WorldWideScience

Sample records for epithelium barrier function

  1. Prolonged phonation impairs the integrity and barrier function of porcine vocal fold epithelium: a preliminary study.

    Science.gov (United States)

    Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J

    2018-04-18

    Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.

  2. Proton nuclear magnetic resonance study on the barrier function of pig corneal epithelium and endothelium

    International Nuclear Information System (INIS)

    Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.

    1995-01-01

    Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)

  3. Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

    Science.gov (United States)

    Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

    2017-05-19

    The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

  4. Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

    Science.gov (United States)

    Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

    2016-06-01

    Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

  5. Barrier properties of cultured retinal pigment epithelium.

    Science.gov (United States)

    Rizzolo, Lawrence J

    2014-09-01

    The principal function of an epithelium is to form a dynamic barrier that regulates movement between body compartments. Each epithelium is specialized with barrier functions that are specific for the tissues it serves. The apical surface commonly faces a lumen, but the retinal pigment epithelium (RPE) appears to be unique by a facing solid tissue, the sensory retina. Nonetheless, there exists a thin (subretinal) space that can become fluid filled during pathology. RPE separates the subretinal space from the blood supply of the outer retina, thereby forming the outer blood-retinal barrier. The intricate interaction between the RPE and sensory retina presents challenges for learning how accurately culture models reflect native behavior. The challenge is heightened by findings that detail the variation of RPE barrier proteins both among species and at different stages of the life cycle. Among the striking differences is the expression of claudin family members. Claudins are the tight junction proteins that regulate ion diffusion across the spaces that lie between the cells of a monolayer. Claudin expression by RPE varies with species and life-stage, which implies functional differences among commonly used animal models. Investigators have turned to transcriptomics to supplement functional studies when comparing native and cultured tissue. The most detailed studies of the outer blood-retinal barrier have focused on human RPE with transcriptome and functional studies reported for human fetal, adult, and stem-cell derived RPE. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  7. Functional nanoparticles exploit the bile acid pathway to overcome multiple barriers of the intestinal epithelium for oral insulin delivery

    DEFF Research Database (Denmark)

    Fan, Weiwei; Xia, Dengning; Zhu, Quanlei

    2018-01-01

    , especially to avoid lysosomal degradation, and basolateral release. Here, the functional material, deoxycholic acid-conjugated chitosan, is synthesized and loaded with the model protein drug insulin into deoxycholic acid-modified nanoparticles (DNPs). The DNPs designed in this study are demonstrated......Oral absorption of protein/peptide-loaded nanoparticles is often limited by multiple barriers of the intestinal epithelium. In addition to mucus translocation and apical endocytosis, highly efficient transepithelial absorption of nanoparticles requires successful intracellular trafficking...... to endolysosomal escape of DNPs. Additionally, DNPs can interact with a cytosolic ileal bile acid-binding protein that facilitates the intracellular trafficking and basolateral release of insulin. In rats, intravital two-photon microscopy also reveals that the transport of DNPs into the intestinal villi...

  8. Alterations in Factors Involved in Differentiation and Barrier Function in the Epithelium in Oral and Genital Lichen Planus.

    Science.gov (United States)

    Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

    2017-02-08

    Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.

  9. Acute exposure to ergot alkaloids from endophyte-infected tall fescue does not alter absorptive or barrier function of the isolated bovine ruminal epithelium.

    Science.gov (United States)

    Foote, A P; Penner, G B; Walpole, M E; Klotz, J L; Brown, K R; Bush, L P; Harmon, D L

    2014-07-01

    Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in volatile fatty acids (VFA) absorption from the washed rumen of steers. Previous data also indicates that incubating an extract of endophyte-infected tall fescue seed causes an increase in the amount of VFA absorbed per unit of blood flow, which could result from an alteration in the absorptive or barrier function of the rumen epithelium. An experiment was conducted to determine the acute effects of an endophyte-infected tall fescue seed extract (EXT) on total, passive or facilitated acetate and butyrate flux across the isolated bovine rumen as well as the barrier function measured by inulin flux and tissue conductance (G t ). Flux of ergovaline across the rumen epithelium was also evaluated. Rumen tissue from the caudal dorsal sac of Holstein steers (n=6), fed a common diet, was collected and isolated shortly after slaughter and mounted between two halves of Ussing chambers. In vitro treatments included vehicle control (80% methanol, 0.5% of total volume), Low EXT (50 ng ergovaline/ml) and High EXT (250 ng ergovaline/ml). Results indicate that there is no effect of acute exposure to ergot alkaloids on total, passive or facilitated flux of acetate or butyrate across the isolate bovine rumen epithelium (P>0.51). Inulin flux (P=0.16) and G t (P>0.17) were not affected by EXT treatment, indicating no alteration in barrier function due to acute ergot alkaloid exposure. Ergovaline was detected in the serosal buffer of the High EXT treatment indicating that the flux rate is ~0.25 to 0.44 ng/cm2 per hour. Data indicate that specific pathways for VFA absorption and barrier function of the rumen epithelium are not affected by acute exposure to ergot alkaloids from tall fescue at the concentrations tested. Ergovaline has the potential to be absorbed from the rumen of cattle that

  10. A study of the barrier function of the upper respiratory tract covering epithelium in the event of combined respiratory tract injuries

    International Nuclear Information System (INIS)

    Ivanov, Z.; Kolev, K.; Dermendzhiev, Kh.; Nikolova, M.; Kantardzhiev, V.

    1976-01-01

    Functional and morphologic impairment of upper respiratory tract mucous membranes after chronic exposure to the three major occupational noxious agents in ore mining - radon-222, silica dust, and respirable dust - has been studied experimentally. Over a 6-month period, rats were given daily treatments, with the agents applied either individually or in combination. Radon-222 (at 1 x 10 -10 Ci/l, corresponding to the maximum permissible concentrotion in uranium mine atmospheres) and respirable dust (dispersed silicogen at 100 mg/m 3 ) were administered four hours daily in toxicological chambers. Monodisperse silica dust was given by tracheal tube, at 50 mg in 1 ml of saline per rat. At the end of the treatment period, the barrier function of the respiratory epithelium was tested, and found to have been affected, by measuring beta radioactivity in blood following introduction into -the animal's nasopharynx of a 32 P-labelled staphylococcus culture. The most severe degree if impairment was found to result from simultaneous exposure to radon and respirable dust. Any of ti'e agents given individually caused a similar degree of impairment. Intratracheal administration of silicic acid anhydride appeared to have no deleterious consequences. The evidence for functional impairment was supported by histologic findings, indicating Jevelopment of ulcerous bronchitis, metaplasia of cylindrical epithelium, etc., after both individual and combined radon exposure. (A.B.)

  11. Molecular Characterization of Barrier Properties in Follicle-Associated Epithelium of Porcine Peyer's Patches Reveals Major Sealing Function of Claudin-4

    Directory of Open Access Journals (Sweden)

    Judith Radloff

    2017-08-01

    Full Text Available The pig represents a preferred model for the analysis of intestinal immunology. However, the barrier of the follicle-associated epithelium (FAE covering porcine Peyer's patches (PP has not yet been characterized in detail. This study aimed to perform this characterization in order to pave the way toward an understanding of the functional contribution of epithelial barrier properties in gut immunology. Porcine tissue specimens were taken from the distal small intestine in order to obtain electrophysiological data of PP FAE and neighboring villous epithelium (VE, employing the Ussing chamber technique. Transepithelial resistance (TER and paracellular fluorescein flux were measured, and tissues were morphometrically compared. In selfsame tissues, expression and localization of major tight junction (TJ proteins (claudin-1, -2, -3, -4, -5, and -8 were analyzed. PP FAE specimens showed a higher TER and a lower apparent permeability for sodium fluorescein than VE. Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. The results are in accordance with the physiological function of the FAE, which strongly regulates and limits antigen uptake determining a mandatory transcellular route for antigen presentation, highlighting the importance of this structure for the first steps of the intestinal immune response. Thus, this study provides detailed insights into the specific barrier properties of the porcine FAE covering intestinal PP, at the interface of intestinal immunology and barriology.

  12. The epithelium in idiopathic pulmonary fibrosis: breaking the barrier

    Directory of Open Access Journals (Sweden)

    Ana eCamelo

    2014-01-01

    Full Text Available Idiopathic pulmonary fibrosis is a progressive disease of unknown etiology characterised by a dysregulated wound healing response that leads to fatal accumulation of fibroblasts and extracellular matrix in the lung, which compromises tissue architecture and lung function capacity. Injury to type II alveolar epithelial cells is thought to be the key event for the initiation of the disease, and so far both genetic factors, such as mutations in telomerase and MUC5b genes as well as environmental components, like cigarette smoking, exposure to asbestos and viral infections have been implicated as potential initiating triggers. The injured epithelium then enters a state of senescence-associated secretory phenotype whereby it produces both pro-inflammatory and pro-fibrotic factors that contribute to the wound healing process in the lung. Immune cells, like macrophages and neutrophils as well as activated myofibroblasts then perpetuate this cascade of epithelial cell apoptosis and proliferation by release of pro-fibrotic TGF-β and continuous deposition of extracellular matrix stiffens the basement membrane, altogether having a deleterious impact on epithelial cell function. In this review we describe the role of the epithelium as both a physical and immunological barrier between environment and self in the homeostatic versus diseased lung and explore the potential mechanisms of epithelial cell injury and the impact of loss of epithelial cell permeability and function on cytokine production, inflammation and myofibroblast activation in the fibrotic lung.

  13. Epithelium

    Science.gov (United States)

    The term "epithelium" refers to layers of cells that line hollow organs and glands. It is also those cells that make ... Kierszenbaum AL, Tres LL. Epithelium. In: Kierszenbaum AL, Tres LL, ... to Pathology . 4th ed. Philadelphia, PA: Elsevier Saunders; ...

  14. Effect of acute exposure to ergot alkaloids on short-chain fatty acid absorption and barrier function of isolated bovine ruminal epithelium

    Science.gov (United States)

    Ergot alkaloids present in endophyte-infected tall fescue are the causative agents for fescue toxicosis in cattle. Ergot alkaloids have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in short-chain fatty acid (SCFA) absorption from the washed rumen of ste...

  15. Acute exposure to ergot alkaloids from endophyte-infected tall fescue does not alter absorptive or barrier function of the isolated ruminal epithelium

    Science.gov (United States)

    Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in VFA absorption from the washed rumen of steers. Previous data also indicates that incubating an extr...

  16. LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM

    Science.gov (United States)

    Martinez-Palomo, A.; Erlij, D.; Bracho, H.

    1971-01-01

    Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611

  17. Development of a human corneal epithelium model utilizing a collagen vitrigel membrane and the changes of its barrier function induced by exposing eye irritant chemicals.

    Science.gov (United States)

    Takezawa, Toshiaki; Nishikawa, Kazunori; Wang, Pi-Chao

    2011-09-01

    The brief TEER (trans-epithelial electrical resistance) assay after exposing chemicals to corneal epithelium in vivo is known as a suitable method for evaluating corneal irritancy and permeability quantitatively and continuously. A collagen vitrigel membrane we previously developed is a thin (about 20 μm thick) and transparent membrane composed of high density collagen fibrils equivalent to connective tissues in vivo, e.g. corneal Bowman's membrane. To develop such a TEER assay system in vitro utilizing a human corneal epithelial model, HCE-T cells (a human corneal epithelial cell line) were cultured on the collagen vitrigel membrane substratum prepared in a Millicell chamber suitable for TEER measurement. Human corneal epithelium model possessing 5-6 cell layers sufficient for TEER assay was successfully reconstructed on the substratum in the Millicell chamber by culturing the cells in monolayer for 2 days and subsequently in air-liquid interface for 7 days. The exposure of chemicals to the model induced the time-dependent relative changes of TEER in response to the characteristic of each chemical within a few minutes. These results suggest that the TEER assay using the human corneal epithelial model is very useful for an ocular irritancy evaluation as an alternative to the Draize eye irritation test. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Requirement of the Epithelium-specific Ets Transcription Factor Spdef for Mucous Gland Cell Function in the Gastric Antrum*

    OpenAIRE

    Horst, David; Gu, Xuesong; Bhasin, Manoj; Yang, Quanli; Verzi, Michael; Lin, Dongxu; Joseph, Marie; Zhang, Xiaobo; Chen, Wei; Li, Yi-Ping; Shivdasani, Ramesh A.; Libermann, Towia A.

    2010-01-01

    Mucus-secreting cells of the stomach epithelium provide a protective barrier against damage that might result from bacterial colonization or other stimuli. Impaired barrier function contributes to chronic inflammation and cancer. Knock-out mice for the epithelium-specific transcription factor Spdef (also called Pdef) have defects in terminal differentiation of intestinal and bronchial secretory cells. We sought to determine the physiologic function of Spdef in the stomach, another site of sig...

  19. T-Lymphocytes Traffic into the Brain across the Blood-CSF Barrier: Evidence Using a Reconstituted Choroid Plexus Epithelium.

    Science.gov (United States)

    Strazielle, Nathalie; Creidy, Rita; Malcus, Christophe; Boucraut, José; Ghersi-Egea, Jean-François

    2016-01-01

    An emerging concept of normal brain immune surveillance proposes that recently and moderately activated central memory T lymphocytes enter the central nervous system (CNS) directly into the cerebrospinal fluid (CSF) via the choroid plexus. Within the CSF space, T cells inspect the CNS environment for cognate antigens. This gate of entry into the CNS could also prevail at the initial stage of neuroinflammatory processes. To actually demonstrate T cell migration across the choroidal epithelium forming the blood-CSF barrier, an in vitro model of the rat blood-CSF barrier was established in an "inverse" configuration that enables cell transmigration studies in the basolateral to apical, i.e. blood/stroma to CSF direction. Structural barrier features were evaluated by immunocytochemical analysis of tight junction proteins, functional barrier properties were assessed by measuring the monolayer permeability to sucrose and the active efflux transport of organic anions. The migratory behaviour of activated T cells across the choroidal epithelium was analysed in the presence and absence of chemokines. The migration pathway was examined by confocal microscopy. The inverse rat BCSFB model reproduces the continuous distribution of tight junction proteins at cell margins, the restricted paracellular permeability, and polarized active transport mechanisms, which all contribute to the barrier phenotype in vivo. Using this model, we present experimental evidence of T cell migration across the choroidal epithelium. Cell migration appears to occur via a paracellular route without disrupting the restrictive barrier properties of the epithelial interface. Apical chemokine addition strongly stimulates T cell migration across the choroidal epithelium. The present data provide evidence for the controlled migration of T cells across the blood-CSF barrier into brain. They further indicate that this recruitment route is sensitive to CSF-borne chemokines, extending the relevance of this

  20. Engineering Functional Epithelium for Regenerative Medicine and In Vitro Organ Models: A Review

    Science.gov (United States)

    Vrana, Nihal E.; Lavalle, Philippe; Dokmeci, Mehmet R.; Dehghani, Fariba; Ghaemmaghami, Amir M.

    2013-01-01

    Recent advances in the fields of microfabrication, biomaterials, and tissue engineering have provided new opportunities for developing biomimetic and functional tissues with potential applications in disease modeling, drug discovery, and replacing damaged tissues. An intact epithelium plays an indispensable role in the functionality of several organs such as the trachea, esophagus, and cornea. Furthermore, the integrity of the epithelial barrier and its degree of differentiation would define the level of success in tissue engineering of other organs such as the bladder and the skin. In this review, we focus on the challenges and requirements associated with engineering of epithelial layers in different tissues. Functional epithelial layers can be achieved by methods such as cell sheets, cell homing, and in situ epithelialization. However, for organs composed of several tissues, other important factors such as (1) in vivo epithelial cell migration, (2) multicell-type differentiation within the epithelium, and (3) epithelial cell interactions with the underlying mesenchymal cells should also be considered. Recent successful clinical trials in tissue engineering of the trachea have highlighted the importance of a functional epithelium for long-term success and survival of tissue replacements. Hence, using the trachea as a model tissue in clinical use, we describe the optimal structure of an artificial epithelium as well as challenges of obtaining a fully functional epithelium in macroscale. One of the possible remedies to address such challenges is the use of bottom-up fabrication methods to obtain a functional epithelium. Modular approaches for the generation of functional epithelial layers are reviewed and other emerging applications of microscale epithelial tissue models for studying epithelial/mesenchymal interactions in healthy and diseased (e.g., cancer) tissues are described. These models can elucidate the epithelial/mesenchymal tissue interactions at the

  1. Claudin-8d is a cortisol-responsive barrier protein in the gill epithelium of trout.

    Science.gov (United States)

    Kolosov, Dennis; Kelly, Scott P

    2017-10-01

    The influence of claudin (Cldn) 8 tight junction (TJ) proteins on cortisol-mediated alterations in gill epithelium permeability was examined using a primary cultured trout gill epithelium model. Genes encoding three Cldn-8 proteins ( cldn-8b, -8c and -8d ) have been identified in trout and all are expressed in the model gill epithelium. Cortisol treatment 'tightened' the gill epithelium, as indicated by increased transepithelial resistance (TER) and reduced paracellular [ 3 H]polyethylene glycol (MW 400 Da; PEG-400) flux. This occurred in association with elevated cldn-8d mRNA abundance, but no alterations in cldn-8b and -8c mRNA abundance were observed. Transcriptional knockdown (KD) of cldn-8d inhibited a cortisol-induced increase in Cldn-8d abundance and reduced the 'epithelium tightening' effect of cortisol in association with increased paracellular PEG-400 flux. Under simulated in vivo conditions (i.e. apical freshwater), cldn-8d KD hindered a cortisol-mediated reduction in basolateral to apical Na + and Cl - flux (i.e. reduced the ability of cortisol to mitigate ion loss). However, cldn-8d KD did not abolish the tightening effect of cortisol on the gill epithelium. This is likely due, in part, to the effect of cortisol on genes encoding other TJ proteins, which in some cases appeared to exhibit a compensatory response. Data support the idea that Cldn-8d is a barrier protein of the gill epithelium TJ that contributes significantly to corticosteroid-mediated alterations in gill epithelium permeability. © 2017 Society for Endocrinology.

  2. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  3. Low humidity environmental challenge causes barrier disruption and cornification of the mouse corneal epithelium via a c-jun N-terminal kinase 2 (JNK2) pathway.

    Science.gov (United States)

    Pelegrino, F S A; Pflugfelder, S C; De Paiva, C S

    2012-01-01

    Patients with tear dysfunction often experience increased irritation symptoms when subjected to drafty and/or low humidity environmental conditions. The purpose of this study was to investigate the effects of low humidity stress (LHS) on corneal barrier function and expression of cornified envelope (CE) precursor proteins in the epithelium of C57BL/6 and c-jun N-terminal kinase 2 (JNK2) knockout (KO) mice. LHS was induced in both strains by exposure to an air draft for 15 (LHS15D) or 30 days (LHS30D) at a relative humidity LHS15D showed corneal barrier dysfunction, decreased apical corneal epithelial cell area, higher MMP-9 expression and gelatinase activity and increased involucrin and SPRR-2 immunoreactivity in the corneal epithelium compared to NS mice. JNK2KO mice were resistant to LHS-induced corneal barrier disruption. MMP-3,-9,-13, IL-1α, IL-1β, involucrin and SPRR-2a RNA transcripts were significantly increased in C57BL/6 mice at LHS15D, while no change was noted in JNK2KO mice. LHS is capable of altering corneal barrier function, promoting pathologic alteration of the TJ complex and stimulating production of CE proteins by the corneal epithelium. Activation of the JNK2 signaling pathway contributes to corneal epithelial barrier disruption in LHS. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Piezoelectric materials mimic the function of the cochlear sensory epithelium.

    Science.gov (United States)

    Inaoka, Takatoshi; Shintaku, Hirofumi; Nakagawa, Takayuki; Kawano, Satoyuki; Ogita, Hideaki; Sakamoto, Tatsunori; Hamanishi, Shinji; Wada, Hiroshi; Ito, Juichi

    2011-11-08

    Cochlear hair cells convert sound vibration into electrical potential, and loss of these cells diminishes auditory function. In response to mechanical stimuli, piezoelectric materials generate electricity, suggesting that they could be used in place of hair cells to create an artificial cochlear epithelium. Here, we report that a piezoelectric membrane generated electrical potentials in response to sound stimuli that were able to induce auditory brainstem responses in deafened guinea pigs, indicating its capacity to mimic basilar membrane function. In addition, sound stimuli were transmitted through the external auditory canal to a piezoelectric membrane implanted in the cochlea, inducing it to vibrate. The application of sound to the middle ear ossicle induced voltage output from the implanted piezoelectric membrane. These findings establish the fundamental principles for the development of hearing devices using piezoelectric materials, although there are many problems to be overcome before practical application.

