    Rinerson, Charles I; Scully, Erin D; Palmer, Nathan A; Donze-Reiner, Teresa; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Sattler, Scott E; Rohila, Jai S; Sarath, Gautam; Rushton, Paul J


    Early aerial senescence in switchgrass (Panicum virgatum) can significantly limit biomass yields. WRKY transcription factors that can regulate senescence could be used to reprogram senescence and enhance biomass yields. All potential WRKY genes present in the version 1.0 of the switchgrass genome were identified and curated using manual and bioinformatic methods. Expression profiles of WRKY genes in switchgrass flag leaf RNA-Seq datasets were analyzed using clustering and network analyses tools to identify both WRKY and WRKY-associated gene co-expression networks during leaf development and senescence onset. We identified 240 switchgrass WRKY genes including members of the RW5 and RW6 families of resistance proteins. Weighted gene co-expression network analysis of the flag leaf transcriptomes across development readily separated clusters of co-expressed genes into thirteen modules. A visualization highlighted separation of modules associated with the early and senescence-onset phases of flag leaf growth. The senescence-associated module contained 3000 genes including 23 WRKYs. Putative promoter regions of senescence-associated WRKY genes contained several cis-element-like sequences suggestive of responsiveness to both senescence and stress signaling pathways. A phylogenetic comparison of senescence-associated WRKY genes from switchgrass flag leaf with senescence-associated WRKY genes from other plants revealed notable hotspots in Group I, IIb, and IIe of the phylogenetic tree. We have identified and named 240 WRKY genes in the switchgrass genome. Twenty three of these genes show elevated mRNA levels during the onset of flag leaf senescence. Eleven of the WRKY genes were found in hotspots of related senescence-associated genes from multiple species and thus represent promising targets for future switchgrass genetic improvement. Overall, individual WRKY gene expression profiles could be readily linked to developmental stages of flag leaves.

  3. WRKY transcription factors: key components in abscisic acid signalling. (United States)

    Rushton, Deena L; Tripathi, Prateek; Rabara, Roel C; Lin, Jun; Ringler, Patricia; Boken, Ashley K; Langum, Tanner J; Smidt, Lucas; Boomsma, Darius D; Emme, Nicholas J; Chen, Xianfeng; Finer, John J; Shen, Qingxi J; Rushton, Paul J


    WRKY transcription factors (TFs) are key regulators of many plant processes, including the responses to biotic and abiotic stresses, senescence, seed dormancy and seed germination. For over 15 years, limited evidence has been available suggesting that WRKY TFs may play roles in regulating plant responses to the phytohormone abscisic acid (ABA), notably some WRKY TFs are ABA-inducible repressors of seed germination. However, the roles of WRKY TFs in other aspects of ABA signalling, and the mechanisms involved, have remained unclear. Recent significant progress in ABA research has now placed specific WRKY TFs firmly in ABA-responsive signalling pathways, where they act at multiple levels. In Arabidopsis, WRKY TFs appear to act downstream of at least two ABA receptors: the cytoplasmic PYR/PYL/RCAR-protein phosphatase 2C-ABA complex and the chloroplast envelope-located ABAR-ABA complex. In vivo and in vitro promoter-binding studies show that the target genes for WRKY TFs that are involved in ABA signalling include well-known ABA-responsive genes such as ABF2, ABF4, ABI4, ABI5, MYB2, DREB1a, DREB2a and RAB18. Additional well-characterized stress-inducible genes such as RD29A and COR47 are also found in signalling pathways downstream of WRKY TFs. These new insights also reveal that some WRKY TFs are positive regulators of ABA-mediated stomatal closure and hence drought responses. Conversely, many WRKY TFs are negative regulators of seed germination, and controlling seed germination appears a common function of a subset of WRKY TFs in flowering plants. Taken together, these new data demonstrate that WRKY TFs are key nodes in ABA-responsive signalling networks. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  4. Characterization of the Far Transcription Factor Family in Aspergillus flavus. (United States)

    Luo, Xingyu; Affeldt, Katharyn J; Keller, Nancy P


    Metabolism of fatty acids is a critical requirement for the pathogenesis of oil seed pathogens including the fungus Aspergillus flavus Previous studies have correlated decreased ability to grow on fatty acids with reduced virulence of this fungus on host seed. Two fatty acid metabolism regulatory transcription factors, FarA and FarB, have been described in other filamentous fungi. Unexpectedly, we find A. flavus possesses three Far homologs, FarA, FarB, and FarC, with FarA and FarC showing a greater protein similarity to each other than FarB. farA and farB are located in regions of colinearity in all Aspergillus spp. sequenced to date, whereas farC is limited to a subset of species where it is inserted in an otherwise colinear region in Aspergillus genomes. Deletion and overexpression (OE) of farA and farB, but not farC, yielded mutants with aberrant growth patterns on specific fatty acids as well as altered expression of genes involved in fatty acid metabolism. Marked differences included significant growth defects of both ∆farA and ∆farB on medium-chain fatty acids and decreased growth of OE::farA on unsaturated fatty acids. Loss of farA diminished expression of mitochondrial β-oxidation genes whereas OE::farA inhibited expression of genes involved in unsaturated fatty acid catabolism. FarA also positively regulated the desaturase genes required to generate polyunsaturated fatty acids. Aflatoxin production on toxin-inducing media was significantly decreased in the ∆farB mutant and increased in the OE::farB mutant, with gene expression data supporting a role for FarB in tying β-oxidation processes with aflatoxin accumulation. Copyright © 2016 Luo et al.

  5. Characterization of the Far Transcription Factor Family in Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Xingyu Luo


    Full Text Available Metabolism of fatty acids is a critical requirement for the pathogenesis of oil seed pathogens including the fungus Aspergillus flavus. Previous studies have correlated decreased ability to grow on fatty acids with reduced virulence of this fungus on host seed. Two fatty acid metabolism regulatory transcription factors, FarA and FarB, have been described in other filamentous fungi. Unexpectedly, we find A. flavus possesses three Far homologs, FarA, FarB, and FarC, with FarA and FarC showing a greater protein similarity to each other than FarB. farA and farB are located in regions of colinearity in all Aspergillus spp. sequenced to date, whereas farC is limited to a subset of species where it is inserted in an otherwise colinear region in Aspergillus genomes. Deletion and overexpression (OE of farA and farB, but not farC, yielded mutants with aberrant growth patterns on specific fatty acids as well as altered expression of genes involved in fatty acid metabolism. Marked differences included significant growth defects of both ∆farA and ∆farB on medium-chain fatty acids and decreased growth of OE::farA on unsaturated fatty acids. Loss of farA diminished expression of mitochondrial β-oxidation genes whereas OE::farA inhibited expression of genes involved in unsaturated fatty acid catabolism. FarA also positively regulated the desaturase genes required to generate polyunsaturated fatty acids. Aflatoxin production on toxin-inducing media was significantly decreased in the ∆farB mutant and increased in the OE::farB mutant, with gene expression data supporting a role for FarB in tying β-oxidation processes with aflatoxin accumulation.

  6. Using TESS to predict transcription factor binding sites in DNA sequence. (United States)

    Schug, Jonathan


    This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.

  7. The MYST family histone acetyltransferase complex regulates stress resistance and longevity through transcriptional control of DAF-16/FOXO transcription factors. (United States)

    Ikeda, Takako; Uno, Masaharu; Honjoh, Sakiko; Nishida, Eisuke


    The well-known link between longevity and the Sir2 histone deacetylase family suggests that histone deacetylation, a modification associated with repressed chromatin, is beneficial to longevity. However, the molecular links between histone acetylation and longevity remain unclear. Here, we report an unexpected finding that the MYST family histone acetyltransferase complex (MYS-1/TRR-1 complex) promotes rather than inhibits stress resistance and longevity in Caenorhabditis elegans Our results show that these beneficial effects are largely mediated through transcriptional up-regulation of the FOXO transcription factor DAF-16. MYS-1 and TRR-1 are recruited to the promoter regions of the daf-16 gene, where they play a role in histone acetylation, including H4K16 acetylation. Remarkably, we also find that the human MYST family Tip60/TRRAP complex promotes oxidative stress resistance by up-regulating the expression of FOXO transcription factors in human cells. Tip60 is recruited to the promoter regions of the foxo1 gene, where it increases H4K16 acetylation levels. Our results thus identify the evolutionarily conserved role of the MYST family acetyltransferase as a key epigenetic regulator of DAF-16/FOXO transcription factors. © 2017 The Authors.

  8. Network based transcription factor analysis of regenerating axolotl limbs

    Directory of Open Access Journals (Sweden)

    Cameron Jo Ann


    Full Text Available Abstract Background Studies on amphibian limb regeneration began in the early 1700's but we still do not completely understand the cellular and molecular events of this unique process. Understanding a complex biological process such as limb regeneration is more complicated than the knowledge of the individual genes or proteins involved. Here we followed a systems biology approach in an effort to construct the networks and pathways of protein interactions involved in formation of the accumulation blastema in regenerating axolotl limbs. Results We used the human orthologs of proteins previously identified by our research team as bait to identify the transcription factor (TF pathways and networks that regulate blastema formation in amputated axolotl limbs. The five most connected factors, c-Myc, SP1, HNF4A, ESR1 and p53 regulate ~50% of the proteins in our data. Among these, c-Myc and SP1 regulate 36.2% of the proteins. c-Myc was the most highly connected TF (71 targets. Network analysis showed that TGF-β1 and fibronectin (FN lead to the activation of these TFs. We found that other TFs known to be involved in epigenetic reprogramming, such as Klf4, Oct4, and Lin28 are also connected to c-Myc and SP1. Conclusions Our study provides a systems biology approach to how different molecular entities inter-connect with each other during the formation of an accumulation blastema in regenerating axolotl limbs. This approach provides an in silico methodology to identify proteins that are not detected by experimental methods such as proteomics but are potentially important to blastema formation. We found that the TFs, c-Myc and SP1 and their target genes could potentially play a central role in limb regeneration. Systems biology has the potential to map out numerous other pathways that are crucial to blastema formation in regeneration-competent limbs, to compare these to the pathways that characterize regeneration-deficient limbs and finally, to identify stem

  9. Transcription factor cooperativity in early adipogenic hotspots and super-enhancers

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Rabiee, Atefeh; Nielsen, Ronni


    . Using a combination of advanced proteomics and genomics approaches, we identify ∼12,000 transcription factor hotspots (∼400 bp) in the early phase of adipogenesis, and we find evidence of both simultaneous and sequential binding of transcription factors at these regions. We demonstrate that hotspots...

  10. Interaction between FMDV Lpro and transcription factor ADNP is required for viral replication (United States)

    The foot-and-mouth disease virus (FMDV) leader protease (Lpro) inhibits host translation and transcription affecting the expression of several factors involved in innate immunity. In this study, we have identified the host transcription factor ADNP (activity dependent neuroprotective protein) as an ...

  11. Characterization of senscence-associated NAC transcription factors in Barley (Hordeum Vulgare L.)

    DEFF Research Database (Denmark)

    Podzimska, Dagmara Agata

    , such as yield, biomass production and nutrient quality, and NAC (NAM, ATAF1/2 and CUC2) transcription factors are promising targets for the breeding. The aim of this thesis was thus to assess the role of NAC transcription factors in regulation of senescence in barley (Hordeum vulgare L.) and to contribute...

  12. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  13. MADS interactomics : towards understanding the molecular mechanisms of plant MADS-domain transcription factor function

    NARCIS (Netherlands)

    Smaczniak, C.D.


    Protein-protein and protein-DNA interactions are essential for the molecular action of transcription factors. By combinatorial binding to target gene promoters, transcription factors are able to up- or down-regulate the expression of these genes. MADS-domain proteins comprise a large family of

  14. Proteopedia: 3D Visualization and Annotation of Transcription Factor-DNA Readout Modes (United States)

    Dantas Machado, Ana Carolina; Saleebyan, Skyler B.; Holmes, Bailey T.; Karelina, Maria; Tam, Julia; Kim, Sharon Y.; Kim, Keziah H.; Dror, Iris; Hodis, Eran; Martz, Eric; Compeau, Patricia A.; Rohs, Remo


    3D visualization assists in identifying diverse mechanisms of protein-DNA recognition that can be observed for transcription factors and other DNA binding proteins. We used Proteopedia to illustrate transcription factor-DNA readout modes with a focus on DNA shape, which can be a function of either nucleotide sequence (Hox proteins) or base pairing…

  15. Transcription factor binding site enrichment analysis predicts drivers of altered gene expression in nonalcoholic steatohepatitis

    Czech Academy of Sciences Publication Activity Database

    Lake, A.D.; Chaput, A.L.; Novák, Petr; Cherrington, N.J.; Smith, C.L.


    Roč. 122, December 15 (2016), s. 62-71 ISSN 0006-2952 Institutional support: RVO:60077344 Keywords : Transcription factor * Liver * Gene expression * Bioinformatics Subject RIV: CE - Biochemistry Impact factor: 4.581, year: 2016

  16. A Role for the NF-kb/Rel Transcription Factors in Human Breast Cancer

    National Research Council Canada - National Science Library

    Baldwin, Albert


    Human breast cancer is characterized by the inappropriate expression of growth factors, kinases and possibly certain transcription factors Our project has focused on the regulation of the NF-kB family...

  17. Protein-protein interactions in the regulation of WRKY transcription factors. (United States)

    Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang


    It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.

  18. The transcription factor DREAM represses A20 and mediates inflammation


    Tiruppathi, Chinnaswamy; Soni, Dheeraj; Wang, Dong-Mei; Xue, Jiaping; Singh, Vandana; Thippegowda, Prabhakar B.; Cheppudira, Bopaiah P.; Mishra, Rakesh K.; DebRoy, Auditi; Qian, Zhijian; Bachmaier, Kurt; Zhao, Youyang; Christman, John W.; Vogel, Stephen M.; Ma, Averil


    Here we show that the transcription-repressor DREAM binds to the A20 promoter to repress the expression of A20, the deubiquitinase suppressing inflammatory NF-κB signaling. DREAM-deficient (Dream−/− ) mice displayed persistent and unchecked A20 expression in response to endotoxin. DREAM functioned by transcriptionally repressing A20 through binding to downstream regulatory elements (DREs). In contrast, USF1 binding to the DRE-associated E-box domain activated A20 expression in response to inf...

  19. Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors. (United States)

    Narasimhan, Kamesh; Micoine, Kevin; Lacôte, Emmanuel; Thorimbert, Serge; Cheung, Edwin; Hasenknopf, Bernold; Jauch, Ralf


    SOX transcription factors constitute an attractive target class for intervention with small molecules as they play a prominent role in the field of regenerative biomedicine and cancer biology. However, rationally engineering specific inhibitors that interfere with transcription factor DNA interfaces continues to be a monumental challenge in the field of transcription factor chemical biology. Polyoxometalates (POMs) are inorganic compounds that were previously shown to target the high-mobility group (HMG) of SOX proteins at nanomolar concentrations. In continuation of this work, we carried out an assessment of the selectivity of a panel of newly synthesized organo-polyoxometalate hybrids in targeting different transcription factor families to enable the usage of polyoxometalates as specific SOX transcription factor drugs. The residual DNA-binding activities of 15 different transcription factors were measured after treatment with a panel of diverse polyoxometalates. Polyoxometalates belonging to the Dawson structural class were found to be more potent inhibitors than the Keggin class. Further, organically modified Dawson polyoxometalates were found to be the most potent in inhibiting transcription factor DNA binding activity. The size of the polyoxometalates and its derivitization were found to be the key determinants of their potency. Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures

  20. A deeper look into transcription regulatory code by preferred pair distance templates for transcription factor binding sites

    KAUST Repository

    Kulakovskiy, Ivan V.


    Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.

  1. Functional characterization of tobacco transcription factor TGA2.1

    DEFF Research Database (Denmark)

    Kegler, C.; Lenk, I.; Krawczyk, S.


    Activation sequence-1 (as-1)-like regulatory cis elements mediate transcriptional activation in response to increased levels of plant signalling molecules auxin and salicylic acid (SA). Our earlier work has shown that tobacco cellular as-1-binding complex SARP (salicylic acid responsive protein...

  2. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer


    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...

  3. TcoF-DB v2: update of the database of human and mouse transcription co-factors and transcription factor interactions

    KAUST Repository

    Schmeier, Sebastian


    Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at

  4. TcoF-DB v2: update of the database of human and mouse transcription co-factors and transcription factor interactions

    KAUST Repository

    Schmeier, Sebastian; Alam, Tanvir; Essack, Magbubah; Bajic, Vladimir B.


    Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at

  5. Transcription Factor Repertoire of Necrotrophic Fungal Phytopathogen Ascochyta rabiei: Predominance of MYB Transcription Factors As Potential Regulators of Secretome

    Directory of Open Access Journals (Sweden)

    Sandhya Verma


    Full Text Available Transcription factors (TFs are the key players in gene expression and their study is highly significant for shedding light on the molecular mechanisms and evolutionary history of organisms. During host–pathogen interaction, extensive reprogramming of gene expression facilitated by TFs is likely to occur in both host and pathogen. To date, the knowledge about TF repertoire in filamentous fungi is in infancy. The necrotrophic fungus Ascochyta rabiei, that causes destructive Ascochyta blight (AB disease of chickpea (Cicer arietinum, demands more comprehensive study for better understanding of Ascochyta-legume pathosystem. In the present study, we performed the genome-wide identification and analysis of TFs in A. rabiei. Taking advantage of A. rabiei genome sequence, we used a bioinformatic approach to predict the TF repertoire of A. rabiei. For identification and classification of A. rabiei TFs, we designed a comprehensive pipeline using a combination of BLAST and InterProScan software. A total of 381 A. rabiei TFs were predicted and divided into 32 fungal specific families of TFs. The gene structure, domain organization and phylogenetic analysis of abundant families of A. rabiei TFs were also carried out. Comparative study of A. rabiei TFs with that of other necrotrophic, biotrophic, hemibiotrophic, symbiotic, and saprotrophic fungi was performed. It suggested presence of both conserved as well as unique features among them. Moreover, cis-acting elements on promoter sequences of earlier predicted A. rabiei secretome were also identified. With the help of published A. rabiei transcriptome data, the differential expression of TF and secretory protein coding genes was analyzed. Furthermore, comprehensive expression analysis of few selected A. rabiei TFs using quantitative real-time polymerase chain reaction revealed variety of expression patterns during host colonization. These genes were expressed in at least one of the time points tested post

  6. Transcription Factor Functional Protein-Protein Interactions in Plant Defense Responses

    Directory of Open Access Journals (Sweden)

    Murilo S. Alves


    Full Text Available Responses to biotic stress in plants lead to dramatic reprogramming of gene expression, favoring stress responses at the expense of normal cellular functions. Transcription factors are master regulators of gene expression at the transcriptional level, and controlling the activity of these factors alters the transcriptome of the plant, leading to metabolic and phenotypic changes in response to stress. The functional analysis of interactions between transcription factors and other proteins is very important for elucidating the role of these transcriptional regulators in different signaling cascades. In this review, we present an overview of protein-protein interactions for the six major families of transcription factors involved in plant defense: basic leucine zipper containing domain proteins (bZIP, amino-acid sequence WRKYGQK (WRKY, myelocytomatosis related proteins (MYC, myeloblastosis related proteins (MYB, APETALA2/ ETHYLENE-RESPONSIVE ELEMENT BINDING FACTORS (AP2/EREBP and no apical meristem (NAM, Arabidopsis transcription activation factor (ATAF, and cup-shaped cotyledon (CUC (NAC. We describe the interaction partners of these transcription factors as molecular responses during pathogen attack and the key components of signal transduction pathways that take place during plant defense responses. These interactions determine the activation or repression of response pathways and are crucial to understanding the regulatory networks that modulate plant defense responses.

  7. A critique on nuclear factor-kappa B and signal transducer and activator of transcription 3: The key transcription factors in periodontal pathogenesis

    Directory of Open Access Journals (Sweden)

    Ranjith Ambili


    Full Text Available Periodontal disease is initiated by microorganisms in dental plaque, and host immunoinflammatory response to the microbial challenge helps in disease progression. Conventional periodontal therapy was mainly targeted on the elimination of microbial component. However, a better understanding of molecular aspects in host response will enable the clinicians to formulate effective host modulation therapy (HMT for the periodontal management. Inflammatory mediators were the main targets for HMT in the past. Transcription factors can regulate the production of multiple mediators simultaneously, and inhibition of these factors will be more beneficial than blocking individual molecule. Two important transcription factors implicated in chronic inflammatory diseases are nuclear factor kappa B (NF-κB and signal transducers and activators of transcription 3. The role of these factors in periodontal disease is a less explored area. This comprehensive review is aimed at unveiling the critical role of NF-κB and signal transducers and activators of transcription 3 in periodontal pathogenesis. An online search was performed using MEDLINE/PubMed database. All publications till 2016 related to NF-κB, signal transducer and activator of transcription 3 (STAT3, and inflammation were included in writing this review. A total of 27,390 references were published based on the search terms used. Out of these, 507 were related to the periodontal research published in English till 2016. Relevant papers were chosen after carefully reading the abstract. This review has attempted to comprehend the existing knowledge regarding the role of transcription factors NF-κB and STAT3 in periodontal disease. Moreover, it also provides a connecting molecular link for the periodontal medicine concept.

  8. Myocardin-related transcription factors are required for cardiac development and function


    Mokalled, Mayssa H.; Carroll, Kelli J.; Cenik, Bercin K.; Chen, Beibei; Liu, Ning; Olson, Eric N.; Bassel-Duby, Rhonda


    Myocardin-Related Transcription Factors A and B (MRTF-A and MRTF-B) are highly homologous proteins that function as powerful coactivators of serum response factor (SRF), a ubiquitously expressed transcription factor essential for cardiac development. The SRF/MRTF complex binds to CArG boxes found in the control regions of genes that regulate cytoskeletal dynamics and muscle contraction, among other processes. While SRF is required for heart development and function, the role of MRTFs in the d...

  9. Breaking the mold: transcription factors in the anucleate platelet and platelet-derived microparticles

    Directory of Open Access Journals (Sweden)

    Katie L Lannan


    Full Text Available Platelets are small anucleate blood cells derived from megakaryocytes. In addition to their pivotal roles in hemostasis, platelets are the smallest, yet most abundant, immune cell and regulate inflammation, immunity, and disease progression. Although platelets lack DNA, and thus no functional transcriptional activities, they are nonetheless rich sources of RNAs, possess an intact spliceosome, and are thus capable of synthesizing proteins. Previously, it was thought that platelet RNAs and translational machinery were remnants from the megakaryocyte. We now know that the initial description of platelets as cellular fragments is an antiquated notion, as mounting evidence suggests otherwise. Therefore, it is reasonable to hypothesize that platelet transcription factors are not vestigial remnants from megakaryoctes, but have important, if only partly understood functions. Proteins play multiple cellular roles to minimize energy expenditure for maximum cellular function; thus, the same can be expected for transcription factors. In fact, numerous transcription factors have non-genomic roles, both in platelets and in nucleated cells. Our lab and others have discovered the presence and nongenomic roles of transcription factors in platelets, such as the nuclear factor kappa β (NFκB family of proteins and peroxisome proliferator activated receptor gamma (PPARγ. In addition to numerous roles in regulating platelet activation, functional transcription factors can be transferred to vascular and immune cells through platelet microparticles. This method of transcellular delivery of key immune molecules may be a vital mechanism by which platelet transcription factors regulate inflammation and immunity. At the very least, platelets are an ideal model cell to dissect out the nongenomic roles of transcription factors in nucleated cells. There is abundant evidence to suggest that transcription factors in platelets play key roles in regulating inflammatory and

  10. Step out of the groove : epigenetic gene control systems and engineered transcription factors

    NARCIS (Netherlands)

    Verschure, P.J.; Visser, A.E.; Rots, M.G.