  5. Functional annotation of the human retinal pigment epithelium transcriptome

    Directory of Open Access Journals (Sweden)

    Gorgels Theo GMF

    2009-04-01

    Full Text Available Abstract Background To determine level, variability and functional annotation of gene expression of the human retinal pigment epithelium (RPE, the key tissue involved in retinal diseases like age-related macular degeneration and retinitis pigmentosa. Macular RPE cells from six selected healthy human donor eyes (aged 63–78 years were laser dissected and used for 22k microarray studies (Agilent technologies. Data were analyzed with Rosetta Resolver, the web tool DAVID and Ingenuity software. Results In total, we identified 19,746 array entries with significant expression in the RPE. Gene expression was analyzed according to expression levels, interindividual variability and functionality. A group of highly (n = 2,194 expressed RPE genes showed an overrepresentation of genes of the oxidative phosphorylation, ATP synthesis and ribosome pathways. In the group of moderately expressed genes (n = 8,776 genes of the phosphatidylinositol signaling system and aminosugars metabolism were overrepresented. As expected, the top 10 percent (n = 2,194 of genes with the highest interindividual differences in expression showed functional overrepresentation of the complement cascade, essential in inflammation in age-related macular degeneration, and other signaling pathways. Surprisingly, this same category also includes the genes involved in Bruch's membrane (BM composition. Among the top 10 percent of genes with low interindividual differences, there was an overrepresentation of genes involved in local glycosaminoglycan turnover. Conclusion Our study expands current knowledge of the RPE transcriptome by assigning new genes, and adding data about expression level and interindividual variation. Functional annotation suggests that the RPE has high levels of protein synthesis, strong energy demands, and is exposed to high levels of oxidative stress and a variable degree of inflammation. Our data sheds new light on the molecular composition of BM, adjacent to the

  6. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  7. Histone Deacetylase Inhibition Restores Retinal Pigment Epithelium Function in Hyperglycemia.

    Directory of Open Access Journals (Sweden)

    Danielle Desjardins

    Full Text Available In diabetic individuals, macular edema is a major cause of vision loss. This condition is refractory to insulin therapy and has been attributed to metabolic memory. The retinal pigment epithelium (RPE is central to maintaining fluid balance in the retina, and this function is compromised by the activation of advanced glycation end-product receptors (RAGE. Here we provide evidence that acute administration of the RAGE agonist, glycated-albumin (gAlb or vascular endothelial growth factor (VEGF, increased histone deacetylase (HDAC activity in RPE cells. The administration of the class I/II HDAC inhibitor, trichostatin-A (TSA, suppressed gAlb-induced reductions in RPE transepithelial resistance (in vitro and fluid transport (in vivo. Systemic TSA also restored normal RPE fluid transport in rats with subchronic hyperglycemia. Both gAlb and VEGF increased HDAC activity and reduced acetyl-α-tubulin levels. Tubastatin-A, a relatively specific antagonist of HDAC6, inhibited gAlb-induced changes in RPE cell resistance. These data are consistent with the idea that RPE dysfunction following exposure to gAlb, VEGF, or hyperglycemia is associated with increased HDAC6 activity and decreased acetyl-α-tubulin. Therefore, we propose inhibiting HDAC6 in the RPE as a potential therapy for preserving normal fluid homeostasis in the hyperglycemic retina.

  8. Gene expression and functional annotation of the human and mouse choroid plexus epithelium.

    Directory of Open Access Journals (Sweden)

    Sarah F Janssen

    Full Text Available BACKGROUND: The choroid plexus epithelium (CPE is a lobed neuro-epithelial structure that forms the outer blood-brain barrier. The CPE protrudes into the brain ventricles and produces the cerebrospinal fluid (CSF, which is crucial for brain homeostasis. Malfunction of the CPE is possibly implicated in disorders like Alzheimer disease, hydrocephalus or glaucoma. To study human genetic diseases and potential new therapies, mouse models are widely used. This requires a detailed knowledge of similarities and differences in gene expression and functional annotation between the species. The aim of this study is to analyze and compare gene expression and functional annotation of healthy human and mouse CPE. METHODS: We performed 44k Agilent microarray hybridizations with RNA derived from laser dissected healthy human and mouse CPE cells. We functionally annotated and compared the gene expression data of human and mouse CPE using the knowledge database Ingenuity. We searched for common and species specific gene expression patterns and function between human and mouse CPE. We also made a comparison with previously published CPE human and mouse gene expression data. RESULTS: Overall, the human and mouse CPE transcriptomes are very similar. Their major functionalities included epithelial junctions, transport, energy production, neuro-endocrine signaling, as well as immunological, neurological and hematological functions and disorders. The mouse CPE presented two additional functions not found in the human CPE: carbohydrate metabolism and a more extensive list of (neural developmental functions. We found three genes specifically expressed in the mouse CPE compared to human CPE, being ACE, PON1 and TRIM3 and no human specifically expressed CPE genes compared to mouse CPE. CONCLUSION: Human and mouse CPE transcriptomes are very similar, and display many common functionalities. Nonetheless, we also identified a few genes and pathways which suggest that the CPE

  9. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  10. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  11. Loss of Retinal Function and Pigment Epithelium Changes in a Patient with Common Variable Immunodeficiency

    Directory of Open Access Journals (Sweden)

    Jakob Halborg

    2012-01-01

    Full Text Available Common variable immunodeficiency (CVID has only scarcely been associated with ocular symptoms and rarely with retinal disease. In this case we describe a patient with distinct morphological and functional alterations in the retina. The patient presents with characteristic changes in retinal pigment epithelium, autofluorescence, and electrophysiology.

  12. Conserved form and function of the germinal epithelium through 500 million years of vertebrate evolution.

    Science.gov (United States)

    Grier, Harry J; Uribe, Mari Carmen; Lo Nostro, Fabiana L; Mims, Steven D; Parenti, Lynne R

    2016-08-01

    The germinal epithelium, i.e., the site of germ cell production in males and females, has maintained a constant form and function throughout 500 million years of vertebrate evolution. The distinguishing characteristic of germinal epithelia among all vertebrates, males, and females, is the presence of germ cells among somatic epithelial cells. The somatic epithelial cells, Sertoli cells in males or follicle (granulosa) cells in females, encompass and isolate germ cells. Morphology of all vertebrate germinal epithelia conforms to the standard definition of an epithelium: epithelial cells are interconnected, border a body surface or lumen, are avascular and are supported by a basement membrane. Variation in morphology of gonads, which develop from the germinal epithelium, is correlated with the evolution of reproductive modes. In hagfishes, lampreys, and elasmobranchs, the germinal epithelia of males produce spermatocysts. A major rearrangement of testis morphology diagnoses osteichthyans: the spermatocysts are arranged in tubules or lobules. In protogynous (female to male) sex reversal in teleost fishes, female germinal epithelial cells (prefollicle cells) and oogonia transform into the first male somatic cells (Sertoli cells) and spermatogonia in the developing testis lobules. This common origin of cell types from the germinal epithelium in fishes with protogynous sex reversal supports the homology of Sertoli cells and follicle cells. Spermatogenesis in amphibians develops within spermatocysts in testis lobules. In amniotes vertebrates, the testis is composed of seminiferous tubules wherein spermatogenesis occurs radially. Emerging research indicates that some mammals do not have lifetime determinate fecundity. The fact emerged that germinal epithelia occur in the gonads of all vertebrates examined herein of both sexes and has the same form and function across all vertebrate taxa. Continued study of the form and function of the germinal epithelium in vertebrates

  13. Blood-aqueous Barrier Function in a Patient With Choroideremia

    Directory of Open Access Journals (Sweden)

    Muh-Shy Chen

    2010-02-01

    Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

  14. Ex vivo generation of a functional and regenerative wound epithelium from axolotl (Ambystoma mexicanum) skin.

    Science.gov (United States)

    Ferris, Donald R; Satoh, Akira; Mandefro, Berhan; Cummings, Gillian M; Gardiner, David M; Rugg, Elizabeth L

    2010-10-01

    Urodele amphibians (salamanders) are unique among adult vertebrates in their ability to regenerate structurally complete and fully functional limbs. Regeneration is a stepwise process that requires interactions between keratinocytes, nerves and fibroblasts. The formation of a wound epithelium covering the amputation site is an early and necessary event in the process but the molecular mechanisms that underlie the role of the wound epithelium in regeneration remain unclear. We have developed an ex vivo model that recapitulates many features of in vivo wound healing. The model comprises a circular explant of axolotl (Ambystoma mexicanum) limb skin with a central circular, full thickness wound. Re-epithelialization of the wound area is rapid (typically <11 h) and is dependent on metalloproteinase activity. The ex vivo wound epithelium is viable, responds to neuronal signals and is able to participate in ectopic blastema formation and limb regeneration. This ex vivo model provides a reproducible and tractable system in which to study the cellular and molecular events that underlie wound healing and regeneration. © 2010 The Authors. Journal compilation © 2010 Japanese Society of Developmental Biologists.

  15. Expression pattern of adhesion molecules in junctional epithelium differs from that in other gingival epithelia.

    Science.gov (United States)

    Hatakeyama, S; Yaegashi, T; Oikawa, Y; Fujiwara, H; Mikami, T; Takeda, Y; Satoh, M

    2006-08-01

    The gingival epithelium is the physiologically important interface between the bacterially colonized gingival sulcus and periodontal soft and mineralized connective tissues, requiring protection from exposure to bacteria and their products. However, of the three epithelia comprising the gingival epithelium, the junctional epithelium has much wider intercellular spaces than the sulcular epithelium and oral gingival epithelium. Hence, the aim of the present study was to characterize the cell adhesion structure in the junctional epithelium compared with the other two epithelia. Gingival epithelia excised at therapeutic flap surgery from patients with periodontitis were examined for expression of adhesion molecules by immunofluorescence. In the oral gingival epithelium and sulcular epithelium, but not in the junctional epithelium, desmoglein 1 and 2 in cell-cell contact sites were more abundant in the upper than the suprabasal layers. E-cadherin, the main transmembranous molecule of adherens junctions, was present in spinous layers of the oral gingival epithelium and sulcular epithelium, but was scarce in the junctional epithelium. In contrast, desmoglein 3 and P-cadherin were present in all layers of the junctional epithelium as well as the oral gingival epithelium and sulcular epithelium. Connexin 43 was clearly localized to spinous layers of the oral gingival epithelium, sulcular epithelium and parts of the junctional epithelium. Claudin-1 and occludin were expressed in the cell membranes of a few superficial layers of the oral gingival epithelium. These findings indicated that the junctional epithelium contains only a few desmosomes, composed of only desmoglein 3; adherens junctions are probably absent because of defective E-cadherin. Thus, the anchoring junctions connecting junctional epithelium cells are lax, causing widened intercellular spaces. In contrast, the oral gingival epithelium, which has a few tight junctions, functions as a barrier.

  16. Cellular specificity of the blood-CSF barrier for albumin transfer across the choroid plexus epithelium.

    Directory of Open Access Journals (Sweden)

    Shane A Liddelow

    Full Text Available To maintain the precise internal milieu of the mammalian central nervous system, well-controlled transfer of molecules from periphery into brain is required. Recently the soluble and cell-surface albumin-binding glycoprotein SPARC (secreted protein acidic and rich in cysteine has been implicated in albumin transport into developing brain, however the exact mechanism remains unknown. We postulate that SPARC is a docking site for albumin, mediating its uptake and transfer by choroid plexus epithelial cells from blood into cerebrospinal fluid (CSF. We used in vivo physiological measurements of transfer of endogenous (mouse and exogenous (human albumins, in situ Proximity Ligation Assay (in situ PLA, and qRT-PCR experiments to examine the cellular mechanism mediating protein transfer across the blood-CSF interface. We report that at all developmental stages mouse albumin and SPARC gave positive signals with in situ PLAs in plasma, CSF and within individual plexus cells suggesting a possible molecular interaction. In contrast, in situ PLA experiments in brain sections from mice injected with human albumin showed positive signals for human albumin in the vascular compartment that were only rarely identifiable within choroid plexus cells and only at older ages. Concentrations of both endogenous mouse albumin and exogenous (intraperitoneally injected human albumin were estimated in plasma and CSF and expressed as CSF/plasma concentration ratios. Human albumin was not transferred through the mouse blood-CSF barrier to the same extent as endogenous mouse albumin, confirming results from in situ PLA. During postnatal development Sparc gene expression was higher in early postnatal ages than in the adult and changed in response to altered levels of albumin in blood plasma in a differential and developmentally regulated manner. Here we propose a possible cellular route and mechanism by which albumin is transferred from blood into CSF across a sub

  17. Artificial Cochlear Sensory Epithelium with Functions of Outer Hair Cells Mimicked Using Feedback Electrical Stimuli

    Directory of Open Access Journals (Sweden)

    Tetsuro Tsuji

    2018-05-01

    Full Text Available We report a novel vibration control technique of an artificial auditory cochlear epithelium that mimics the function of outer hair cells in the organ of Corti. The proposed piezoelectric and trapezoidal membrane not only has the acoustic/electric conversion and frequency selectivity of the previous device developed mainly by one of the authors and colleagues, but also has a function to control local vibration according to sound stimuli. Vibration control is achieved by applying local electrical stimuli to patterned electrodes on an epithelium made using micro-electro-mechanical system technology. By choosing appropriate phase differences between sound and electrical stimuli, it is shown that it is possible to both amplify and dampen membrane vibration, realizing better control of the response of the artificial cochlea. To be more specific, amplification and damping are achieved when the phase difference between the membrane vibration by sound stimuli and electrical stimuli is zero and π , respectively. We also demonstrate that the developed control system responds automatically to a change in sound frequency. The proposed technique can be applied to mimic the nonlinear response of the outer hair cells in a cochlea, and to realize a high-quality human auditory system.

  18. Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice

    Science.gov (United States)

    Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo

    2013-01-01

    The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809

  19. Uniting Control Lyapunov and Control Barrier Functions

    NARCIS (Netherlands)

    Romdlony, Zakiyullah; Jayawardhana, Bayu

    2014-01-01

    In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on

  20. Review: Exogenous butyrate: implications for the functional development of ruminal epithelium and calf performance.

    Science.gov (United States)

    Niwińska, B; Hanczakowska, E; Arciszewski, M B; Klebaniuk, R

    2017-09-01

    The importance of the use of exogenous butyrate in calves' diets is due to its role as a factor stimulating the functional development of ruminal epithelium and improving calf performance during the transition from preruminant to ruminant status. Our review will first present results related to effects of the administration of butyrate in calves' diets on the development of ruminal epithelium toward a more effective absorption and metabolism of fermentation products from the rumen. The introduction of sodium butyrate at a level of about 0.3% of diet dry matter is accompanied by an increase to 35% in butyrate concentration in the rumen of 33-day-old calves. Mutual reliance between an enhanced ruminal concentration of butyrate and the activities of transcription factors, genes and proteins involved in cell proliferation, ketogenesis and the maintenance of cell pH homeostasis in the ruminal epithelial cells has been clearly confirmed in many experiments. Second, the review presents results related to the effects of the introduction of butyrate salts in the diet on calf performance. Of 11 studies a positive effect was found in six; five of these were obtained from the calves that started receiving butyrate supplement at a level of about 0.3% diet dry matter from the age of 3 to 5 days. Results indicate that when a supplement is given to calves soon after birth the functional development of ruminal epithelium in cooperation with the endocrine and digestion systems is transferred into improving the efficiency of rearing. There have been no studies on the effects of greater amounts of butyrate salts in milk replacer; butyrate constitutes about 1.2% of the whole cow's milk dry matter. In older calves, when butyrate administration is provided as a component of a starter concentrate at the increasing inclusion rate from 0.3% to 3.0%, the practical effect in calf performance relates to the risk of depression of rumen pH below 5.5 and accompanying disruption of the

  1. Permanent isolation surface barrier: Functional performance

    International Nuclear Information System (INIS)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release

  2. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  3. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  4. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  5. Role of serotonin in the intestinal mucosal epithelium barrier in weaning mice undergoing stress-induced diarrhea.

    Science.gov (United States)

    Dong, Yulan; Wang, Zixu; Qin, Zhuoming; Cao, Jing; Chen, Yaoxing

    2018-02-01

    Stress-induced diarrhea is a frequent and challenging threat to humans and domestic animals. Serotonin (5-HT) has been shown to be involved in the pathological process of stress-induced diarrhea. However, the role of 5-HT in stress-induced diarrhea remains unclear. A stress-induced diarrhea model was established in 21-day-old ICR weaning mice through an intragastric administration of 0.25 mL of 0.4 g/mL folium sennae and restraint of the hind legs with adhesive tape for 4 h to determine whether 5-HT regulates the mucosal barrier to cause diarrhea. Mice with decreased levels of 5-HT were pretreated with an intraperitoneal injection of 300 mg/kg p-chlorophenylalanine (PCPA), a 5-HT synthesis inhibitor. After 5 days of treatment, the stress level, body weight and intestinal mucosal morphology indexes were measured. Compared to the controls, the mice with stress-induced diarrhea displayed a stress reaction, with increased corticosterone levels, as well as increased 5-HT-positive cells. However, the mice with stress-induced diarrhea exhibited decreased body weights, villus height to crypt depth ratios (V/C), and Occludin and Claudin1 expression. The PCPA injection reversed these effects in mice with different degrees of stress-induced diarrhea. Based on these findings, inhibition of 5-HT synthesis relieved the stress response and improved the health of the intestinal tract, including both the intestinal absorption capacity, as determined by the villus height and crypt depth, and the mucosal barrier function, as determined by the tight junction proteins of epithelial cell.

  6. Induction of Functional 3D Ciliary Epithelium-Like Structure From Mouse Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Kinoshita, Hirofumi; Suzuma, Kiyoshi; Kaneko, Jun; Mandai, Michiko; Kitaoka, Takashi; Takahashi, Masayo

    2016-01-01

    To generate ciliary epithelium (CE) from mouse induced pluripotent stem (iPS) cells. Recently, a protocol for self-organizing optic cup morphogenesis in three-dimensional culture was reported, and it was suggested that ocular tissue derived from neural ectoderm could be differentiated. We demonstrated that a CE-like double-layered structure could be induced in simple culture by using a modified Eiraku differentiation protocol. Differentiation of a CE-like double-layered structure could be promoted by glycogen synthase kinase 3β (GSK-3β) inhibitor. Connexin43 and aquaporin1 were expressed in both thin layers, and induced CE-like cells expressed ciliary marker genes, such as cyclinD2, zic1, tgfb2, aldh1a3, wfdc1, otx1, BMP4, and BMP7. Increases in cytoplasmic and nuclear β-catenin in aggregates of the CE-like double-layered structure were confirmed by Western blot analysis. In addition, tankyrase inhibitor prevented the induction of the CE-like double-layered structure by GSK-3β inhibitor. Dye movement from pigmented cells to nonpigmented cells in the mouse iPS cell-derived CE-like structure was observed in a fluid movement experiment, consistent with the physiological function of CE in vivo. We could differentiate CE from mouse iPS cells in the present study. In the future, we hope that this CE-like complex will become useful as a graft for transplantation therapy in pathologic ocular hypotension due to CE dysfunction, and as a screening tool for the development of drugs for diseases associated with CE function.

  7. Fine structure and function of the alimentary epithelium in Artemia salina nauplii

    Energy Technology Data Exchange (ETDEWEB)

    Hootman, S R; Conte, F P

    1974-01-01

    The fine structure of the alimentary tract in the second instar nauplius of the brine shrimp, Artemia salina, has been described. The foregut and hindgut of the larva are composed of cuboidal epithelium which is cuticularized. The epithelium of the midgut and gastric caeca is columnar and is characterized by apical microvilli, basal membrane infolds, and abundant mitochondria. The structural characteristics of the midgut cells correlate with previous physiological and biochemical evidence on both adult and larval brine shrimp which indicates that the midgut plays an important role in absorption and osmoregulation in these animals.

  8. Gut microbiota and probiotics in modulation of epithelium and gut-associated lymphoid tissue function.

    Science.gov (United States)

    Sanz, Yolanda; De Palma, Giada

    2009-01-01

    The intestinal tract mucosa is exposed to a vast number of environmental antigens and a large community of commensal bacteria. The mucosal immune system has to provide both protection against pathogens and tolerance to harmless bacteria. Immune homeostasis depends on the interaction of indigenous commensal and transient bacteria (probiotics) with various components of the epithelium and the gut-associated lymphoid tissue. Herein, an update is given of the mechanisms by which the gut microbiota and probiotics are translocated through the epithelium, sensed via pattern-recognition receptors, and activate innate and adaptive immune responses.

  9. Combination of retinal pigment epithelium cell-conditioned medium and photoreceptor outer segments stimulate mesenchymal stem cell differentiation toward a functional retinal pigment epithelium cell phenotype.

    Science.gov (United States)

    Huang, Chen; Zhang, Jing; Ao, Mingxin; Li, Ying; Zhang, Chun; Xu, Yonggen; Li, Xuemin; Wang, Wei

    2012-02-01

    Recent studies have suggested that bone marrow-derived mesenchymal stem cells (BMMSCs) are capable of retinal tissue-specific differentiation but not retinal pigment epithelium (RPE) cell-specific differentiation. Photoreceptor outer segments (POS) contribute to RPE development and maturation. However, there has been no standard culture system that fosters the differentiation of BMMSCs into mature RPE cells in vitro. In this study, we investigated if the soluble factors from RPE cells and POS could differentiate BMMSCs into cells having a phenotype characteristic of RPE cells. Rat BMMSCs were separately co-cultured with RPE cells, or they were exposed to either control medium, RPE cell-conditioned medium (RPECM), POS, or a combination of RPECM and POS (RPECM-POS). After 7 days, the cells were analyzed for morphology and the expression of RPE markers (cytokeratin 8, CRALBP, and RPE65) to assess the RPE differentiation. Significantly higher pigment accumulation and increased protein expression of the three markers were seen in cells cultured in RPECM-POS than in other treated cultures. Furthermore, the RPECM-POS-treated cultures displayed ultrastructural features typical of RPE cells, expressed RPE cell functional proteins, and had the capability to phagocytose POS. Together, theses results suggest the combination of RPECM and POS stimulate BMMSCs differentiation toward a functional RPE phenotype. Our results provide the foundation for a new route to RPE regenerative therapy involving BMMSCs. Future work isolating the active agent in RPECM and POS would be useful in therapies for RPE diseases or in developing appropriately pre-differentiated BMMSCs for tissue-engineered RPE reconstruction. Copyright © 2011 Wiley Periodicals, Inc.

  10. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  11. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  12. Structurally and functionally characterized in vitro model of rabbit vocal fold epithelium.

    Science.gov (United States)

    Mizuta, Masanobu; Kurita, Takashi; Kimball, Emily E; Rousseau, Bernard

    2017-06-01

    In this paper, we describe a method for primary culture of a well differentiated electrically tight rabbit vocal fold epithelial cell multilayer and the measurement of transepithelial electrical resistance (TEER) for the evaluation of epithelial barrier function in vitro. Rabbit larynges were harvested and enzymatically treated to isolate vocal fold epithelial cells and to establish primary culture. Vocal fold epithelial cells were co-cultured with mitomycin C-treated feeder cells on collagen-coated plates. After 10-14 days in primary culture, cells were passaged and cultured until they achieved 70-90% confluence on collagen-coated plates. Epithelial cells were then passaged onto collagen-coated cell culture inserts using 4.5cm 2 membrane filters (1.0μm pore size) with 10% fetal bovine serum or 30μg/mL bovine pituitary extract to investigate the effects of growth-promoting additives on TEER. Additional experiments were performed to investigate optimal seeding density (1.1, 2.2, 4.4, or 8.9×10 5 cells/cm 2 ), the effect of co-culture with feeder cells, and the effect of passage number on epithelial barrier function. Characterization of in vitro cultures was performed using hematoxylin and eosin staining and immunostaining for vocal fold epithelial cell markers and tight junctions. Results revealed higher TEER in cells supplemented with fetal bovine serum compared to bovine pituitary extract. TEER was highest in cells passaged at a seeding density of 2.2×10 4 cells/cm 2 , and TEER was higher in cells at passage two than passage three. Ultrastructural experiments revealed a well-differentiated epithelial cell multilayer, expressing the epithelial cell markers CK13, CK14 and the tight junction proteins occludin and ZO-1. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

    Directory of Open Access Journals (Sweden)

    Charles W Higdon

    Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

  14. Cellular distribution and function of ion channels involved in transport processes in rat tracheal epithelium.

    Science.gov (United States)

    Hahn, Anne; Faulhaber, Johannes; Srisawang, Lalita; Stortz, Andreas; Salomon, Johanna J; Mall, Marcus A; Frings, Stephan; Möhrlen, Frank

    2017-06-01

    Transport of water and electrolytes in airway epithelia involves chloride-selective ion channels, which are controlled either by cytosolic Ca 2+ or by cAMP The contributions of the two pathways to chloride transport differ among vertebrate species. Because rats are becoming more important as animal model for cystic fibrosis, we have examined how Ca 2+ - dependent and cAMP- dependent Cl - secretion is organized in the rat tracheal epithelium. We examined the expression of the Ca 2+ -gated Cl - channel anoctamin 1 (ANO1), the cystic fibrosis transmembrane conductance regulator (CFTR) Cl - channel, the epithelial Na + channel ENaC, and the water channel aquaporin 5 (AQP5) in rat tracheal epithelium. The contribution of ANO1 channels to nucleotide-stimulated Cl - secretion was determined using the channel blocker Ani9 in short-circuit current recordings obtained from primary cultures of rat tracheal epithelial cells in Ussing chambers. We found that ANO1, CFTR and AQP5 proteins were expressed in nonciliated cells of the tracheal epithelium, whereas ENaC was expressed in ciliated cells. Among nonciliated cells, ANO1 occurred together with CFTR and Muc5b and, in addition, in a different cell type without CFTR and Muc5b. Bioelectrical studies with the ANO1-blocker Ani9 indicated that ANO1 mediated the secretory response to the nucleotide uridine-5'-triphosphate. Our data demonstrate that, in rat tracheal epithelium, Cl - secretion and Na + absorption are routed through different cell types, and that ANO1 channels form the molecular basis of Ca 2+ -dependent Cl - secretion in this tissue. These characteristic features of Cl - -dependent secretion reveal similarities and distinct differences to secretory processes in human airways. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  15. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  16. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  17. Process of tight junction recovery in the injured vocal fold epithelium: Morphological and paracellular permeability analysis.

    Science.gov (United States)

    Suzuki, Ryo; Katsuno, Tatsuya; Kishimoto, Yo; Nakamura, Ryosuke; Mizuta, Masanobu; Suehiro, Atsushi; Yamashita, Masaru; Nakamura, Tatsuo; Tateya, Ichiro; Omori, Koichi

    2018-04-01

    The vocal fold epithelium that includes tight junction (TJ)-based barrier function protects underlying connective tissues from external insults. TJs play an important role to control paracellular permeability of not only solutes but also ions, and preserve the vocal fold homeostasis. However, the distribution of TJs and paracellular diffusion barrier across the entire vocal fold epithelium are still unknown. The aim of this study was to identify the distribution of TJs in the vocal fold epithelium and to characterize the recovery process of TJ-based paracellular diffusion barrier in a rat model of vocal fold injury. Animal experiments with controls. Normal and vocal fold-injured rats were used. Larynges were harvested for immunohistochemical examination of TJ proteins. For functional analysis, a tracer permeability assay was performed using EZ-Link Sulfo-NHS-LC-Biotin. TJ proteins occludin and zonula occludens 1 signals were localized to the junctional regions of the most luminal cell layers of the vocal fold epithelium. The injured region had been recovered with epithelium at 5 days postinjury, but the paracellular diffusion barrier assays revealed that biotinylation reagents diffused into the lamina propria at 5 days postinjury, and were blocked at the epithelium at 14 and 28 days postinjury. It was strongly suggested that TJs in the vocal fold epithelium exist at the junctional regions of the first layer of stratified squamous epithelium. TJ-based paracellular diffusion barrier following vocal fold injury is recovered by 14 days postinjury, and this period corresponds with the time course of structural changes in the regenerating epithelium layer. NA. Laryngoscope, 128:E150-E156, 2018. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  18. Crossing safety barriers: influence of children's morphological and functional variables.

    Science.gov (United States)

    Cordovil, Rita; Vieira, Filomena; Barreiros, João

    2012-05-01

    Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  19. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-05-01

    Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  20. Relationships between Electrokinetic Index of buccal epithelium and some functional and metabolic parameters at men with chronic pyelonephrite

    Directory of Open Access Journals (Sweden)

    Iryna G. Kyrylenko

    2016-01-01

      Abstracts   Background. Known for a number of parameters of the body, which through regression equations derived can assess biological age. We examined relationships between electrokinetic mobility buccal epithelium cell nuclei, named Electrokinetic Index (EKI, and some functional and metabolic parameters of body. Methods. Under a observations were 23 men by age 24-70 years with chronic pyelonephrite in the phase of remission. We estimated the EKI, state of the vegetative and hormonal regulation as well as metabolism of cholesterol. Results. We confirned closely correlation (r=-0,89 between Metric Age and EKI. Baevskiy’s Adaptation Potential and Stange’s Test together determines EKI on 28%. RMSSD, VLF and Baevskiy’s Stress Index determines EKI on 31%. Plasma Colesterol and Klimov’s Atherogenicity Coefficient determines EKI on 56%. In summary model of multiple regression with stepwise excluding are currently two last parameters as well as Plasma Testosterone and relative Power Spectral VLF HRV, which together determines EKI on 73%: R=0,868; R2=0,754; Adjusted R2=0,730;F(4,4=31,4; χ2(4=58,9; p<10-5. Conclusion. Electrokinetic Index of buccal epithelium really rellects neuro-endocrine regulation and metabolism of Cholesterol.   Keywords: Electrokinetic Index, Biological Age, HRV, Cholesterol, Testosterone, Cortisol, Relationships.

  1. Excreted/secreted Trichuris suis products reduce barrier function and suppress inflammatory cytokine production of intestinal epithelial cells

    DEFF Research Database (Denmark)

    Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.

    2014-01-01

    The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...

  2. Progenitor Epithelium

    Science.gov (United States)

    Marty-Santos, Leilani

    2015-01-01

    Insulin-producing β cells within the vertebrate fetal pancreas acquire their fate in a step-wise manner. Whereas the intrinsic factors dictating the transcriptional or epigenetic status of pancreatic lineages have been intensely examined, less is known about cell–cell interactions that might constitute a niche for the developing β cell lineage. It is becoming increasingly clear that understanding and recapitulating these steps may instruct in vitro differentiation of embryonic stem cells and/or therapeutic regeneration. Indeed, directed differentiation techniques have improved since transitioning from 2D to 3D cultures, suggesting that the 3D microenvironment in which β cells are born is critical. However, to date, it remains unknown whether the changing architecture of the pancreatic epithelium impacts the fate of cells therein. An emerging challenge in the field is to elucidate how progenitors are allocated during key events, such as the stratification and subsequent resolution of the pre-pancreatic epithelium, as well as the formation of lumens and branches. Here, we assess the progenitor epithelium and examine how it might influence the emergence of pancreatic multipotent progenitors (MPCs), which give rise to β cells and other pancreatic lineages. PMID:26216134

  3. Expressions of TRPVs in the cholesteatoma epithelium.

    Science.gov (United States)

    Do, Ba Hung; Koizumi, Hiroki; Ohbuchi, Toyoaki; Kawaguchi, Rintaro; Suzuki, Hideaki

    2017-10-01

    We have recently proposed a hypothesis that acid leakage through the cholesteatoma epithelium mediates bone resorption in middle ear cholesteatoma. In the present study, we investigated the expressions of transient receptor potential vanilloid (TRPV) channels, which have been shown to play roles in the regulation of epidermal barrier function, in the cholesteatoma epithelium in comparison with the normal skin. Cholesteatoma epithelium and postauricular skin were collected from 17 patients with primary acquired middle ear cholesteatoma who underwent tympanomastoidectomy. Expressions of TRPV1, TRPV3, TRPV4, and TRPV6 were explored by fluorescence immunohistochemistry and quantitative reverse transcription-polymerase chain reaction (qRT-PCR). TRPV1, TRPV3, TRPV4, and TRPV6 mRNAs were all detected by qRT-PCR both in the skin and cholesteatoma tissue. Immunohistochemical staining showed that TRPV1 and TRPV3 were positive in the viable cell layers of the epidermis of the skin, and only TRPV3 was positive in those of the cholesteatoma epithelium. The immunoreactivity for TRPV3 was significantly weaker in cholesteatoma than in the skin. The lower expression of TRPV3 in cholesteatoma may be one of the mechanisms underlying the increased permeability of this tissue. On the other hand, TRPV1, TRPV4, and TRPV6 are unlikely to be involved in the regulation of epithelial permeability in cholesteatoma.

  4. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  5. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  6. Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

    International Nuclear Information System (INIS)

    Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.

    2004-01-01

    Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

  7. HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

    Science.gov (United States)

    Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

    2014-07-01

    The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

  8. Preservation of visual cortical function following retinal pigment epithelium transplantation in the RCS rat using optical imaging techniques.

    Science.gov (United States)

    Gias, Carlos; Jones, Myles; Keegan, David; Adamson, Peter; Greenwood, John; Lund, Ray; Martindale, John; Johnston, David; Berwick, Jason; Mayhew, John; Coffey, Peter

    2007-04-01

    The aim of this study was to determine the extent of cortical functional preservation following retinal pigment epithelium (RPE) transplantation in the Royal College of Surgeons (RCS) rat using single-wavelength optical imaging and spectroscopy. The cortical responses to visual stimulation in transplanted rats at 6 months post-transplantation were compared with those from age-matched untreated dystrophic and non-dystrophic rats. Our results show that cortical responses were evoked in non-dystrophic rats to both luminance changes and pattern stimulation, whereas no response was found in untreated dystrophic animals to any of the visual stimuli tested. In contrast, a cortical response was elicited in most of the transplanted rats to luminance changes and in many of those a response was also evoked to pattern stimulation. Although the transplanted rats did not respond to high spatial frequency information we found evidence of preservation in the cortical processing of luminance changes and low spatial frequency stimulation. Anatomical sections of transplanted rat retinas confirmed the capacity of RPE transplantation to rescue photoreceptors. Good correlation was found between photoreceptor survival and the extent of cortical function preservation determined with optical imaging techniques. This study determined the efficacy of RPE transplantation to preserve visual cortical processing and established optical imaging as a powerful technique for its assessment.

  9. Tumor suppressor function of Syk in human MCF10A in vitro and normal mouse mammary epithelium in vivo.

    Directory of Open Access Journals (Sweden)

    You Me Sung

    2009-10-01

    Full Text Available The normal function of Syk in epithelium of the developing or adult breast is not known, however, Syk suppresses tumor growth, invasion, and metastasis in breast cancer cells. Here, we demonstrate that in the mouse mammary gland, loss of one Syk allele profoundly increases proliferation and ductal branching and invasion of epithelial cells through the mammary fat pad during puberty. Mammary carcinomas develop by one year. Syk also suppresses proliferation and invasion in vitro. siRNA or shRNA knockdown of Syk in MCF10A breast epithelial cells dramatically increased proliferation, anchorage independent growth, cellular motility, and invasion, with formation of functional, extracellular matrix-degrading invadopodia. Morphological and gene microarray analysis following Syk knockdown revealed a loss of luminal and differentiated epithelial features with epithelial to mesenchymal transition and a gain in invadopodial cell surface markers CD44, CD49F, and MMP14. These results support the role of Syk in limiting proliferation and invasion of epithelial cells during normal morphogenesis, and emphasize the critical role of Syk as a tumor suppressor for breast cancer. The question of breast cancer risk following systemic anti-Syk therapy is raised since only partial loss of Syk was sufficient to induce mammary carcinomas.

  10. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  11. Generation of Functional Thymic Epithelium from Human Embryonic Stem Cells that Supports Host T Cell Development

    OpenAIRE

    Parent, Audrey V.; Russ, Holger A.; Khan, Imran S.; LaFlam, Taylor N.; Metzger, Todd C.; Anderson, Mark S.; Hebrok, Matthias

    2013-01-01

    Inducing immune tolerance to prevent rejection is a key step toward successful engraftment of stem-cell-derived tissue in a clinical setting. Using human pluripotent stem cells to generate thymic epithelial cells (TECs) capable of supporting T cell development represents a promising approach to reach this goal; however, progress toward generating functional TECs has been limited. Here, we describe a robust in vitro method to direct differentiation of human embryonic stem cells (hESCs) into th...

  12. Intestinal epithelium in inflammatory bowel disease

    DEFF Research Database (Denmark)

    Coskun, Mehmet

    2014-01-01

    The intestinal epithelium has a strategic position as a protective physical barrier to luminal microbiota and actively contributes to the mucosal immune system. This barrier is mainly formed by a monolayer of specialized intestinal epithelial cells (IECs) that are crucial in maintaining intestinal...... of inflammatory bowel disease (IBD). Understanding the role of the intestinal epithelium in IBD pathogenesis might contribute to an improved knowledge of the inflammatory processes and the identification of potential therapeutic targets....

  13. Functional short- and long-term effects of nasal CPAP with and without humidification on the ciliary function of the nasal respiratory epithelium.

    Science.gov (United States)

    Sommer, J Ulrich; Kraus, Marius; Birk, Richard; Schultz, Johannes D; Hörmann, Karl; Stuck, Boris A

    2014-03-01

    Continuous positive airway pressure (CPAP) is the gold standard in the treatment of obstructive sleep apnea (OSA), but its impact on ciliary function is unclear to date. Furthermore, CPAP is associated with numerous side effects related to the nose and upper airway. Humidified CPAP is used to relieve these symptoms, but again, little is known regarding its effect on ciliary function of the nasal respiratory epithelium. In this prospective, randomized, crossover trial, 31 patients with OSA (AHI >15/h) were randomized to two treatment arms: nasal continuous positive airway pressure (nCPAP) with humidification or nCPAP without humidification for one night in each modality to assess short-term effects of ciliary beat frequency (CBF) and mucus transport time (MTT) and consecutively for 8 weeks in each modality to assess long-term effects in a crossover fashion. The baseline CBF was 4.8 ± 0.6 Hz, and baseline MTT was 540 ± 221 s. After one night of CPAP with and without humidification, ciliary function increased moderately yet with statistical significance (p humidification did not differ statistically significant. Regarding long-term effects of CPAP, a statistically significant increase in ciliary function above the baseline level and above the short-term level was shown without humidification (7.2 ± 0.4 Hz; 402 ± 176 s; p humidification (9.3 ± 0.7 Hz; 313 ± 95 s; p humidification, nCPAP has moderate effects on short-term ciliary function of the nasal respiratory epithelium. However, a significant increase in ciliary function-both in terms of an increased CBF and a decreased MTT-was detected after long-term use. The effect was more pronounced when humidification was used during nCPAP.

  14. Functional promiscuity in a mammalian chemosensory system: extensive expression of vomeronasal receptors in the main olfactory epithelium of mouse lemurs

    Directory of Open Access Journals (Sweden)

    Philipp eHohenbrink

    2014-09-01

    Full Text Available The vomeronasal organ (VNO is functional in most terrestrial mammals, though progressively reduced in the primate lineage, and is used for intraspecific communication and predator recognition. Vomeronasal receptor (VR genes comprise two families of chemosensory genes (V1R and V2R that have been considered to be specific for the VNO. However, recently a large number of VRs were reported to be expressed in the main olfactory epithelium (MOE of mice, but there is little knowledge of the expression of these genes outside of rodents. To explore the function of VR genes in mammalian evolution, we analyzed and compared the expression of 64 V1R and 2 V2R genes in the VNO and the MOE of the grey mouse lemur (Microcebus murinus, the primate with the largest known VR repertoire. We furthermore compared expression patterns in adults of both sexes and seasons, and in an infant. A large proportion (83% – 97% of the VR loci was expressed in the VNO of all individuals. The repertoire in the infant was as rich as in adults, indicating reliance on olfactory communication from early postnatal development onwards. In concordance with mice, we also detected extensive expression of VRs in the MOE, with proportions of expressed loci in individuals ranging from 29% to 45%. TRPC2, which encodes a channel protein crucial for signal transduction via VRs, was co-expressed in the MOE in all individuals indicating likely functionality of expressed VR genes in the MOE. In summary, the large VR repertoire in mouse lemurs seems to be highly functional. Given the differences in the neural pathways of MOE and VNO signals, which project to higher cortical brain centers or the limbic system, respectively, this raises the intriguing possibility that the evolution of MOE-expression of VRs enabled mouse lemurs to adaptively diversify the processing of VR-encoded olfactory information.

  15. Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

    NARCIS (Netherlands)

    Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

    2016-01-01

    We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

  16. A Proinflammatory Function of Toll-Like Receptor 2 in the Retinal Pigment Epithelium as a Novel Target for Reducing Choroidal Neovascularization in Age-Related Macular Degeneration.