    At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not

  11. Cisplatin- and UV-damaged DNA lure the basal transcription factor TFIID/TBP.

    NARCIS (Netherlands)

    P. Vichi; F. Coin (Frédéric); J-P. Renaud (Jean-Paul); W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); D. Moras; J-M. Egly (Jean-Marc)


    textabstractA connection between transcription and DNA repair was demonstrated previously through the characterization of TFIIH. Using filter binding as well as in vitro transcription challenge competition assays, we now show that the promoter recognition factor TATA box-binding protein (TBP)/TFIID

  12. The mitochondrial transcription factor A functions in mitochondrial base excision repair

    DEFF Research Database (Denmark)

    Canugovi, Chandrika; Maynard, Scott; Bayne, Anne-Cécile V


    Mitochondrial transcription factor A (TFAM) is an essential component of mitochondrial nucleoids. TFAM plays an important role in mitochondrial transcription and replication. TFAM has been previously reported to inhibit nucleotide excision repair (NER) in vitro but NER has not yet been detected i...

  13. Membrane-bound transcription factors: regulated release by RIP or RUP. (United States)

    Hoppe, T; Rape, M; Jentsch, S


    Regulated nuclear transport of transcription factors from cytoplasmic pools is a major route by which eukaryotes control gene expression. Exquisite examples are transcription factors that are kept in a dormant state in the cytosol by membrane anchors; such proteins are released from membranes by proteolytic cleavage, which enables these transcription factors to enter the nucleus. Cleavage can be mediated either by regulated intramembrane proteolysis (RIP) catalysed by specific membrane-bound proteases or by regulated ubiquitin/proteasome-dependent processing (RUP). In both cases processing can be controlled by cues that originate at or in the vicinity of the membrane.

  14. Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors

    Directory of Open Access Journals (Sweden)

    Kamesh Narasimhan


    Conclusion: Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures and that future polyoxometalate chemistry must consider further modification strategies, to address the substantial challenges involved in achieving target selectivity.

  15. Hypoxia-Inducible Factor 3 Is an Oxygen-Dependent Transcription Activator and Regulates a Distinct Transcriptional Response to Hypoxia

    Directory of Open Access Journals (Sweden)

    Peng Zhang


    Full Text Available Hypoxia-inducible factors (HIFs play key roles in the cellular response to hypoxia. It is widely accepted that whereas HIF-1 and HIF-2 function as transcriptional activators, HIF-3 inhibits HIF-1/2α action. Contrary to this idea, we show that zebrafish Hif-3α has strong transactivation activity. Hif-3α is degraded under normoxia. Mutation of P393, P493, and L503 inhibits this oxygen-dependent degradation. Transcriptomics and chromatin immunoprecipitation analyses identify genes that are regulated by Hif-3α, Hif-1α, or both. Under hypoxia or when overexpressed, Hif-3α binds to its target gene promoters and upregulates their expression. Dominant-negative inhibition and knockdown of Hif-3α abolish hypoxia-induced Hif-3α-promoter binding and gene expression. Hif-3α not only mediates hypoxia-induced growth and developmental retardation but also possesses hypoxia-independent activities. Importantly, transactivation activity is conserved and human HIF-3α upregulates similar genes in human cells. These findings suggest that Hif-3 is an oxygen-dependent transcription factor and activates a distinct transcriptional response to hypoxia.

  16. Interactome analysis of transcriptional coactivator multiprotein bridging factor 1 unveils a yeast AP-1-like transcription factor involved in oxidation tolerance of mycopathogen Beauveria bassiana. (United States)

    Chu, Xin-Ling; Dong, Wei-Xia; Ding, Jin-Li; Feng, Ming-Guang; Ying, Sheng-Hua


    Oxidation tolerance is an important determinant to predict the virulence and biocontrol potential of Beauveria bassiana, a well-known entomopathogenic fungus. As a transcriptional coactivator, multiprotein bridging factor 1 mediates the activity of transcription factor in diverse physiological processes, and its homolog in B. bassiana (BbMBF1) contributes to fungal oxidation tolerance. In this study, the BbMBF1-interactomes under oxidative stress and normal growth condition were deciphered by mass spectrometry integrated with the immunoprecipitation. BbMBF1p factor has a broad interaction with proteins that are involved in various cellular processes, and this interaction is dynamically regulated by oxidative stress. Importantly, a B. bassiana homolog of yeast AP-1-like transcription factor (BbAP-1) was specifically associated with the BbMBF1-interactome under oxidation and significantly contributed to fungal oxidation tolerance. In addition, qPCR analysis revealed that several antioxidant genes are jointly controlled by BbAP-1 and BbMBF1. Conclusively, it is proposed that BbMBF1p protein mediates BbAP-1p factor to transcribe the downstream antioxidant genes in B. bassiana under oxidative stress. This study demonstrates for the first time a proteomic view of the MBF1-interactome in fungi, and presents an initial framework to probe the transcriptional mechanism involved in fungal response to oxidation, which will provide a new strategy to improve the biocontrol efficacy of B. bassiana.

  17. Integrative Analysis of Transcription Factor Combinatorial Interactions Using a Bayesian Tensor Factorization Approach (United States)

    Ye, Yusen; Gao, Lin; Zhang, Shihua


    Transcription factors play a key role in transcriptional regulation of genes and determination of cellular identity through combinatorial interactions. However, current studies about combinatorial regulation is deficient due to lack of experimental data in the same cellular environment and extensive existence of data noise. Here, we adopt a Bayesian CANDECOMP/PARAFAC (CP) factorization approach (BCPF) to integrate multiple datasets in a network paradigm for determining precise TF interaction landscapes. In our first application, we apply BCPF to integrate three networks built based on diverse datasets of multiple cell lines from ENCODE respectively to predict a global and precise TF interaction network. This network gives 38 novel TF interactions with distinct biological functions. In our second application, we apply BCPF to seven types of cell type TF regulatory networks and predict seven cell lineage TF interaction networks, respectively. By further exploring the dynamics and modularity of them, we find cell lineage-specific hub TFs participate in cell type or lineage-specific regulation by interacting with non-specific TFs. Furthermore, we illustrate the biological function of hub TFs by taking those of cancer lineage and blood lineage as examples. Taken together, our integrative analysis can reveal more precise and extensive description about human TF combinatorial interactions. PMID:29033978

  18. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis. (United States)

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi


    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    International Nuclear Information System (INIS)

    Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.


    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs

  20. Napsin A and Thyroid Transcription Factor-1-Positive Cerebellar Tumor with Epidermal Growth Factor Receptor Mutation

    Directory of Open Access Journals (Sweden)

    Taiji Kuwata


    Full Text Available We present a very rare case of cerebellar metastasis of unknown origin, in which a primary lung adenocarcinoma was diagnosed by pathological examination of a cerebellar metastatic tumor, using immunohistochemical markers and epidermal growth factor receptor (EGFR mutation of primary lung cancer. A 69-year-old woman was admitted to our hospital because of a hemorrhagic cerebellar tumor and multiple small brain tumors. She underwent cerebellar tumor resection. On pathological examination, the tumor was diagnosed as adenocarcinoma. However, the primary tumor site was unidentifiable even with several imaging inspections. On immunohistochemical analysis, the resected tumor was positive for napsin A and thyroid transcription factor-1. In addition, an EGFR mutation was detected in the tumor. Therefore, primary lung cancer was diagnosed and the patient was started on gefitinib (250 mg/day therapy.

  1. Transcription factor control of growth rate dependent genes in Saccharomyces cerevisiae: A three factor design

    DEFF Research Database (Denmark)

    Fazio, Alessandro; Jewett, Michael Christopher; Daran-Lapujade, Pascale


    , such as Ace2 and Swi6, and stress response regulators, such as Yap1, were also shown to have significantly enriched target sets. Conclusion: Our work, which is the first genome-wide gene expression study to investigate specific growth rate and consider the impact of oxygen availability, provides a more......Background: Characterization of cellular growth is central to understanding living systems. Here, we applied a three-factor design to study the relationship between specific growth rate and genome-wide gene expression in 36 steady-state chemostat cultures of Saccharomyces cerevisiae. The three...... factors we considered were specific growth rate, nutrient limitation, and oxygen availability. Results: We identified 268 growth rate dependent genes, independent of nutrient limitation and oxygen availability. The transcriptional response was used to identify key areas in metabolism around which m...

  2. Role of the GRAS transcription factor ATA/RAM1 in the transcriptional reprogramming of arbuscular mycorrhiza in Petunia hybrida. (United States)

    Rich, Mélanie K; Courty, Pierre-Emmanuel; Roux, Christophe; Reinhardt, Didier


    Development of arbuscular mycorrhiza (AM) requires a fundamental reprogramming of root cells for symbiosis. This involves the induction of hundreds of genes in the host. A recently identified GRAS-type transcription factor in Petunia hybrida, ATA/RAM1, is required for the induction of host genes during AM, and for morphogenesis of the fungal endosymbiont. To better understand the role of RAM1 in symbiosis, we set out to identify all genes that depend on activation by RAM1 in mycorrhizal roots. We have carried out a transcript profiling experiment by RNAseq of mycorrhizal plants vs. non-mycorrhizal controls in wild type and ram1 mutants. The results show that the expression of early genes required for AM, such as the strigolactone biosynthetic genes and the common symbiosis signalling genes, is independent of RAM1. In contrast, genes that are involved at later stages of symbiosis, for example for nutrient exchange in cortex cells, require RAM1 for induction. RAM1 itself is highly induced in mycorrhizal roots together with many other transcription factors, in particular GRAS proteins. Since RAM1 has previously been shown to be directly activated by the common symbiosis signalling pathway through CYCLOPS, we conclude that it acts as an early transcriptional switch that induces many AM-related genes, among them genes that are essential for the development of arbuscules, such as STR, STR2, RAM2, and PT4, besides hundreds of additional RAM1-dependent genes the role of which in symbiosis remains to be explored. Taken together, these results indicate that the defect in the morphogenesis of the fungal arbuscules in ram1 mutants may be an indirect consequence of functional defects in the host, which interfere with nutrient exchange and possibly other functions on which the fungus depends.

  3. Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor (United States)

    Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi


    ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314

  4. CONREAL web server: identification and visualization of conserved transcription factor binding sites

    NARCIS (Netherlands)

    Berezikov, E.; Guryev, V.; Cuppen, E.


    The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are

  5. Sequence2Vec: A novel embedding approach for modeling transcription factor binding affinity landscape

    KAUST Repository

    Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin


    Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have

  6. The logic of communication: roles for mobile transcription factors in plants. (United States)

    Long, Yuchen; Scheres, Ben; Blilou, Ikram


    Mobile transcription factors play many roles in plant development. Here, we compare the use of mobile transcription factors as signals with some canonical signal transduction processes in prokaryotes and eukaryotes. After an initial survey, we focus on the SHORT-ROOT pathway in Arabidopsis roots to show that, despite the simplicity of the concept of mobile transcription factor signalling, many lines of evidence reveal a surprising complexity in control mechanisms linked to this process. We argue that these controls bestow precision, robustness, and versatility on mobile transcription factor signalling. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email:

  7. GATA transcription factors associate with a novel class of nuclear bodies in erythroblasts and megakaryocytes.

    NARCIS (Netherlands)

    A.G. Elefanty (Andrew); M. Antoniou (Michael); N. Custodio; M. Carmo-Fonseca; F.G. Grosveld (Frank)


    textabstractThe nuclear distribution of GATA transcription factors in murine haemopoietic cells was examined by indirect immunofluorescence. Specific bright foci of GATA-1 fluorescence were observed in erythroleukaemia cells and primary murine erythroblasts and megakaryocytes, in addition to diffuse

  8. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.


    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  9. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters.


    Buckley, SM; Delhove, JM; Perocheau, DP; Karda, R; Rahim, AA; Howe, SJ; Ward, NJ; Birrell, MA; Belvisi, MG; Arbuthnot, P; Johnson, MR; Waddington, SN; McKay, TR


    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruse...

  10. Inferring the role of transcription factors in regulatory networks

    Directory of Open Access Journals (Sweden)

    Le Borgne Michel


    Full Text Available Abstract Background Expression profiles obtained from multiple perturbation experiments are increasingly used to reconstruct transcriptional regulatory networks, from well studied, simple organisms up to higher eukaryotes. Admittedly, a key ingredient in developing a reconstruction method is its ability to integrate heterogeneous sources of information, as well as to comply with practical observability issues: measurements can be scarce or noisy. In this work, we show how to combine a network of genetic regulations with a set of expression profiles, in order to infer the functional effect of the regulations, as inducer or repressor. Our approach is based on a consistency rule between a network and the signs of variation given by expression arrays. Results We evaluate our approach in several settings of increasing complexity. First, we generate artificial expression data on a transcriptional network of E. coli extracted from the literature (1529 nodes and 3802 edges, and we estimate that 30% of the regulations can be annotated with about 30 profiles. We additionally prove that at most 40.8% of the network can be inferred using our approach. Second, we use this network in order to validate the predictions obtained with a compendium of real expression profiles. We describe a filtering algorithm that generates particularly reliable predictions. Finally, we apply our inference approach to S. cerevisiae transcriptional network (2419 nodes and 4344 interactions, by combining ChIP-chip data and 15 expression profiles. We are able to detect and isolate inconsistencies between the expression profiles and a significant portion of the model (15% of all the interactions. In addition, we report predictions for 14.5% of all interactions. Conclusion Our approach does not require accurate expression levels nor times series. Nevertheless, we show on both data, real and artificial, that a relatively small number of perturbation experiments are enough to determine

  11. PEA3/ETV4-related transcription factors coupled with active ERK signalling are associated with poor prognosis in gastric adenocarcinoma

    LENUS (Irish Health Repository)

    Keld, R


    Background: Transcription factors often play important roles in tumourigenesis. Members of the PEA3 subfamily of ETS-domain transcription factors fulfil such a role and have been associated with tumour metastasis in several different cancers. Moreover, the activity of the PEA3 subfamily transcription factors is potentiated by Ras-ERK pathway signalling, which is itself often deregulated in tumour cells.\\r\

  12. Nucleosome mediated crosstalk between transcription factors at eukaryotic enhancers

    International Nuclear Information System (INIS)

    Teif, Vladimir B; Rippe, Karsten


    A recent study of transcription regulation in Drosophila embryonic development revealed a complex non-monotonic dependence of gene expression on the distance between binding sites of repressor and activator proteins at the corresponding enhancer cis-regulatory modules (Fakhouri et al 2010 Mol. Syst. Biol. 6 341). The repressor efficiency was high at small separations, low around 30 bp, reached a maximum at 50–60 bp, and decreased at larger distances to the activator binding sites. Here, we propose a straightforward explanation for the distance dependence of repressor activity by considering the effect of the presence of a nucleosome. Using a method that considers partial unwrapping of nucleosomal DNA from the histone octamer core, we calculated the dependence of activator binding on the repressor–activator distance and found a quantitative agreement with the distance dependence reported for the Drosophila enhancer element. In addition, the proposed model offers explanations for other distance-dependent effects at eukaryotic enhancers. (communication)

  13. [Update on the biology of heme synthesis in erythroid cells]. (United States)

    Fujiwara, Tohru; Harigae, Hideo


    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  14. Prospective identification of erythroid elements in cultured peripheral blood. (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P


    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  15. WRKY Transcription Factors Involved in Activation of SA Biosynthesis Genes

    Directory of Open Access Journals (Sweden)

    Bol John F


    Full Text Available Abstract Background Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR. The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA. An important step in SA biosynthesis in Arabidopsis is the conversion of chorismate to isochorismate through the action of isochorismate synthase, encoded by the ICS1 gene. Also AVRPPHB SUSCEPTIBLE 3 (PBS3 plays an important role in SA metabolism, as pbs3 mutants accumulate drastically reduced levels of SA-glucoside, a putative storage form of SA. Bioinformatics analysis previously performed by us identified WRKY28 and WRKY46 as possible regulators of ICS1 and PBS3. Results Expression studies with ICS1 promoter::β-glucuronidase (GUS genes in Arabidopsis thaliana protoplasts cotransfected with 35S::WRKY28 showed that over expression of WRKY28 resulted in a strong increase in GUS expression. Moreover, qRT-PCR analyses indicated that the endogenous ICS1 and PBS3 genes were highly expressed in protoplasts overexpressing WRKY28 or WRKY46, respectively. Electrophoretic mobility shift assays indentified potential WRKY28 binding sites in the ICS1 promoter, positioned -445 and -460 base pairs upstream of the transcription start site. Mutation of these sites in protoplast transactivation assays showed that these binding sites are functionally important for activation of the ICS1 promoter. Chromatin immunoprecipitation assays with haemagglutinin-epitope-tagged WRKY28 showed that the region of the ICS1 promoter containing the binding sites at -445 and -460 was highly enriched in the immunoprecipitated DNA. Conclusions The results obtained here confirm results from our multiple microarray co-expression analyses indicating that WRKY28 and WRKY46 are transcriptional activators of ICS1 and PBS3, respectively, and support this in silico screening as a powerful tool for identifying new components of stress

  16. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    Directory of Open Access Journals (Sweden)

    Pellegrini Matteo


    Full Text Available Abstract Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle.

  17. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.


    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  18. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene. (United States)

    Hale, T K; Braithwaite, A W


    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  19. The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance. (United States)

    Jiang, Yanjuan; Yu, Diqiu


    Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. © 2016 American Society of Plant Biologists. All Rights Reserved.

  20. Epigenetic Transcriptional Memory of GAL Genes Depends on Growth in Glucose and the Tup1 Transcription Factor in Saccharomyces cerevisiae. (United States)

    Sood, Varun; Cajigas, Ivelisse; D'Urso, Agustina; Light, William H; Brickner, Jason H


    Previously expressed inducible genes can remain poised for faster reactivation for multiple cell divisions, a conserved phenomenon called epigenetic transcriptional memory. The GAL genes in Saccharomyces cerevisiae show faster reactivation for up to seven generations after being repressed. During memory, previously produced Gal1 protein enhances the rate of reactivation of GAL1 , GAL10 , GAL2 , and GAL7 These genes also interact with the nuclear pore complex (NPC) and localize to the nuclear periphery both when active and during memory. Peripheral localization of GAL1 during memory requires the Gal1 protein, a memory-specific cis -acting element in the promoter, and the NPC protein Nup100 However, unlike other examples of transcriptional memory, the interaction with NPC is not required for faster GAL gene reactivation. Rather, downstream of Gal1, the Tup1 transcription factor and growth in glucose promote GAL transcriptional memory. Cells only show signs of memory and only benefit from memory when growing in glucose. Tup1 promotes memory-specific chromatin changes at the GAL1 promoter: incorporation of histone variant H2A.Z and dimethylation of histone H3, lysine 4. Tup1 and H2A.Z function downstream of Gal1 to promote binding of a preinitiation form of RNA Polymerase II at the GAL1 promoter, poising the gene for faster reactivation. This mechanism allows cells to integrate a previous experience (growth in galactose, reflected by Gal1 levels) with current conditions (growth in glucose, potentially through Tup1 function) to overcome repression and to poise critical GAL genes for future reactivation. Copyright © 2017 by the Genetics Society of America.

  1. Role of the GRAS transcription factor ATA/RAM1 in the transcriptional reprogramming of arbuscular mycorrhiza in Petunia hybrida


    Rich, Melanie K.; Courty, Pierre-Emmanuel; Roux, Christophe; Reinhardt, Didier


    Background Development of arbuscular mycorrhiza (AM) requires a fundamental reprogramming of root cells for symbiosis. This involves the induction of hundreds of genes in the host. A recently identified GRAS-type transcription factor in Petunia hybrida, ATA/RAM1, is required for the induction of host genes during AM, and for morphogenesis of the fungal endosymbiont. To better understand the role of RAM1 in symbiosis, we set out to identify all genes that depend on activation by RAM1 in mycorr...

  2. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.


    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  3. Sucrose-induced anthocyanin accumulation in vegetative tissue of Petunia plants requires anthocyanin regulatory transcription factors. (United States)

    Ai, Trinh Ngoc; Naing, Aung Htay; Arun, Muthukrishnan; Lim, Sun-Hyung; Kim, Chang Kil


    The effects of three different sucrose concentrations on plant growth and anthocyanin accumulation were examined in non-transgenic (NT) and transgenic (T 2 ) specimens of the Petunia hybrida cultivar 'Mirage rose' that carried the anthocyanin regulatory transcription factors B-Peru+mPAP1 or RsMYB1. Anthocyanin accumulation was not observed in NT plants in any treatments, whereas a range of anthocyanin accumulation was observed in transgenic plants. The anthocyanin content detected in transgenic plants expressing the anthocyanin regulatory transcription factors (B-Peru+mPAP1 or RsMYB1) was higher than that in NT plants. In addition, increasing sucrose concentration strongly enhanced anthocyanin content as shown by quantitative real-time polymerase chain reaction (qRT-PCR) analysis, wherein increased concentrations of sucrose enhanced transcript levels of the transcription factors that are responsible for the induction of biosynthetic genes involved in anthocyanin synthesis; this pattern was not observed in NT plants. In addition, sucrose affected plant growth, although the effects were different between NT and transgenic plants. Taken together, the application of sucrose could enhance anthocyanin production in vegetative tissue of transgenic Petunia carrying anthocyanin regulatory transcription factors, and this study provides insights about interactive effects of sucrose and transcription factors in anthocyanin biosynthesis in the transgenic plant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte

    Directory of Open Access Journals (Sweden)

    Kang Il-Ho


    Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this

  5. A Genome-Scale Resource for the Functional Characterization of Arabidopsis Transcription Factors

    Directory of Open Access Journals (Sweden)

    Jose L. Pruneda-Paz


    Full Text Available Extensive transcriptional networks play major roles in cellular and organismal functions. Transcript levels are in part determined by the combinatorial and overlapping functions of multiple transcription factors (TFs bound to gene promoters. Thus, TF-promoter interactions provide the basic molecular wiring of transcriptional regulatory networks. In plants, discovery of the functional roles of TFs is limited by an increased complexity of network circuitry due to a significant expansion of TF families. Here, we present the construction of a comprehensive collection of Arabidopsis TFs clones created to provide a versatile resource for uncovering TF biological functions. We leveraged this collection by implementing a high-throughput DNA binding assay and identified direct regulators of a key clock gene (CCA1 that provide molecular links between different signaling modules and the circadian clock. The resources introduced in this work will significantly contribute to a better understanding of the transcriptional regulatory landscape of plant genomes.

  6. Factor C*, the specific initiation component of the mouse RNA polymerase I holoenzyme, is inactivated early in the transcription process.


    Brun, R P; Ryan, K; Sollner-Webb, B


    Factor C* is the component of the RNA polymerase I holoenzyme (factor C) that allows specific transcriptional initiation on a factor D (SL1)- and UBF-activated rRNA gene promoter. The in vitro transcriptional capacity of a preincubated rDNA promoter complex becomes exhausted very rapidly upon initiation of transcription. This is due to the rapid depletion of C* activity. In contrast, C* activity is not unstable in the absence of transcription, even in the presence of nucleoside triphosphates ...

  7. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  8. A systems biology perspective on the role of WRKY transcription factors in drought responses in plants. (United States)

    Tripathi, Prateek; Rabara, Roel C; Rushton, Paul J


    Drought is one of the major challenges affecting crop productivity and yield. However, water stress responses are notoriously multigenic and quantitative with strong environmental effects on phenotypes. It is also clear that water stress often does not occur alone under field conditions but rather in conjunction with other abiotic stresses such as high temperature and high light intensities. A multidisciplinary approach with successful integration of a whole range of -omics technologies will not only define the system, but also provide new gene targets for both transgenic approaches and marker-assisted selection. Transcription factors are major players in water stress signaling and some constitute major hubs in the signaling webs. The main transcription factors in this network include MYB, bHLH, bZIP, ERF, NAC, and WRKY transcription factors. The role of WRKY transcription factors in abiotic stress signaling networks is just becoming apparent and systems biology approaches are starting to define their places in the signaling network. Using systems biology approaches, there are now many transcriptomic analyses and promoter analyses that concern WRKY transcription factors. In addition, reports on nuclear proteomics have identified WRKY proteins that are up-regulated at the protein level by water stress. Interactomics has started to identify different classes of WRKY-interacting proteins. What are often lacking are connections between metabolomics, WRKY transcription factors, promoters, biosynthetic pathways, fluxes and downstream responses. As more levels of the system are characterized, a more detailed understanding of the roles of WRKY transcription factors in drought responses in crops will be obtained.

  9. The transcription factor KLF2 restrains CD4⁺ T follicular helper cell differentiation. (United States)

    Lee, June-Yong; Skon, Cara N; Lee, You Jeong; Oh, Soohwan; Taylor, Justin J; Malhotra, Deepali; Jenkins, Marc K; Rosenfeld, M Geoffrey; Hogquist, Kristin A; Jameson, Stephen C


    T follicular helper (Tfh) cells are essential for efficient B cell responses, yet the factors that regulate differentiation of this CD4(+) T cell subset are incompletely understood. Here we found that the KLF2 transcription factor serves to restrain Tfh cell generation. Induced KLF2 deficiency in activated CD4(+) T cells led to increased Tfh cell generation and B cell priming, whereas KLF2 overexpression prevented Tfh cell production. KLF2 promotes expression of the trafficking receptor S1PR1, and S1PR1 downregulation is essential for efficient Tfh cell production. However, KLF2 also induced expression of the transcription factor Blimp-1, which repressed transcription factor Bcl-6 and thereby impaired Tfh cell differentiation. Furthermore, KLF2 induced expression of the transcription factors T-bet and GATA3 and enhanced Th1 differentiation. Hence, our data indicate KLF2 is pivotal for coordinating CD4(+) T cell differentiation through two distinct and complementary mechanisms: via control of T cell localization and by regulation of lineage-defining transcription factors. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome. (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang


    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Function of the PHA-4/FOXA transcription factor during C. elegans post-embryonic development

    Directory of Open Access Journals (Sweden)

    Chen Di


    Full Text Available Abstract Background pha-4 encodes a forkhead box (FOX A transcription factor serving as the C. elegans pharynx organ identity factor during embryogenesis. Using Serial Analysis of Gene Expression (SAGE, comparison of gene expression profiles between growing stages animals and long-lived, developmentally diapaused dauer larvae revealed that pha-4 transcription is increased in the dauer stage. Results Knocking down pha-4 expression by RNAi during post-embryonic development showed that PHA-4 is essential for dauer recovery, gonad and vulva development. daf-16, which encodes a FOXO transcription factor regulated by insulin/IGF-1 signaling, shows overlapping expression patterns and a loss-of-function post-embryonic phenotype similar to that of pha-4 during dauer recovery. pha-4 RNAi and daf-16 mutations have additive effects on dauer recovery, suggesting these two regulators may function in parallel pathways. Gene expression studies using RT-PCR and GFP reporters showed that pha-4 transcription is elevated under starvation, and a conserved forkhead transcription factor binding site in the second intron of pha-4 is important for the neuronal expression. The vulval transcription of lag-2, which encodes a ligand for the LIN-12/Notch lateral signaling pathway, is inhibited by pha-4 RNAi, indicating that LAG-2 functions downstream of PHA-4 in vulva development. Conclusion Analysis of PHA-4 during post-embryonic development revealed previously unsuspected functions for this important transcriptional regulator in dauer recovery, and may help explain the network of transcriptional control integrating organogenesis with the decision between growth and developmental arrest at the dauer entry and exit stages.

  12. Identification of transcription factors linked to cell cycle regulation in Arabidopsis


    Dehghan Nayeri, Fatemeh


    Cell cycle is an essential process in growth and development of living organisms consists of the replication and mitotic phases separated by 2 gap phases; G1 and G2. It is tightly controlled at the molecular level and especially at the level of transcription. Precise regulation of the cell cycle is of central significance for plant growth and development and transcription factors are global regulators of gene expression playing essential roles in cell cycle regulation. This study has uncovere...

  13. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression

    DEFF Research Database (Denmark)

    Cano, A; Pérez-Moreno, M A; Rodrigo, I


    The Snail family of transcription factors has previously been implicated in the differentiation of epithelial cells into mesenchymal cells (epithelial-mesenchymal transitions) during embryonic development. Epithelial-mesenchymal transitions are also determinants of the progression of carcinomas......, occurring concomitantly with the cellular acquisition of migratory properties following downregulation of expression of the adhesion protein E-cadherin. Here we show that mouse Snail is a strong repressor of transcription of the E-cadherin gene. Epithelial cells that ectopically express Snail adopt...

  14. Mouse Incisor Stem Cell Niche and Myb Transcription Factors

    Czech Academy of Sciences Publication Activity Database

    Švandová, Eva; Veselá, Barbora; Šmarda, J.; Hampl, A.; Radlanski, R.J.; Matalová, Eva


    Roč. 44, č. 5 (2015), s. 338-344 ISSN 0340-2096 R&D Projects: GA ČR GAP304/11/1418; GA ČR GCP302/12/J059 Institutional support: RVO:67985904 Keywords : c-Myb * stem cell niches Subject RIV: EA - Cell Biology Impact factor: 0.615, year: 2015

  15. Activating transcription factor 3 regulates immune and metabolic homeostasis

    Czech Academy of Sciences Publication Activity Database

    Ryneš, J.; Donohoe, C. D.; Frommolt, P.; Brodesser, S.; Jindra, Marek; Uhlířová, M.


    Roč. 32, č. 19 (2012), s. 3949-3962 ISSN 0270-7306 R&D Projects: GA ČR(CZ) GD204/09/H058 Institutional support: RVO:60077344 Keywords : metabolic homeostasis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.372, year: 2012

  16. Osteogenic Potential of the Transcription Factor c-MYB

    Czech Academy of Sciences Publication Activity Database

    Oralová, Veronika; Matalová, Eva; Killinger, Michael; Knopfová, L.; Šmarda, J.; Buchtová, Marcela


    Roč. 100, č. 3 (2017), s. 311-322 ISSN 0171-967X R&D Projects: GA ČR(CZ) GB14-37368G Institutional support: RVO:67985904 Keywords : mineralised matrix * micromass cultures * mouse limbs Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Developmental biology Impact factor: 3.124, year: 2016

  17. Identification of a novel and unique transcription factor in the intraerythrocytic stage of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available The mechanisms of stage-specific gene regulation in the malaria parasite Plasmodium falciparum are largely unclear, with only a small number of specific regulatory transcription factors (AP2 family having been identified. In particular, the transcription factors that function in the intraerythrocytic stage remain to be elucidated. Previously, as a model case for stage-specific transcription in the P. falciparum intraerythrocytic stage, we analyzed the transcriptional regulation of pf1-cys-prx, a trophozoite/schizont-specific gene, and suggested that some nuclear factors bind specifically to the cis-element of pf1-cys-prx and enhance transcription. In the present study, we purified nuclear factors from parasite nuclear extract by 5 steps of chromatography, and identified a factor termed PREBP. PREBP is not included in the AP2 family, and is a novel protein with four K-homology (KH domains. The KH domain is known to be found in RNA-binding or single-stranded DNA-binding proteins. PREBP is well conserved in Plasmodium species and partially conserved in phylum Apicomplexa. To evaluate the effects of PREBP overexpression, we used a transient overexpression and luciferase assay combined approach. Overexpression of PREBP markedly enhanced luciferase expression under the control of the pf1-cys-prx cis-element. These results provide the first evidence of a novel transcription factor that activates the gene expression in the malaria parasite intraerythrocytic stage. These findings enhance our understanding of the evolution of specific transcription machinery in Plasmodium and other eukaryotes.

  18. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.). (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P


    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  19. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize. (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin


    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  20. Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors. (United States)

    Perdigão, Pedro; Gaj, Thomas; Santa-Marta, Mariana; Barbas, Carlos F; Goncalves, Joao


    The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE) proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.

  1. Role of Transcription Factor Modifications in the Pathogenesis of Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Mi-Young Kim


    Full Text Available Non-alcoholic fatty liver disease (NAFLD is characterized by fat accumulation in the liver not due to alcohol abuse. NAFLD is accompanied by variety of symptoms related to metabolic syndrome. Although the metabolic link between NAFLD and insulin resistance is not fully understood, it is clear that NAFLD is one of the main cause of insulin resistance. NAFLD is shown to affect the functions of other organs, including pancreas, adipose tissue, muscle and inflammatory systems. Currently efforts are being made to understand molecular mechanism of interrelationship between NAFLD and insulin resistance at the transcriptional level with specific focus on post-translational modification (PTM of transcription factors. PTM of transcription factors plays a key role in controlling numerous biological events, including cellular energy metabolism, cell-cycle progression, and organ development. Cell type- and tissue-specific reversible modifications include lysine acetylation, methylation, ubiquitination, and SUMOylation. Moreover, phosphorylation and O-GlcNAcylation on serine and threonine residues have been shown to affect protein stability, subcellular distribution, DNA-binding affinity, and transcriptional activity. PTMs of transcription factors involved in insulin-sensitive tissues confer specific adaptive mechanisms in response to internal or external stimuli. Our understanding of the interplay between these modifications and their effects on transcriptional regulation is growing. Here, we summarize the diverse roles of PTMs in insulin-sensitive tissues and their involvement in the pathogenesis of insulin resistance.

  2. A transcript cleavage factor of Mycobacterium tuberculosis important for its survival.

    Directory of Open Access Journals (Sweden)

    Arnab China

    Full Text Available After initiation of transcription, a number of proteins participate during elongation and termination modifying the properties of the RNA polymerase (RNAP. Gre factors are one such group conserved across bacteria. They regulate transcription by projecting their N-terminal coiled-coil domain into the active center of RNAP through the secondary channel and stimulating hydrolysis of the newly synthesized RNA in backtracked elongation complexes. Rv1080c is a putative gre factor (MtbGre in the genome of Mycobacterium tuberculosis. The protein enhanced the efficiency of promoter clearance by lowering abortive transcription and also rescued arrested and paused elongation complexes on the GC rich mycobacterial template. Although MtbGre is similar in domain organization and shares key residues for catalysis and RNAP interaction with the Gre factors of Escherichia coli, it could not complement an E. coli gre deficient strain. Moreover, MtbGre failed to rescue E. coli RNAP stalled elongation complexes, indicating the importance of specific protein-protein interactions for transcript cleavage. Decrease in the level of MtbGre reduced the bacterial survival by several fold indicating its essential role in mycobacteria. Another Gre homolog, Rv3788 was not functional in transcript cleavage activity indicating that a single Gre is sufficient for efficient transcription of the M. tuberculosis genome.

  3. Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors.

    Directory of Open Access Journals (Sweden)

    Pedro Perdigão

    Full Text Available The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.

  4. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.


    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  5. Termination factor Rho: From the control of pervasive transcription to cell fate determination in Bacillus subtilis (United States)

    Nicolas, Pierre; Repoila, Francis; Bardowski, Jacek; Aymerich, Stéphane


    In eukaryotes, RNA species originating from pervasive transcription are regulators of various cellular processes, from the expression of individual genes to the control of cellular development and oncogenesis. In prokaryotes, the function of pervasive transcription and its output on cell physiology is still unknown. Most bacteria possess termination factor Rho, which represses pervasive, mostly antisense, transcription. Here, we investigate the biological significance of Rho-controlled transcription in the Gram-positive model bacterium Bacillus subtilis. Rho inactivation strongly affected gene expression in B. subtilis, as assessed by transcriptome and proteome analysis of a rho–null mutant during exponential growth in rich medium. Subsequent physiological analyses demonstrated that a considerable part of Rho-controlled transcription is connected to balanced regulation of three mutually exclusive differentiation programs: cell motility, biofilm formation, and sporulation. In the absence of Rho, several up-regulated sense and antisense transcripts affect key structural and regulatory elements of these differentiation programs, thereby suppressing motility and biofilm formation and stimulating sporulation. We dissected how Rho is involved in the activity of the cell fate decision-making network, centered on the master regulator Spo0A. We also revealed a novel regulatory mechanism of Spo0A activation through Rho-dependent intragenic transcription termination of the protein kinase kinB gene. Altogether, our findings indicate that distinct Rho-controlled transcripts are functional and constitute a previously unknown built-in module for the control of cell differentiation in B. subtilis. In a broader context, our results highlight the recruitment of the termination factor Rho, for which the conserved biological role is probably to repress pervasive transcription, in highly integrated, bacterium-specific, regulatory networks. PMID:28723971

  6. Mechanism of transcription activation at the comG promoter by the competence transcription factor ComK of Bacillus subtilis

    NARCIS (Netherlands)

    Susanna, KA; van der Werff, AF; den Hengst, CD; Calles, B; Salas, M; Venema, G; Hamoen, LW; Kuipers, OP

    The development of genetic competence in Bacillus subtilis is regulated by a complex signal transduction cascade, which results in the synthesis of the competence transcription factor, encoded by comK. ComK is required for the transcription of the late competence genes that encode the DNA binding

  7. Regulation of cell proliferation by the E2F transcription factors

    DEFF Research Database (Denmark)

    Helin, K


    Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice h......Fs in the proteasomes. Novel target genes for the E2F transcription factors have been identified that link the E2Fs directly to the initiation of DNA replication.......Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice has...... demonstrated that individual members of the E2F transcription factor family are likely to have distinct roles in mammalian development and homeostasis. Additional mechanisms regulating the activity of the E2F transcription factors have been reported, including subcellular localization and proteolysis of the E2...

  8. Temporally Regulated Neural Crest Transcription Factors Distinguish Neuroectodermal Tumors of Varying Malignancy and Differentiation

    Directory of Open Access Journals (Sweden)

    Timothy R. Gershon


    Full Text Available Neuroectodermal tumor cells, like neural crest (NC cells, are pluripotent, proliferative, and migratory. We tested the hypothesis that genetic programs essential to NC development are activated in neuroectodermal tumors. We examined the expression of transcription factors PAX3, PAX7, AP-2α, and SOX10 in human embryos and neuroectodermal tumors: neurofibroma, schwannoma, neuroblastoma, malignant nerve sheath tumor, melanoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, and Ewing's sarcoma. We also examined the expression of P0, ERBB3, and STX, targets of SOX10, AP-2α, and PAX3, respectively. PAX3, AP-2α, and SOX10 were expressed sequentially in human NC development, whereas PAX7 was restricted to mesoderm. Tumors expressed PAX3, AP-2α, SOX10, and PAX7 in specific combinations. SOX10 and AP-2α were expressed in relatively differentiated neoplasms. The early NC marker, PAX3, and its homologue, PAX7, were detected in poorly differentiated tumors and tumors with malignant potential. Expression of NC transcription factors and target genes correlated. Transcription factors essential to NC development are thus present in neuroectodermal tumors. Correlation of specific NC transcription factors with phenotype, and with expression of specific downstream genes, provides evidence that these transcription factors actively influence gene expression and tumor behavior. These findings suggest that PAX3, PAX7, AP-2α, and SOX10 are potential markers of prognosis and targets for therapeutic intervention.

  9. Mitochondrial biogenesis in brown adipose tissue is associated with differential expression of transcription regulatory factors

    Czech Academy of Sciences Publication Activity Database

    Villena, J. A.; Carmona, M. C.; Rodriguez de la Concepción, M.; Rossmeisl, Martin; Vinas, O.; Mampel, T.; Iglesias, R.; Giralt, M.; Villarroya, F.


    Roč. 59, č. 11 (2002), s. 1934-1944 ISSN 1420-682X Grant - others:Ministerio de Ciencia y Tecnología (ES) PM98.0188 Institutional research plan: CEZ:AV0Z5011922 Keywords : brown adipose tissue * mitochondria * transcription factors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.259, year: 2002

  10. DOT/FAA Human Factors Workshop on Aviation (5th). Transcript. (United States)


    This document is a verbatim transcript of the proceedings of the Fifth Human Factors Workshop held at the Mike Monroney Aeronautical Center in Oklahoma City, Oklahoma, on July 7-9, 1981. The Sixth Human Factors Workshop was held at the same facility ...

  11. Analysis of functional redundancies within the Arabidopsis TCP transcription factor family

    NARCIS (Netherlands)

    Danisman, S.; Dijk, van A.D.J.; Bimbo, A.; Wal, van der F.; Hennig, L.; Folter, de S.; Angenent, G.C.; Immink, R.G.H.


    Analyses of the functions of TEOSINTE-LIKE1, CYCLOIDEA, and ROLIFERATING CELL FACTOR1 (TCP) transcription factors have been hampered by functional redundancy between its individual members. In general, putative functionally redundant genes are predicted based on sequence similarity and confirmed by

  12. ZNF143 protein is an important regulator of the myeloid transcription factor C/EBP

    Czech Academy of Sciences Publication Activity Database

    Gonzalez, D.; Luyten, A.; Bartholdy, B.; Zhou, Q.; Kardošová, Miroslava; Ebralidze, A.; Swanson, K.D.; Radomska, H.S.; Zhang, P.; Kobayashi, S.S.; Welner, R.S.; Levantini, E.; Steidl, U.; Chong, G.; Collombet, S.; Choi, M.H.; Friedman, A.D.; Scott, L.M.; Alberich-Jorda, Meritxell; Tenen, D.G.


    Roč. 292, č. 46 (2017), s. 18924-18936 ISSN 0021-9258 Institutional support: RVO:68378050 Keywords : CCAAT-enhancer-binding protein * gene regulation * hematopoiesis * promoter * transcription factor * EBPalpha * ZNF143 Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 4.125, year: 2016

  13. Insights into mRNP biogenesis provided by new genetic interactions among export and transcription factors

    Directory of Open Access Journals (Sweden)

    Estruch Francisco


    Full Text Available Abstract Background The various steps of mRNP biogenesis (transcription, processing and export are interconnected. It has been shown that the transcription machinery plays a pivotal role in mRNP assembly, since several mRNA export factors are recruited during transcription and physically interact with components of the transcription machinery. Although the shuttling DEAD-box protein Dbp5p is concentrated on the cytoplasmic fibrils of the NPC, previous studies demonstrated that it interacts physically and genetically with factors involved in transcription initiation. Results We investigated the effect of mutations affecting various components of the transcription initiation apparatus on the phenotypes of mRNA export mutant strains. Our results show that growth and mRNA export defects of dbp5 and mex67 mutant strains can be suppressed by mutation of specific transcription initiation components, but suppression was not observed for mutants acting in the very first steps of the pre-initiation complex (PIC formation. Conclusions Our results indicate that mere reduction in the amount of mRNP produced is not sufficient to suppress the defects caused by a defective mRNA export factor. Suppression occurs only with mutants affecting events within a narrow window of the mRNP biogenesis process. We propose that reducing the speed with which transcription converts from initiation and promoter clearance to elongation may have a positive effect on mRNP formation by permitting more effective recruitment of partially-functional mRNP proteins to the nascent mRNP.

  14. SUMOylation of the KRAB zinc-finger transcription factor PARIS/ZNF746 regulates its transcriptional activity

    International Nuclear Information System (INIS)

    Nishida, Tamotsu; Yamada, Yoshiji


    Parkin-interacting substrate (PARIS), a member of the family of Krüppel-associated box (KRAB)-containing zinc-finger transcription factors, is a substrate of the ubiquitin E3 ligase parkin. PARIS represses the expression of peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), although the underlying mechanisms remain largely unknown. In the present study, we demonstrate that PARIS can be SUMOylated, and its SUMOylation plays a role in the repression of PGC-1a promoter activity. Protein inhibitor of activated STAT y (PIASy) was identified as an interacting protein of PARIS and shown to enhance its SUMOylation. PIASy repressed PGC-1a promoter activity, and this effect was attenuated by PARIS in a manner dependent on its SUMOylation status. Co-expression of SUMO-1 with PIASy completely repressed PGC-1a promoter activity independently of PARIS expression. PARIS-mediated PGC-1a promoter repression depended on the activity of histone deacetylases (HDAC), whereas PIASy repressed the PGC-1a promoter in an HDAC-independent manner. Taken together, these results suggest that PARIS and PIASy modulate PGC-1a gene transcription through distinct molecular mechanisms. -- Highlights: •PARIS can be SUMOylated in vivo and in vitro. •SUMOylation of PARIS functions in the repression of PGC-1a promoter activity. •PIASy interacts with PARIS and enhances its SUMOylation. •PIASy influences PARIS-mediated repression of PGC-1a promoter activity.

  15. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae


    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  16. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong


    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  17. SUMOylation of the KRAB zinc-finger transcription factor PARIS/ZNF746 regulates its transcriptional activity

    Energy Technology Data Exchange (ETDEWEB)

    Nishida, Tamotsu, E-mail:; Yamada, Yoshiji


    Parkin-interacting substrate (PARIS), a member of the family of Krüppel-associated box (KRAB)-containing zinc-finger transcription factors, is a substrate of the ubiquitin E3 ligase parkin. PARIS represses the expression of peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), although the underlying mechanisms remain largely unknown. In the present study, we demonstrate that PARIS can be SUMOylated, and its SUMOylation plays a role in the repression of PGC-1a promoter activity. Protein inhibitor of activated STAT y (PIASy) was identified as an interacting protein of PARIS and shown to enhance its SUMOylation. PIASy repressed PGC-1a promoter activity, and this effect was attenuated by PARIS in a manner dependent on its SUMOylation status. Co-expression of SUMO-1 with PIASy completely repressed PGC-1a promoter activity independently of PARIS expression. PARIS-mediated PGC-1a promoter repression depended on the activity of histone deacetylases (HDAC), whereas PIASy repressed the PGC-1a promoter in an HDAC-independent manner. Taken together, these results suggest that PARIS and PIASy modulate PGC-1a gene transcription through distinct molecular mechanisms. -- Highlights: •PARIS can be SUMOylated in vivo and in vitro. •SUMOylation of PARIS functions in the repression of PGC-1a promoter activity. •PIASy interacts with PARIS and enhances its SUMOylation. •PIASy influences PARIS-mediated repression of PGC-1a promoter activity.