    Science.gov (United States)

    Feng, Lili; Ju, Meihua; Lee, Kei Ying V; Mackey, Ashley; Evangelista, Mariasilvia; Iwata, Daiju; Adamson, Peter; Lashkari, Kameran; Foxton, Richard; Shima, David; Ng, Yin Shan

    2017-10-01

    Current treatments for choroidal neovascularization, a major cause of blindness for patients with age-related macular degeneration, treat symptoms but not the underlying causes of the disease. Inflammation has been strongly implicated in the pathogenesis of choroidal neovascularization. We examined the inflammatory role of Toll-like receptor 2 (TLR2) in age-related macular degeneration. TLR2 was robustly expressed by the retinal pigment epithelium in mouse and human eyes, both normal and with macular degeneration/choroidal neovascularization. Nuclear localization of NF-κB, a major downstream target of TLR2 signaling, was detected in the retinal pigment epithelium of human eyes, particularly in eyes with advanced stages of age-related macular degeneration. TLR2 antagonism effectively suppressed initiation and growth of spontaneous choroidal neovascularization in a mouse model, and the combination of anti-TLR2 and antivascular endothelial growth factor receptor 2 yielded an additive therapeutic effect on both area and number of spontaneous choroidal neovascularization lesions. Finally, in primary human fetal retinal pigment epithelium cells, ligand binding to TLR2 induced robust expression of proinflammatory cytokines, and end products of lipid oxidation had a synergistic effect on TLR2 activation. Our data illustrate a functional role for TLR2 in the pathogenesis of choroidal neovascularization, likely by promoting inflammation of the retinal pigment epithelium, and validate TLR2 as a novel therapeutic target for reducing choroidal neovascularization. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  18. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Science.gov (United States)

    Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti

    2016-01-01

    Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  19. Barrier functions for Pucci-Heisenberg operators and applications

    OpenAIRE

    Cutri , Alessandra; Tchou , Nicoletta

    2007-01-01

    International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

  20. Safety barriers and safety functions a comparison of different applications

    International Nuclear Information System (INIS)

    Harms-Ringdahl, L.

    1998-01-01

    A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

  1. The effect of long-term administered CRAC channels blocker on the functions of respiratory epithelium in guinea pig allergic asthma model.

    Science.gov (United States)

    Sutovska, Martina; Kocmalova, Michaela; Joskova, Marta; Adamkov, Marian; Franova, Sona

    2015-04-01

    Previously, therapeutic potency of CRAC channels blocker was evidenced as a significant decrease in airway smooth muscle hyperreactivity, antitussive and anti-inflammatory effects. The major role of the respiratory epithelium in asthma pathogenesis was highlighted only recently and CRAC channels were proposed as the most significant route of Ca2+ entry into epithelial cells. The aim of the study was to analyse the impact of long-term administered CRAC channels blocker on airway epithelium, e.g. cytokine production and ciliary beat frequency (CBF) using an animal model of allergic asthma. Ovalbumin-induced allergic airway inflammation of guinea pigs was followed by long-term (14 days lasted) therapy by CRAC blocker (3-fluoropyridine-4-carboxylic acid, FPCA). The influence of long-term therapy on cytokines (IL-4, IL-5 and IL-13) in BALF and in plasma, immunohistochemical staining of pulmonary tissue (c-Fos positivity) and CBF in vitro were used for analysis. Decrease in cytokine levels and in c-Fos positivity confirmed an anti-inflammatory effect of long-term administered FPCA. Cytokine levels in BALF and distribution of c-Fos positivity suggested that FPCA was a more potent inhibitor of respiratory epithelium secretory functions than budesonide. FPCA and budesonide reduced CBF only insignificantly. All findings supported CRAC channels as promising target in the new strategy of antiasthmatic treatment.

  2. Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

    Science.gov (United States)

    Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

    2017-11-01

    Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function

  3. Effects of carprofen on the integrity and barrier function of canine colonic mucosa.

    Science.gov (United States)

    Briere, Catherine A; Hosgood, Giselle; Morgan, Timothy W; Hedlund, Cheryl S; Hicks, Merrin; McConnico, Rebecca S

    2008-02-01

    To measure effects of carprofen on conductance and permeability to mannitol and histologic appearance in canine colonic mucosa. Colonic mucosa from 13 mature mixed-breed dogs. Procedures-Sections of mucosa from the transverse colon and proximal and distal portions of the descending colon were obtained immediately after dogs were euthanized. Sections were mounted in Ussing chambers. Carprofen (400 microg/mL) was added to the bathing solution for treated sections. Conductance was calculated at 15-minute intervals for 240 minutes. Flux of mannitol was calculated for three 1-hour periods. Histologic examination of sections was performed after experiments concluded. Conductance was graphed against time for each chamber, and area under each curve was calculated. Conductance X time, flux of mannitol, and frequency distribution of histologic findings were analyzed for an effect of region and carprofen. Carprofen significantly increased mean conductance X time, compared with values for control (untreated) sections for all regions of colon. Carprofen significantly increased mean flux of mannitol from period 1 to period 2 and from period 2 to period 3 for all regions of colon. Carprofen caused a significant proportion of sections to have severe sloughing of cells and erosions involving >or= 10% of the epithelium, compared with control sections. Carprofen increased in vitro conductance and permeability to mannitol in canine colonic mucosa. Carprofen resulted in sloughing of cells and erosion of the colonic mucosa. These findings suggested that carprofen can compromise the integrity and barrier function of the colonic mucosa of dogs.

  4. EMMPRIN Modulates Epithelial Barrier Function through a MMP–Mediated Occludin Cleavage

    Science.gov (United States)

    Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E.

    2011-01-01

    Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. PMID:21777561

  5. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  6. Histopathological and ultrastructural changes experimentally induced by bee venom in seminiferous epithelium via structural-functional alteration of Sertoli cells.

    Science.gov (United States)

    Florea, Adrian; Puică, Constantin; Hamed, Sami; Tilinca, Mariana; Matei, Horea

    2017-11-01

    We tested here the ability of bee venom (BV) to interfere with spermatogenesis in rats in two experimental conditions. The histopathological changes were assessed with brightfield microscopy using a novel staining technique, based on methylene blue, orange G and ponceau xylidine. Transmission electron microscopy was also used to identify fine subcellular changes. BV injection for 30days in daily doses of 700μg BV/kg resulted in reducing testicular weight, along with significant larger diameters of seminiferous tubules and reduced number of Sertoli cells (SCs). SCs were vacuolated, detached from the basement membrane, many necrosed, leading to the basement membrane denudation. Germ cells layers were separated by empty spaces conferring a rarefied aspect to the tissue, and spermatids were detached into lumen. Thus, the seminiferous epithelium was significantly thinned. Many Leydig cells (LCs) were in a necrotic state, with disrupted plasma membrane and without smooth endoplasmic reticulum. The acute treatment with a single LD50 of 62mgBV/kg, was followed by focal disruptions of the basement membrane and localized areas of necrosis, mainly affecting the SCs. Most of the observed SCs as well as some spermatogonia were highly vacuoled, empty spaces being observed within the epithelium. The SCs count was significantly decreased. Spermatids had also the tendency of separation from the SCs, and the significant larger diameter of the tubules found was associated with a thicker epithelium. Many LCs were necrosed, with disrupted plasma membrane, swollen mitochondria, no endoplasmic reticulum and implicitly showing rarefied cytoplasm. We concluded that BV was a testicular toxicant affecting both the LCs and the seminiferous tubules. The SCs cells represented the primary target site of BV whose effects were next extended upon the germ cells. In all cells, BV triggered unspecific degenerative changes that could impaire spermatogenesis. The present study also proposes an

  7. The Effects of Anthrax Lethal Toxin on Host Barrier Function

    Directory of Open Access Journals (Sweden)

    David M. Frucht

    2011-06-01

    Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

  8. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Directory of Open Access Journals (Sweden)

    Xinxin Liu

    Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  9. Crossing the entropy barrier of dynamical zeta functions

    International Nuclear Information System (INIS)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

  10. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  11. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  12. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  13. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  14. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

  15. Ginger Extract Suppresses Inflammatory Response and Maintains Barrier Function in Human Colonic Epithelial Caco-2 Cells Exposed to Inflammatory Mediators.

    Science.gov (United States)

    Kim, Yunyoung; Kim, Dong-Min; Kim, Ji Yeon

    2017-05-01

    The beneficial effects of ginger in the management of gastrointestinal disturbances have been reported. In this study, the anti-inflammatory potential of ginger extract was assessed in a cellular model of gut inflammation. In addition, the effects of ginger extract and its major active compounds on intestinal barrier function were evaluated. The response of Caco-2 cells following exposure to a mixture of inflammatory mediators [interleukin [IL]-1β, 25 ng/mL; lipopolysaccharides [LPS], 10 ng/mL; tumor necrosis factor [TNF]-α, 50 ng/mL; and interferon [INF]-γ, 50 ng/mL] were assessed by measuring the levels of secreted IL-6 and IL-8. In addition, the mRNA levels of cyclooxygenase-2 and inducible nitric oxide synthase were measured. Moreover, the degree of nuclear factor (NF)-κB inhibition was examined, and the intestinal barrier function was determined by measuring the transepithelial electrical resistance (TEER) and fluorescein isothiocyanate (FITC)-dextran transfer. It was observed that ginger extract and its constituents improved inflammatory responses by decreasing the levels of nitrite, PGE2, IL-6, and IL-8 via NF-κB inhibition. The ginger extract also increased the TEER and decreased the transfer of FITC-dextran from the apical side of the epithelium to the basolateral side. Taken together, these results show that ginger extract may be developed as a functional food for the maintenance of gastrointestinal health. © 2017 Institute of Food Technologists®.

  16. The junctional epithelium originates from the odontogenic epithelium of an erupted tooth.

    Science.gov (United States)

    Yajima-Himuro, Sara; Oshima, Masamitsu; Yamamoto, Gou; Ogawa, Miho; Furuya, Madoka; Tanaka, Junichi; Nishii, Kousuke; Mishima, Kenji; Tachikawa, Tetsuhiko; Tsuji, Takashi; Yamamoto, Matsuo

    2014-05-02

    The junctional epithelium (JE) is an epithelial component that is directly attached to the tooth surface and has a protective function against periodontal diseases. In this study, we determined the origin of the JE using a bioengineered tooth technique. We transplanted the bioengineered tooth germ into the alveolar bone with an epithelial component that expressed green fluorescence protein. The reduced enamel epithelium from the bioengineered tooth fused with the oral epithelium, and the JE was apparently formed around the bioengineered tooth 50 days after transplantation. Importantly, the JE exhibited green fluorescence for at least 140 days after transplantation, suggesting that the JE was not replaced by oral epithelium. Therefore, our results demonstrated that the origin of the JE was the odontogenic epithelium, and odontogenic epithelium-derived JE was maintained for a relatively long period.

  17. Interferon-β induced in female genital epithelium by HIV-1 glycoprotein 120 via Toll-like-receptor 2 pathway acts to protect the mucosal barrier.

    Science.gov (United States)

    Nazli, Aisha; Dizzell, Sara; Zahoor, Muhammad Atif; Ferreira, Victor H; Kafka, Jessica; Woods, Matthew William; Ouellet, Michel; Ashkar, Ali A; Tremblay, Michel J; Bowdish, Dawn Me; Kaushic, Charu

    2018-03-19

    More than 40% of HIV infections occur via female reproductive tract (FRT) through heterosexual transmission. Epithelial cells that line the female genital mucosa are the first line of defense against HIV-1 and other sexually transmitted pathogens. These sentient cells recognize and respond to external stimuli by induction of a range of carefully balanced innate immune responses. Previously, we have shown that in response to HIV-1 gp120, the genital epithelial cells (GECs) from upper reproductive tract induce an inflammatory response that may facilitate HIV-1 translocation and infection. In this study, we report that the endometrial and endocervical GECs simultaneously induce biologically active interferon-β (IFNβ) antiviral responses following exposure to HIV-1 that act to protect the epithelial tight junction barrier. The innate antiviral response was directly induced by HIV-1 envelope glycoprotein gp120 and addition of gp120 neutralizing antibody inhibited IFNβ production. Interferon-β was induced by gp120 in upper GECs through Toll-like receptor 2 signaling and required presence of heparan sulfate on epithelial cell surface. The induction of IFNβ was dependent upon activation of transcription factor IRF3 (interferon regulatory factor 3). The IFNβ was biologically active, had a protective effect on epithelial tight junction barrier and was able to inhibit HIV-1 infection in TZM-bl indicator cells and HIV-1 replication in T cells. This is the first report that recognition of HIV-1 by upper GECs leads to induction of innate antiviral pathways. This could explain the overall low infectivity of HIV-1 in the FRT and could be exploited for HIV-1 prophylaxis.Cellular and Molecular Immunology advance online publication, 19 March 2018; doi:10.1038/cmi.2017.168.

  18. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  19. Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

    International Nuclear Information System (INIS)

    Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

    2006-01-01

    The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

  20. Regulation of Tight Junctions in Upper Airway Epithelium

    Directory of Open Access Journals (Sweden)

    Takashi Kojima

    2013-01-01

    Full Text Available The mucosal barrier of the upper respiratory tract including the nasal cavity, which is the first site of exposure to inhaled antigens, plays an important role in host defense in terms of innate immunity and is regulated in large part by tight junctions of epithelial cells. Tight junction molecules are expressed in both M cells and dendritic cells as well as epithelial cells of upper airway. Various antigens are sampled, transported, and released to lymphocytes through the cells in nasal mucosa while they maintain the integrity of the barrier. Expression of tight junction molecules and the barrier function in normal human nasal epithelial cells (HNECs are affected by various stimuli including growth factor, TLR ligand, and cytokine. In addition, epithelial-derived thymic stromal lymphopoietin (TSLP, which is a master switch for allergic inflammatory diseases including allergic rhinitis, enhances the barrier function together with an increase of tight junction molecules in HNECs. Furthermore, respiratory syncytial virus infection in HNECs in vitro induces expression of tight junction molecules and the barrier function together with proinflammatory cytokine release. This paper summarizes the recent progress in our understanding of the regulation of tight junctions in the upper airway epithelium under normal, allergic, and RSV-infected conditions.

  1. Sleep Restriction Impairs Blood–Brain Barrier Function

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

    2014-01-01

    The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

  2. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  3. In vivo models of human airway epithelium repair and regeneration

    Directory of Open Access Journals (Sweden)

    C. Coraux

    2005-12-01

    Full Text Available Despite an efficient defence system, the airway surface epithelium, in permanent contact with the external milieu, is frequently injured by inhaled pollutants, microorganisms and viruses. The response of the airway surface epithelium to an acute injury includes a succession of cellular events varying from the loss of the surface epithelium integrity to partial shedding of the epithelium or even to complete denudation of the basement membrane. The epithelium has then to repair and regenerate to restore its functions. The in vivo study of epithelial regeneration in animal models has shown that airway epithelial cells are able to dedifferentiate, spread, migrate over the denuded basement membrane and progressively redifferentiate to reconstitute a functional respiratory epithelium after several weeks. Humanised tracheal xenograft models have been developed in immunodeficient nude and severe combined immunodeficient (SCID mice in order to mimic the natural regeneration process of the human airway epithelium and to analyse the cellular and molecular events involved during the different steps of airway epithelial reconstitution. These models represent very powerful tools for analysing the modulation of the biological functions of the epithelium during its regeneration. They are also very useful for identifying stem/progenitor cells of the human airway epithelium. A better knowledge of the mechanisms involved in airway epithelium regeneration, as well as the characterisation of the epithelial stem and progenitor cells, may pave the way to regenerative therapeutics, allowing the reconstitution of a functional airway epithelium in numerous respiratory diseases, such as asthma, chronic obstructive pulmonary diseases, cystic fibrosis and bronchiolitis.

  4. Evidence for the functional involvement of members of the TRP channel family in the uptake of Na(+) and NH4 (+) by the ruminal epithelium.

    Science.gov (United States)

    Rosendahl, Julia; Braun, Hannah S; Schrapers, Katharina T; Martens, Holger; Stumpff, Friederike

    2016-08-01

    Large quantities of protein are degraded in the fermentative parts of the gut to ammonia, which is absorbed, detoxified to urea, and excreted, leading to formation of nitrogenous compounds such as N2O that are associated with global warming. In ruminants, channel-mediated uptake of NH4 (+) from the rumen predominates. The molecular identity of these channels remains to be clarified. Ruminal cells and epithelia from cows and sheep were investigated using patch clamp, Ussing chamber, microelectrode techniques, and qPCR. In patch clamp experiments, bovine ruminal epithelial cells expressed a conductance for NH4 (+) that could be blocked in a voltage-dependent manner by divalent cations. In the native epithelium, NH4 (+) depolarized the apical potential, acidified the cytosol and induced a rise in short-circuit current (I sc) that persisted after the removal of Na(+), was blocked by verapamil, enhanced by the removal of divalent cations, and was sensitive to certain transient receptor potential (TRP) channel modulators. Menthol or thymol stimulated the I sc in Na(+) or NH4 (+) containing solutions in a dose-dependent manner and modulated transepithelial Ca(2+) fluxes. On the level of messenger RNA (mRNA), ovine and bovine ruminal epithelium expressed TRPA1, TRPV3, TRPV4, TRPM6, and TRPM7, with any expression of TRPV6 marginal. No bands were detected for TRPV1, TRPV5, or TRPM8. Functional and molecular biological data suggest that the transport of NH4 (+), Na(+), and Ca(2+) across the rumen involves TRP channels, with TRPV3 and TRPA1 emerging as prime candidate genes. TRP channels may also contribute to the transport of NH4 (+) across other epithelia.

  5. Recovery of Vocal Fold Epithelium after Acute Phonotrauma.

    Science.gov (United States)

    Rousseau, Bernard; Kojima, Tsuyoshi; Novaleski, Carolyn K; Kimball, Emily E; Valenzuela, Carla V; Mizuta, Masanobu; Daniero, James J; Garrett, C Gaelyn; Sivasankar, M Preeti

    2017-01-01

    We investigated the timeline of tissue repair of vocal fold epithelium after acute vibration exposure using an in vivo rabbit model. Sixty-five New Zealand white breeder rabbits were randomized to 120 min of modal- or raised-intensity phonation. After the larynges were harvested at 0, 4, 8, and 24 h, and at 3 and 7 days, the vocal fold tissue was evaluated using electron microscopy and quantitative real-time polymerase chain reaction. There was an immediate decrease in the microprojection depth and height following raised-intensity phonation, paired with upregulation of cyclooxygenase-2. This initial 24-h period was also characterized by the significant downregulation of junction proteins. Interleukin 1β and transforming growth factor β1 were upregulated for 3 and 7 days, respectively, followed by an increase in epithelial cell surface depth at 3 and 7 days. These data appear to demonstrate a shift from inflammatory response to the initiation of a restorative process in the vocal fold epithelium between 24 h and 3 days. Despite the initial damage from raised-intensity phonation, the vocal fold epithelium demonstrates a remarkable capacity for the expeditious recovery of structural changes from transient episodes of acute phonotrauma. While structurally intact, the return of functional barrier integrity may be delayed by repeated episodes of phonotrauma and may also play an important role in the pathophysiology of vocal fold lesions. © 2017 S. Karger AG, Basel.

  6. deltaNp63 has a role in maintaining epithelial integrity in airway epithelium.

    Science.gov (United States)

    Arason, Ari Jon; Jonsdottir, Hulda R; Halldorsson, Skarphedinn; Benediktsdottir, Berglind Eva; Bergthorsson, Jon Thor; Ingthorsson, Saevar; Baldursson, Olafur; Sinha, Satrajit; Gudjonsson, Thorarinn; Magnusson, Magnus K

    2014-01-01

    The upper airways are lined with a pseudostratified bronchial epithelium that forms a barrier against unwanted substances in breathing air. The transcription factor p63, which is important for stratification of skin epithelium, has been shown to be expressed in basal cells of the lungs and its ΔN isoform is recognized as a key player in squamous cell lung cancer. However, the role of p63 in formation and maintenance of bronchial epithelia is largely unknown. The objective of the current study was to determine the expression pattern of the ΔN and TA isoforms of p63 and the role of p63 in the development and maintenance of pseudostratified lung epithelium in situ and in culture. We used a human bronchial epithelial cell line with basal cell characteristics (VA10) to model bronchial epithelium in an air-liquid interface culture (ALI) and performed a lentiviral-based silencing of p63 to characterize the functional and phenotypic consequences of p63 loss. We demonstrate that ΔNp63 is the major isoform in the human lung and its expression was exclusively found in the basal cells lining the basement membrane of the bronchial epithelium. Knockdown of p63 affected proliferation and migration of VA10 cells and facilitated cellular senescence. Expression of p63 is critical for epithelial repair as demonstrated by wound healing assays. Importantly, generation of pseudostratified VA10 epithelium in the ALI setup depended on p63 expression and goblet cell differentiation, which can be induced by IL-13 stimulation, was abolished by the p63 knockdown. After knockdown of p63 in primary bronchial epithelial cells they did not proliferate and showed marked senescence. We conclude that these results strongly implicate p63 in the formation and maintenance of differentiated pseudostratified bronchial epithelium.

  7. Functional Anatomy and Oncologic Barriers of the Larynx.

    Science.gov (United States)

    Mor, Niv; Blitzer, Andrew

    2015-08-01

    Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.