  18. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell


    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  19. Targeting cancer stem cells: emerging role of Nanog transcription factor

    Directory of Open Access Journals (Sweden)

    Wang ML


    Full Text Available Mong-Lien Wang,1 Shih-Hwa Chiou,2,3 Cheng-Wen Wu1,4–61Institute of Biochemistry and Molecular Biology, 2Institute of Pharmacology, National Yang Ming University, Taipei, Taiwan; 3Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan; 4Institute of Microbiology and Immunology, 5Institute of Clinical Medicine, National Yang Ming University, Taipei, Taiwan; 6Institute of Biomedical Science, Academia Sinica, Taipei, TaiwanAbstract: The involvement of stemness factors in cancer initiation and progression has drawn much attention recently, especially after the finding that introducing four stemness factors in somatic cells is able to reprogram the cells back to an embryonic stem cell-like state. Following accumulating data revealing abnormal elevated expression levels of key stemness factors, like Nanog, Oct4, and Sox2, in several types of cancer stem cells; the importance and therapeutic potential of targeting these stemness regulators in cancers has turned to research focus. Nanog determines cell fate in both embryonic and cancer stem cells; activating Nanog at an inappropriate time would result in cancer stem cells rather than normal pluripotent stem cells or differentiated somatic cells. Upregulated Nanog is correlated with poor survival outcome of patients with various types of cancer. The discoveries of downstream regulatory pathways directly or indirectly mediated by Nanog indicate that Nanog regulates several aspects of cancer development such as tumor cell proliferation, self-renewal, motility, epithelial-mesenchymal transition, immune evasion, and drug-resistance, which are all defined features for cancer stem cells. The current review paper illustrates the central role of Nanog in the regulatory networks of cancer malignant development and stemness acquirement, as well as in the communication between cancer cells and the surrounding stroma. Though a more defined model is needed to test the

  20. Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice (United States)

    Overman, Jeroen; Fontaine, Frank; Moustaqil, Mehdi; Mittal, Deepak; Sierecki, Emma; Sacilotto, Natalia; Zuegg, Johannes; Robertson, Avril AB; Holmes, Kelly; Salim, Angela A; Mamidyala, Sreeman; Butler, Mark S; Robinson, Ashley S; Lesieur, Emmanuelle; Johnston, Wayne; Alexandrov, Kirill; Black, Brian L; Hogan, Benjamin M; De Val, Sarah; Capon, Robert J; Carroll, Jason S; Bailey, Timothy L; Koopman, Peter; Jauch, Ralf; Smyth, Mark J; Cooper, Matthew A; Gambin, Yann; Francois, Mathias


    Pharmacological targeting of transcription factors holds great promise for the development of new therapeutics, but strategies based on blockade of DNA binding, nuclear shuttling, or individual protein partner recruitment have yielded limited success to date. Transcription factors typically engage in complex interaction networks, likely masking the effects of specifically inhibiting single protein-protein interactions. Here, we used a combination of genomic, proteomic and biophysical methods to discover a suite of protein-protein interactions involving the SOX18 transcription factor, a known regulator of vascular development and disease. We describe a small-molecule that is able to disrupt a discrete subset of SOX18-dependent interactions. This compound selectively suppressed SOX18 transcriptional outputs in vitro and interfered with vascular development in zebrafish larvae. In a mouse pre-clinical model of breast cancer, treatment with this inhibitor significantly improved survival by reducing tumour vascular density and metastatic spread. Our studies validate an interactome-based molecular strategy to interfere with transcription factor activity, for the development of novel disease therapeutics. DOI: PMID:28137359

  1. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. (United States)

    Motohashi, Hozumi; O'Connor, Tania; Katsuoka, Fumiki; Engel, James Douglas; Yamamoto, Masayuki


    Recent progress in the analysis of transcriptional regulation has revealed the presence of an exquisite functional network comprising the Maf and Cap 'n' collar (CNC) families of regulatory proteins, many of which have been isolated. Among Maf factors, large Maf proteins are important in the regulation of embryonic development and cell differentiation, whereas small Maf proteins serve as obligatory heterodimeric partner molecules for members of the CNC family. Both Maf homodimers and CNC-small Maf heterodimers bind to the Maf recognition element (MARE). Since the MARE contains a consensus TRE sequence recognized by AP-1, Jun and Fos family members may act to compete or interfere with the function of CNC-small Maf heterodimers. Overall then, the quantitative balance of transcription factors interacting with the MARE determines its transcriptional activity. Many putative MARE-dependent target genes such as those induced by antioxidants and oxidative stress are under concerted regulation by the CNC family member Nrf2, as clearly proven by mouse germline mutagenesis. Since these genes represent a vital aspect of the cellular defense mechanism against oxidative stress, Nrf2-null mutant mice are highly sensitive to xenobiotic and oxidative insults. Deciphering the molecular basis of the regulatory network composed of Maf and CNC families of transcription factors will undoubtedly lead to a new paradigm for the cooperative function of transcription factors.

  2. Myocardin-related transcription factor regulates Nox4 protein expression

    DEFF Research Database (Denmark)

    Rozycki, Matthew; Bialik, Janne Folke; Speight, Pam


    translocation of MRTF. Because the Nox4 promoter harbors a serum response factor/MRTF cis-element (CC(A/T)6GG box), we asked if MRTF (and thus cytoskeleton organization) could regulate Nox4 expression. We show that Nox4 protein is robustly induced in kidney tubular cells exclusively by combined application...... TGFβ/contact disruption-provoked Nox4 protein and mRNA expression, Nox4 promoter activation, and reactive oxygen species production. Mutation of the CC(A/T)6GG box eliminates the synergistic activation of the Nox4 promoter. Jasplakinolide-induced actin polymerization synergizes with TGFβ to facilitate...... MRTF-dependent Nox4 mRNA expression/promoter activation. Moreover, MRTF inhibition prevents Nox4 expression during TGFβ-induced fibroblast-myofibroblast transition as well. Although necessary, MRTF is insufficient; Nox4 expression also requires TGFβ-activated Smad3 and TAZ/YAP, two contact...

  3. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box. (United States)

    Kageyama, R; Merlino, G T; Pastan, I


    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  4. Transcriptional regulators of legume-rhizobia symbiosis: nuclear factors Ys and GRAS are two for tango. (United States)

    Rípodas, Carolina; Clúa, Joaquín; Battaglia, Marina; Baudin, Maël; Niebel, Andreas; Zanetti, María Eugenia; Blanco, Flavio


    Transcription factors are DNA binding proteins that regulate gene expression. The nitrogen fixing symbiosis established between legume plants and soil bacteria is a complex interaction, in which plants need to integrate signals derived from the symbiont and the surrounding environment to initiate the developmental program of nodule organogenesis and the infection process. Several transcription factors that play critical roles in these processes have been reported in the past decade, including proteins of the GRAS and NF-Y families. Recently, we reported the characterization of a new GRAS domain containing-protein that interacts with a member of the C subunit of the NF-Y family, which plays an important role in nodule development and the progression of bacterial infection during the symbiotic interaction. The connection between transcription factors of these families highlights the significance of multimeric complexes in the fabulous capacity of plants to integrate and respond to multiple environmental stimuli.

  5. Asap: a framework for over-representation statistics for transcription factor binding sites

    DEFF Research Database (Denmark)

    Marstrand, Troels T; Frellsen, Jes; Moltke, Ida


    -founded choice. METHODOLOGY: We introduce a software package, Asap, for fast searching with position weight matrices that include several standard methods for assessing over-representation. We have compared the ability of these methods to detect over-represented transcription factor binding sites in artificial......BACKGROUND: In studies of gene regulation the efficient computational detection of over-represented transcription factor binding sites is an increasingly important aspect. Several published methods can be used for testing whether a set of hypothesised co-regulated genes share a common regulatory...... regime based on the occurrence of the modelled transcription factor binding sites. However there is little or no information available for guiding the end users choice of method. Furthermore it would be necessary to obtain several different software programs from various sources to make a well...

  6. G =  MAT: linking transcription factor expression and DNA binding data. (United States)

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak


    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at

  7. G =  MAT: linking transcription factor expression and DNA binding data.

    Directory of Open Access Journals (Sweden)

    Konstantin Tretyakov

    Full Text Available Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at

  8. G = MAT: Linking Transcription Factor Expression and DNA Binding Data (United States)

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak


    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at PMID:21297945

  9. Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue

    Directory of Open Access Journals (Sweden)

    R. Linden


    Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.

  10. Identification of a Transcription Factor Controlling pH-Dependent Organic Acid Response in Aspergillus niger

    DEFF Research Database (Denmark)

    Poulsen, Lars; Andersen, Mikael Rørdam; Lantz, Anna Eliasson


    exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants......, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0). Transcriptional profiles showed that 241 genes were differentially......Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants...

  11. Using network component analysis to dissect regulatory networks mediated by transcription factors in yeast.

    Directory of Open Access Journals (Sweden)

    Chun Ye


    Full Text Available Understanding the relationship between genetic variation and gene expression is a central question in genetics. With the availability of data from high-throughput technologies such as ChIP-Chip, expression, and genotyping arrays, we can begin to not only identify associations but to understand how genetic variations perturb the underlying transcription regulatory networks to induce differential gene expression. In this study, we describe a simple model of transcription regulation where the expression of a gene is completely characterized by two properties: the concentrations and promoter affinities of active transcription factors. We devise a method that extends Network Component Analysis (NCA to determine how genetic variations in the form of single nucleotide polymorphisms (SNPs perturb these two properties. Applying our method to a segregating population of Saccharomyces cerevisiae, we found statistically significant examples of trans-acting SNPs located in regulatory hotspots that perturb transcription factor concentrations and affinities for target promoters to cause global differential expression and cis-acting genetic variations that perturb the promoter affinities of transcription factors on a single gene to cause local differential expression. Although many genetic variations linked to gene expressions have been identified, it is not clear how they perturb the underlying regulatory networks that govern gene expression. Our work begins to fill this void by showing that many genetic variations affect the concentrations of active transcription factors in a cell and their affinities for target promoters. Understanding the effects of these perturbations can help us to paint a more complete picture of the complex landscape of transcription regulation. The software package implementing the algorithms discussed in this work is available as a MATLAB package upon request.

  12. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus. (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng


    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  13. Host transcription factors in the immediate pro-inflammatory response to the parasitic mite Psoroptes ovis.

    Directory of Open Access Journals (Sweden)

    Stewart T G Burgess

    Full Text Available BACKGROUND: Sheep scab, caused by infestation with the ectoparasitic mite Psoroptes ovis, results in the rapid development of cutaneous inflammation and leads to the crusted skin lesions characteristic of the disease. We described previously the global host transcriptional response to infestation with P. ovis, elucidating elements of the inflammatory processes which lead to the development of a rapid and profound immune response. However, the mechanisms by which this response is instigated remain unclear. To identify novel methods of intervention a better understanding of the early events involved in triggering the immune response is essential. The objective of this study was to gain a clearer understanding of the mechanisms and signaling pathways involved in the instigation of the immediate pro-inflammatory response. RESULTS: Through a combination of transcription factor binding site enrichment and pathway analysis we identified key roles for a number of transcription factors in the instigation of cutaneous inflammation. In particular, defined roles were elucidated for the transcription factors NF-kB and AP-1 in the orchestration of the early pro-inflammatory response, with these factors being implicated in the activation of a suite of inflammatory mediators. CONCLUSIONS: Interrogation of the host temporal response to P. ovis infestation has enabled the further identification of the mechanisms underlying the development of the immediate host pro-inflammatory response. This response involves key regulatory roles for the transcription factors NF-kB and AP-1. Pathway analysis demonstrated that the activation of these transcription factors may be triggered following a host LPS-type response, potentially involving TLR4-signalling and also lead to the intriguing possibility that this could be triggered by a P. ovis allergen.

  14. The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation. (United States)

    Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A


    The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. © 2015 Authors.

  15. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.


    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  16. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio


    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  17. An engineered tale-transcription factor rescues transcription of factor VII impaired by promoter mutations and enhances its endogenous expression in hepatocytes. (United States)

    Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo


    Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.

  18. Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.

    Directory of Open Access Journals (Sweden)

    Georgi K Marinov

    Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.

  19. bZIPs and WRKYs: two large transcription factor families executing two different functional strategies

    Directory of Open Access Journals (Sweden)

    Carles eMarco Llorca


    Full Text Available bZIPs and WRKYs are two important plant transcription factor families regulating diverse developmental and stress-related processes. Since a partial overlap in these biological processes is obvious, it can be speculated that they fulfill non-redundant functions in a complex regulatory network. Here, we focus on the regulatory mechanisms that are so far described for bZIPs and WRKYs. bZIP factors need to heterodimerize for DNA-binding and regulation of transcription, and based on a bioinformatics approach, bZIPs can build up more than the double of protein interactions than WRKYs. In contrast, an enrichment of the WRKY DNA-binding motifs can be found in WRKY promoters, a phenomenon which is not observed for the bZIP family. Thus, the two transcription factor families follow two different functional strategies in which WRKYs regulate each other’s transcription in a transcriptional network whereas bZIP action relies on intensive heterodimerization.

  20. Valproic acid disrupts the oscillatory expression of core circadian rhythm transcription factors. (United States)

    Griggs, Chanel A; Malm, Scott W; Jaime-Frias, Rosa; Smith, Catharine L


    Valproic acid (VPA) is a well-established therapeutic used in treatment of seizure and mood disorders as well as migraines and a known hepatotoxicant. About 50% of VPA users experience metabolic disruptions, including weight gain, hyperlipidemia, and hyperinsulinemia, among others. Several of these metabolic abnormalities are similar to the effects of circadian rhythm disruption. In the current study, we examine the effect of VPA exposure on the expression of core circadian transcription factors that drive the circadian clock via a transcription-translation feedback loop. In cells with an unsynchronized clock, VPA simultaneously upregulated the expression of genes encoding core circadian transcription factors that regulate the positive and negative limbs of the feedback loop. Using low dose glucocorticoid, we synchronized cultured fibroblast cells to a circadian oscillatory pattern. Whether VPA was added at the time of synchronization or 12h later at CT12, we found that VPA disrupted the oscillatory expression of multiple genes encoding essential transcription factors that regulate circadian rhythm. Therefore, we conclude that VPA has a potent effect on the circadian rhythm transcription-translation feedback loop that may be linked to negative VPA side effects in humans. Furthermore, our study suggests potential chronopharmacology implications of VPA usage. Copyright © 2017. Published by Elsevier Inc.

  1. Development of DNA affinity techniques for the functional characterization of purified RNA polymerase II transcription factors

    International Nuclear Information System (INIS)

    Garfinkel, S.; Thompson, J.A.; Cohen, R.B.; Brendler, T.; Safer, B.


    Affinity adsorption, precipitation, and partitioning techniques have been developed to purify and characterize RNA Pol II transcription components from whole cell extracts (WCE) (HeLa) and nuclear extracts (K562). The titration of these extracts with multicopy constructs of the Ad2 MLP but not pUC8, inhibits transcriptional activity. DNA-binding factors precipitated by this technique are greatly enriched by centrifugation. Using this approach, factors binding to the upstream promoter sequence (UPS) of the Ad2 MLP have been rapidly isolated by Mono Q, Mono S, and DNA affinity chromatography. By U.V. crosslinking to nucleotides containing specific 32 P-phosphodiester bonds within the recognition sequence, this factor is identified as a M/sub r/ = 45,000 polypeptide. To generate an assay system for the functional evaluation of single transcription components, a similar approach using synthetic oligonucleotide sequences spanning single promoter binding sites has been developed. The addition of a synthetic 63-mer containing the UPS element of the Ad2 MLP to HeLa WCE inhibited transcription by 60%. The addition of partially purified UPS binding protein, but not RNA Pol II, restored transcriptional activity. The addition of synthetic oligonucleotides containing other regulatory sequences not present in the Ad2 MLP was without effect

  2. Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias. (United States)

    Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F


    The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.

  3. Transcription factor FoxO1 is essential for enamel biomineralization.

    Directory of Open Access Journals (Sweden)

    Ross A Poché

    Full Text Available The Transforming growth factor β (Tgf-β pathway, by signaling via the activation of Smad transcription factors, induces the expression of many diverse downstream target genes thereby regulating a vast array of cellular events essential for proper development and homeostasis. In order for a specific cell type to properly interpret the Tgf-β signal and elicit a specific cellular response, cell-specific transcriptional co-factors often cooperate with the Smads to activate a discrete set of genes in the appropriate temporal and spatial manner. Here, via a conditional knockout approach, we show that mice mutant for Forkhead Box O transcription factor FoxO1 exhibit an enamel hypomaturation defect which phenocopies that of the Smad3 mutant mice. Furthermore, we determined that both the FoxO1 and Smad3 mutant teeth exhibit changes in the expression of similar cohort of genes encoding enamel matrix proteins required for proper enamel development. These data raise the possibility that FoxO1 and Smad3 act in concert to regulate a common repertoire of genes necessary for complete enamel maturation. This study is the first to define an essential role for the FoxO family of transcription factors in tooth development and provides a new molecular entry point which will allow researchers to delineate novel genetic pathways regulating the process of biomineralization which may also have significance for studies of human tooth diseases such as amelogenesis imperfecta.

  4. Genetic Variants in Transcription Factors Are Associated With the Pharmacokinetics and Pharmacodynamics of Metformin (United States)

    Goswami, S; Yee, SW; Stocker, S; Mosley, JD; Kubo, M; Castro, R; Mefford, JA; Wen, C; Liang, X; Witte, J; Brett, C; Maeda, S; Simpson, MD; Hedderson, MM; Davis, RL; Roden, DM; Giacomini, KM; Savic, RM


    One-third of type 2 diabetes patients do not respond to metformin. Genetic variants in metformin transporters have been extensively studied as a likely contributor to this high failure rate. Here, we investigate, for the first time, the effect of genetic variants in transcription factors on metformin pharmacokinetics (PK) and response. Overall, 546 patients and healthy volunteers contributed their genome-wide, pharmacokinetic (235 subjects), and HbA1c data (440 patients) for this analysis. Five variants in specificity protein 1 (SP1), a transcription factor that modulates the expression of metformin transporters, were associated with changes in treatment HbA1c (P < 0.01) and metformin secretory clearance (P < 0.05). Population pharmacokinetic modeling further confirmed a 24% reduction in apparent clearance in homozygous carriers of one such variant, rs784888. Genetic variants in other transcription factors, peroxisome proliferator–activated receptor-α and hepatocyte nuclear factor 4-α, were significantly associated with HbA1c change only. Overall, our study highlights the importance of genetic variants in transcription factors as modulators of metformin PK and response. PMID:24853734

  5. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43. (United States)

    Hurst, H C; Masson, N; Jones, N C; Lee, K A


    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.

  6. Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease. (United States)

    Xue, Gongda; Hemmings, Brian A


    The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

  7. Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB. (United States)

    Magill, C P; Jackson, S P; Bell, S D


    Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

  8. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DEFF Research Database (Denmark)

    Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather


    regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

  9. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors. (United States)

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F


    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  10. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra


    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  11. Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors. (United States)

    Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha


    The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

  12. The Transcription Factor STAT6 Mediates Direct Repression of Inflammatory Enhancers and Limits Activation of Alternatively Polarized Macrophages


    Czimmerer, Zsolt; Daniel, Bence; Horvath, Attila; Rückerl, Dominik; Nagy, Gergely; Kiss, Mate; Peloquin, Matthew; Budai, Marietta M.; Cuaranta-Monroy, Ixchelt; Simandi, Zoltan; Steiner, Laszlo; Nagy, Bela; Poliska, Szilard; Banko, Csaba; Bacso, Zsolt


    Summary The molecular basis of signal-dependent transcriptional activation has been extensively studied in macrophage polarization, but our understanding remains limited regarding the molecular determinants of repression. Here we show that IL-4-activated STAT6 transcription factor is required for the direct transcriptional repression of a large number of genes during in vitro and in vivo alternative macrophage polarization. Repression results in decreased lineage-determining transcription fac...

  13. Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes

    KAUST Repository

    Piatek, Marek J.


    Background:Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.Results:Based on experimentally validated interactions between human TFs with different TFs, TcoFs and other nuclear proteins, our two classification systems (implemented as a web-based application) achieve high accuracies in distinguishing TFs and TcoFs from other nuclear proteins, and TFs from TcoFs respectively.Conclusion:As demonstrated, given the fact that two proteins are capable of forming direct physical interactions and using only information about their sequence composition, we have developed a completely new method for predicting a functional class of TF interacting protein partners

  14. Exploring cellular memory molecules marking competent and active transcriptions

    Directory of Open Access Journals (Sweden)

    Liu De-Pei


    Full Text Available Abstract Background Development in higher eukaryotes involves programmed gene expression. Cell type-specific gene expression is established during this process and is inherited in succeeding cell cycles. Higher eukaryotes have evolved elegant mechanisms by which committed gene-expression states are transmitted through numerous cell divisions. Previous studies have shown that both DNase I-sensitive sites and the basal transcription factor TFIID remain on silenced mitotic chromosomes, suggesting that certain trans-factors might act as bookmarks, maintaining the information and transmitting it to the next generation. Results We used the mouse globin gene clusters as a model system to examine the retention of active information on M-phase chromosomes and its contribution to the persistence of transcriptional competence of these gene clusters in murine erythroleukemia cells. In cells arrested in mitosis, the erythroid-specific activator NF-E2p45 remained associated with its binding sites on the globin gene loci, while the other major erythroid factor, GATA-1, was removed from chromosome. Moreover, despite mitotic chromatin condensation, the distant regulatory regions and promoters of transcriptionally competent globin gene loci are marked by a preserved histone code consisting in active histone modifications such as H3 acetylation, H3-K4 dimethylation and K79 dimethylation. Further analysis showed that other active genes are also locally marked by the preserved active histone code throughout mitotic inactivation of transcription. Conclusion Our results imply that certain kinds of specific protein factors and active histone modifications function as cellular memory markers for both competent and active genes during mitosis, and serve as a reactivated core for the resumption of transcription when the cells exit mitosis.

  15. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors. (United States)

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel


    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  16. A network of paralogous stress response transcription factors in the human pathogen Candida glabrata.

    Directory of Open Access Journals (Sweden)

    Jawad eMerhej


    Full Text Available The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq, transcriptome analyses and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1 transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption and iron metabolism.

  17. The transcription fidelity factor GreA impedes DNA break repair. (United States)

    Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe


    Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

  18. Undifferentiated Embryonic Cell Transcription Factor 1 Regulates ESC Chromatin Organization and Gene Expression

    NARCIS (Netherlands)

    Kooistra, Susanne M.; van den Boom, Vincent; Thummer, Rajkumar P.; Johannes, Frank; Wardenaar, Rene; Tesson, Bruno M.; Veenhoff, Liesbeth M.; Fusetti, Fabrizia; O'Neill, Laura P.; Turner, Bryan M.; de Haan, Gerald; Eggen, Bart J. L.; O’Neill, Laura P.


    Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES

  19. Functional analysis of jasmonate-responsive transcription factors in Arabidopsis thaliana

    NARCIS (Netherlands)

    Zarei, Adel


    The aim of the studies described in this thesis was the functional analysis of JA-responsive transcription factors in Arabidopsis with an emphasis on the interaction with the promoters of their target genes. In short, the following new results were obtained. The promoter of the PDF1.2 gene contains

  20. The strategy of fusion genes construction determines efficient expression of introduced transcription factors. (United States)

    Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin


    The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

  1. Reprogramming of metabolism by the Arabidopsis thaliana bZIP11 transcription factor

    NARCIS (Netherlands)

    Ma, J.


    The Arabidopsis bZIP11 transcription factor is known to regulate amino acid metabolism, and transcriptomic analysis suggests that bZIP11 has a broader regulatory effects in metabolism. Moreover, sucrose controls its translation via its uORF and all the available evidences point to the fact that

  2. Potential roles of WRKY transcription factors in resistance to Aspergillus flavus colonization of immature maize kernels (United States)

    Resistance to Aspergillus flavus by maize (Zea mays L.) is mediated by several defense proteins; however the mechanism regulating the expression of these defenses is poorly understood. This study examined the potential roles of six maize WRKY transcription factors, ZmWRKY19, ZmWRKY21, ZmWRKY53, ZmW...

  3. Evolutionary history of Arecaccea tribe Cocoseae inferred from seven WRKY transcription factors (United States)

    The Cocoseae is one of 13 tribes of Arecaceae subfam. Arecoideae, and contains a number of palms with significant economic importance, including the monotypic and pantropical Cocos nucifera, the coconut, and African oil palm (Elaeis guineensis). Using seven single copy WRKY transcription factor gen...

  4. Cross activity of orthologous WRKY transcription factors in wheat and Arabidopsis

    NARCIS (Netherlands)

    Poietti, S.; Bertini, L.; Ent, S. van der; Leon Reyes, H.A.; Pieterse, C.M.J.; Tucci, M.; Caporale, C.; Caruso, C.


    WRKY proteins are transcription factors involved in many plant processes including plant responses to pathogens. Here, the cross activity of TaWRKY78 from the monocot wheat and AtWRKY20 from the dicot Arabidopsis on the cognate promoters of the orthologous PR4-type genes wPR4e and AtHEL of wheat and

  5. DOT/FAA Human Factors Workshop on Aviation (6th). Transcript. (United States)


    This document is a verbatim transcript of the proceedings of the DOT/FAA Sixth Human Factors Workshop on Aviation held at the Mike Monroney Aeronautical Center, Oklahoma City, Oklahoma on July 7-8, 1981. The subject of the workshop was aviation maint...