    Science.gov (United States)

    McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L

    2014-04-01

    This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.

  9. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  10. Methamphetamine Effects on Blood-Brain Barrier Structure and Function

    Directory of Open Access Journals (Sweden)

    Nicole Alia Northrop

    2015-03-01

    Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.

  11. A nuclide transfer model for barriers of the seabed repository using response function

    International Nuclear Information System (INIS)

    Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo

    1996-01-01

    A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)

  12. Molecular and functional expression of high conductance Ca 2+ activated K+ channels in the eel intestinal epithelium

    DEFF Research Database (Denmark)

    Lionetto, Maria G; Rizzello, Antonia; Giordano, Maria E

    2008-01-01

    Several types of K(+) channels have been identified in epithelial cells. Among them high conductance Ca(2+)-activated K(+) channels (BK channels) are of relevant importance for their involvement in regulatory volume decrease (RVD) response following hypotonic stress. The aim of the present work...... was to investigate the functional and molecular expression of BK in the eel intestine, which is a useful experimental model for cell volume regulation research. In the present paper using rat BK channel-specific primer, a RT-PCR signal of 696 pb cDNA was detected in eel intestine, whole nucleotide sequence showed...... high similarity (83%) to the alpha subunit of BK channel family. BK channel protein expression was verified by immunoblotting and confocal microscopy, while the functional role of BK channels in epithelial ion transport mechanisms and cell volume regulation was examined by electrophysiological...

  13. New insights into potential functions for the protein 4.1superfamily of proteins in kidney epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Calinisan, Venice; Gravem, Dana; Chen, Ray Ping-Hsu; Brittin,Sachi; Mohandas, Narla; Lecomte, Marie-Christine; Gascard, Philippe

    2005-06-17

    Members of the protein 4.1 family of adapter proteins are expressed in a broad panel of tissues including various epithelia where they likely play an important role in maintenance of cell architecture and polarity and in control of cell proliferation. We have recently characterized the structure and distribution of three members of the protein 4.1 family, 4.1B, 4.1R and 4.1N, in mouse kidney. We describe here binding partners for renal 4.1 proteins, identified through the screening of a rat kidney yeast two-hybrid system cDNA library. The identification of putative protein 4.1-based complexes enables us to envision potential functions for 4.1 proteins in kidney: organization of signaling complexes, response to osmotic stress, protein trafficking, and control of cell proliferation. We discuss the relevance of these protein 4.1-based interactions in kidney physio-pathology in the context of their previously identified functions in other cells and tissues. Specifically, we will focus on renal 4.1 protein interactions with beta amyloid precursor protein (beta-APP), 14-3-3 proteins, and the cell swelling-activated chloride channel pICln. We also discuss the functional relevance of another member of the protein 4.1 superfamily, ezrin, in kidney physiopathology.

  14. Effect of a Semi-Purified Oligosaccharide-Enriched Fraction from Caprine Milk on Barrier Integrity and Mucin Production of Co-Culture Models of the Small and Large Intestinal Epithelium

    OpenAIRE

    Alicia M. Barnett; Nicole C. Roy; Warren C. McNabb; Adrian L. Cookson

    2016-01-01

    Caprine milk contains the highest amount of oligosaccharides among domestic animals, which are structurally similar to human milk oligosaccharides (HMOs). This suggests caprine milk oligosaccharides may offer similar protective and developmental effects to that of HMOs. However, to date, studies using oligosaccharides from caprine milk have been limited. Thus, this study aimed to examine the impact of a caprine milk oligosaccharide-enriched fraction (CMOF) on barrier function of epithelial ce...

  15. Intestinal epithelium in inflammatory bowel disease

    Directory of Open Access Journals (Sweden)

    Mehmet eCoskun

    2014-08-01

    Full Text Available The intestinal epithelium has a strategic position as a protective physical barrier to luminal microbiota and actively contributes to the mucosal immune system. This barrier is mainly formed by a monolayer of specialized intestinal epithelial cells (IECs that are crucial in maintaining intestinal homeostasis. Therefore, dysregulation within the epithelial layer can increase intestinal permeability, lead to abnormalities in interactions between IECs and immune cells in underlying lamina propria, and disturb the intestinal immune homeostasis, all of which are linked to the clinical disease course of inflammatory bowel disease (IBD. Understanding the role of the intestinal epithelium in IBD pathogenesis might contribute to an improved knowledge of the inflammatory processes and the identification of potential therapeutic targets.

  16. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  17. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    International Nuclear Information System (INIS)

    Svenson, Ola

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses

  18. Radiation-induced functional damages in the regeneration system for the gastrointestinal epithelium cell and analysis of its nutritional modification

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Kazuhiko; Narita, Mayumi; Ogawa, Yuko; Shinohara, Kiyoko; Nakazawa, Yukiko; Yamada, Keiko [National Inst. of Health and Nutrition, Tokyo (Japan)

    2000-02-01

    It has been known that the stem cells of villus-crypt zone are highly sensitive to radiation exposure. In this study, radiation-induced damages in gastrointestinal cell regeneration system were investigated from an aspect of nutritional factors to clarify the damages in digestive functions caused by X-ray exposure and recovery from them. The activities of digestive enzymes in the small intestine after in vivo X-ray exposure at 100 Gy were determined. The sucrose activity in the upper intestine was gradually reduced to about a half 3 days after the exposure. This change pattern of activity was also observed in other regions in the intestine. This tendency was similar to that of trehalase activity, but the changes in alkaline phosphatase and leucine amino-peptidase activities were less than the above two enzymes. Therefore, time course changes of sucrose and trehalase pattern in the villus-crypt zone were monitored after radiation exposure. Either of the two enzyme activities was low in the crypt and gradually increased from the basement of villus to its top. These activities were dose-dependently reduced by X-ray exposure. Especially it was marked for trehalose activity. Moreover, the amounts of short-chain fatty acids such as acetic acid, propionic acid, butylic acid in the cecum were determined. Significant increases in acetic acid and propionic acid contents were fount at 1 or 2 days after the X-ray exposure. These increases in fatty acids contents were more distinctive in the animals that received forced and free administration of food than those that received free administration alone. The presence of food components in the intestine might be effective for protecting the mucous membrane regeneration from radiation exposure. (M.N.)

  19. Effect of a Semi-Purified Oligosaccharide-Enriched Fraction from Caprine Milk on Barrier Integrity and Mucin Production of Co-Culture Models of the Small and Large Intestinal Epithelium

    Directory of Open Access Journals (Sweden)

    Alicia M. Barnett

    2016-05-01

    Full Text Available Caprine milk contains the highest amount of oligosaccharides among domestic animals, which are structurally similar to human milk oligosaccharides (HMOs. This suggests caprine milk oligosaccharides may offer similar protective and developmental effects to that of HMOs. However, to date, studies using oligosaccharides from caprine milk have been limited. Thus, this study aimed to examine the impact of a caprine milk oligosaccharide-enriched fraction (CMOF on barrier function of epithelial cell co-cultures of absorptive enterocytes (Caco-2 cells and mucus-secreting goblet cells (HT29-MTX cells, that more closely simulate the cell proportions found in the small (90:10 and large intestine (75:25. Treatment of epithelial co-cultures with 0.4, 1.0, 2.0 and 4.0 mg/mL of CMOF was shown to have no effect on metabolic activity but did enhance cell epithelial barrier integrity as measured by trans-epithelial electrical resistance (TEER, in a dose-dependent manner. The CMOF at the maximum concentration tested (4.0 mg/mL enhanced TEER, mucin gene expression and mucin protein abundance of epithelial co-cultures, all of which are essential components of intestinal barrier function.

  20. Effect of a Semi-Purified Oligosaccharide-Enriched Fraction from Caprine Milk on Barrier Integrity and Mucin Production of Co-Culture Models of the Small and Large Intestinal Epithelium.

    Science.gov (United States)

    Barnett, Alicia M; Roy, Nicole C; McNabb, Warren C; Cookson, Adrian L

    2016-05-06

    Caprine milk contains the highest amount of oligosaccharides among domestic animals, which are structurally similar to human milk oligosaccharides (HMOs). This suggests caprine milk oligosaccharides may offer similar protective and developmental effects to that of HMOs. However, to date, studies using oligosaccharides from caprine milk have been limited. Thus, this study aimed to examine the impact of a caprine milk oligosaccharide-enriched fraction (CMOF) on barrier function of epithelial cell co-cultures of absorptive enterocytes (Caco-2 cells) and mucus-secreting goblet cells (HT29-MTX cells), that more closely simulate the cell proportions found in the small (90:10) and large intestine (75:25). Treatment of epithelial co-cultures with 0.4, 1.0, 2.0 and 4.0 mg/mL of CMOF was shown to have no effect on metabolic activity but did enhance cell epithelial barrier integrity as measured by trans-epithelial electrical resistance (TEER), in a dose-dependent manner. The CMOF at the maximum concentration tested (4.0 mg/mL) enhanced TEER, mucin gene expression and mucin protein abundance of epithelial co-cultures, all of which are essential components of intestinal barrier function.

  1. EMMPRIN modulates epithelial barrier function through a MMP-mediated occludin cleavage: implications in dry eye disease.

    Science.gov (United States)

    Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E

    2011-09-01

    Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  2. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

  3. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  4. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  5. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

    2000-08-01

    The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

  7. Transport across the choroid plexus epithelium.

    Science.gov (United States)

    Praetorius, Jeppe; Damkier, Helle Hasager

    2017-06-01

    The choroid plexus epithelium is a secretory epithelium par excellence. However, this is perhaps not the most prominent reason for the massive interest in this modest-sized tissue residing inside the brain ventricles. Most likely, the dominant reason for extensive studies of the choroid plexus is the identification of this epithelium as the source of the majority of intraventricular cerebrospinal fluid. This finding has direct relevance for studies of diseases and conditions with deranged central fluid volume or ionic balance. While the concept is supported by the vast majority of the literature, the implication of the choroid plexus in secretion of the cerebrospinal fluid was recently challenged once again. Three newer and promising areas of current choroid plexus-related investigations are as follows: 1 ) the choroid plexus epithelium as the source of mediators necessary for central nervous system development, 2 ) the choroid plexus as a route for microorganisms and immune cells into the central nervous system, and 3 ) the choroid plexus as a potential route for drug delivery into the central nervous system, bypassing the blood-brain barrier. Thus, the purpose of this review is to highlight current active areas of research in the choroid plexus physiology and a few matters of continuous controversy. Copyright © 2017 the American Physiological Society.

  8. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.

    NARCIS (Netherlands)

    Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.

    2001-01-01

    Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,

  9. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  10. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  11. Challenges and opportunities for tissue-engineering polarized epithelium.

    Science.gov (United States)

    Paz, Ana C; Soleas, John; Poon, James C H; Trieu, Dennis; Waddell, Thomas K; McGuigan, Alison P

    2014-02-01

    The epithelium is one of the most important tissue types in the body and the specific organization of the epithelial cells in these tissues is important for achieving appropriate function. Since many tissues contain an epithelial component, engineering functional epithelium and understanding the factors that control epithelial maturation and organization are important for generating whole artificial organ replacements. Furthermore, disruption of the cellular organization leads to tissue malfunction and disease; therefore, engineered epithelium could provide a valuable in vitro model to study disease phenotypes. Despite the importance of epithelial tissues, a surprisingly limited amount of effort has been focused on organizing epithelial cells into artificial polarized epithelium with an appropriate structure that resembles that seen in vivo. In this review, we provide an overview of epithelial tissue organization and highlight the importance of cell polarization to achieve appropriate epithelium function. We next describe the in vitro models that exist to create polarized epithelium and summarize attempts to engineer artificial epithelium for clinical use. Finally, we highlight the opportunities that exist to translate strategies from tissue engineering other tissues to generate polarized epithelium with a functional structure.

  12. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Cytokeratin expression in mouse lacrimal gland germ epithelium.

    Science.gov (United States)

    Hirayama, Masatoshi; Liu, Ying; Kawakita, Tetsuya; Shimmura, Shigeto; Tsubota, Kazuo

    2016-05-01

    The lacrimal gland secretes tear fluids that protect the ocular surface epithelium, and its dysfunction leads to dry eye disease (DED). The functional restoration of the lacrimal gland by engraftment of a bioengineered lacrimal gland using lacrimal gland germ epithelial cells has been proposed to cure DED in mice. Here, we investigate the expression profile of cytokeratins in the lacrimal gland germ epithelium to clarify their unique characteristics. We performed quantitative polymerase chain reaction (Q-PCR) and immunohistochemistry (IHC) analysis to clarify the expression profile of cytokeratin in the lacrimal gland germ epithelium. The mRNA expression of keratin (KRT) 5, KRT8, KRT14, KRT15, and KRT18 in the lacrimal gland germ epithelium was increased compared with that in mouse embryonic stem cells and the lacrimal gland germ mesenchyme, as analyzed by Q-PCR. The expression level of KRT15 increased in the transition from stem cells to lacrimal gland germ epithelium, then decreased as the lacrimal gland matured. IHC revealed that the expression set of these cytokeratins in the lacrimal gland germ epithelium was different from that in the adult lacrimal gland. The expression of KRT15 was observed in the lacrimal gland germ epithelium, and it segmentalized into some of the basal cells in the intercanulated duct in mature gland. We determined the expression profile of cytokeratins in the lacrimal gland epithelium, and identified KRT15 as a candidate unique cellular marker for the lacrimal gland germ epithelium. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. The Drosophila blood-brain barrier: Development and function of a glial endothelium

    Directory of Open Access Journals (Sweden)

    Stefanie eLimmer

    2014-11-01

    Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  16. The Drosophila blood-brain barrier: development and function of a glial endothelium.

    Science.gov (United States)

    Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

    2014-01-01

    The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  17. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  18. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  19. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Probiotic-derived polyphosphate enhances the epithelial barrier function and maintains intestinal homeostasis through integrin-p38 MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Shuichi Segawa

    Full Text Available Probiotics exhibit beneficial effects on human health, particularly in the maintenance of intestinal homeostasis in a complex manner notwithstanding the diversity of an intestinal flora between individuals. Thus, it is highly probable that some common molecules secreted by probiotic and/or commensal bacteria contribute to the maintenance of intestinal homeostasis and protect the intestinal epithelium from injurious stimuli. To address this question, we aimed to isolate the cytoprotective compound from a lactobacillus strain, Lactobacillus brevis SBC8803 which possess the ability to induce cytoprotective heat shock proteins in mouse small intestine. L. brevis was incubated in MRS broth and the supernatant was passed through with a 0.2-µm filter. Caco2/bbe cells were treated with the culture supernatant, and HSP27 expression was evaluated by Western blotting. HSP27-inducible components were separated by ammonium sulfate precipitation, DEAE anion exchange chromatography, gel filtration, and HPLC. Finally, we identified that the HSP27-inducible fraction was polyphosphate (poly P, a simple repeated structure of phosphates, which is a common product of lactobacilli and other bacteria associated with intestinal microflora without any definitive physiological functions. Then, poly P was synthesized by poly P-synthesizing enzyme polyphosphate kinase. The synthesized poly P significantly induced HSP27 from Caco2/BBE cells. In addition, Poly P suppressed the oxidant-induced intestinal permeability in the mouse small intestine and pharmacological inhibitors of p38 MAPK and integrins counteract its protective effect. Daily intrarectal administration of poly P (10 µg improved the inflammation grade and survival rate in 4% sodium dextran sulfate-administered mice. This study, for the first time, demonstrated that poly P is the molecule responsible for maintaining intestinal barrier actions which are mediated through the intestinal integrin β1-p38 MAPK.

  1. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  2. A search for parameters of universal sub-barrier fusion excitation function

    Energy Technology Data Exchange (ETDEWEB)

    Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

    2016-11-15

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

  3. Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

    Science.gov (United States)

    Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

    2004-03-01

    Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

  4. Barrier and system performances within a safety case: their functioning and evolution with time

    International Nuclear Information System (INIS)

    Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.

    2002-01-01

    The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

  5. Ultrastructural study on the embryonic development of the orthokeratinized epithelium and its cornified layer (lingual nail) on the ventral surface of the lingual apex in the domestic duck (Anas platyrhynchos f. domestica).

    Science.gov (United States)

    Skieresz-Szewczyk, Kinga; Jackowiak, Hanna; Ratajczak, Marlena

    2018-02-01

    The lingual nail as the cornified layer of the orthokeratinized epithelium in birds is responsible for the collection of solid food by pecking. The aim of the present study is to determine the manner of orthokeratinized epithelium development and assess the degree of readiness of the epithelium to fulfill its mechanical function at hatching. Three developmental phases are distinguished, i.e. embryonic, transformation and pre-hatching stage. In the embryonic stage lasting until day 13 of incubation the epithelium is composed of several layers of undifferentiated cells. During the transformation stage, from day 14 to 20 of incubation, the epithelium becomes differentiated to form three layers. A characteristic feature is the formation of osmophilic granules in the superficial layer, referred to as periderm granules. Until the pre-hatching stage the fibrous cytoskeleton of epithelial cells and an impermeable epithelial barrier are gradually developed. In the pre-hatching stage, a cornified lingual nail is formed, while the periderm is exfoliated. At hatching the orthokeratinized epithelium and lingual nail are fully developed and ready to perform feeding activities. The presence of periderm, similarly as in the epidermis, indicates the ectodermal derivation of the oral cavity epithelium. Moreover, occurrence of osmophilic granules may be considered as evidence for the phylogenetic affinity of birds and reptiles. Copyright © 2018 Elsevier GmbH. All rights reserved.

  6. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  7. Functions of an engineered barrier system for a nuclear waste repository in basalt

    International Nuclear Information System (INIS)

    Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

    1980-01-01

    Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance

  8. Effect of wild-type Shigella species and attenuated Shigella vaccine candidates on small intestinal barrier function, antigen trafficking, and cytokine release.

    Directory of Open Access Journals (Sweden)

    Maria Fiorentino

    Full Text Available Bacterial dysentery due to Shigella species is a major cause of morbidity and mortality worldwide. The pathogenesis of Shigella is based on the bacteria's ability to invade and replicate within the colonic epithelium, resulting in severe intestinal inflammatory response and epithelial destruction. Although the mechanisms of pathogenesis of Shigella in the colon have been extensively studied, little is known on the effect of wild-type Shigella on the small intestine and the role of the host response in the development of the disease. Moreover, to the best of our knowledge no studies have described the effects of apically administered Shigella flexneri 2a and S. dysenteriae 1 vaccine strains on human small intestinal enterocytes. The aim of this study was to assess the coordinated functional and immunological human epithelial responses evoked by strains of Shigella and candidate vaccines on small intestinal enterocytes. To model the interactions of Shigella with the intestinal mucosa, we apically exposed monolayers of human intestinal Caco2 cells to increasing bacterial inocula. We monitored changes in paracellular permeability, examined the organization of tight-junctions and the pro-inflammatory response of epithelial cells. Shigella infection of Caco2 monolayers caused severe mucosal damage, apparent as a drastic increase in paracellular permeability and disruption of tight junctions at the cell-cell boundary. Secretion of pro-inflammatory IL-8 was independent of epithelial barrier dysfunction. Shigella vaccine strains elicited a pro-inflammatory response without affecting the intestinal barrier integrity. Our data show that wild-type Shigella infection causes a severe alteration of the barrier function of a small intestinal cell monolayer (a proxy for mucosa and might contribute (along with enterotoxins to the induction of watery diarrhea. Diarrhea may be a mechanism by which the host attempts to eliminate harmful bacteria and transport them

  9. Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

    Science.gov (United States)

    Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

    2018-01-01

    Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

  10. Effects of industrial detergents on the barrier function of human skin

    DEFF Research Database (Denmark)

    Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

    2000-01-01

    Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

  11. The blood-brain barrier and oncology : new insights into function and modulation

    NARCIS (Netherlands)

    Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE

    2000-01-01

    The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the

  12. Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

    Science.gov (United States)

    Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

    2000-08-01

    The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

  13. Modelling of migration from multi-layers and functional barriers: Estimation of parameters

    NARCIS (Netherlands)

    Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

    2006-01-01

    Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

  14. Role of airway epithelial barrier dysfunction in pathogenesis of asthma.

    Science.gov (United States)

    Gon, Yasuhiro; Hashimoto, Shu

    2018-01-01

    Bronchial asthma is characterized by persistent cough, increased sputum, and repeated wheezing. The pathophysiology underlying these symptoms is the hyper-responsiveness of the airway along with chronic airway inflammation. Repeated injury, repair, and regeneration of the airway epithelium following exposure to environmental factors and inflammation results in histological changes and functional abnormalities in the airway mucosal epithelium; such changes are believed to have a significant association with the pathophysiology of asthma. Damage to the barrier functions of the airway epithelium enhances mucosal permeability of foreign substances in the airway epithelium of patients with asthma. Thus, epithelial barrier fragility is closely involved in releasing epithelial cytokines (e.g., TSLP, IL-25, and IL-33) because of the activation of airway epithelial cells, dendritic cells, and innate group 2 innate lymphoid cells (ILC2). Functional abnormalities of the airway epithelial cells along with the activation of dendritic cells, Th2 cells, and ILC2 form a single immunopathological unit that is considered to cause allergic airway inflammation. Here we use the latest published literature to discuss the potential pathological mechanisms regarding the onset and progressive severity of asthma with regard to the disruption of the airway epithelial function. Copyright © 2017 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  15. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  16. The distribution of free calcium ions in the cholesteatoma epithelium

    DEFF Research Database (Denmark)

    Svane-Knudsen, Viggo; Rasmussen, Gurli; Ottosen, Peter D

    2005-01-01

    The distribution of free calcium ions in normal skin and cholesteatoma epithelium was investigated using the oxalate precipitation method. In agreement with previous observations, we could demonstrate a calcium ion gradient in normal epidermis where the cells in stratum basale and spinosum reside...... appeared where oblong accumulations of free calcium ions were found basally in the stratum. These findings provide evidence that fluctuations in epidermal calcium in cholesteatoma epithelium may underlie the abnormal desquamation, may contribute to the formation of an abnormal permeability barrier and may...

  17. Changes in the Adult Vertebrate Auditory Sensory Epithelium After Trauma

    Science.gov (United States)

    Oesterle, Elizabeth C.

    2012-01-01

    Auditory hair cells transduce sound vibrations into membrane potential changes, ultimately leading to changes in neuronal firing and sound perception. This review provides an overview of the characteristics and repair capabilities of traumatized auditory sensory epithelium in the adult vertebrate ear. Injured mammalian auditory epithelium repairs itself by forming permanent scars but is unable to regenerate replacement hair cells. In contrast, injured non-mammalian vertebrate ear generates replacement hair cells to restore hearing functions. Non-sensory support cells within the auditory epithelium play key roles in the repair processes. PMID:23178236

  18. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  19. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  20. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Science.gov (United States)

    Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

    2016-01-01

    Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

  1. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  3. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  4. Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

    Science.gov (United States)

    Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

    2014-01-01

    In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

  5. Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

    Directory of Open Access Journals (Sweden)

    Ling-Yun Chu

    Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

  6. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    OpenAIRE

    Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

  7. Functions and requirements for subsurface barriers used in support of single-shell tank waste retrieval

    International Nuclear Information System (INIS)

    Lowe, S.S.

    1993-01-01

    The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers

  8. Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

    Science.gov (United States)

    Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

    2008-11-15

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

  9. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  10. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  11. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  12. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

    Science.gov (United States)

    Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

    2017-08-23

    A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

  14. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  15. Barriers and Facilitators to Implementing Functional Family Therapy in a Community Setting: Client and Practitioner Perspectives.

    Science.gov (United States)

    McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John

    2017-10-01

    While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.

  16. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  17. Biosensor Technology Reveals the Disruption of the Endothelial Barrier Function and the Subsequent Death of Blood Brain Barrier Endothelial Cells to Sodium Azide and Its Gaseous Products.

    Science.gov (United States)

    Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott

    2017-09-21

    Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.

  18. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  19. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  20. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

    CSIR Research Space (South Africa)

    Angelstam, P

    2017-05-01

    Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...

  2. Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

    Science.gov (United States)

    Ohno, Yusuke

    2017-01-01

    The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

  3. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  4. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  6. Glucose, epithelium, and enteric nervous system: dialogue in the dark.

    Science.gov (United States)

    Pfannkuche, H; Gäbel, G

    2009-06-01

    The gastrointestinal epithelium is in close contact with the various components of the chymus, including nutrients, bacteria and toxins. The epithelial barrier has to decide which components are effectively absorbed and which components are extruded. In the small intestine, a nutrient like glucose is mainly absorbed by the sodium linked glucose cotransporter 1 (SGLT1) and the glucose transporter 2 (GLUT2). The expression and activity of both transport proteins is directly linked to the amount of intraluminal glucose. Besides the direct interaction between glucose and the enterocytes, glucose also stimulates different sensory mechanisms within the intestinal wall. The most important types of cells involved in the sensing of intraluminal contents are enteroendocrine cells and neurones of the enteric nervous system. Regarding glucosensing, a distinct type of enteroendocrine cells, the enterochromaffine (EC) cells are involved. Excitation of EC cells by intraluminal glucose results in the release of serotonin (5-HT), which modulates epithelial functions and activates enteric secretomotorneurones. Enteric neurones are not only activated by 5-HT, but also directly by glucose. The activation of different cell types and the subsequent crosstalk between these cells may trigger appropriate absorptive and secretory processes within the intestine.

  7. Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice

    Science.gov (United States)

    Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua

    2012-01-01

    AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548

  8. Hair cell regeneration in the avian auditory epithelium.

    Science.gov (United States)

    Stone, Jennifer S; Cotanche, Douglas A

    2007-01-01

    Regeneration of sensory hair cells in the mature avian inner ear was first described just over 20 years ago. Since then, it has been shown that many other non-mammalian species either continually produce new hair cells or regenerate them in response to trauma. However, mammals exhibit limited hair cell regeneration, particularly in the auditory epithelium. In birds and other non-mammals, regenerated hair cells arise from adjacent non-sensory (supporting) cells. Hair cell regeneration was initially described as a proliferative response whereby supporting cells re-enter the mitotic cycle, forming daughter cells that differentiate into either hair cells or supporting cells and thereby restore cytoarchitecture and function in the sensory epithelium. However, further analyses of the avian auditory epithelium (and amphibian vestibular epithelium) revealed a second regenerative mechanism, direct transdifferentiation, during which supporting cells change their gene expression and convert into hair cells without dividing. In the chicken auditory epithelium, these two distinct mechanisms show unique spatial and temporal patterns, suggesting they are differentially regulated. Current efforts are aimed at identifying signals that maintain supporting cells in a quiescent state or direct them to undergo direct transdifferentiation or cell division. Here, we review current knowledge about supporting cell properties and discuss candidate signaling molecules for regulating supporting cell behavior, in quiescence and after damage. While significant advances have been made in understanding regeneration in non-mammals over the last 20 years, we have yet to determine why the mammalian auditory epithelium lacks the ability to regenerate hair cells spontaneously and whether it is even capable of significant regeneration under additional circumstances. The continued study of mechanisms controlling regeneration in the avian auditory epithelium may lead to strategies for inducing

  9. Thiolated silicone oils as adhesive skin protectants for improved barrier function.

    Science.gov (United States)

    Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

    2016-06-01

    The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  10. A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function.

    Science.gov (United States)

    Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio

    2016-05-01

    Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.

  11. Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

    Science.gov (United States)

    Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

    2012-01-01

    Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

  12. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Directory of Open Access Journals (Sweden)

    Xiang Ling

    Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may

  13. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  14. Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

    KAUST Repository

    Huang, Jing-Kai

    2018-01-04

    Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

  15. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  16. Relative permeability of the endothelium and epithelium of rabbit lungs

    International Nuclear Information System (INIS)

    Effros, R.M.; Mason, G.R.; Silverman, P.; Hukkanen, J.

    1986-01-01

    Electron micrographic studies of lungs suggest that the epithelial cells are more tightly joined than the underlying endothelium, and macromolecules penetrate the endothelium more readily than the epithelium. Comparisons of epithelial and endothelial permeability to small molecules have been based upon the relative rates at which solutes traverse the alveolar-capillary barrier in fluid filled lungs and those at which they equilibrate across the capillaries in air-filled lungs. Because the former process is much slower than the latter, it has been concluded that the epithelium is less permeable to small solutes than the endothelium. However this difference may be related to inadequate access of solutes to airway surfaces. In this study, solute losses from the vascular space were compared to those from the airspace in perfused, fluid-filled rabbit lungs. 36 Cl - and 125 I - were lost from air-spaces almost twice as rapidly as 22 Na + . In contrast, the endothelium is equally permeable to 22 Na + and these anions. Loss of 3 H-mannitol from the perfusate resembled that of 22 Na + for about 30 minutes, after which diffusion of 3 H-mannitol into the tissue nearly ceased. These observations suggest that the epithelium is more permselective than the endothelium. By resisting solute and water transport, the epithelium tends to prevent alveolar flooding and confines edema to the interstitium, where it is less likely to interfere with gas exchange

  17. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  18. Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions

    Directory of Open Access Journals (Sweden)

    Milos Mihajlovic

    2017-11-01

    Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.

  19. Employment status, employment functioning, and barriers to employment among VA primary care patients.

    Science.gov (United States)

    Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia

    2016-03-15

    Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.

  20. Experimental fusion excitation functions and derived barrier distributions for heavy ion systems involving prolate and oblate target nuclei

    International Nuclear Information System (INIS)

    Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.

    1996-01-01

    Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed

  1. Fulfillment of the long-term safety functions by the different barriers during the main time frames after repository closure

    International Nuclear Information System (INIS)

    Preter, P. de; Lalieux, Ph.

    2002-01-01

    In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)

  2. Cell-cell junctions: a target of acoustic overstimulation in the sensory epithelium of the cochlea

    Directory of Open Access Journals (Sweden)

    Zheng Guiliang

    2012-06-01

    Full Text Available Abstract Background Exposure to intense noise causes the excessive movement of the organ of Corti, stretching the organ and compromising sensory cell functions. We recently revealed changes in the transcriptional expression of multiple adhesion-related genes during the acute phases of cochlear damage, suggesting that the disruption of cell-cell junctions is an early event in the process of cochlear pathogenesis. However, the functional state of cell junctions in the sensory epithelium is not clear. Here, we employed graded dextran-FITC, a macromolecule tracer that is impermeable to the organ of Corti under physiological conditions, to evaluate the barrier function of cell junctions in normal and noise-traumatized cochlear sensory epithelia. Results Exposure to an impulse noise of 155 dB (peak sound pressure level caused a site-specific disruption in the intercellular junctions within the sensory epithelium of the chinchilla cochlea. The most vulnerable sites were the junctions among the Hensen cells and between the Hensen and Deiters cells within the outer zone of the sensory epithelium. The junction clefts that formed in the reticular lamina were permeable to 40 and 500 but not 2,000 kDa dextran-FITC macromolecules. Moreover, this study showed that the interruption of junction integrity occurred in the reticular lamina and also in the basilar membrane, a site that had been considered to be resistant to acoustic injury. Finally, our study revealed a general spatial correlation between the site of sensory cell damage and the site of junction disruption. However, the two events lacked a strict one-to-one correlation, suggesting that the disruption of cell-cell junctions is a contributing, but not the sole, factor for initiating acute sensory cell death. Conclusions Impulse noise causes the functional disruption of intercellular junctions in the sensory epithelium of the chinchilla cochlea. This disruption occurs at an early phase of cochlear

  3. Alteration of intestinal barrier function during activity-based anorexia in mice.

    Science.gov (United States)

    Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse

    2014-12-01

    Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  4. Survival and Functionality of hESC-Derived Retinal Pigment Epithelium Cells Cultured as a Monolayer on Polymer Substrates Transplanted in RCS Rats.

    Science.gov (United States)

    Thomas, Biju B; Zhu, Danhong; Zhang, Li; Thomas, Padmaja B; Hu, Yuntao; Nazari, Hossein; Stefanini, Francisco; Falabella, Paulo; Clegg, Dennis O; Hinton, David R; Humayun, Mark S

    2016-05-01

    To determine the safety, survival, and functionality of human embryonic stem cell-derived RPE (hESC-RPE) cells seeded on a polymeric substrate (rCPCB-RPE1 implant) and implanted into the subretinal (SR) space of Royal College of Surgeons (RCS) rats. Monolayers of hESC-RPE cells cultured on parylene membrane were transplanted into the SR space of 4-week-old RCS rats. Group 1 (n = 46) received vitronectin-coated parylene membrane without cells (rMSPM+VN), group 2 (n = 59) received rCPCB-RPE1 implants, and group 3 (n = 13) served as the control group. Animals that are selected based on optical coherence tomography screening were subjected to visual function assays using optokinetic (OKN) testing and superior colliculus (SC) electrophysiology. At approximately 25 weeks of age (21 weeks after surgery), the eyes were examined histologically for cell survival, phagocytosis, and local toxicity. Eighty-seven percent of the rCPCB-RPE1-implanted animals showed hESC-RPE survivability. Significant numbers of outer nuclear layer cells were rescued in both group 1 (rMSPM+VN) and group 2 (rCPCB-RPE1) animals. A significantly higher ratio of rod photoreceptor cells to cone photoreceptor cells was found in the rCPCB-RPE1-implanted group. Animals with rCPCB-RPE1 implant showed hESC-RPE cells containing rhodopsin-positive particles in immunohistochemistry, suggesting phagocytic function. Superior colliculus mapping data demonstrated that a significantly higher number of SC sites responded to light stimulus at a lower luminance threshold level in the rCPCB-RPE1-implanted group. Optokinetic data suggested both implantation groups showed improved visual acuity. These results demonstrate the safety, survival, and functionality of the hESC-RPE monolayer transplantation in an RPE dysfunction rat model.

  5. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    DEFF Research Database (Denmark)

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-01-01

    A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented perme...

  6. Barriers to Medical Compassion as a Function of Experience and Specialization: Psychiatry, Pediatrics, Internal Medicine, Surgery, and General Practice.

    Science.gov (United States)

    Fernando, Antonio T; Consedine, Nathan S

    2017-06-01

    Compassion is an expectation of patients, regulatory bodies, and physicians themselves. Most research has, however, studied compassion fatigue rather than compassion itself and has concentrated on the role of the physician. The Transactional Model of Physician Compassion suggests that physician, patient, external environment, and clinical factors are all relevant. Because these factors vary both across different specialities and among physicians with differing degrees of experience, barriers to compassion are also likely to vary. We describe barriers to physician compassion as a function of specialization (psychiatry, general practice, surgery, internal medicine, and pediatrics) and physician experience. We used a cross-sectional study using demographic data, specialization, practice parameters, and the Barriers to Physician Compassion Questionnaire. Nonrandom convenience sampling was used to recruit 580 doctors, of whom 444 belonged to the targeted speciality groups. The sample was characterized before conducting a factorial Multivariate Analysis of Covariance and further post hoc analyses. A 5 (speciality grouping) × 2 (more vs. less physician experience) Multivariate Analysis of Covariance showed that the barriers varied as a function of both speciality and experience. In general, psychiatrists reported lower barriers, whereas general practitioners and internal medicine specialists generally reported greater barriers. Barriers were generally greater among less experienced doctors. Documenting and investigating barriers to compassion in different speciality groups have the potential to broaden current foci beyond the physician and inform interventions aimed at enhancing medical compassion. In addition, certain aspects of the training or practice of psychiatry that enhance compassion may mitigate barriers to compassion in other specialities. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  7. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  8. Tests of potential functional barriers for laminated multilayer food packages. Part II: Medium molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Rijk, R

    2000-09-01

    Experiments were performed to characterize the kinetics of the permeation of different medium molecular weight model permeants: bisphenol A, warfarin and anthracene, from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick orientated polypropylene--OPP) into the food simulants olive oil and 3% (w/v) acetic acid. The characterization of permeation kinetics generally observed the permeation models previously reported to explain the experimental permeation results obtained for a low molecular weight group of model permeants. In general, the model permeants exhibited behaviour consistent with their relative molecular weights with respect to (a) the time taken to attain steady-state permeation into the food simulant in which they were more soluble, (b) their subsequent steady-state permeation rates, and (c) their partition between liquid paraffin and the OPP membrane.

  9. The effect of fucoidan on intestinal flora and intestinal barrier function in rats with breast cancer.

    Science.gov (United States)

    Xue, Meilan; Ji, Xinqiang; Liang, Hui; Liu, Ying; Wang, Bing; Sun, Lingling; Li, Weiwei

    2018-02-21

    Recent research studies have shown that the intestinal flora are related to the occurrence and progress of breast cancer. This study investigates the effect of fucoidan on intestinal flora and intestinal barrier function in rats with 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancers. Sixty female Sprague-Dawley rats were randomly assigned to the control group, the model group, and the F1 and F2 groups, which were fed fucoidan at concentrations of 200 and 400 mg per kg bw (body weight), respectively. Intestinal histopathological analysis was performed and 16S rDNA high-throughput sequencing was used to provide an overview of the intestinal flora composition. The contents of d-lactic acid (d-LA), diamine oxidase (DAO) and endotoxin in plasma were detected by ELISA. Expression levels of the tight junction (TJ) proteins, phosphorylated p38 MAPK and ERK1/2 were measured using western blotting. Our results suggested that the intestinal wall of the model group was damaged. However, after fucoidan intervention, the villi were gradually restored. ELISA showed that the levels of plasma endotoxin, d-LA and DAO decreased in the F1 and F2 groups compared to those in the model group. Fucoidan treatment also increased the expressions of ZO-1, occludin, claudin-1 and claudin-8. Furthermore, the expression levels of phosphorylated p38 MAPK and ERK1/2 were upregulated in fucoidan treatment groups. The results of 16S rDNA high-throughput sequencing indicated that fucoidan increased the diversity of the intestinal microbiota and induced changes in microbial composition, with the increased Bacteroidetes/Firmicutes phylum ratio. In conclusion, the supplement of fucoidan could improve the fecal microbiota composition and repair the intestinal barrier function. The study suggested the use of fucoidan as an intestinal flora modulator for potential prevention of breast cancer.

  10. Mechanisms underlying epithelium-dependent relaxation in rat bronchioles

    DEFF Research Database (Denmark)

    Kroigaard, Christel; Dalsgaard, Thomas; Simonsen, Ulf

    2010-01-01

    This study investigated the mechanisms underlying epithelium-derived hyperpolarizing factor (EpDHF)-type relaxation in rat bronchioles. Immunohistochemistry was performed, and rat bronchioles and pulmonary arteries were mounted in microvascular myographs for functional studies. An opener of small...... (SK(Ca)) and intermediate (IK(Ca))-conductance calcium-activated potassium channels, NS309 (6,7-dichloro-1H-indole-2,3-dione 3-oxime) was used to induce EpDHF-type relaxation. IK(Ca) and SK(Ca)3 positive immunoreactions were observed mainly in the epithelium and endothelium of bronchioles and arteries......, respectively. In 5-hydroxytryptamine (1 microM)-contracted bronchioles (828 +/- 20 microm, n = 84) and U46619 (0.03 microM)-contracted arteries (720 +/- 24 microm, n = 68), NS309 (0.001-10 microM) induced concentration-dependent relaxations that were reduced by epithelium/endothelium removal and by blocking IK...

  11. Investigating the Potential Barrier Function of Nanostructured Materials Formed in Engineered Barrier Systems (EBS) Designed for Nuclear Waste Isolation.

    Science.gov (United States)

    Cuevas, Jaime; Ruiz, Ana Isabel; Fernández, Raúl

    2018-02-21

    Clay and cement are known nano-colloids originating from natural processes or traditional materials technology. Currently, they are used together as part of the engineered barrier system (EBS) to isolate high-level nuclear waste (HLW) metallic containers in deep geological repositories (DGR). The EBS should prevent radionuclide (RN) migration into the biosphere until the canisters fail, which is not expected for approximately 10 3  years. The interactions of cementitious materials with bentonite swelling clay have been the scope of our research team at the Autonomous University of Madrid (UAM) with participation in several European Union (EU) projects from 1998 up to now. Here, we describe the mineral and chemical nature and microstructure of the alteration rim generated by the contact between concrete and bentonite. Its ability to buffer the surrounding chemical environment may have potential for further protection against RN migration. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Toll-8/Tollo negatively regulates antimicrobial response in the Drosophila respiratory epithelium.

    Directory of Open Access Journals (Sweden)

    Idir Akhouayri

    2011-10-01

    Full Text Available Barrier epithelia that are persistently exposed to microbes have evolved potent immune tools to eliminate such pathogens. If mechanisms that control Drosophila systemic responses are well-characterized, the epithelial immune responses remain poorly understood. Here, we performed a genetic dissection of the cascades activated during the immune response of the Drosophila airway epithelium i.e. trachea. We present evidence that bacteria induced-antimicrobial peptide (AMP production in the trachea is controlled by two signalling cascades. AMP gene transcription is activated by the inducible IMD pathway that acts non-cell autonomously in trachea. This IMD-dependent AMP activation is antagonized by a constitutively active signalling module involving the receptor Toll-8/Tollo, the ligand Spätzle2/DNT1 and Ect-4, the Drosophila ortholog of the human Sterile alpha and HEAT/ARMadillo motif (SARM. Our data show that, in addition to Toll-1 whose function is essential during the systemic immune response, Drosophila relies on another Toll family member to control the immune response in the respiratory epithelium.

  13. Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

    Science.gov (United States)

    Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

    2013-11-07

    The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

  14. An empirical orthogonal function analysis of ocean shoreline location on the Virginia barrier islands

    Science.gov (United States)

    Haluska, J. D.