  6. Structural and functional studies on the pituitary-specific transcription factor Pit-1

    NARCIS (Netherlands)

    Augustijn, K.D.


    Pit-1 is a pituitary specific transcription factor that plays a central role in the development and maintenance of a number of cell lineages in the anterior pituitary gland. In these cell lineages, Pit-1 is required for the selective expression of the growth hormone (GH), prolactin (PRL) and the

  7. Genome-wide strategies identify downstream target genes of chick connective tissue-associated transcription factors. (United States)

    Orgeur, Mickael; Martens, Marvin; Leonte, Georgeta; Nassari, Sonya; Bonnin, Marie-Ange; Börno, Stefan T; Timmermann, Bernd; Hecht, Jochen; Duprez, Delphine; Stricker, Sigmar


    Connective tissues support organs and play crucial roles in development, homeostasis and fibrosis, yet our understanding of their formation is still limited. To gain insight into the molecular mechanisms of connective tissue specification, we selected five zinc-finger transcription factors - OSR1, OSR2, EGR1, KLF2 and KLF4 - based on their expression patterns and/or known involvement in connective tissue subtype differentiation. RNA-seq and ChIP-seq profiling of chick limb micromass cultures revealed a set of common genes regulated by all five transcription factors, which we describe as a connective tissue core expression set. This common core was enriched with genes associated with axon guidance and myofibroblast signature, including fibrosis-related genes. In addition, each transcription factor regulated a specific set of signalling molecules and extracellular matrix components. This suggests a concept whereby local molecular niches can be created by the expression of specific transcription factors impinging on the specification of local microenvironments. The regulatory network established here identifies common and distinct molecular signatures of limb connective tissue subtypes, provides novel insight into the signalling pathways governing connective tissue specification, and serves as a resource for connective tissue development. © 2018. Published by The Company of Biologists Ltd.

  8. Forkhead-box transcription factors and their role in the immune system

    NARCIS (Netherlands)

    Coffer, PJ; Burgering, BMT


    It is more than a decade since the discovery of the first forkhead-box (FOX) transcription factor in the fruit fly Drosophila melanogaster. In the intervening time, there has been an explosion in the identification and characterization of members of this family of proteins. Importantly, in the past

  9. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Hidalgo, Cecilia [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Lavandero, Sergio, E-mail: [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile)


    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal {alpha}-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  10. Shared control of gene expression in bacteria by transcription factors and global physiology of the cell.

    NARCIS (Netherlands)

    Berthoumieux, S.; Jong, H. de; Baptist, G.; Pinel, C.; Ranquet, C.; Ropers, D.; Geiselmann, J.


    Gene expression is controlled by the joint effect of (i) the global physiological state of the cell, in particular the activity of the gene expression machinery, and (ii) DNA-binding transcription factors and other specific regulators. We present a model-based approach to distinguish between these

  11. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    International Nuclear Information System (INIS)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo; Hidalgo, Cecilia; Lavandero, Sergio


    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal α-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  12. Heat shock transcription factors regulate heat induced cell death in a ...

    Indian Academy of Sciences (India)


    Mar 29, 2007 ... Heat shock transcription factors regulate heat induced cell death in a rat ... the synthesis of heat shock proteins (Hsps) which is strictly regulated by ... The lack of Hsp synthesis in these cells was due to a failure in HSF1 DNA ...

  13. JUNGBRUNNEN1, a Reactive Oxygen Species–Responsive NAC Transcription Factor, Regulates Longevity in Arabidopsis

    NARCIS (Netherlands)

    Wu, A.; Devi Allu, A.; Garapati, P.; Siddiqui, H.; Dortay, H.; Zanor, M.I.; Amparo Asensi-Fabado, M.; Munne´ -Bosch, S.; Antonio, C.; Tohge, T.; Fernie, A.R.; Kaufmann, K.; Xue, G.P.; Mueller-Roeber, B.; Balazadeh, S.


    The transition from juvenility through maturation to senescence is a complex process that involves the regulation of longevity. Here, we identify JUNGBRUNNEN1 (JUB1), a hydrogen peroxide (H2O2)-induced NAC transcription factor, as a central longevity regulator in Arabidopsis thaliana. JUB1

  14. Sparse Non-negative Matrix Factor 2-D Deconvolution for Automatic Transcription of Polyphonic Music

    DEFF Research Database (Denmark)

    Schmidt, Mikkel N.; Mørup, Morten


    We present a novel method for automatic transcription of polyphonic music based on a recently published algorithm for non-negative matrix factor 2-D deconvolution. The method works by simultaneously estimating a time-frequency model for an instrument and a pattern corresponding to the notes which...... are played based on a log-frequency spectrogram of the music....

  15. Transcription factor 7-like 2 gene links increased in vivo insulin synthesis to type 2 diabetes

    NARCIS (Netherlands)

    S. Jainandunsing (Sjaam); Koole, H.R. (H. Rita); van Miert, J.N.I. (Joram N.I.); T. Rietveld (Trinet); J.L.D. Wattimena (Josias); E.J.G. Sijbrands (Eric); F.W.M. de Rooij (Felix)


    textabstractTranscription factor 7-like 2 (TCF7L2) is the main susceptibility gene for type 2 diabetes, primarily through impairing the insulin secretion by pancreatic β cells. However, the exact in vivo mechanisms remain poorly understood. We performed a family study and determined if the T risk

  16. Aluminum resistance transcription factor 1 (ART1) contributes to natural variation in rice aluminum resistance (United States)

    Transcription factors (TFs) mediate stress resistance indirectly via physiological mechanisms driven by the array of genes they regulate. Therefore, when studying TF-mediated stress resistance, it is important to understand how TFs interact with different genetic backgrounds. Here, we fine-mapped th...

  17. Transcription factor ZNF25 is associated with osteoblast differentiation of human skeletal stem cells

    DEFF Research Database (Denmark)

    Twine, Natalie A.; Harkness, Linda; Kassem, Moustapha


    containing G protein-coupled receptor 5 and RAN-binding protein 3-like. We also observed enrichment in extracellular matrix organization, skeletal system development and regulation of ossification in the entire upregulated set of genes. Consistent with its function as a transcription factor during osteoblast...

  18. IRF8 Transcription-Factor-Dependent Classical Dendritic Cells Are Essential for Intestinal T Cell Homeostasis

    DEFF Research Database (Denmark)

    Luda, Katarzyna M.; Joeris, Thorsten; Persson, Emma K.


    The role of dendritic cells (DCs) in intestinal immune homeostasis remains incompletely defined. Here we show that mice lacking IRF8 transcription-factor-dependent DCs had reduced numbers of T cells in the small intestine (SI), but not large intestine (LI), including an almost complete absence...... dependent DCs in the maintenance of intestinal T cell homeostasis....

  19. Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity. (United States)

    Finley, Lydia W S; Vardhana, Santosha A; Carey, Bryce W; Alonso-Curbelo, Direna; Koche, Richard; Chen, Yanyang; Wen, Duancheng; King, Bryan; Radler, Megan R; Rafii, Shahin; Lowe, Scott W; Allis, C David; Thompson, Craig B


    A robust network of transcription factors and an open chromatin landscape are hallmarks of the naive pluripotent state. Recently, the acetyllysine reader Brd4 has been implicated in stem cell maintenance, but the relative contribution of Brd4 to pluripotency remains unclear. Here, we show that Brd4 is dispensable for self-renewal and pluripotency of embryonic stem cells (ESCs). When maintained in their ground state, ESCs retain transcription factor binding and chromatin accessibility independent of Brd4 function or expression. In metastable ESCs, Brd4 independence can be achieved by increased expression of pluripotency transcription factors, including STAT3, Nanog or Klf4, so long as the DNA methylcytosine oxidases Tet1 and Tet2 are present. These data reveal that Brd4 is not essential for ESC self-renewal. Rather, the levels of pluripotency transcription factor abundance and Tet1/2 function determine the extent to which bromodomain recognition of protein acetylation contributes to the maintenance of gene expression and cell identity.

  20. A single gene target of an ETS-family transcription factor determines neuronal CO2-chemosensitivity

    DEFF Research Database (Denmark)

    Brandt, Julia P; Aziz-Zaman, Sonya; Juozaityte, Vaida


    . We report here a mechanism that endows C. elegans neurons with the ability to detect CO(2). The ETS-5 transcription factor is necessary for the specification of CO(2)-sensing BAG neurons. Expression of a single ETS-5 target gene, gcy-9, which encodes a receptor-type guanylate cyclase, is sufficient...

  1. The Transcription Factor Orthodenticle Homeobox 2 Influences Axonal Projections and Vulnerability of Midbrain Dopaminergic Neurons (United States)

    Chung, Chee Yeun; Licznerski, Pawel; Alavian, Kambiz N.; Simeone, Antonio; Lin, Zhicheng; Martin, Eden; Vance, Jeffery; Isacson, Ole


    Two adjacent groups of midbrain dopaminergic neurons, A9 (substantia nigra pars compacta) and A10 (ventral tegmental area), have distinct projections and exhibit differential vulnerability in Parkinson's disease. Little is known about transcription factors that influence midbrain dopaminergic subgroup phenotypes or their potential role in disease.…

  2. The Gata3 transcription factor is required for the survival of embryonic and adult sympathetic neurons

    NARCIS (Netherlands)

    K. Tsarovina (Konstantina); T. Reiff (Tobias); J. Stubbusch (Jutta); D. Kurek (Dorota); F.G. Grosveld (Frank); R. Parlato (Rosanna); G. Schütz (Günther); H. Rohrer (Hermann)


    textabstractThe transcription factor Gata3 is essential for the development of sympathetic neurons and adrenal chromaffin cells. As Gata3 expression is maintained up to the adult stage, we addressed its function in differentiated sympathoadrenal cells at embryonic and adult stages by conditional

  3. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators. (United States)

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane


    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  4. Nfatc1 Is a Functional Transcriptional Factor Mediating Nell-1-Induced Runx3 Upregulation in Chondrocytes

    Directory of Open Access Journals (Sweden)

    Chenshuang Li


    Full Text Available Neural EGFL like 1 (Nell-1 is essential for chondrogenic differentiation, maturation, and regeneration. Our previous studies have demonstrated that Nell-1’s pro-chondrogenic activities are predominantly reliant upon runt-related transcription factor 3 (Runx3-mediated Indian hedgehog (Ihh signaling. Here, we identify the nuclear factor of activated T-cells 1 (Nfatc1 as the key transcriptional factor mediating the Nell-1 → Runx3 signal transduction in chondrocytes. Using chromatin immunoprecipitation assay, we were able to determine that Nfatc1 binds to the −833–−810 region of the Runx3-promoter in response to Nell-1 treatment. By revealing the Nell-1 → Nfatc1 → Runx3 → Ihh cascade, we demonstrate the involvement of Nfatc1, a nuclear factor of activated T-cells, in chondrogenesis, while providing innovative insights into developing a novel therapeutic strategy for cartilage regeneration and other chondrogenesis-related conditions.

  5. Basic aspects of tumor cell fatty acid-regulated signaling and transcription factors. (United States)

    Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martín Ernesto; Pasqualini, Marìa Eugenia


    This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases, cyclooxygenases, and cytochrome P-450, seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator-activated receptors or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C) and other transcription factors (nuclear factor kappa B and sterol regulatory element binding protein). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer and provide insight into the development of new therapeutic strategies for a better management of whole body lipid metabolism.

  6. Transcriptome-wide identification of Camellia sinensis WRKY transcription factors in response to temperature stress. (United States)

    Wu, Zhi-Jun; Li, Xing-Hui; Liu, Zhi-Wei; Li, Hui; Wang, Yong-Xin; Zhuang, Jing


    Tea plant [Camellia sinensis (L.) O. Kuntze] is a leaf-type healthy non-alcoholic beverage crop, which has been widely introduced worldwide. Tea is rich in various secondary metabolites, which are important for human health. However, varied climate and complex geography have posed challenges for tea plant survival. The WRKY gene family in plants is a large transcription factor family that is involved in biological processes related to stress defenses, development, and metabolite synthesis. Therefore, identification and analysis of WRKY family transcription factors in tea plant have a profound significance. In the present study, 50 putative C. sinensis WRKY proteins (CsWRKYs) with complete WRKY domain were identified and divided into three Groups (Group I-III) on the basis of phylogenetic analysis results. The distribution of WRKY family transcription factors among plantae, fungi, and protozoa showed that the number of WRKY genes increased in higher plant, whereas the number of these genes did not correspond to the evolutionary relationships of different species. Structural feature and annotation analysis results showed that CsWRKY proteins contained WRKYGQK/WRKYGKK domains and C2H2/C2HC-type zinc-finger structure: D-X18-R-X1-Y-X2-C-X4-7-C-X23-H motif; CsWRKY proteins may be associated with the biological processes of abiotic and biotic stresses, tissue development, and hormone and secondary metabolite biosynthesis. Temperature stresses suggested that the candidate CsWRKY genes were involved in responses to extreme temperatures. The current study established an extensive overview of the WRKY family transcription factors in tea plant. This study also provided a global survey of CsWRKY transcription factors and a foundation of future functional identification and molecular breeding.

  7. Elk3 from hamster-a ternary complex factor with strong transcriptional repressor activity

    DEFF Research Database (Denmark)

    Hjortoe, G.M.; Weilguny, D.; Willumsen, Berthe Marie


    the transcription of genes that are activated during entry into G1. We have isolated the Cricetulus griseus Elk3 gene from the Chinese hamster ovary (CHO) cell line and investigated the transcriptional potential of this factor. Transient transfections revealed that, in addition to its regulation of the c......-fos promoter, Elk3 from CHO cells seems to inhibit other promoters controlling expression of proteins involved in G1/S phase progression; Cyclin D1 and DHFR. As has been described for the Elk3 homologs Net (Mouse) and Sap-2 (Human), the results of the present study further indicate that hamster Elk3...

  8. Identification of additional genes under the control of the transcription factor sigma F of Bacillus subtilis.


    Decatur, A; Losick, R


    We describe the identification of five transcriptional units under the control of the sporulation transcription factor sigma F in Bacillus subtilis. These are csfA, csfB, csfC, csfD, and csfF, located at approximately 230 degrees, 2 degrees, 316 degrees, 205 degrees, and approximately 290 degrees, respectively, on the genetic map. Null mutations in csfA, csfB, csfC, or csfD, either alone or together, do not cause a noticeable defect in sporulation or germination.

  9. Protein intrinsic disorder in Arabidopsis NAC transcription factors

    DEFF Research Database (Denmark)

    O'Shea, Charlotte; Jensen, Mikael Kryger; Stender, Emil G.P.


    of differences in binding mechanisms. Although substitution of both hydrophobic and acidic residues of the ANAC046 MoRF region abolished binding, substitution of other residues, even with α-helix-breaking proline, was less disruptive. Together, the biophysical analyses suggest that RCD1-ANAC046 complex formation......Protein ID (intrinsic disorder) plays a significant, yet relatively unexplored role in transcription factors (TFs). In the present paper, analysis of the transcription regulatory domains (TRDs) of six phylogenetically representative, plant-specific NAC [no apical meristem, ATAF (Arabidopsis...

  10. Mga2 transcription factor regulates an oxygen-responsive lipid homeostasis pathway in fission yeast

    DEFF Research Database (Denmark)

    Burr, Risa; Stewart, Emerson V; Shao, Wei


    -binding protein (SREBP) transcription factors regulate lipid homeostasis. In mammals, SREBP-2 controls cholesterol biosynthesis, whereas SREBP-1 controls triacylglycerol and glycerophospholipid biosynthesis. In the fission yeast Schizosaccharomyces pombe, the SREBP-2 homolog Sre1 regulates sterol homeostasis....... In the absence of mga2, fission yeast exhibited growth defects under both normoxia and low oxygen conditions. Mga2 transcriptional targets were enriched for lipid metabolism genes, and mga2Δ cells showed disrupted triacylglycerol and glycerophospholipid homeostasis, most notably with an increase in fatty acid...

  11. Temporal regulation of Drosophila salivary gland degeneration by the Broad-Complex transcription factors

    Czech Academy of Sciences Publication Activity Database

    Kuchárová-Mahmood, S.; Raška, Ivan; Mechler, B. M.; Farkaš, R.


    Roč. 140, - (2002), s. 67-78 ISSN 1047-8477 R&D Projects: GA ČR GA304/02/0342 Grant - others:GA-(SK) VEGA:2/7194/20 Institutional research plan: CEZ:AV0Z5039906; CEZ:MSM 111100003 Keywords : programmed cell death * BR-C transcription factors * drosophila Subject RIV: EA - Cell Biology Impact factor: 4.194, year: 2002

  12. Hierarchical role for transcription factors and chromatin structure in genome organization along adipogenesis

    DEFF Research Database (Denmark)

    Sarusi Portuguez, Avital; Schwartz, Michal; Siersbaek, Rasmus


    The three dimensional folding of mammalian genomes is cell type specific and difficult to alter suggesting that it is an important component of gene regulation. However, given the multitude of chromatin-associating factors, the mechanisms driving the colocalization of active chromosomal domains...... by PPARγ and Lpin1, undergoes orchestrated reorganization during adipogenesis. Coupling the dynamics of genome architecture with multiple chromatin datasets indicated that among all the transcription factors (TFs) tested, RXR is central to genome reorganization at the beginning of adipogenesis...

  13. Three WRKY transcription factors additively repress abscisic acid and gibberellin signaling in aleurone cells. (United States)

    Zhang, Liyuan; Gu, Lingkun; Ringler, Patricia; Smith, Stanley; Rushton, Paul J; Shen, Qingxi J


    Members of the WRKY transcription factor superfamily are essential for the regulation of many plant pathways. Functional redundancy due to duplications of WRKY transcription factors, however, complicates genetic analysis by allowing single-mutant plants to maintain wild-type phenotypes. Our analyses indicate that three group I WRKY genes, OsWRKY24, -53, and -70, act in a partially redundant manner. All three showed characteristics of typical WRKY transcription factors: each localized to nuclei and yeast one-hybrid assays indicated that they all bind to W-boxes, including those present in their own promoters. Quantitative real time-PCR (qRT-PCR) analyses indicated that the expression levels of the three WRKY genes varied in the different tissues tested. Particle bombardment-mediated transient expression analyses indicated that all three genes repress the GA and ABA signaling in a dosage-dependent manner. Combination of all three WRKY genes showed additive antagonism of ABA and GA signaling. These results suggest that these WRKY proteins function as negative transcriptional regulators of GA and ABA signaling. However, different combinations of these WRKY genes can lead to varied strengths in suppression of their targets. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5. (United States)

    Nezich, Catherine L; Wang, Chunxin; Fogel, Adam I; Youle, Richard J


    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats-generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy.

  15. Eukaryotic Initiation Factor 4H Is under Transcriptional Control of p65/NF-κB (United States)

    Fiume, Giuseppe; Rossi, Annalisa; de Laurentiis, Annamaria; Falcone, Cristina; Pisano, Antonio; Vecchio, Eleonora; Pontoriero, Marilena; Scala, Iris; Scialdone, Annarita; Masci, Francesca Fasanella; Mimmi, Selena; Palmieri, Camillo; Scala, Giuseppe; Quinto, Ileana


    Protein synthesis is mainly regulated at the initiation step, allowing the fast, reversible and spatial control of gene expression. Initiation of protein synthesis requires at least 13 translation initiation factors to assemble the 80S ribosomal initiation complex. Loss of translation control may result in cell malignant transformation. Here, we asked whether translational initiation factors could be regulated by NF-κB transcription factor, a major regulator of genes involved in cell proliferation, survival, and inflammatory response. We show that the p65 subunit of NF-κB activates the transcription of eIF4H gene, which is the regulatory subunit of eIF4A, the most relevant RNA helicase in translation initiation. The p65-dependent transcriptional activation of eIF4H increased the eIF4H protein content augmenting the rate of global protein synthesis. In this context, our results provide novel insights into protein synthesis regulation in response to NF-κB activation signalling, suggesting a transcription-translation coupled mechanism of control. PMID:23776612

  16. Histone Deacetylase Rpd3 Regulates Olfactory Projection Neuron Dendrite Targeting via the Transcription Factor Prospero (United States)

    Tea, Joy S.; Chihara, Takahiro; Luo, Liqun


    Compared to the mechanisms of axon guidance, relatively little is known about the transcriptional control of dendrite guidance. The Drosophila olfactory system with its stereotyped organization provides an excellent model to study the transcriptional control of dendrite wiring specificity. Each projection neuron (PN) targets its dendrites to a specific glomerulus in the antennal lobe and its axon stereotypically to higher brain centers. Using a forward genetic screen, we identified a mutation in Rpd3 that disrupts PN targeting specificity. Rpd3 encodes a class I histone deacetylase (HDAC) homologous to mammalian HDAC1 and HDAC2. Rpd3−/− PN dendrites that normally target to a dorsolateral glomerulus mistarget to medial glomeruli in the antennal lobe, and axons exhibit a severe overbranching phenotype. These phenotypes can be rescued by postmitotic expression of Rpd3 but not HDAC3, the only other class I HDAC in Drosophila. Furthermore, disruption of the atypical homeodomain transcription factor Prospero (Pros) yields similar phenotypes, which can be rescued by Pros expression in postmitotic neurons. Strikingly, overexpression of Pros can suppress Rpd3−/− phenotypes. Our study suggests a specific function for the general chromatin remodeling factor Rpd3 in regulating dendrite targeting in neurons, largely through the postmitotic action of the Pros transcription factor. PMID:20660276

  17. NF-κB Transcription Factor Role in Consolidation and Reconsolidation of Persistent Memories

    Directory of Open Access Journals (Sweden)

    Verónica ede la Fuente


    Full Text Available Transcriptional regulation is an important molecular process required for long-term neural plasticity and long-term memory formation. Thus, one main interest in molecular neuroscience in the last decades has been the identification of transcription factors that are involved in memory processes. Among them, the NF-κB family of transcription factors has gained interest due to a significant body of evidence that supports a key role of these proteins in synaptic plasticity and memory. In recent years, the interest was particularly reinforced because NF-κB was characterized as an important regulator of synaptogenesis. This function may be explained by its participation in synapse to nucleus communication, as well as a possible local role at the synapse. This review provides an overview of experimental work obtained in the last years, showing the essential role of this transcription factor in memory processes in different learning tasks in mammals. We focus the review on the consolidation and reconsolidation memory phases as well as on the regulation of immediate-early and late genes by epigenetic mechanisms that determine enduring forms of memories.

  18. Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression. (United States)

    Kabadi, Ami M; Gersbach, Charles A


    Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Embryonic maturation of epidermal Merkel cells is controlled by a redundant transcription factor network. (United States)

    Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena


    Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.

  20. The Arabidopsis transcription factor ABIG1 relays ABA signaled growth inhibition and drought induced senescence. (United States)

    Liu, Tie; Longhurst, Adam D; Talavera-Rauh, Franklin; Hokin, Samuel A; Barton, M Kathryn


    Drought inhibits plant growth and can also induce premature senescence. Here we identify a transcription factor, ABA INSENSITIVE GROWTH 1 (ABIG1) required for abscisic acid (ABA) mediated growth inhibition, but not for stomatal closure. ABIG1 mRNA levels are increased both in response to drought and in response to ABA treatment. When treated with ABA, abig1 mutants remain greener and produce more leaves than comparable wild-type plants. When challenged with drought, abig1 mutants have fewer yellow, senesced leaves than wild-type. Induction of ABIG1 transcription mimics ABA treatment and regulates a set of genes implicated in stress responses. We propose a model in which drought acts through ABA to increase ABIG1 transcription which in turn restricts new shoot growth and promotes leaf senescence. The results have implications for plant breeding: the existence of a mutant that is both ABA resistant and drought resistant points to new strategies for isolating drought resistant genetic varieties.