    2017-12-01

    Shoreline change along the Eastern Atlantic shore of Virginia has been studied for the individual barrier islands but not as an integrated system. This study combines the Atlantic shoreline locations for eleven barrier islands obtained from LANDSAT 5, 7, and 8 images. Approximately 250 shoreline locations over a 24-year period from Jan 1990 to Dec 2014 were extracted from the digitized shoreline data at 338 transects. The resulting 338 by 250 matrix was analyzed by the empirical orthogonal function (EOF) technique. The first four principal components (PC) explained 86 percent of the sample variance. Since the data was not detrended, the first PC was the overall trend of the data with a discontinuity in 2004-2005. The 2004-2005 interval included storm events and large shoreline changes. PCs 2 to 4 reflect the effects of El Nino events and tropical and non-tropical storms. Eigenvectors 1 to 4 all show the effects of the nine inlets in the island group. Eigenvector (EV) 1 explains 59 percent of the shoreline spatial variance and shows the largest changes at the northern and southern island ends. EVs 2 to 4 reflect the pattern of EV1 but at sequentially smaller percentages of the spatial variance. As a group, the eleven islands are losing ocean side shoreline. The lone exception is Hog Island. Sea level had the strongest correlation with the shoreline loss trend of PC1. The coefficient of determination was 0.41. The NAO and MEI also correlated with PC1 with correlations of determination of 0.05 and 0.12 respectively. These confidence level for the three factors was better than 99 percent. Sea level also correlated with PC3 and PC4. The PCs as a group show that the year intervals 2004-2005 and 2009-2010 had large effects on the shoreline change pattern for the island group. EVs 1 to 4 had the highest range of shoreline change at the island ends indicating the effect the changes of the inlets have on the adjacent islands. The smaller islands as a group had a higher level

  15. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  16. Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)

    2016-11-01

    This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La2Zr2O7, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.

  17. Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

    Science.gov (United States)

    Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

    2018-04-24

    In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

  18. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Science.gov (United States)

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  19. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  20. Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma

    Science.gov (United States)

    Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.

    2017-07-01

    The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.

  1. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    Science.gov (United States)

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.

    Science.gov (United States)

    Sina, Christian; Kemper, Claudia; Derer, Stefanie

    2018-06-01

    The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Airway Epithelial Barrier Dysfunction in Chronic Obstructive Pulmonary Disease: Role of Cigarette Smoke Exposure.

    Science.gov (United States)

    Aghapour, Mahyar; Raee, Pourya; Moghaddam, Seyed Javad; Hiemstra, Pieter S; Heijink, Irene H

    2018-02-01

    The epithelial lining of the airway forms the first barrier against environmental insults, such as inhaled cigarette smoke, which is the primary risk factor for the development of chronic obstructive pulmonary disease (COPD). The barrier is formed by airway epithelial junctions, which are interconnected structures that restrict permeability to inhaled pathogens and environmental stressors. Destruction of the epithelial barrier not only exposes subepithelial layers to hazardous agents in the inspired air, but also alters the normal function of epithelial cells, which may eventually contribute to the development of COPD. Of note, disruption of epithelial junctions may lead to modulation of signaling pathways involved in differentiation, repair, and proinflammatory responses. Epithelial barrier dysfunction may be particularly relevant in COPD, where repeated injury by cigarette smoke exposure, pathogens, inflammatory mediators, and impaired epithelial regeneration may compromise the barrier function. In the current review, we discuss recent advances in understanding the mechanisms of barrier dysfunction in COPD, as well as the molecular mechanisms that underlie the impaired repair response of the injured epithelium in COPD and its inability to redifferentiate into a functionally intact epithelium.

  4. Study of the Wigner function at the device boundaries in one-dimensional single- and double-barrier structures

    International Nuclear Information System (INIS)

    Savio, Andrea; Poncet, Alain

    2011-01-01

    In this work, we compute the Wigner distribution function on one-dimensional devices from wave functions generated by solving the Schroedinger equation. Our goal is to investigate certain issues that we encountered in implementing Wigner transport equation solvers, such as the large discrepancies observed between the boundary conditions and the solution in the neighborhood of the boundaries. By evaluating the Wigner function without solving the Wigner transport equation, we intend to ensure that the actual boundary conditions are consistent with those commonly applied in literature. We study both single- and double-barrier unbiased structures. We use simple potential profiles, so that we can compute the wave functions analytically for better accuracy. We vary a number of structure geometry, material, meshing, and numerical parameters, among which are the contact length, the barrier height, the number of incident wave functions, and the numerical precision used for the computations, and we observe how the Wigner function at the device boundaries is affected. For the double-barrier structures, we look at the density matrix function and we study a model for the device transmission spectrum which helps explain the lobelike artifacts that we observe on the Wigner function.

  5. Investigation of the functional lifetime of TRISOPLASTr in relation to chemical compositions of pore water solutions in barriers

    NARCIS (Netherlands)

    Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.

    2003-01-01

    Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and

  6. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

    NARCIS (Netherlands)

    Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

    2005-01-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

  7. Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

    NARCIS (Netherlands)

    den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

    2008-01-01

    The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

  8. "Targeted disruption of the epithelial-barrier by Helicobacter pylori"

    Directory of Open Access Journals (Sweden)

    Wroblewski Lydia E

    2011-11-01

    Full Text Available Abstract Helicobacter pylori colonizes the human gastric epithelium and induces chronic gastritis, which can lead to gastric cancer. Through cell-cell contacts the gastric epithelium forms a barrier to protect underlying tissue from pathogenic bacteria; however, H. pylori have evolved numerous strategies to perturb the integrity of the gastric barrier. In this review, we summarize recent research into the mechanisms through which H. pylori disrupts intercellular junctions and disrupts the gastric epithelial barrier.

  9. Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

    DEFF Research Database (Denmark)

    Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

    2007-01-01

    12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

  10. The blood-brain barrier: structure, function and therapeutic approaches to cross it.

    Science.gov (United States)

    Tajes, Marta; Ramos-Fernández, Eva; Weng-Jiang, Xian; Bosch-Morató, Mònica; Guivernau, Biuse; Eraso-Pichot, Abel; Salvador, Bertrán; Fernàndez-Busquets, Xavier; Roquer, Jaume; Muñoz, Francisco J

    2014-08-01

    The blood-brain barrier (BBB) is constituted by a specialized vascular endothelium that interacts directly with astrocytes, neurons and pericytes. It protects the brain from the molecules of the systemic circulation but it has to be overcome for the proper treatment of brain cancer, psychiatric disorders or neurodegenerative diseases, which are dramatically increasing as the population ages. In the present work we have revised the current knowledge on the cellular structure of the BBB and the different procedures utilized currently and those proposed to cross it. Chemical modifications of the drugs, such as increasing their lipophilicity, turn them more prone to be internalized in the brain. Other mechanisms are the use of molecular tools to bind the drugs such as small immunoglobulins, liposomes or nanoparticles that will act as Trojan Horses favoring the drug delivery in brain. This fusion of the classical pharmacology with nanotechnology has opened a wide field to many different approaches with promising results to hypothesize that BBB will not be a major problem for the new generation of neuroactive drugs. The present review provides an overview of all state-of-the-art of the BBB structure and function, as well as of the classic strategies and these appeared in recent years to deliver drugs into the brain for the treatment of Central Nervous System (CNS) diseases.

  11. AKAP12 mediates barrier functions of fibrotic scars during CNS repair.

    Directory of Open Access Journals (Sweden)

    Jong-Ho Cha

    Full Text Available The repair process after CNS injury shows a well-organized cascade of three distinct stages: inflammation, new tissue formation, and remodeling. In the new tissue formation stage, various cells migrate and form the fibrotic scar surrounding the lesion site. The fibrotic scar is known as an obstacle for axonal regeneration in the remodeling stage. However, the role of the fibrotic scar in the new tissue formation stage remains largely unknown. We found that the number of A-kinase anchoring protein 12 (AKAP12-positive cells in the fibrotic scar was increased over time, and the cells formed a structure which traps various immune cells. Furthermore, the AKAP12-positive cells strongly express junction proteins which enable the structure to function as a physical barrier. In in vivo validation, AKAP12 knock-out (KO mice showed leakage from a lesion, resulting from an impaired structure with the loss of the junction complex. Consistently, focal brain injury in the AKAP12 KO mice led to extended inflammation and more severe tissue damage compared to the wild type (WT mice. Accordingly, our results suggest that AKAP12-positive cells in the fibrotic scar may restrict excessive inflammation, demonstrating certain mechanisms that could underlie the beneficial actions of the fibrotic scar in the new tissue formation stage during the CNS repair process.

  12. Macleaya cordata Extract Decreased Diarrhea Score and Enhanced Intestinal Barrier Function in Growing Piglets

    Directory of Open Access Journals (Sweden)

    Gang Liu

    2016-01-01

    Full Text Available Macleaya cordata extract is of great scientific and practical interest to researchers, due to its antimicrobial and anti-inflammatory responses within experimental animals. This study was designed to determine the diarrhea score and innate immunity of growing piglets after they had received Macleaya cordata extract supplements. A total of 240 growing pigs were randomly assigned to one of three dietary treatments, with 8 replicates per treatment and 10 piglets per replicate. All pigs received a basal diet containing similar amounts of nutrients. The three treatments were a control (no additive, an antibiotic (200 mg/kg colistin, and the Macleaya cordata extract supplement group (40 mg/kg Macleaya cordata extract. The diarrhea score was calculated after D 28. The jejunal samples were obtained from five piglets selected randomly from each treatment on D 28. In comparison with the control group, the dietary Macleaya cordata extract and colistin group demonstrated a substantially decreased diarrhea score. The introduction of Macleaya cordata extract supplements to the diet significantly increased volumes of ZO-1 and claudin-1, particularly in comparison with the pigs in the control group (P<0.05. The findings indicate that Macleaya cordata extract does enhance intestinal barrier function in growing piglets and that it could be used as a viable substitute for antibiotics.

  13. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

  14. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  15. I. Fission Probabilities, Fission Barriers, and Shell Effects. II. Particle Structure Functions

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Kexing [Univ. of California, Berkeley, CA (United States)

    1999-05-01

    In Part I, fission excitation functions of osmium isotopes 185,186, 187, 189 Os produced in 3He +182,183, 184, 186W reactions, and of polonium isotopes 209,210, 211, 212Po produced in 3He/4He + 206, 207, 208Pb reactions, were measured with high precision. These excitation functions have been analyzed in detail based upon the transition state formalism. The fission barriers, and shell effects for the corresponding nuclei are extracted from the detailed analyses. A novel approach has been developed to determine upper limits of the transient time of the fission process. The upper limits are constrained by the fission probabilities of neighboring isotopes. The upper limits for the transient time set with this new method are 15x 10–21 sec and 25x 10–21 sec for 0s and Po compound nuclei, respectively. In Part II, we report on a search for evidence of the optical modulations in the energy spectra of alpha particles emitted from hot compound nuclei. The optical modulations are expected to arise from the ~-particle interaction with the rest of the nucleus as the particle prepares to exit. Some evidence for the modulations has been observed in the alpha spectra measured in the 3He-induced reactions, 3He + natAg in particular. The identification of the modulations involves a technique that subtracts the bulk statistical background from the measured alpha spectra, in order for the modulations to become visible in the residuals. Due to insufficient knowledge of the background spectra, however, the presented evidence should only be regarded as preliminary and tentative.

  16. Identification of blood-brain barrier function following subarachnoid hemorrhage in rats at different stages

    Institute of Scientific and Technical Information of China (English)

    Zongyi Xie; Weiwei Shen; Ying Ma; Yuan Cheng

    2008-01-01

    BACKGROUND: Recent studies have indicated that blood-brain barrier (BBB) disruption following subarachnoid hemorrhage (SAH) significantly correlates with the development of brain injury and poor prognosis of patients subjected to SAH. OBJECTIVE: To investigate both functional and structural changes related to BBB in various phases after SAH in rats through quantitative and qualitative methods.DESIGN, TIME AND SETTING: This experiment, a completely randomized design and controlled experiment, was performed at the Department of Neurosurgery, the Second Affiliated Hospital of Chongqing University of Medical Sciences from June 2006 to March 2007.MATERIALS: A total of 128 female, healthy, Sprague-Dawley rats were selected for this study. Main reagents and instruments: Evans Blue dye (Sigma Company, USA), fluorescence spectrophotometer (Shimadzu Company, Japan), and transmission electron microscope (Olympus Company, Japan). MAIN OUTCOME MEASURES: Brain tissue water content was determined by the wet-dry method. BBB permeability in the cerebral cortex was determined by Evans Blue dye and fluorescent spectrophotometer. The ultrastructural changes in BBB were observed with transmission electron microscope.RESULTS: Compared with the sham-operated group, SAH induced a significant increase in brain water content between 24 and 60 hours (F = 888.32, P 0.05). Electron microscopy demonstrated only a mild perivascular edema at 24 hours after SAH. By 36 hours, a notable perivascular edema was associated with a collapse of the capillary. Astrocytic endfeet surrounding the capillary were prominently swollen in the edematous areas. The above-mentioned abnormal ultrastructural changes in the BBB were reversed by 72 hours after SAH. No obvious morphological changes in the BBB were detected in the sham-operated rats.CONCLUSION: These results directly suggest that SAH could induce rapid changes in BBB function and structure during the acute phases of BBB breakdown. Moreover, these dynamic

  17. Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

    Science.gov (United States)

    Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

    2017-12-01

    Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

  18. Cytokine Tuning of Intestinal Epithelial Function

    Directory of Open Access Journals (Sweden)

    Caroline Andrews

    2018-06-01

    Full Text Available The intestine serves as both our largest single barrier to the external environment and the host of more immune cells than any other location in our bodies. Separating these potential combatants is a single layer of dynamic epithelium composed of heterogeneous epithelial subtypes, each uniquely adapted to carry out a subset of the intestine’s diverse functions. In addition to its obvious role in digestion, the intestinal epithelium is responsible for a wide array of critical tasks, including maintaining barrier integrity, preventing invasion by microbial commensals and pathogens, and modulating the intestinal immune system. Communication between these epithelial cells and resident immune cells is crucial for maintaining homeostasis and coordinating appropriate responses to disease and can occur through cell-to-cell contact or by the release or recognition of soluble mediators. The objective of this review is to highlight recent literature illuminating how cytokines and chemokines, both those made by and acting on the intestinal epithelium, orchestrate many of the diverse functions of the intestinal epithelium and its interactions with immune cells in health and disease. Areas of focus include cytokine control of intestinal epithelial proliferation, cell death, and barrier permeability. In addition, the modulation of epithelial-derived cytokines and chemokines by factors such as interactions with stromal and immune cells, pathogen and commensal exposure, and diet will be discussed.

  19. Permeability measurement of some barrier materials as a function of temperature and pressure

    International Nuclear Information System (INIS)

    Maqsood, M.; Faisal, S.; Ali, J.; Usman, A.; Alamgir, K.; Farooq, K.

    2011-01-01

    Barrier materials possess the ability to restrict the passage of gases, vapors, and organic liquids through their boundaries. These barrier materials have large number of applications in industry and scientific research. To measure the permeability of barrier materials, a specific gas flow system has been developed, pure helium gas is used to measure the back ground reading through SS-316. The permeability and break-through time has been measured through Inconel X-750, NBR and Viton below and above the atmospheric pressure and at different temperatures 20 deg. C, 40 deg. C and 70 deg. C. (author)

  20. Coelomic epithelium-derived cells in visceral morphogenesis.

    Science.gov (United States)

    Ariza, Laura; Carmona, Rita; Cañete, Ana; Cano, Elena; Muñoz-Chápuli, Ramón

    2016-03-01

    Coelomic cavities of vertebrates are lined by a mesothelium which develops from the lateral plate mesoderm. During development, the coelomic epithelium is a highly active cell layer, which locally is able to supply mesenchymal cells that contribute to the mesodermal elements of many organs and provide signals which are necessary for their development. The relevance of this process of mesenchymal cell supply to the developing organs is becoming clearer because genetic lineage tracing techniques have been developed in recent years. Body wall, heart, liver, lungs, gonads, and gastrointestinal tract are populated by cells derived from the coelomic epithelium which contribute to their connective and vascular tissues, and sometimes to specialized cell types such as the stellate cells of the liver, the Cajal interstitial cells of the gut or the Sertoli cells of the testicle. In this review we collect information about the contribution of coelomic epithelium derived cells to visceral development, their developmental fates and signaling functions. The common features displayed by all these processes suggest that the epithelial-mesenchymal transition of the embryonic coelomic epithelium is an underestimated but key event of vertebrate development, and probably it is shared by all the coelomate metazoans. © 2015 Wiley Periodicals, Inc.

  1. Addressing barriers to eco-innovation: Exploring the finance mobilisation functions of institutional innovation intermediaries

    NARCIS (Netherlands)

    Polzin, Friedemann; Flotow, von Paschen; Klerkx, L.W.A.

    2016-01-01

    This research article explores the role of institutional innovation intermediaries in accelerating the commercialisation of (clean) technologies. Drawing on the finance and innovation intermediaries literatures, we show that financial barriers to eco-innovation can be partly overcome by particular

  2. Use of radial basis functions for meshless numerical solutions applied to financial engineering barrier options

    Directory of Open Access Journals (Sweden)

    Gisele Tessari Santos

    2009-08-01

    Full Text Available A large number of financial engineering problems involve non-linear equations with non-linear or time-dependent boundary conditions. Despite available analytical solutions, many classical and modified forms of the well-known Black-Scholes (BS equation require fast and accurate numerical solutions. This work introduces the radial basis function (RBF method as applied to the solution of the BS equation with non-linear boundary conditions, related to path-dependent barrier options. Furthermore, the diffusional method for solving advective-diffusive equations is explored as to its effectiveness to solve BS equations. Cubic and Thin-Plate Spline (TPS radial basis functions were employed and evaluated as to their effectiveness to solve barrier option problems. The numerical results, when compared against analytical solutions, allow affirming that the RBF method is very accurate and easy to be implemented. When the RBF method is applied, the diffusional method leads to the same results as those obtained from the classical formulation of Black-Scholes equation.Muitos problemas de engenharia financeira envolvem equações não-lineares com condições de contorno não-lineares ou dependentes do tempo. Apesar de soluções analíticas disponíveis, várias formas clássicas e modificadas da conhecida equação de Black-Scholes (BS requerem soluções numéricas rápidas e acuradas. Este trabalho introduz o método de função de base radial (RBF aplicado à solução da equação BS com condições de contorno não-lineares relacionadas a opções de barreira dependentes da trajetória. Além disso, explora-se o método difusional para solucionar equações advectivo-difusivas quanto à sua efetividade para solucionar equações BS. Utilizam-se funções de base radial Cúbica e Thin-Plate Spline (TPS, aplicadas à solução de problemas de opções de barreiras. Os resultados numéricos, quando comparados com as soluções analíticas, permitem afirmar

  3. Impedance analysis of GPCR-mediated changes in endothelial barrier function: overview and fundamental considerations for stable and reproducible measurements.

    Science.gov (United States)

    Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed

    2015-10-01

    The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.

  4. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells.

    Science.gov (United States)

    Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn

    2015-04-01

    Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  5. Reinstatement of "germinal epithelium" of the ovary

    Directory of Open Access Journals (Sweden)

    Nishida Naoyo

    2006-08-01

    Full Text Available Abstract Background The existing dogma that the former term ovarian "germinal epithelium" resulted from a mistaken belief that it could give rise to new germ cells is now strongly challenged. Discussion Two years ago, a research group of the University of Tennessee led by Antonin Bukovsky successfully demonstrated the oogenic process from the human ovarian covering epithelium now commonly called the ovarian surface epithelium. They showed the new oocyte with zona pellucida and granulosa cells, both originated from the surface epithelium arising from mesenchymal cells in the tunica albuginea, and stressed that the human ovary could form primary follicles throughout the reproductive period. This gives a big impact not only to the field of reproductive medicine, but also to the oncologic area. The surface epithelium is regarded as the major source of ovarian cancers, and most of the neoplasms exhibit the histology resembling müllerian epithelia. Since the differentiating capability of the surface epithelium has now expanded, the histologic range of the neoplasms in this category may extend to include both germ cell tumors and sex cord-stromal cell tumors. Summary Since the oogenic capability of ovarian surface cells has been proven, it is now believed that the oocytes can originate from them. The term "germinal epithelium", hence, might reasonably be reinstated.

  6. Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

    Science.gov (United States)

    Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

    2012-11-01

    Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

  7. Dysfunctions at human intestinal barrier by water-borne protozoan parasites: lessons from cultured human fully differentiated colon cancer cell lines.