  1. A Systematic Approach to Identify Candidate Transcription Factors that Control Cell Identity

    Directory of Open Access Journals (Sweden)

    Ana C. D’Alessio


    Full Text Available Hundreds of transcription factors (TFs are expressed in each cell type, but cell identity can be induced through the activity of just a small number of core TFs. Systematic identification of these core TFs for a wide variety of cell types is currently lacking and would establish a foundation for understanding the transcriptional control of cell identity in development, disease, and cell-based therapy. Here, we describe a computational approach that generates an atlas of candidate core TFs for a broad spectrum of human cells. The potential impact of the atlas was demonstrated via cellular reprogramming efforts where candidate core TFs proved capable of converting human fibroblasts to retinal pigment epithelial-like cells. These results suggest that candidate core TFs from the atlas will prove a useful starting point for studying transcriptional control of cell identity and reprogramming in many human cell types.

  2. Genome-wide identification of the regulatory targets of a transcription factor using biochemical characterization and computational genomic analysis

    Directory of Open Access Journals (Sweden)

    Jolly Emmitt R


    Full Text Available Abstract Background A major challenge in computational genomics is the development of methodologies that allow accurate genome-wide prediction of the regulatory targets of a transcription factor. We present a method for target identification that combines experimental characterization of binding requirements with computational genomic analysis. Results Our method identified potential target genes of the transcription factor Ndt80, a key transcriptional regulator involved in yeast sporulation, using the combined information of binding affinity, positional distribution, and conservation of the binding sites across multiple species. We have also developed a mathematical approach to compute the false positive rate and the total number of targets in the genome based on the multiple selection criteria. Conclusion We have shown that combining biochemical characterization and computational genomic analysis leads to accurate identification of the genome-wide targets of a transcription factor. The method can be extended to other transcription factors and can complement other genomic approaches to transcriptional regulation.

  3. Enhanced somatic embryogenesis in Theobroma cacao using the homologous BABY BOOM transcription factor. (United States)

    Florez, Sergio L; Erwin, Rachel L; Maximova, Siela N; Guiltinan, Mark J; Curtis, Wayne R


    Theobroma cacao, the chocolate tree, is an important economic crop in East Africa, South East Asia, and South and Central America. Propagation of elite varieties has been achieved through somatic embryogenesis (SE) but low efficiencies and genotype dependence still presents a significant limitation for its propagation at commercial scales. Manipulation of transcription factors has been used to enhance the formation of SEs in several other plant species. This work describes the use of the transcription factor Baby Boom (BBM) to promote the transition of somatic cacao cells from the vegetative to embryonic state. An ortholog of the Arabidopsis thaliana BBM gene (AtBBM) was characterized in T. cacao (TcBBM). TcBBM expression was observed throughout embryo development and was expressed at higher levels during SE as compared to zygotic embryogenesis (ZE). TcBBM overexpression in A. thaliana and T. cacao led to phenotypes associated with SE that did not require exogenous hormones. While transient ectopic expression of TcBBM provided only moderate enhancements in embryogenic potential, constitutive overexpression dramatically increased SE proliferation but also appeared to inhibit subsequent development. Our work provides validation that TcBBM is an ortholog to AtBBM and has a specific role in both somatic and zygotic embryogenesis. Furthermore, our studies revealed that TcBBM transcript levels could serve as a biomarker for embryogenesis in cacao tissue. Results from transient expression of TcBBM provide confirmation that transcription factors can be used to enhance SE without compromising plant development and avoiding GMO plant production. This strategy could compliment a hormone-based method of reprogramming somatic cells and lead to more precise manipulation of SE at the regulatory level of transcription factors. The technology would benefit the propagation of elite varieties with low regeneration potential as well as the production of transgenic plants, which

  4. Biological effects of tolerable level chronic boron intake on transcription factors. (United States)

    Orenay Boyacioglu, Seda; Korkmaz, Mehmet; Kahraman, Erkan; Yildirim, Hatice; Bora, Selin; Ataman, Osman Yavuz


    The mechanism of boron effect on human transcription and translation has not been fully understood. In the current study it was aimed to reveal the role of boron on the expression of certain transcription factors that play key roles in many cellular pathways on human subjects chronically exposed to low amounts of boron. The boron concentrations in drinking water samples were 1.57±0.06mg/l for boron group while the corresponding value for the control group was 0.016±0.002mg/l. RNA isolation was performed using PAX gene RNA kit on the blood samples from the subjects. The RNA was then reverse transcribed into cDNA and analyzed using the Human Transcription Factors RT 2 Profiler™ PCR Arrays. While the boron amount in urine was detected as 3.56±1.47mg/day in the boron group, it was 0.72±0.30mg/day in the control group. Daily boron intake of the boron and control groups were calculated to be 6.98±3.39 and 1.18±0.41mg/day, respectively. The expression levels of the transcription factor genes were compared between the boron and control groups and no statistically significant difference was detected (P>0.05). The data suggest that boron intake at 6.98±3.39mg/day, which is the dose at which beneficial effects might be seen, does not result in toxicity at molecular level since the expression levels of transcription factors are not changed. Although boron intake over this level will seem to increase RNA synthesis, further examination of the topic is needed using new molecular epidemiological data. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Identification of a transcription factor controlling pH-dependent organic acid response in Aspergillus niger.

    Directory of Open Access Journals (Sweden)

    Lars Poulsen

    Full Text Available Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0. Transcriptional profiles showed that 241 genes were differentially expressed due to the deletion of oafA and this supported the argument of OafA being a trans-acting transcription factor. Furthermore, expression of two phosphoketolases was down-regulated in the ΔoafA mutant, one of which has not previously been described in fungi. It was argued that the observed oxalate overproducing phenotype was a consequence of the efficient re-uptake of gluconic acid and thereby a higher flux through glycolysis. This results in a lower flux through the pentose phosphate pathway, demonstrated by the down-regulation of the phosphoketolases. Finally, the physiological data, in terms of the specific oxygen consumption, indicated a connection between the oxidative phosphorylation and oxalate production and this was further substantiated through transcription analysis.

  6. Sequence motifs in MADS transcription factors responsible for specificity and diversification of protein-protein interaction.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Protein sequences encompass tertiary structures and contain information about specific molecular interactions, which in turn determine biological functions of proteins. Knowledge about how protein sequences define interaction specificity is largely missing, in particular for paralogous protein families with high sequence similarity, such as the plant MADS domain transcription factor family. In comparison to the situation in mammalian species, this important family of transcription regulators has expanded enormously in plant species and contains over 100 members in the model plant species Arabidopsis thaliana. Here, we provide insight into the mechanisms that determine protein-protein interaction specificity for the Arabidopsis MADS domain transcription factor family, using an integrated computational and experimental approach. Plant MADS proteins have highly similar amino acid sequences, but their dimerization patterns vary substantially. Our computational analysis uncovered small sequence regions that explain observed differences in dimerization patterns with reasonable accuracy. Furthermore, we show the usefulness of the method for prediction of MADS domain transcription factor interaction networks in other plant species. Introduction of mutations in the predicted interaction motifs demonstrated that single amino acid mutations can have a large effect and lead to loss or gain of specific interactions. In addition, various performed bioinformatics analyses shed light on the way evolution has shaped MADS domain transcription factor interaction specificity. Identified protein-protein interaction motifs appeared to be strongly conserved among orthologs, indicating their evolutionary importance. We also provide evidence that mutations in these motifs can be a source for sub- or neo-functionalization. The analyses presented here take us a step forward in understanding protein-protein interactions and the interplay between protein sequences and

  7. Capsella rubella TGA4, a bZIP transcription factor, causes delayed flowering in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Li Maofu


    Full Text Available Flowering time is usually regulated by many environmental factors and endogenous signals. TGA family members are bZIP transcription factors that bind to the octopine synthase element, which has been closely linked to defense/stress responses. Most TGA factors interact with non-expressor of PR1 (NPR1 and plant defense responses are strengthened by this interaction. TGA1and TGA4factors bind to NPR1 only in salicylic acid (SA-induced leaves, suggesting that TGA4 has another function during plant development. Here, we isolated a bZIP transcription factor gene, TGA4, from Capsella rubella. TGA4transcripts were detected in most tissues, with high expression in leaves, low expression in stems and flowering buds, and undetectable in siliques. CruTGA4was over expressed in Arabidopsis thaliana wild typeCol-0 plants. Flowering time and total leaf number in the transgenic plants showed that overexpression of CruTGA4could delay flowering in A. thaliana. Our findings suggest that TGA4 may act as flowering regulator that controls plant flowering.

  8. Occupancy classification of position weight matrix-inferred transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Hollis Wright

    Full Text Available BACKGROUND: Computational prediction of Transcription Factor Binding Sites (TFBS from sequence data alone is difficult and error-prone. Machine learning techniques utilizing additional environmental information about a predicted binding site (such as distances from the site to particular chromatin features to determine its occupancy/functionality class show promise as methods to achieve more accurate prediction of true TFBS in silico. We evaluate the Bayesian Network (BN and Support Vector Machine (SVM machine learning techniques on four distinct TFBS data sets and analyze their performance. We describe the features that are most useful for classification and contrast and compare these feature sets between the factors. RESULTS: Our results demonstrate good performance of classifiers both on TFBS for transcription factors used for initial training and for TFBS for other factors in cross-classification experiments. We find that distances to chromatin modifications (specifically, histone modification islands as well as distances between such modifications to be effective predictors of TFBS occupancy, though the impact of individual predictors is largely TF specific. In our experiments, Bayesian network classifiers outperform SVM classifiers. CONCLUSIONS: Our results demonstrate good performance of machine learning techniques on the problem of occupancy classification, and demonstrate that effective classification can be achieved using distances to chromatin features. We additionally demonstrate that cross-classification of TFBS is possible, suggesting the possibility of constructing a generalizable occupancy classifier capable of handling TFBS for many different transcription factors.

  9. Gene expression meta-analysis identifies metastatic pathways and transcription factors in breast cancer

    International Nuclear Information System (INIS)

    Thomassen, Mads; Tan, Qihua; Kruse, Torben A


    Metastasis is believed to progress in several steps including different pathways but the determination and understanding of these mechanisms is still fragmentary. Microarray analysis of gene expression patterns in breast tumors has been used to predict outcome in recent studies. Besides classification of outcome, these global expression patterns may reflect biological mechanisms involved in metastasis of breast cancer. Our purpose has been to investigate pathways and transcription factors involved in metastasis by use of gene expression data sets. We have analyzed 8 publicly available gene expression data sets. A global approach, 'gene set enrichment analysis' as well as an approach focusing on a subset of significantly differently regulated genes, GenMAPP, has been applied to rank pathway gene sets according to differential regulation in metastasizing tumors compared to non-metastasizing tumors. Meta-analysis has been used to determine overrepresentation of pathways and transcription factors targets, concordant deregulated in metastasizing breast tumors, in several data sets. The major findings are up-regulation of cell cycle pathways and a metabolic shift towards glucose metabolism reflected in several pathways in metastasizing tumors. Growth factor pathways seem to play dual roles; EGF and PDGF pathways are decreased, while VEGF and sex-hormone pathways are increased in tumors that metastasize. Furthermore, migration, proteasome, immune system, angiogenesis, DNA repair and several signal transduction pathways are associated to metastasis. Finally several transcription factors e.g. E2F, NFY, and YY1 are identified as being involved in metastasis. By pathway meta-analysis many biological mechanisms beyond major characteristics such as proliferation are identified. Transcription factor analysis identifies a number of key factors that support central pathways. Several previously proposed treatment targets are identified and several new pathways that may

  10. Arabidopsis R2R3-MYB transcription factor AtMYB60 functions as a transcriptional repressor of anthocyanin biosynthesis in lettuce (Lactuca sativa). (United States)

    Park, Jong-Sug; Kim, Jung-Bong; Cho, Kang-Jin; Cheon, Choong-Ill; Sung, Mi-Kyung; Choung, Myoung-Gun; Roh, Kyung-Hee


    The MYB transcription factors play important roles in the regulation of many secondary metabolites at the transcriptional level. We evaluated the possible roles of the Arabidopsis R2R3-MYB transcription factors in flavonoid biosynthesis because they are induced by UV-B irradiation but their associated phenotypes are largely unexplored. We isolated their genes by RACE-PCR, and performed transgenic approach and metabolite analyses in lettuce (Lactuca sativa). We found that one member of this protein family, AtMYB60, inhibits anthocyanin biosynthesis in the lettuce plant. Wild-type lettuce normally accumulates anthocyanin, predominantly cyanidin and traces of delphinidin, and develops a red pigmentation. However, the production and accumulation of anthocyanin pigments in AtMYB60-overexpressing lettuce was inhibited. Using RT-PCR analysis, we also identified the complete absence or reduction of dihydroflavonol 4-reductase (DFR) transcripts in AtMYB60- overexpressing lettuce (AtMYB60-117 and AtMYB60-112 lines). The correlation between the overexpression of AtMYB60 and the inhibition of anthocyanin accumulation suggests that the transcription factorAtMYB60 controls anthocyanin biosynthesis in the lettuce leaf. Clarification of the roles of the AtMYB60 transcription factor will facilitate further studies and provide genetic tools to better understand the regulation in plants of the genes controlled by the MYB-type transcription factors. Furthermore, the characterization of AtMYB60 has implications for the development of new varieties of lettuce and other commercially important plants with metabolic engineering approaches.

  11. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.


    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  12. Rice homeobox transcription factor HOX1a positively regulates gibberellin responses by directly suppressing EL1. (United States)

    Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei


    Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.

  13. Transcription factor Oct1 is a somatic and cancer stem cell determinant.

    Directory of Open Access Journals (Sweden)

    Jessica Maddox

    Full Text Available Defining master transcription factors governing somatic and cancer stem cell identity is an important goal. Here we show that the Oct4 paralog Oct1, a transcription factor implicated in stress responses, metabolic control, and poised transcription states, regulates normal and pathologic stem cell function. Oct1(HI cells in the colon and small intestine co-express known stem cell markers. In primary malignant tissue, high Oct1 protein but not mRNA levels strongly correlate with the frequency of CD24(LOCD44(HI cancer-initiating cells. Reducing Oct1 expression via RNAi reduces the proportion of ALDH(HI and dye efflux(HI cells, and increasing Oct1 increases the proportion of ALDH(HI cells. Normal ALDH(HI cells harbor elevated Oct1 protein but not mRNA levels. Functionally, we show that Oct1 promotes tumor engraftment frequency and promotes hematopoietic stem cell engraftment potential in competitive and serial transplants. In addition to previously described Oct1 transcriptional targets, we identify four Oct1 targets associated with the stem cell phenotype. Cumulatively, the data indicate that Oct1 regulates normal and cancer stem cell function.

  14. Microphthalmia-associated transcription factor (MITF – from Waardenburg syndrome genetics to melanoma therapy

    Directory of Open Access Journals (Sweden)

    Ivan Šamija


    Full Text Available Microphthalmia-associated transcription factor (MITF was first discovered as protein coded by gene whose mutations are associated with Waardenburg syndrome. Later, MITF was shown to be key transcription factor regulating melanogenesis. Further studies have shown that in addition to regulating melanogenesis MITF also plays central role in regulation of melanocyte development and survival. MITF gene is amplified in a proportion of melanomas and ectopic MITF expression can transform melanocytes so MITF can function as melanoma “lineage survival” oncogene. Different studies have further revealed MITF’s important but complex role in tumorigenesis and progression of melanoma. As expected from its important role in melanocytes and melanoma MITF is intricately regulated on all the levels from transcription to post-translational modifications. Although complex mechanisms of MITF functioning are still being revealed, MITF already has a valuable role in managing melanoma patients. Immunohistochemical analysis of MITF has shown both diagnostic and prognostic value in patients with melanoma. MITF is also a valuable specific marker for detection of circulating melanoma cells by reverse-transcription – polymerase chain reaction. MITF has recently been investigated as a potential target for melanoma therapy.

  15. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs. (United States)

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D


    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  16. Synthetic Promoters and Transcription Factors for Heterologous Protein Expression in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Fabian Machens


    Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.

  17. Utrophin up-regulation by an artificial transcription factor in transgenic mice.

    Directory of Open Access Journals (Sweden)

    Elisabetta Mattei


    Full Text Available Duchenne Muscular Dystrophy (DMD is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter "A". Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics.

  18. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    International Nuclear Information System (INIS)

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.


    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  19. B-GATA transcription factors - insights into their structure, regulation and role in plant development

    Directory of Open Access Journals (Sweden)

    Claus eSchwechheimer


    Full Text Available GATA transcription factors are evolutionarily conserved transcriptional regulators that recognize promoter elements with a G-A-T-A core sequence. In comparison to animal genomes, the GATA transcription factor family in plants is comparatively large with approximately 30 members. In spite of a long-standing interest of plant molecular biologists in GATA factors, only research conducted in the last years has led to reliable insights into their functions during plant development. Here, we review the current knowledge on B-GATAs, one of four GATA factor subfamilies from Arabidopsis thaliana. We show that B-GATAs can be subdivided based on structural features and their biological function into family members with a C-terminal LLM- (leucine-leucine-methionine domain or an N-terminal HAN- (HANABA TARANU domain. The paralogous GNC (GATA, NITRATE-INDUCIBLE, CARBON-METABOLISM INVOLVED and CGA1/GNL (CYTOKININ-INDUCED GATA1/GNC-LIKE are introduced as LLM-domain containing B-GATAs from Arabidopsis that control germination, greening, senescence and flowering time downstream from several growth regulatory signals including light and the hormones gibberellin, auxin, and cytokinin. Arabidopsis HAN and its monocot-specific paralogs from rice (NECK LEAF1, maize (TASSEL SHEATH1, and barley (THIRD OUTER GLUME are HAN-domain-containing B-GATAs with a predominant role in embryo development and floral development. We also review GATA23, a regulator of lateral root initiation from Arabidopsis, that is closely related to GNC and GNL but has a degenerate LLM-domain that is seemingly specific for the Brassicaceae family. The Brassicaceae-specific GATA23 together with the above-mentioned monocot-specific HAN-domain GATAs provide evidence that neofunctionalization of the B-GATAs was used during plant evolution to expand the functional repertoire of these transcription factors.

  20. Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

    Directory of Open Access Journals (Sweden)

    Jinyi Liu

    Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

  1. Transcriptional profiling in human HaCaT keratinocytes in response to kaempferol and identification of potential transcription factors for regulating differential gene expression (United States)

    Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee


    Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059

  2. Emerging roles and regulation of MiT/TFE transcriptional factors. (United States)

    Yang, Min; Liu, En; Tang, Li; Lei, Yuanyuan; Sun, Xuemei; Hu, Jiaxi; Dong, Hui; Yang, Shi-Ming; Gao, Mingfa; Tang, Bo


    The MiT/TFE transcription factors play a pivotal role in the regulation of autophagy and lysosomal biogenesis. The subcellular localization and activity of MiT/TFE proteins are primarily regulated through phosphorylation. And the phosphorylated protein is retained in the cytoplasm and subsequently translocates to the nucleus upon dephosphorylation, where it stimulates the expression of hundreds of genes, leading to lysosomal biogenesis and autophagy induction. The transcription factor-mediated lysosome-to-nucleus signaling can be directly controlled by several signaling molecules involved in the mTORC1, PKC, and AKT pathways. MiT/TFE family members have attracted much attention owing to their intracellular clearance of pathogenic factors in numerous diseases. Recently, multiple studies have also revealed the MiT/TFE proteins as master regulators of cellular metabolic reprogramming, converging on autophagic and lysosomal function and playing a critical role in cancer, suggesting that novel therapeutic strategies could be based on the modulation of MiT/TFE family member activity. Here, we present an overview of the latest research on MiT/TFE transcriptional factors and their potential mechanisms in cancer.

  3. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  4. Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods. (United States)

    Kast, Brigitte; Schori, Christian; Grimm, Christian


    Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  6. Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation. (United States)

    Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta


    Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. The transcription factor Mlc promotes Vibrio cholerae biofilm formation through repression of phosphotransferase system components. (United States)

    Pickering, Bradley S; Lopilato, Jane E; Smith, Daniel R; Watnick, Paula I


    The phosphoenol phosphotransferase system (PTS) is a multicomponent signal transduction cascade that regulates diverse aspects of bacterial cellular physiology in response to the availability of high-energy sugars in the environment. Many PTS components are repressed at the transcriptional level when the substrates they transport are not available. In Escherichia coli, the transcription factor Mlc (for makes large colonies) represses transcription of the genes encoding enzyme I (EI), histidine protein (HPr), and the glucose-specific enzyme IIBC (EIIBC(Glc)) in defined media that lack PTS substrates. When glucose is present, the unphosphorylated form of EIIBC(Glc) sequesters Mlc to the cell membrane, preventing its interaction with DNA. Very little is known about Vibrio cholerae Mlc. We found that V. cholerae Mlc activates biofilm formation in LB broth but not in defined medium supplemented with either pyruvate or glucose. Therefore, we questioned whether V. cholerae Mlc functions differently than E. coli Mlc. Here we have shown that, like E. coli Mlc, V. cholerae Mlc represses transcription of PTS components in both defined medium and LB broth and that E. coli Mlc is able to rescue the biofilm defect of a V. cholerae Δmlc mutant. Furthermore, we provide evidence that Mlc indirectly activates transcription of the vps genes by repressing expression of EI. Because activation of the vps genes by Mlc occurs under only a subset of the conditions in which repression of PTS components is observed, we conclude that additional inputs present in LB broth are required for activation of vps gene transcription by Mlc. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.


    Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early

  9. The herpes viral transcription factor ICP4 forms a novel DNA recognition complex (United States)

    Tunnicliffe, Richard B.; Lockhart-Cairns, Michael P.; Levy, Colin; Mould, A. Paul; Jowitt, Thomas A.; Sito, Hilary; Baldock, Clair; Sandri-Goldin, Rozanne M.


    Abstract The transcription factor ICP4 from herpes simplex virus has a central role in regulating the gene expression cascade which controls viral infection. Here we present the crystal structure of the functionally essential ICP4 DNA binding domain in complex with a segment from its own promoter, revealing a novel homo-dimeric fold. We also studied the complex in solution by small angle X-Ray scattering, nuclear magnetic resonance and surface-plasmon resonance which indicated that, in addition to the globular domain, a flanking intrinsically disordered region also recognizes DNA. Together the data provides a rationale for the bi-partite nature of the ICP4 DNA recognition consensus sequence as the globular and disordered regions bind synergistically to adjacent DNA motifs. Therefore in common with its eukaryotic host, the viral transcription factor ICP4 utilizes disordered regions to enhance the affinity and tune the specificity of DNA interactions in tandem with a globular domain. PMID:28505309

  10. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus


    kinase 4 (MPK4) exists in nuclear complexes with the WRKY33 transcription factor. This complex depends on the MPK4 substrate MKS1. Challenge with Pseudomonas syringae or flagellin leads to the activation of MPK4 and phosphorylation of MKS1. Subsequently, complexes with MKS1 and WRKY33 are released from...... MPK4, and WRKY33 targets the promoter of PHYTOALEXIN DEFICIENT3 (PAD3) encoding an enzyme required for the synthesis of antimicrobial camalexin. Hence, wrky33 mutants are impaired in the accumulation of PAD3 mRNA and camalexin production upon infection. That WRKY33 is an effector of MPK4 is further...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  11. A new FACS approach isolates hESC derived endoderm using transcription factors.

    Directory of Open Access Journals (Sweden)

    Yuqiong Pan


    Full Text Available We show that high quality microarray gene expression profiles can be obtained following FACS sorting of cells using combinations of transcription factors. We use this transcription factor FACS (tfFACS methodology to perform a genomic analysis of hESC-derived endodermal lineages marked by combinations of SOX17, GATA4, and CXCR4, and find that triple positive cells have a much stronger definitive endoderm signature than other combinations of these markers. Additionally, SOX17(+ GATA4(+ cells can be obtained at a much earlier stage of differentiation, prior to expression of CXCR4(+ cells, providing an important new tool to isolate this earlier definitive endoderm subtype. Overall, tfFACS represents an advancement in FACS technology which broadly crosses multiple disciplines, most notably in regenerative medicine to redefine cellular populations.

  12. Novel splice mutation in microthalmia-associated transcription factor in Waardenburg Syndrome. (United States)

    Brenner, Laura; Burke, Kelly; Leduc, Charles A; Guha, Saurav; Guo, Jiancheng; Chung, Wendy K


    Waardenburg Syndrome (WS) is a syndromic form of hearing loss associated with mutations in six different genes. We identified a large family with WS that had previously undergone clinical testing, with no reported pathogenic mutation. Using linkage analysis, a region on 3p14.1 with an LOD score of 6.6 was identified. Microthalmia-Associated Transcription Factor, a gene known to cause WS, is located within this region of linkage. Sequencing of Microthalmia-Associated Transcription Factor demonstrated a c.1212 G>A synonymous variant that segregated with the WS in the family and was predicted to cause a novel splicing site that was confirmed with expression analysis of the mRNA. This case illustrates the need to computationally analyze novel synonymous sequence variants for possible effects on splicing to maximize the clinical sensitivity of sequence-based genetic testing.

  13. The transcription factor c-Maf controls touch receptor development and function. (United States)

    Wende, Hagen; Lechner, Stefan G; Cheret, Cyril; Bourane, Steeve; Kolanczyk, Maria E; Pattyn, Alexandre; Reuter, Katja; Munier, Francis L; Carroll, Patrick; Lewin, Gary R; Birchmeier, Carmen


    The sense of touch relies on detection of mechanical stimuli by specialized mechanosensory neurons. The scarcity of molecular data has made it difficult to analyze development of mechanoreceptors and to define the basis of their diversity and function. We show that the transcription factor c-Maf/c-MAF is crucial for mechanosensory function in mice and humans. The development and function of several rapidly adapting mechanoreceptor types are disrupted in c-Maf mutant mice. In particular, Pacinian corpuscles, a type of mechanoreceptor specialized to detect high-frequency vibrations, are severely atrophied. In line with this, sensitivity to high-frequency vibration is reduced in humans carrying a dominant mutation in the c-MAF gene. Thus, our work identifies a key transcription factor specifying development and function of mechanoreceptors and their end organs.

  14. Expression of the Transcription Factor E4BP4 in Human Basophils

    DEFF Research Database (Denmark)

    Jensen, Bettina Margrethe; Gohr, Maria; Poulsen, Lars Kærgaard


    Rationale The cytokine IL-3 plays an important role for human basophil development, function and survival. IL-3 is also reported to induce the expression of the transcription factor E4BP4, but it is not known whether E4BP4 is expressed in basophils and influences basophil responsiveness. The aim...... by Alcian blue. RNA was extracted (0.005-0.02 µg RNA from 0.5 - 1 x 106 cells), and the corresponding cDNA analyzed by real-time PCR where E4BP4 expression was calculated as 2-(CT(E4BP4) - CT(β-actin)). E4BP4 protein expression was visualized in basophil lysates (107 cells/ml) by Western blot followed...... the transcription factor E4BP4 which might have an impact on basophil histamine release....

  15. Molecular genetic analysis of activation-tagged transcription factors thought to be involved in photomorphogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Neff, Michael M.


    This is a final report for Department of Energy Grant No. DE-FG02-08ER15927 entitled “Molecular Genetic Analysis of Activation-Tagged Transcription Factors Thought to be Involved in Photomorphogenesis”. Based on our preliminary photobiological and genetic analysis of the sob1-D mutant, we hypothesized that OBP3 is a transcription factor involved in both phytochrome and cryptochrome-mediated signal transduction. In addition, we hypothesized that OBP3 is involved in auxin signaling and root development. Based on our preliminary photobiological and genetic analysis of the sob2-D mutant, we also hypothesized that a related gene, LEP, is involved in hormone signaling and seedling development.

  16. A role for Runx transcription factor signaling in dorsal root ganglion sensory neuron diversification. (United States)

    Kramer, Ina; Sigrist, Markus; de Nooij, Joriene C; Taniuchi, Ichiro; Jessell, Thomas M; Arber, Silvia


    Subpopulations of sensory neurons in the dorsal root ganglion (DRG) can be characterized on the basis of sensory modalities that convey distinct peripheral stimuli, but the molecular mechanisms that underlie sensory neuronal diversification remain unclear. Here, we have used genetic manipulations in the mouse embryo to examine how Runx transcription factor signaling controls the acquisition of distinct DRG neuronal subtype identities. Runx3 acts to diversify an Ngn1-independent neuronal cohort by promoting the differentiation of proprioceptive sensory neurons through erosion of TrkB expression in prospective TrkC+ sensory neurons. In contrast, Runx1 controls neuronal diversification within Ngn1-dependent TrkA+ neurons by repression of neuropeptide CGRP expression and controlling the fine pattern of laminar termination in the dorsal spinal cord. Together, our findings suggest that Runx transcription factor signaling plays a key role in sensory neuron diversification.

  17. Fungal Morphology, Iron Homeostasis, and Lipid Metabolism Regulated by a GATA Transcription Factor in Blastomyces dermatitidis.

    Directory of Open Access Journals (Sweden)

    Amber J Marty


    Full Text Available In response to temperature, Blastomyces dermatitidis converts between yeast and mold forms. Knowledge of the mechanism(s underlying this response to temperature remains limited. In B. dermatitidis, we identified a GATA transcription factor, SREB, important for the transition to mold. Null mutants (SREBΔ fail to fully complete the conversion to mold and cannot properly regulate siderophore biosynthesis. To capture the transcriptional response regulated by SREB early in the phase transition (0-48 hours, gene expression microarrays were used to compare SREB∆ to an isogenic wild type isolate. Analysis of the time course microarray data demonstrated SREB functioned as a transcriptional regulator at 37°C and 22°C. Bioinformatic and biochemical analyses indicated SREB was involved in diverse biological processes including iron homeostasis, biosynthesis of triacylglycerol and ergosterol, and lipid droplet formation. Integration of microarray data, bioinformatics, and chromatin immunoprecipitation identified a subset of genes directly bound and regulated by SREB in vivo in yeast (37°C and during the phase transition to mold (22°C. This included genes involved with siderophore biosynthesis and uptake, iron homeostasis, and genes unrelated to iron assimilation. Functional analysis suggested that lipid droplets were actively metabolized during the phase transition and lipid metabolism may contribute to filamentous growth at 22°C. Chromatin immunoprecipitation, RNA interference, and overexpression analyses suggested that SREB was in a negative regulatory circuit with the bZIP transcription factor encoded by HAPX. Both SREB and HAPX affected morphogenesis at 22°C; however, large changes in transcript abundance by gene deletion for SREB or strong overexpression for HAPX were required to alter the phase transition.

  18. The transcription factor ETS-1 regulates angiotensin II-stimulated fibronectin production in mesangial cells. (United States)

    Hua, Ping; Feng, Wenguang; Rezonzew, Gabriel; Chumley, Phillip; Jaimes, Edgar A


    Angiotensin II (ANG II) produced as result of activation of the renin-angiotensin system (RAS) plays a critical role in the pathogenesis of chronic kidney disease via its hemodynamic effects on the renal microcirculation as well as by its nonhemodynamic actions including the production of extracellular matrix proteins such as fibronectin, a multifunctional extracellular matrix protein that plays a major role in cell adhesion and migration as well as in the development of glomerulosclerosis. ETS-1 is an important transcription factor essential for normal kidney development and glomerular integrity. We previously showed that ANG II increases ETS-1 expression and is required for fibronectin production in mesangial cells. In these studies, we determined that ANG II induces phosphorylation of ETS-1 via activation of the type 1 ANG II receptor and that Erk1/2 and Akt/PKB phosphorylation are required for these effects. In addition, we characterized the role of ETS-1 on the transcriptional activation of fibronectin production in mesangial cells. We determined that ETS-1 directly activates the fibronectin promoter and by utilizing gel shift assays and chromatin immunoprecipitation assays identified two different ETS-1 binding sites that promote the transcriptional activation of fibronectin in response to ANG II. In addition, we identified the essential role of CREB and its coactivator p300 on the transcriptional activation of fibronectin by ETS-1. These studies unveil novel mechanisms involved in RAS-induced production of the extracellular matrix protein fibronectin in mesangial cells and establish the role of the transcription factor ETS-1 as a direct mediator of these effects.

  19. Inhibition of CRM1-mediated nuclear export of transcription factors by leukemogenic NUP98 fusion proteins. (United States)

    Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R


    NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.

  20. ERK-dependent phosphorylation of the transcription initiation factor TIF-IA is required for RNA polymerase I transcription and cell growth

    DEFF Research Database (Denmark)

    Zhao, Jian; Yuan, Xuejun; Frödin, Morten


    -specific transcription initiation factor TIF-IA. Activation of TIF-IA and ribosomal gene transcription is sensitive to PD98059, indicating that TIF-IA is targeted by MAPK in vivo. Phosphopeptide mapping and mutational analysis reveals two serine residues (S633 and S649) that are phosphorylated by ERK and RSK kinases....... Replacement of S649 by alanine inactivates TIF-IA, inhibits pre-rRNA synthesis, and retards cell growth. The results provide a link between growth factor signaling, ribosome production, and cell growth, and may have a major impact on the mechanism of cell transformation....

  1. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available Members of the plant NUCLEAR FACTOR Y (NF-Y family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola, each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14 were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12 and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14 were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12 and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14 and two NF-YC members (BnNF-YC2 and BnNF-YC3 were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides

  2. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L. (United States)

    Xu, Li; Lin, Zhongyuan; Tao, Qing; Liang, Mingxiang; Zhao, Gengmao; Yin, Xiangzhen; Fu, Ruixin


    Members of the plant NUCLEAR FACTOR Y (NF-Y) family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola), each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14) were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12) and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14) were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12) and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14) and two NF-YC members (BnNF-YC2 and BnNF-YC3) were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides insight into

  3. Role of WRKY Transcription Factors in Arabidopsis Development and Stress Responses


    Li, Jing


    It has been well established that environmentally induced alterations in gene expression are mediated by transcription factors (TFs). One of the important plant-specific TF groups is the WRKY (TFs containing a highly conserved WRKY domain) family, which is involved in regulation of various physiological programs including biotic and abiotic defenses, senescence and trichome development. Two members of WRKY group III in Arabidopsis thaliana, WRKY54 and WRKY70, are demonstrated in this study to...

  4. Identification of novel transcription factors regulating secondary cell wall formation in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Hua eCassan-Wang


    Full Text Available The presence of lignin in secondary cell walls (SCW is a major factor preventing hydrolytic enzymes from gaining access to cellulose, thereby limiting the saccharification potential of plant biomass. To understand how lignification is regulated is a prerequisite for selecting plant biomass better adapted to bioethanol production. Because transcriptional regulation is a major mechanism controlling the expression of genes involved in lignin biosynthesis, our aim was to identify novel transcription factors dictating lignin profiles in the model plant Arabidopsis. To this end, we have developed a post-genomic approach by combining four independent in-house SCW-related transcriptome datasets obtained from (i the fiber cell wall-deficient wat1 Arabidopsis mutant, (ii Arabidopsis lines over-expressing either the master regulatory activator EgMYB2 or (iii the repressor EgMYB1 and finally (iv Arabidopsis orthologs of Eucalyptus xylem-expressed genes. This allowed us to identify 502 up- or down-regulated transcription factors. We preferentially selected those present in more than one dataset and further analyzed their in silico expression patterns as an additional selection criteria. This selection process led to 80 candidates. Notably, 16 of them were already proven to regulate SCW formation, thereby validating the overall strategy. Then, we phenotyped 43 corresponding mutant lines focusing on histological observations of xylem and interfascicular fibers. This phenotypic screen revealed six mutant lines exhibiting altered lignification patterns. Two of them (blh6 and a zinc finger transcription factor presented hypolignified SCW. Three others (myb52, myb-like TF, hb5 showed hyperlignified SCW whereas the last one (hb15 showed ectopic lignification. In addition, our meta-analyses highlighted a reservoir of new potential regulators adding to the gene network regulating SCW but also opening new avenues to ultimately improve SCW composition for biofuel

  5. Roles of Arabidopsis WRKY3 and WRKY4 Transcription Factors in Plant Responses to Pathogens

    Directory of Open Access Journals (Sweden)

    Fan Baofang


    Full Text Available Abstract Background Plant WRKY DNA-binding transcription factors are involved in plant responses to biotic and abiotic responses. It has been previously shown that Arabidopsis WRKY3 and WRKY4, which encode two structurally similar WRKY transcription factors, are induced by pathogen infection and salicylic acid (SA. However, the role of the two WRKY transcription factors in plant disease resistance has not been directly analyzed. Results Both WRKY3 and WRKY4 are nuclear-localized and specifically recognize the TTGACC W-box sequences in vitro. Expression of WRKY3 and WRKY4 was induced rapidly by stress conditions generated by liquid infiltration or spraying. Stress-induced expression of WRKY4 was further elevated by pathogen infection and SA treatment. To determine directly their role in plant disease resistance, we have isolated T-DNA insertion mutants and generated transgenic overexpression lines for WRKY3 and WRKY4. Both the loss-of-function mutants and transgenic overexpression lines were examined for responses to the biotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea. The wrky3 and wrky4 single and double mutants exhibited more severe disease symptoms and support higher fungal growth than wild-type plants after Botrytis infection. Although disruption of WRKY3 and WRKY4 did not have a major effect on plant response to P. syringae, overexpression of WRKY4 greatly enhanced plant susceptibility to the bacterial pathogen and suppressed pathogen-induced PR1 gene expression. Conclusion The nuclear localization and sequence-specific DNA-binding activity support that WRKY3 and WRKY4 function as transcription factors. Functional analysis based on T-DNA insertion mutants and transgenic overexpression lines indicates that WRKY3 and WRKY4 have a positive role in plant resistance to necrotrophic pathogens and WRKY4 has a negative effect on plant resistance to biotrophic pathogens.

  6. Unexpected complexity of the reef-building coral Acropora millepora transcription factor network.

    KAUST Repository

    Ryu, Tae Woo


    Coral reefs are disturbed on a global scale by environmental changes including rising sea surface temperatures and ocean acidification. Little is known about how corals respond or adapt to these environmental changes especially at the molecular level. This is mostly because of the paucity of genome-wide studies on corals and the application of systems approaches that incorporate the latter. Like in any other organism, the response of corals to stress is tightly controlled by the coordinated interplay of many transcription factors.

  7. Relaxed selection against accidental binding of transcription factors with conserved chromatin contexts. (United States)

    Babbitt, G A


    The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome. 2010 Elsevier B.V. All rights reserved.

  8. Identification of direct regulatory targets of the transcription factor Sox10 based on function and conservation

    Directory of Open Access Journals (Sweden)

    Lee Sanghyuk


    Full Text Available Abstract Background Sox10, a member of the Sry-related HMG-Box gene family, is a critical transcription factor for several important cell lineages, most notably the neural crest stem cells and the derivative peripheral glial cells and melanocytes. Thus far, only a handful of direct target genes are known for this transcription factor limiting our understanding of the biological network it governs. Results We describe identification of multiple direct regulatory target genes of Sox10 through a procedure based on function and conservation. By combining RNA interference technique and DNA microarray technology, we have identified a set of genes that show significant down-regulation upon introduction of Sox10 specific siRNA into Schwannoma cells. Subsequent comparative genomics analyses led to potential binding sites for Sox10 protein conserved across several mammalian species within the genomic region proximal to these genes. Multiple sites belonging to 4 different genes (proteolipid protein, Sox10, extracellular superoxide dismutase, and pleiotrophin were shown to directly interact with Sox10 by chromatin immunoprecipitation assay. We further confirmed the direct regulation through the identified cis-element for one of the genes, extracellular superoxide dismutase, using electrophoretic mobility shift assay and reporter assay. Conclusion In sum, the process of combining differential expression profiling and comparative genomics successfully led to further defining the role of Sox10, a critical transcription factor for the development of peripheral glia. Our strategy utilizing relatively accessible techniques and tools should be applicable to studying the function of other transcription factors.

  9. Regulation of Nitrogen Metabolism by GATA Zinc Finger Transcription Factors in Yarrowia lipolytica


    Pomraning, Kyle R.; Bredeweg, Erin L.; Baker, Scott E.


    ABSTRACT Fungi accumulate lipids in a manner dependent on the quantity and quality of the nitrogen source on which they are growing. In the oleaginous yeast Yarrowia lipolytica, growth on a complex source of nitrogen enables rapid growth and limited accumulation of neutral lipids, while growth on a simple nitrogen source promotes lipid accumulation in large lipid droplets. Here we examined the roles of nitrogen catabolite repression and its regulation by GATA zinc finger transcription factors...

  10. Unexpected complexity of the reef-building coral Acropora millepora transcription factor network.

    KAUST Repository

    Ryu, Tae Woo; Mavromatis, Charalampos Harris; Bayer, Till; Voolstra, Christian R.; Ravasi, Timothy


    Coral reefs are disturbed on a global scale by environmental changes including rising sea surface temperatures and ocean acidification. Little is known about how corals respond or adapt to these environmental changes especially at the molecular level. This is mostly because of the paucity of genome-wide studies on corals and the application of systems approaches that incorporate the latter. Like in any other organism, the response of corals to stress is tightly controlled by the coordinated interplay of many transcription factors.

  11. Conservation of transcription factor binding events predicts gene expression across species


    Hemberg, Martin; Kreiman, Gabriel


    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...

  12. RNF11 is a multifunctional modulator of growth factor receptor signalling and transcriptional regulation. (United States)

    Azmi, Peter; Seth, Arun


    Our laboratory has found that the 154aa RING finger protein 11 (RNF11), has modular domains and motifs including a RING-H2 finger domain, a PY motif, an ubiquitin interacting motif (UIM), a 14-3-3 binding sequence and an AKT phosphorylation site. RNF11 represents a unique protein with no other known immediate family members yet described. Comparative genetic analysis has shown that RNF11 is highly conserved throughout evolution. This may indicate a conserved and non-redundant role for the RNF11 protein. Molecular binding assays using RNF11 have shown that RNF11 has important roles in growth factor signalling, ubiquitination and transcriptional regulation. RNF11 has been shown to interact with HECT-type E3 ubiquitin ligases Nedd4, AIP4, Smurf1 and Smurf2, as well as with Cullin1, the core protein in the multi-subunit SCF E3 ubiquitin ligase complex. Work done in our laboratory has shown that RNF11 is capable of antagonizing Smurf2-mediated inhibition of TGFbeta signalling. Furthermore, RNF11 is capable of degrading AMSH, a positive regulator of both TGFbeta and EGFR signalling pathways. Recently, we have found that RNF11 can directly enhance TGFbeta signalling through a direct association with Smad4, the common signal transducer and transcription factor in the TGFbeta, BMP, and Activin pathways. Through its association with Smad4 and other transcription factors, RNF11 may have a role in direct transcriptional regulation. Our laboratory and others have found nearly 80 protein interactions for RNF11, placing RNF11 at the cross-roads of cell signalling and transcriptional regulation. RNF11 is highly expressed in breast tumours. Deregulation of RNF11 function may prove to be harmful to patient therapeutic outcomes. RNF11 may therefore provide a novel target for cancer therapeutics. The purpose of this review is to discuss the role of RNF11 in cell signalling and transcription factor modulation with special attention given to the ubiquitin-proteasomal pathway, TGFbeta

  13. The Inflammatory Transcription Factors NFκB, STAT1 and STAT3 Drive Age-Associated Transcriptional Changes in the Human Kidney (United States)

    O’Brown, Zach K.; Van Nostrand, Eric L.; Higgins, John P.; Kim, Stuart K.


    Human kidney function declines with age, accompanied by stereotyped changes in gene expression and histopathology, but the mechanisms underlying these changes are largely unknown. To identify potential regulators of kidney aging, we compared age-associated transcriptional changes in the human kidney with genome-wide maps of transcription factor occupancy from ChIP-seq datasets in human cells. The strongest candidates were the inflammation-associated transcription factors NFκB, STAT1 and STAT3, the activities of which increase with age in epithelial compartments of the renal cortex. Stimulation of renal tubular epithelial cells with the inflammatory cytokines IL-6 (a STAT3 activator), IFNγ (a STAT1 activator), or TNFα (an NFκB activator) recapitulated age-associated gene expression changes. We show that common DNA variants in RELA and NFKB1, the two genes encoding subunits of the NFκB transcription factor, associate with kidney function and chronic kidney disease in gene association studies, providing the first evidence that genetic variation in NFκB contributes to renal aging phenotypes. Our results suggest that NFκB, STAT1 and STAT3 underlie transcriptional changes and chronic inflammation in the aging human kidney. PMID:26678048

  14. Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets

    Energy Technology Data Exchange (ETDEWEB)

    Springer, Patricia S


    The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes that encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.

  15. Genome wide analysis of stress responsive WRKY transcription factors in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Shaiq Sultan


    Full Text Available WRKY transcription factors are a class of DNA-binding proteins that bind with a specific sequence C/TTGACT/C known as W-Box found in promoters of genes which are regulated by these WRKYs. From previous studies, 43 different stress responsive WRKY transcription factors in Arabidopsis thaliana, identified and then categorized in three groups viz., abiotic, biotic and both of these stresses. A comprehensive genome wide analysis including chromosomal localization, gene structure analysis, multiple sequence alignment, phylogenetic analysis and promoter analysis of these WRKY genes was carried out in this study to determine the functional homology in Arabidopsis. This analysis led to the classification of these WRKY family members into 3 major groups and subgroups and showed evolutionary relationship among these groups on the base of their functional WRKY domain, chromosomal localization and intron/exon structure. The proposed groups of these stress responsive WRKY genes and annotation based on their position on chromosomes can also be explored to determine their functional homology in other plant species in relation to different stresses. The result of the present study provides indispensable genomic information for the stress responsive WRKY transcription factors in Arabidopsis and will pave the way to explain the precise role of various AtWRKYs in plant growth and development under stressed conditions.

  16. Transcription factor levels enable metabolic diversification of single cells of environmental bacteria. (United States)

    Guantes, Raúl; Benedetti, Ilaria; Silva-Rocha, Rafael; de Lorenzo, Víctor


    Transcriptional noise is a necessary consequence of the molecular events that drive gene expression in prokaryotes. However, some environmental microorganisms that inhabit polluted sites, for example, the m-xylene degrading soil bacterium Pseudomonas putida mt-2 seem to have co-opted evolutionarily such a noise for deploying a metabolic diversification strategy that allows a cautious exploration of new chemical landscapes. We have examined this phenomenon under the light of deterministic and stochastic models for activation of the main promoter of the master m-xylene responsive promoter of the system (Pu) by its cognate transcriptional factor (XylR). These analyses consider the role of co-factors for Pu activation and determinants of xylR mRNA translation. The model traces the onset and eventual disappearance of the bimodal distribution of Pu activity along time to the growth-phase dependent abundance of XylR itself, that is, very low in exponentially growing cells and high in stationary. This tenet was validated by examining the behaviour of a Pu-GFP fusion in a P. putida strain in which xylR expression was engineered under the control of an IPTG-inducible system. This work shows how a relatively simple regulatory scenario (for example, growth-phase dependent expression of a limiting transcription factor) originates a regime of phenotypic diversity likely to be advantageous in competitive environmental settings.

  17. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ. (United States)

    Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald


    Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  18. Molecular Cloning and Characterization of PnbHLH1 Transcription Factor in Panax notoginseng

    Directory of Open Access Journals (Sweden)

    Xiang Zhang


    Full Text Available Panax notoginseng has been extensively used as a traditional Chinese medicine. In the current study, molecular cloning and characterization of PnbHLH1 transcription factor were explored in Panax notoginseng. The full length of the PnbHLH1 gene obtained by splicing was 1430 bp, encoding 321 amino acids. Prokaryotic expression vector pET-28a-PnbHLH1 was constructed and transferred into the BL21 prokaryotic expression strain. An electrophoretic mobility shift assay of PnbHLH1 protein binding to E-box cis-acting elements verified that PnbHLH1 belonged to the bHLH class transcription factor which could interact with the promoter region of the E-box core sequence. The expression levels of key genes involved in the biosynthesis of triterpenoid saponins in PnbHLH1 transgenic cells were higher than those in the wild cells. Similarly, the total saponin contents were increased in the PnbHLH1 transgenic cell lines compared with the wild cell lines. Such results suggest that the PnbHLH1 transcription factor is a positive regulator in the biosynthesis of triterpenoid saponins in Panax notoginseng.

  19. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ

    Directory of Open Access Journals (Sweden)

    Kathrin Pallauf


    Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  20. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively. (United States)

    Clifford, Jacob; Adami, Christoph


    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  1. [The function of transcription factor P63 and its signaling pathway during limb development]. (United States)

    Ma, Wei; Tian, Wen


    The development of human limb is controlled by several transcription factors and signaling pathways, which are organized in precise time- and space-restricted manners. Recent studies showed that P63 and its signaling pathway play important roles in this process. Transcription factor P63, one member of the P53 family, is characterized by a similar amino acid domain, plays a crucial role in the development of limb and ectoderm differentiation, especially with its DNA binding domain, and sterile alpha motif domains. Mutated P63 gene may produce abnormal transcription factor P63 which can affect the signaling pathway. Furthermore, defective signaling protein in structure and/or quantity is synthesized though the pathway. Eventually, members of the signaling protein family are involved in the regulation of differentiation and development of stem cell, which causes deformity of limbs. In brief, three signaling pathways are related to the digit formation along three axes, including SHH-ZPA, FGFs-AER and Lmx1B-Wnt7a-En1. Each contains numerous signaling molecules which are integrated in self-regulatory modules that assure the acquisition or the correct digit complements. These finding has brought new clues for deciphering the etiology of congenital limb malformation and may provide alternatives for both prevention and treatment.

  2. Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

    Directory of Open Access Journals (Sweden)

    Down Thomas A


    Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.

  3. Coordinate Regulation of Yeast Sterol Regulatory Element-binding Protein (SREBP) and Mga2 Transcription Factors. (United States)

    Burr, Risa; Stewart, Emerson V; Espenshade, Peter J


    The Mga2 and Sre1 transcription factors regulate oxygen-responsive lipid homeostasis in the fission yeast Schizosaccharomyces pombe in a manner analogous to the mammalian sterol regulatory element-binding protein (SREBP)-1 and SREBP-2 transcription factors. Mga2 and SREBP-1 regulate triacylglycerol and glycerophospholipid synthesis, whereas Sre1 and SREBP-2 regulate sterol synthesis. In mammals, a shared activation mechanism allows for coordinate regulation of SREBP-1 and SREBP-2. In contrast, distinct pathways activate fission yeast Mga2 and Sre1. Therefore, it is unclear whether and how these two related pathways are coordinated to maintain lipid balance in fission yeast. Previously, we showed that Sre1 cleavage is defective in the absence of mga2 Here, we report that this defect is due to deficient unsaturated fatty acid synthesis, resulting in aberrant membrane transport. This defect is recapitulated by treatment with the fatty acid synthase inhibitor cerulenin and is rescued by addition of exogenous unsaturated fatty acids. Furthermore, sterol synthesis inhibition blocks Mga2 pathway activation. Together, these data demonstrate that Sre1 and Mga2 are each regulated by the lipid product of the other transcription factor pathway, providing a source of coordination for these two branches of lipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy (United States)

    Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian


    A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179

  5. pH modulates the binding of early growth response protein 1 transcription factor to DNA. (United States)

    Mikles, David C; Bhat, Vikas; Schuchardt, Brett J; Deegan, Brian J; Seldeen, Kenneth L; McDonald, Caleb B; Farooq, Amjad


    The transcription factor early growth response protein (EGR)1 orchestrates a plethora of signaling cascades involved in cellular homeostasis, and its downregulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with an increase in pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as His382 by virtue of the fact that its replacement by nonionizable residues abolishes the pH dependence of the binding of EGR1 to DNA. Notably, His382 inserts into the major groove of DNA, and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, His382 is mainly conserved across other members of the EGR family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating the protein-DNA interactions that are central to this family of transcription factors. Collectively, our findings reveal an unexpected but a key step in the molecular recognition of the EGR family of transcription factors, and suggest that they may act as sensors of pH within the intracellular environment. © 2013 FEBS.

  6. pH Modulates the Binding of EGR1 Transcription Factor to DNA (United States)

    Mikles, David C.; Bhat, Vikas; Schuchardt, Brett J.; Deegan, Brian J.; Seldeen, Kenneth L.; McDonald, Caleb B.; Farooq, Amjad


    EGR1 transcription factor orchestrates a plethora of signaling cascades involved in cellular homeostasis and its down-regulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with increasing pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as H382 by virtue of the fact that its substitution to non-ionizable residues abolishes pH-dependence of the binding of EGR1 to DNA. Notably, H382 inserts into the major groove of DNA and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, H382 is predominantly conserved across other members of EGR1 family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating protein-DNA interactions central to this family of transcription factors. Collectively, our findings uncover an unexpected but a key step in the molecular recognition of EGR1 family of transcription factors and suggest that they may act as sensors of pH within the intracellular environment. PMID:23718776

  7. TCP Transcription Factors at the Interface between Environmental Challenges and the Plant's Growth Responses. (United States)

    Danisman, Selahattin


    Plants are sessile and as such their reactions to environmental challenges differ from those of mobile organisms. Many adaptions involve growth responses and hence, growth regulation is one of the most crucial biological processes for plant survival and fitness. The plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, PCF1 (TCP) transcription factor family is involved in plant development from cradle to grave, i.e., from seed germination throughout vegetative development until the formation of flowers and fruits. TCP transcription factors have an evolutionary conserved role as regulators in a variety of plant species, including orchids, tomatoes, peas, poplar, cotton, rice and the model plant Arabidopsis. Early TCP research focused on the regulatory functions of TCPs in the development of diverse organs via the cell cycle. Later research uncovered that TCP transcription factors are not static developmental regulators but crucial growth regulators that translate diverse endogenous and environmental signals into growth responses best fitted to ensure plant fitness and health. I will recapitulate the research on TCPs in this review focusing on two topics: the discovery of TCPs and the elucidation of their evolutionarily conserved roles across the plant kingdom, and the variety of signals, both endogenous (circadian clock, plant hormones) and environmental (pathogens, light, nutrients), TCPs respond to in the course of their developmental roles.

  8. Transcription factor expression uniquely identifies most postembryonic neuronal lineages in the Drosophila thoracic central nervous system. (United States)

    Lacin, Haluk; Zhu, Yi; Wilson, Beth A; Skeath, James B


    Most neurons of the adult Drosophila ventral nerve cord arise from a burst of neurogenesis during the third larval instar stage. Most of this growth occurs in thoracic neuromeres, which contain 25 individually identifiable postembryonic neuronal lineages. Initially, each lineage consists of two hemilineages--'A' (Notch(On)) and 'B' (Notch(Off))--that exhibit distinct axonal trajectories or fates. No reliable method presently exists to identify these lineages or hemilineages unambiguously other than labor-intensive lineage-tracing methods. By combining mosaic analysis with a repressible cell marker (MARCM) analysis with gene expression studies, we constructed a gene expression map that enables the rapid, unambiguous identification of 23 of the 25 postembryonic lineages based on the expression of 15 transcription factors. Pilot genetic studies reveal that these transcription factors regulate the specification and differentiation of postembryonic neurons: for example, Nkx6 is necessary and sufficient to direct axonal pathway selection in lineage 3. The gene expression map thus provides a descriptive foundation for the genetic and molecular dissection of adult-specific neurogenesis and identifies many transcription factors that are likely to regulate the development and differentiation of discrete subsets of postembryonic neurons.

  9. The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. (United States)

    Aharoni, A; De Vos, C H; Wein, M; Sun, Z; Greco, R; Kroon, A; Mol, J N; O'Connell, A P


    Fruit ripening is characterized by dramatic changes in gene expression, enzymatic activities and metabolism. Although the process of ripening has been studied extensively, we still lack valuable information on how the numerous metabolic pathways are regulated and co-ordinated. In this paper we describe the characterization of FaMYB1, a ripening regulated strawberry gene member of the MYB family of transcription factors. Flowers of transgenic tobacco lines overexpressing FaMYB1 showed a severe reduction in pigmentation. A reduction in the level of cyanidin 3-rutinoside (an anthocyanin) and of quercetin-glycosides (flavonols) was observed. Expression of late flavonoid biosynthesis genes and their enzyme activities were adversely affected by FaMYB1 overexpression. Two-hybrid assays in yeast showed that FaMYB1 could interact with other known anthocyanin regulators, but it does not act as a transcriptional activator. Interestingly, the C-terminus of FaMYB1 contains the motif pdLNL(D)/(E)Lxi(G)/S. This motif is contained in a region recently proposed to be involved in the repression of transcription by AtMYB4, an Arabidopsis MYB protein. Our results suggest that FaMYB1 may play a key role in regulating the biosynthesis of anthocyanins and flavonols in strawberry. It may act to repress transcription in order to balance the levels of anthocyanin pigments produced at the latter stages of strawberry fruit maturation, and/or to regulate metabolite levels in various branches of the flavonoid biosynthetic pathway.

  10. In Silico discovery of transcription factors as potential diagnostic biomarkers of ovarian cancer

    KAUST Repository

    Kaur, Mandeep


    Background: Our study focuses on identifying potential biomarkers for diagnosis and early detection of ovarian cancer (OC) through the study of transcription regulation of genes affected by estrogen hormone.Results: The results are based on a set of 323 experimentally validated OC-associated genes compiled from several databases, and their subset controlled by estrogen. For these two gene sets we computationally determined transcription factors (TFs) that putatively regulate transcription initiation. We ranked these TFs based on the number of genes they are likely to control. In this way, we selected 17 top-ranked TFs as potential key regulators and thus possible biomarkers for a set of 323 OC-associated genes. For 77 estrogen controlled genes from this set we identified three unique TFs as potential biomarkers.Conclusions: We introduced a new methodology to identify potential diagnostic biomarkers for OC. This report is the first bioinformatics study that explores multiple transcriptional regulators of OC-associated genes as potential diagnostic biomarkers in connection with estrogen responsiveness. We show that 64% of TF biomarkers identified in our study are validated based on real-time data from microarray expression studies. As an illustration, our method could identify CP2 that in combination with CA125 has been reported to be sensitive in diagnosing ovarian tumors. 2011 Kaur et al; licensee BioMed Central Ltd.

  11. In Silico discovery of transcription factors as potential diagnostic biomarkers of ovarian cancer

    KAUST Repository

    Kaur, Mandeep; MacPherson, Cameron R; Schmeier, Sebastian; Narasimhan, Kothandaraman; Choolani, Mahesh; Bajic, Vladimir B.


    Background: Our study focuses on identifying potential biomarkers for diagnosis and early detection of ovarian cancer (OC) through the study of transcription regulation of genes affected by estrogen hormone.Results: The results are based on a set of 323 experimentally validated OC-associated genes compiled from several databases, and their subset controlled by estrogen. For these two gene sets we computationally determined transcription factors (TFs) that putatively regulate transcription initiation. We ranked these TFs based on the number of genes they are likely to control. In this way, we selected 17 top-ranked TFs as potential key regulators and thus possible biomarkers for a set of 323 OC-associated genes. For 77 estrogen controlled genes from this set we identified three unique TFs as potential biomarkers.Conclusions: We introduced a new methodology to identify potential diagnostic biomarkers for OC. This report is the first bioinformatics study that explores multiple transcriptional regulators of OC-associated genes as potential diagnostic biomarkers in connection with estrogen responsiveness. We show that 64% of TF biomarkers identified in our study are validated based on real-time data from microarray expression studies. As an illustration, our method could identify CP2 that in combination with CA125 has been reported to be sensitive in diagnosing ovarian tumors. 2011 Kaur et al; licensee BioMed Central Ltd.

  12. The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells. (United States)

    Froldi, Francesca; Szuperak, Milan; Weng, Chen-Fang; Shi, Wei; Papenfuss, Anthony T; Cheng, Louise Y


    Cellular dedifferentiation is the regression of a cell from a specialized state to a more multipotent state and is implicated in cancer. However, the transcriptional network that prevents differentiated cells from reacquiring stem cell fate is so far unclear. Neuroblasts (NBs), the Drosophila neural stem cells, are a model for the regulation of stem cell self-renewal and differentiation. Here we show that the Drosophila zinc finger transcription factor Nervous fingers 1 (Nerfin-1) locks neurons into differentiation, preventing their reversion into NBs. Following Prospero-dependent neuronal specification in the ganglion mother cell (GMC), a Nerfin-1-specific transcriptional program maintains differentiation in the post-mitotic neurons. The loss of Nerfin-1 causes reversion to multipotency and results in tumors in several neural lineages. Both the onset and rate of neuronal dedifferentiation in nerfin-1 mutant lineages are dependent on Myc- and target of rapamycin (Tor)-mediated cellular growth. In addition, Nerfin-1 is required for NB differentiation at the end of neurogenesis. RNA sequencing (RNA-seq) and chromatin immunoprecipitation (ChIP) analysis show that Nerfin-1 administers its function by repression of self-renewing-specific and activation of differentiation-specific genes. Our findings support the model of bidirectional interconvertibility between neural stem cells and their post-mitotic progeny and highlight the importance of the Nerfin-1-regulated transcriptional program in neuronal maintenance. © 2015 Froldi et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression. (United States)

    Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A


    To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division.

  14. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen


    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  15. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses (United States)


    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  16. TMEM14C is required for erythroid mitochondrial heme metabolism. (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H


    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  17. MicroRNA-212 post-transcriptionally regulates oocyte-specific basic-helix-loop-helix transcription factor, factor in the germline alpha (FIGLA, during bovine early embryogenesis.

    Directory of Open Access Journals (Sweden)

    Swamy K Tripurani

    Full Text Available Factor in the germline alpha (FIGLA is an oocyte-specific basic helix-loop-helix transcription factor essential for primordial follicle formation and expression of many genes required for folliculogenesis, fertilization and early embryonic survival. Here we report the characterization of bovine FIGLA gene and its regulation during early embryogenesis. Bovine FIGLA mRNA expression is restricted to gonads and is detected in fetal ovaries harvested as early as 90 days of gestation. FIGLA mRNA and protein are abundant in germinal vesicle and metaphase II stage oocytes, as well as in embryos from pronuclear to eight-cell stage but barely detectable at morula and blastocyst stages, suggesting that FIGLA might be a maternal effect gene. Recent studies in zebrafish and mice have highlighted the importance of non-coding small RNAs (microRNAs as key regulatory molecules targeting maternal mRNAs for degradation during embryonic development. We hypothesized that FIGLA, as a maternal transcript, is regulated by microRNAs during early embryogenesis. Computational predictions identified a potential microRNA recognition element (MRE for miR-212 in the 3' UTR of the bovine FIGLA mRNA. Bovine miR-212 is expressed in oocytes and tends to increase in four-cell and eight-cell stage embryos followed by a decline at morula and blastocyst stages. Transient transfection and reporter assays revealed that miR-212 represses the expression of FIGLA in a MRE dependent manner. In addition, ectopic expression of miR-212 mimic in bovine early embryos dramatically reduced the expression of FIGLA protein. Collectively, our results demonstrate that FIGLA is temporally regulated during bovine early embryogenesis and miR-212 is an important negative regulator of FIGLA during the maternal to zygotic transition in bovine embryos.

  18. Engineered zinc-finger transcription factors inhibit the replication and transcription of HBV in vitro and in vivo. (United States)

    Luo, Wei; Wang, Junxia; Xu, Dengfeng; Bai, Huili; Zhang, Yangli; Zhang, Yuhong; Li, Xiaosong


    In the present study, an artificial zinc-finger transcription factor eukaryotic expression vector specifically recognizing and binding to the hepatitis B virus (HBV) enhancer (Enh) was constructed, which inhibited the replication and expression of HBV DNA. The HBV EnhI‑specific pcDNA3.1‑artificial transcription factor (ATF) vector was successfully constructed, and then transformed or injected into HepG2.2.15 cells and HBV transgenic mice, respectively. The results demonstrated that the HBV EnhI (1,070‑1,234 bp)‑specific ATF significantly inhibited the replication and transcription of HBV DNA in vivo and in vitro. The HBV EnhI‑specific ATF may be a meritorious component of progressive combination therapies for eliminating HBV DNA in infected patients. A radical cure for chronic HBV infection may become feasible by using this bioengineering technology.

  19. Low nucleosome occupancy is encoded around functional human transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Daenen Floris


    Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.

  20. Reconstruction of the core and extended regulons of global transcription factors.

    Directory of Open Access Journals (Sweden)

    Yann S Dufour


    Full Text Available The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across alpha-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual alpha-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 alpha-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator in the alpha-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other

  1. Specificity versus redundancy in the RAP2.4 transcription factor family of Arabidopsis thaliana: transcriptional regulation of genes for chloroplast peroxidases. (United States)

    Rudnik, Radoslaw; Bulcha, Jote Tafese; Reifschneider, Elena; Ellersiek, Ulrike; Baier, Margarete


    The Arabidopsis ERFIb / RAP2.4 transcription factor family consists of eight members with highly conserved DNA binding domains. Selected members have been characterized individually, but a systematic comparison is pending. The redox-sensitive transcription factor RAP2.4a mediates chloroplast-to-nucleus redox signaling and controls induction of the three most prominent chloroplast peroxidases, namely 2-Cys peroxiredoxin A (2CPA) and thylakoid- and stromal ascorbate peroxidase (tAPx and sAPx). To test the specificity and redundancy of RAP2.4 transcription factors in the regulation of genes for chloroplast peroxidases, we compared the DNA-binding sites of the transcription factors in tertiary structure models, analyzed transcription factor and target gene regulation by qRT-PCR in RAP2.4, 2-Cys peroxiredoxin and ascorbate peroxidase T-DNA insertion lines and RAP2.4 overexpressing lines of Arabidopsis thaliana and performed promoter binding studies. All RAP2.4 proteins bound the tAPx promoter, but only the four RAP2.4 proteins with identical DNA contact sites, namely RAP2.4a, RAP2.4b, RAP2.4d and RAP2.4h, interacted stably with the redox-sensitive part of the 2CPA promoter. Gene expression analysis in RAP2.4 knockout lines revealed that RAP2.4a is the only one supporting 2CPA and chloroplast APx expression. Rap2.4h binds to the same promoter region as Rap2.4a and antagonizes 2CPA expression. Like the other six RAP2.4 proteins, Rap2.4 h promotes APx mRNA accumulation. Chloroplast ROS signals induced RAP2.4b and RAP2.4d expression, but these two transcription factor genes are (in contrast to RAP2.4a) insensitive to low 2CP availability, and their expression decreased in APx knockout lines. RAP2.4e and RAP2.4f gradually responded to chloroplast APx availability and activated specifically APx expression. These transcription factors bound, like RAP2.4c and RAP2.4g, the tAPx promoter, but hardly the 2CPA promoter. The RAP2.4 transcription factors form an environmentally and

  2. Survival-related profile, pathways, and transcription factors in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Anne P G Crijns


    Full Text Available BACKGROUND: Ovarian cancer has a poor prognosis due to advanced stage at presentation and either intrinsic or acquired resistance to classic cytotoxic drugs such as platinum and taxoids. Recent large clinical trials with different combinations and sequences of classic cytotoxic drugs indicate that further significant improvement in prognosis by this type of drugs is not to be expected. Currently a large number of drugs, targeting dysregulated molecular pathways in cancer cells have been developed and are introduced in the clinic. A major challenge is to identify those patients who will benefit from drugs targeting these specific dysregulated pathways.The aims of our study were (1 to develop a gene expression profile associated with overall survival in advanced stage serous ovarian cancer, (2 to assess the association of pathways and transcription factors with overall survival, and (3 to validate our identified profile and pathways/transcription factors in an independent set of ovarian cancers. METHODS AND FINDINGS: According to a randomized design, profiling of 157 advanced stage serous ovarian cancers was performed in duplicate using approximately 35,000 70-mer oligonucleotide microarrays. A continuous predictor of overall survival was built taking into account well-known issues in microarray analysis, such as multiple testing and overfitting. A functional class scoring analysis was utilized to assess pathways/transcription factors for their association with overall survival. The prognostic value of genes that constitute our overall survival profile was validated on a fully independent, publicly available dataset of 118 well-defined primary serous ovarian cancers. Furthermore, functional class scoring analysis was also performed on this independent dataset to assess the similarities with results from our own dataset. An 86-gene overall survival profile discriminated between patients with unfavorable and favorable prognosis (median survival, 19

  3. Molecular characterization of Quercus suber MYB1, a transcription factor up-regulated in cork tissues. (United States)

    Almeida, Tânia; Menéndez, Esther; Capote, Tiago; Ribeiro, Teresa; Santos, Conceição; Gonçalves, Sónia


    The molecular processes associated with cork development in Quercus suber L. are poorly understood. A previous molecular approach identified a list of genes potentially important for cork formation and differentiation, providing a new basis for further molecular studies. This report is the first molecular characterization of one of these candidate genes, QsMYB1, coding for an R2R3-MYB transcription factor. The R2R3-MYB gene sub-family has been described as being involved in the phenylpropanoid and lignin pathways, both involved in cork biosynthesis. The results showed that the expression of QsMYB1 is putatively mediated by an alternative splicing (AS) mechanism that originates two different transcripts (QsMYB1.1 and QsMYB1.2), differing only in the 5'-untranslated region, due to retention of the first intron in one of the variants. Moreover, within the retained intron, a simple sequence repeat (SSR) was identified. The upstream regulatory region of QsMYB1 was extended by a genome walking approach, which allowed the identification of the putative gene promoter region. The relative expression pattern of QsMYB1 transcripts determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) revealed that both transcripts were up-regulated in cork tissues; the detected expression was several times higher in newly formed cork harvested from trees producing virgin, second or reproduction cork when compared with wood. Moreover, the expression analysis of QsMYB1 in several Q. suber organs showed very low expression in young branches and roots, whereas in leaves, immature acorns or male flowers, no expression was detected. These preliminary results suggest that QsMYB1 may be related to secondary growth and, in particular, with the cork biosynthesis process with a possible alternative splicing mechanism associated with its regulatory function. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes. (United States)

    Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C


    The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

  5. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor. (United States)

    Kroes, R A; Abravaya, K; Seidenfeld, J; Morimoto, R I


    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or beta-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes. Images PMID:2052560

  6. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.


    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  7. APETALA 2-domain-containing transcription factors: focusing on abscisic acid and gibberellins antagonism. (United States)

    Shu, Kai; Zhou, Wenguan; Yang, Wenyu


    The phytohormones abscisic acid (ABA) and gibberellin (GA) antagonistically mediate diverse plant developmental processes including seed dormancy and germination, root development, and flowering time control, and thus the optimal balance between ABA and GA is essential for plant growth and development. Although more than a half and one century have passed since the initial discoveries of ABA and GA, respectively, the precise mechanisms underlying ABA-GA antagonism still need further investigation. Emerging evidence indicates that two APETALA 2 (AP2)-domain-containing transcription factors (ATFs), ABI4 in Arabidopsis and OsAP2-39 in rice, play key roles in ABA and GA antagonism. These two transcription factors precisely regulate the transcription pattern of ABA and GA biosynthesis or inactivation genes, mediating ABA and GA levels. In this Viewpoint article, we try to shed light on the effects of ATFs on ABA-GA antagonism, and summarize the overlapping but distinct biological functions of these ATFs in the antagonism between