    Science.gov (United States)

    Liévin-Le Moal, Vanessa

    2013-06-01

    Some water-borne protozoan parasites induce diseases through their membrane-associated functional structures and virulence factors that hijack the host cellular molecules and signalling pathways leading to structural and functional lesions in the intestinal barrier. In this Microreview we analyse the insights on the mechanisms of pathogenesis of Entamoeba intestinalis, Giardia and Cryptosporidium observed in the human colon carcinoma fully differentiated colon cancer cell lines, cell subpopulations and clones expressing the structural and functional characteristics of highly specialized fully differentiated epithelial cells lining the intestinal epithelium and mimicking structurally and functionally an intestinal barrier. © 2013 John Wiley & Sons Ltd.

  8. The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

    Directory of Open Access Journals (Sweden)

    Adam Paré

    Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

  9. Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems

    Energy Technology Data Exchange (ETDEWEB)

    Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others

    1995-10-01

    New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.

  10. Organ Culture as a Model System for Studies on Enterotoxin Interactions with the Intestinal Epithelium

    DEFF Research Database (Denmark)

    Lorenzen, Ulver Spangsberg; Hansen, Gert H; Danielsen, E Michael

    2015-01-01

    Studies on bacterial enterotoxin-epithelium interactions require model systems capable of mimicking the events occurring at the molecular and cellular levels during intoxication. In this chapter, we describe organ culture as an often neglected alternative to whole-animal experiments or enterocyte......-like cell lines. Like cell culture, organ culture is versatile and suitable for studying rapidly occurring events, such as enterotoxin binding and uptake. In addition, it is advantageous in offering an epithelium with more authentic permeability/barrier properties than any cell line, as well...

  11. Probabilistic migration modelling focused on functional barrier efficiency and low migration concepts in support of risk assessment.

    Science.gov (United States)

    Brandsch, Rainer

    2017-10-01

    Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.

  12. Patient-specific three-dimensional explant spheroids derived from human nasal airway epithelium

    DEFF Research Database (Denmark)

    Marthin, June Kehlet; Stevens, Elizabeth Munkebjerg; Larsen, Lars Allan

    2017-01-01

    BACKGROUND: Three-dimensional explant spheroid formation is an ex vivo technique previously used in studies of airway epithelial ion and water transport. Explanted cells and sheets of nasal epithelium form fully differentiated spheroids enclosing a partly fluid-filled lumen with the ciliated apical...... surface facing the outside and accessible for analysis of ciliary function. METHODS: We performed a two-group comparison study of ciliary beat pattern and ciliary beat frequency in spheroids derived from nasal airway epithelium in patients with primary ciliary dyskinesia (PCD) and in healthy controls...... in the investigation of pathophysiological aspects and drug effects in human nasal airway epithelium....

  13. Intestinal infection with Giardia spp. reduces epithelial barrier function in a myosin light chain kinase-dependent fashion.

    Science.gov (United States)

    Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G

    2002-10-01

    Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.

  14. Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2016-09-01

    Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

  15. Low uptake of silica nanoparticles in Caco-2 intestinal epithelial barriers

    NARCIS (Netherlands)

    Ye, Dong; Bramini, Mattia; Hristov, Delyan R.; Wan, Sha; Salvati, Anna; Åberg, Christoffer; Dawson, Kenneth A.

    2017-01-01

    Cellular barriers, such as the skin, the lung epithelium or the intestinal epithelium, constitute one of the first obstacles facing nanomedicines or other nanoparticles entering organisms. It is thus important to assess the capacity of nanoparticles to enter and transport across such barriers. In

  16. Claudin expression in follicle-associated epithelium of rat Peyer's patches defines a major restriction of the paracellular pathway.

    Science.gov (United States)

    Markov, A G; Falchuk, E L; Kruglova, N M; Radloff, J; Amasheh, S

    2016-01-01

    Members of the tight junction protein family of claudins have been demonstrated to specifically determine paracellular permeability of the intestinal epithelium. In small intestinal mucosa, which is generally considered to be a leaky epithelium, Peyer's patches are a primary part of the immune system. The aim of this study was to analyse the tight junctional barrier of follicle-associated epithelium covering Peyer's patches (lymphoid follicles). Employing small intestinal tissue specimens of male Wistar rats, electrophysiological analyses including the Ussing chamber technique, marker flux measurements and one-path impedance spectroscopy were performed. Morphometry of HE-stained tissue sections was taken into account. Claudin expression and localization was analysed by immunoblotting and confocal laser scanning immunofluorescence microscopy. Almost twofold higher parameters of epithelial and transepithelial tissue resistance and a markedly lower permeability for the paracellular permeability markers 4 and 20 kDa FITC-dextran were detected in follicle-associated epithelium compared to neighbouring villous epithelium. Analysis of claudin expression and localization revealed a stronger expression of major sealing proteins in follicle-associated epithelium, including claudin-1, claudin-4, claudin-5 and claudin-8. Therefore, the specific expression and localization of claudins is in accordance with barrier properties of follicle-associated epithelium vs. neighbouring villous epithelium. We demonstrate that follicle-associated epithelium is specialized to ensure maximum restriction of the epithelial paracellular pathway in Peyer's patches by selective sealing of tight junctions. This results in an exclusive transcellular pathway of epithelial cells as the limiting and mandatory route for a controlled presentation of antigens to the underlying lymphocytes under physiological conditions. © 2015 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  17. Permeability and ultrastructure of human bladder epithelium

    DEFF Research Database (Denmark)

    Eldrup, J; Thorup, Jørgen Mogens; Nielsen, S L

    1983-01-01

    Leakage of tight junctions as observed with electron microscopy and demonstration of solute transport across bladder epithelium was investigated in 13 patients with different bladder diseases: urinary retention and infection, bladder tumours and interstitial cystitis. The latter group showed...

  18. Transport across the choroid plexus epithelium

    DEFF Research Database (Denmark)

    Praetorius, Jeppe; Damkier, Helle Hasager

    2017-01-01

    The choroid plexus epithelium is a secretory epithelium par excellence. However, this is perhaps not the most prominent reason for the massive interest in this modest-sized tissue residing inside the brain ventricles. Most likely, the dominant reason for extensive studies of the choroid plexus...... is the identification of this epithelium as the source of the majority of intraventricular cerebrospinal fluid. This finding has direct relevance for studies of diseases and conditions with deranged central fluid volume or ionic balance. While the concept is supported by the vast majority of the literature......, the implication of the choroid plexus in secretion of the cerebrospinal fluid was recently challenged once again. Three newer and promising areas of current choroid plexus-related investigations are as follows: 1) the choroid plexus epithelium as the source of mediators necessary for central nervous system...

  19. Non-invasive assessment of barrier integrity and function of the human gut

    NARCIS (Netherlands)

    Grootjans, J.; Thuijls, G.; Verdam, F.J.; Derikx, J.P.M.; Lenaerts, K.; Buurman, W.A.

    2010-01-01

    Over the past decades evidence has been accumulating that intestinal barrier integrity loss plays a key role in the development and perpetuation of a variety of disease states including inflammatory bowel disease and celiac disease, and is a key player in the onset of sepsis and multiple organ

  20. Systems pharmacology and blood-brain barrier functionality in Parkinson's disease

    NARCIS (Netherlands)

    Ravenstijn, Paulien Gerarda Maria

    2009-01-01

    Parkinson’s disease is a progressive neurodegenerative disease, which is composed of many components, each caused by interplay of a number of genetic and nongenetic causes. As the blood-brain barrier (BBB) is a key player in the relationship between plasma and brain pharmacokinetics, the influences

  1. Improved cell line IPEC-J2, characterized as a model for porcine jejunal epithelium.

    Directory of Open Access Journals (Sweden)

    Silke S Zakrzewski

    Full Text Available Cell lines matching the source epithelium are indispensable for investigating porcine intestinal transport and barrier properties on a subcellular or molecular level and furthermore help to reduce animal usage. The porcine jejunal cell line IPEC-J2 is established as an in vitro model for porcine infection studies but exhibits atypically high transepithelial resistances (TER and only low active transport rates so that the effect of nutritional factors cannot be reliably investigated. This study aimed to properly remodel IPEC-J2 and then to re-characterize these cells regarding epithelial architecture, expression of barrier-relevant tight junction (TJ proteins, adequate TER and transport function, and reaction to secretagogues. For this, IPEC-J2 monolayers were cultured on permeable supports, either under conventional (fetal bovine serum, FBS or species-specific (porcine serum, PS conditions. Porcine jejunal mucosa was analyzed for comparison. Main results were that under PS conditions (IPEC-J2/PS, compared to conventional FBS culture (IPEC-J2/FBS, the cell height increased 6-fold while the cell diameter was reduced by 50%. The apical cell membrane of IPEC-J2/PS exhibited typical microvilli. Most importantly, PS caused a one order of magnitude reduction of TER and of trans- and paracellular resistance, and a 2-fold increase in secretory response to forskolin when compared to FBS condition. TJ ultrastructure and appearance of TJ proteins changed dramatically in IPEC-J2/PS. Most parameters measured under PS conditions were much closer to those of typical pig jejunocytes than ever reported since the cell line's initial establishment in 1989. In conclusion, IPEC-J2, if cultured under defined species-specific conditions, forms a suitable model for investigating porcine paracellular intestinal barrier function.

  2. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  3. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-09-29

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  4. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    International Nuclear Information System (INIS)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-01-01

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  5. Nested Expression Domains for Odorant Receptors in Zebrafish Olfactory Epithelium

    Science.gov (United States)

    Weth, Franco; Nadler, Walter; Korsching, Sigrun

    1996-11-01

    The mapping of high-dimensional olfactory stimuli onto the two-dimensional surface of the nasal sensory epithelium constitutes the first step in the neuronal encoding of olfactory input. We have used zebrafish as a model system to analyze the spatial distribution of odorant receptor molecules in the olfactory epithelium by quantitative in situ hybridization. To this end, we have cloned 10 very divergent zebrafish odorant receptor molecules by PCR. Individual genes are expressed in sparse olfactory receptor neurons. Analysis of the position of labeled cells in a simplified coordinate system revealed three concentric, albeit overlapping, expression domains for the four odorant receptors analyzed in detail. Such regionalized expression should result in a corresponding segregation of functional response properties. This might represent the first step of spatial encoding of olfactory input or be essential for the development of the olfactory system.

  6. Deposition and characterization of plasma sprayed Ni-5A1/ magnesia stabilized zirconia based functionally graded thermal barrier coating

    International Nuclear Information System (INIS)

    Baig, M N; Khalid, F A

    2014-01-01

    Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating

  7. Integrin Beta 1 Suppresses Multilayering of a Simple Epithelium

    Science.gov (United States)

    Chen, Jichao; Krasnow, Mark A.

    2012-01-01

    Epithelia are classified as either simple, a single cell layer thick, or stratified (multilayered). Stratified epithelia arise from simple epithelia during development, and transcription factor p63 functions as a key positive regulator of epidermal stratification. Here we show that deletion of integrin beta 1 (Itgb1) in the developing mouse airway epithelium abrogates airway branching and converts this monolayer epithelium into a multilayer epithelium with more than 10 extra layers. Mutant lung epithelial cells change mitotic spindle orientation to seed outer layers, and cells in different layers become molecularly and functionally distinct, hallmarks of normal stratification. However, mutant lung epithelial cells do not activate p63 and do not switch to the stratified keratin profile of epidermal cells. These data, together with previous data implicating Itgb1 in regulation of epidermal stratification, suggest that the simple-versus-stratified developmental decision may involve not only stratification inducers like p63 but suppressors like Itgb1 that prevent simple epithelia from inappropriately activating key steps in the stratification program. PMID:23285215

  8. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

    NARCIS (Netherlands)

    Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

    2010-01-01

    Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

  9. Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

    Directory of Open Access Journals (Sweden)

    Singh Varinderjit

    2015-01-01

    Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

  10. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

  11. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

    Science.gov (United States)

    Draelos, Zoe D

    2005-01-01

    The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

  13. Treatment with Entinostat Heals Experimental Cholera by Affecting Physical and Chemical Barrier Functions of Intestinal Epithelia.

    Science.gov (United States)

    Sarker, Protim; Banik, Atanu; Stromberg, Roger; Gudmundsson, Gudmundur H; Raqib, Rubhana; Agerberth, Birgitta

    2017-07-01

    We have shown previously that oral treatment with sodium butyrate or phenylbutyrate in an experimental model of shigellosis improves clinical outcomes and induces the expression of the antimicrobial peptide CAP-18 in the large intestinal epithelia. In a subsequent study, we found that entinostat, an aroylated phenylenediamine compound, has similar therapeutic potential against shigellosis. In this study, we aimed to evaluate entinostat as a potential candidate for host-directed therapy against cholera in an experimental model. Vibrio cholerae -infected rabbits were treated with two different dose regimens of entinostat: either 0.5 mg twice daily for 2 days or 1 mg once daily for 2 days. The effects of treatment on clinical outcomes and V. cholerae shedding (CFU count in stool) were observed. Immunohistochemical analysis was carried out to assess CAP-18 expression in ileal and jejunal mucosae. The serum zonulin level was measured by an enzyme-linked immunosorbent assay (ELISA) to evaluate gut permeability. Infection of rabbits with V. cholerae downregulated CAP-18 expression in the ileal epithelium; the expression was replenished by oral treatment with entinostat at either dose regimen. The level of zonulin, a marker of gut permeability, in serum was upregulated after infection, and this upregulation was counteracted after treatment with entinostat. Entinostat treatment also led to recovery from cholera and a decline in the V. cholerae count in stool. In conclusion, the improved clinical outcome of cholera for rabbits treated with entinostat is associated with the induction of CAP-18 and the reduction of gut epithelial permeability. Copyright © 2017 American Society for Microbiology.

  14. Shigella infection of intestinal epithelium and circumvention of the host innate defense system.

    Science.gov (United States)

    Ashida, Hiroshi; Ogawa, Michinaga; Mimuro, Hitomi; Sasakawa, Chihiro

    2009-01-01

    Shigella, Gram-negative bacteria closely related to Escherichia coli, are highly adapted human pathogens that cause bacillary dysentery. Although Shigella have neither adherence factors nor flagella required for attaching or accessing the intestinal epithelium, Shigella are capable of colonizing the intestinal epithelium by exploiting epithelial-cell functions and circumventing the host innate immune response. During Shigella infection, they deliver many numbers of effectors through the type III secretion system into the surrounding space and directly into the host-cell cytoplasm. The effectors play pivotal roles from the onset of bacterial infection through to the establishment of the colonization of the intestinal epithelium, such as bacterial invasion, intracellular survival, subversion of the host immune defense response, and maintenance of the infectious foothold. These examples suggest that Shigella have evolved highly sophisticated infectious and intracellular strategies to establish replicative niches in the intestinal epithelium.

  15. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  16. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  17. Altered free radical metabolism in acute mountain sickness: implications for dynamic cerebral autoregulation and blood-brain barrier function

    DEFF Research Database (Denmark)

    Bailey, D M; Evans, K A; James, P E

    2008-01-01

    We tested the hypothesis that dynamic cerebral autoregulation (CA) and blood-brain barrier (BBB) function would be compromised in acute mountain sickness (AMS) subsequent to a hypoxia-mediated alteration in systemic free radical metabolism. Eighteen male lowlanders were examined in normoxia (21% O...... developed clinical AMS (AMS+) and were more hypoxaemic relative to subjects without AMS (AMS-). A more marked increase in the venous concentration of the ascorbate radical (A(*-)), lipid hydroperoxides (LOOH) and increased susceptibility of low-density lipoprotein (LDL) to oxidation was observed during...

  18. Blood-ocular and blood-brain barrier function in streptozocin-induced diabetes in rats

    International Nuclear Information System (INIS)

    Maeepea, O.; Karlsson, C.; Alm, A.

    1984-01-01

    Edetic acid labeled with chromium 51 was injected intravenously in normal rats and in rats with streptozocin-induced diabetes. One hour after the injection the animals were killed and the concentrations of edetic acid 51Cr in vitreous body, retina, and brain were determined. No significant difference was observed between the two groups for either tissue. In a second series, a mixture of tritiated 1-glucose and aminohippuric acid tagged with carbon 14 was injected instead of edetic acid. A substantial accumulation of aminohippuric acid 14C compared with tritiated 1-glucose was observed in the vitreous body and the brain of diabetic rats in comparison with the control group. It is concluded that untreated streptozocin-induced diabetes in rats for one to two weeks will not cause a generalized increase in the permeability of the blood-ocular or the blood-brain barriers, but organic acids may accumulate in the vitreous body as well as in the brain as a consequence of reduced outward transport through these barriers

  19. Anthrax lethal toxin disrupts intestinal barrier function and causes systemic infections with enteric bacteria.

    Directory of Open Access Journals (Sweden)

    Chen Sun

    Full Text Available A variety of intestinal pathogens have virulence factors that target mitogen activated protein kinase (MAPK signaling pathways, including Bacillus anthracis. Anthrax lethal toxin (LT has specific proteolytic activity against the upstream regulators of MAPKs, the MAPK kinases (MKKs. Using a murine model of intoxication, we show that LT causes the dose-dependent disruption of intestinal epithelial integrity, characterized by mucosal erosion, ulceration, and bleeding. This pathology correlates with an LT-dependent blockade of intestinal crypt cell proliferation, accompanied by marked apoptosis in the villus tips. C57BL/6J mice treated with intravenous LT nearly uniformly develop systemic infections with commensal enteric organisms within 72 hours of administration. LT-dependent intestinal pathology depends upon its proteolytic activity and is partially attenuated by co-administration of broad spectrum antibiotics, indicating that it is both a cause and an effect of infection. These findings indicate that targeting of MAPK signaling pathways by anthrax LT compromises the structural integrity of the mucosal layer, serving to undermine the effectiveness of the intestinal barrier. Combined with the well-described immunosuppressive effects of LT, this disruption of the intestinal barrier provides a potential mechanism for host invasion via the enteric route, a common portal of entry during the natural infection cycle of Bacillus anthracis.

  20. Barrier Systems

    NARCIS (Netherlands)

    Heteren, S. van

    2015-01-01

    Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change

  1. Asymmetric [14C]albumin transport across bullfrog alveolar epithelium

    International Nuclear Information System (INIS)

    Kim, K.J.; LeBon, T.R.; Shinbane, J.S.; Crandall, E.D.

    1985-01-01

    Bullfrog lungs were prepared as planar sheets and bathed with Ringer solution in Ussing chambers. In the presence of a constant electrical gradient (20, 0, or -20 mV) across the tissue, 14 C-labeled bovine serum albumin or inulin was instilled into the upstream reservoir and the rate of appearance of the tracer in the downstream reservoir was monitored. Two lungs from the same animal were used to determine any directional difference in tracer fluxes. An apparent permeability coefficient was estimated from a relationship between normalized downstream radioactivities and time. Results showed that the apparent permeability of albumin in the alveolar to pleural direction across the alveolar epithelial barrier is 2.3 X 10(-7) cm/s, significantly greater (P less than 0.0005) than that in the pleural to alveolar direction (5.3 X 10(-8) cm/s) when the tissue was short circuited. Permeability of inulin, on the other hand, did not show any directional dependence and averaged 3.1 X 10(-8) cm/s in both directions. There was no effect on radiotracer fluxes permeabilities of different electrical gradients across the tissue. Gel electrophoretograms and corresponding radiochromatograms suggest that the large and asymmetric isotope fluxes are not primarily due to digestion or degradation of labeled molecules. Inulin appears to traverse the alveolar epithelial barrier by simple diffusion through hydrated paracellular pathways. On the other hand, [ 14 C]albumin crosses the alveolar epithelium more rapidly than would be expected by simple diffusion. These asymmetric and large tracer fluxes suggest that a specialized mechanism is present in alveolar epithelium that may be capable of helping to remove albumin from the alveolar space

  2. Primary angle closure glaucoma (PACG) susceptibility gene PLEKHA7 encodes a novel Rac1/Cdc42 GAP that modulates cell migration and blood-aqueous barrier function.

    Science.gov (United States)

    Lee, Mei-Chin; Shei, William; Chan, Anita S; Chua, Boon-Tin; Goh, Shuang-Ru; Chong, Yaan-Fun; Hilmy, Maryam H; Nongpiur, Monisha E; Baskaran, Mani; Khor, Chiea-Chuen; Aung, Tin; Hunziker, Walter; Vithana, Eranga N

    2017-10-15

    PLEKHA7, a gene recently associated with primary angle closure glaucoma (PACG), encodes an apical junctional protein expressed in components of the blood aqueous barrier (BAB). We found that PLEKHA7 is down-regulated in lens epithelial cells and in iris tissue of PACG patients. PLEKHA7 expression also correlated with the C risk allele of the sentinel SNP rs11024102 with the risk allele carrier groups having significantly reduced PLEKHA7 levels compared to non-risk allele carriers. Silencing of PLEKHA7 in human immortalized non-pigmented ciliary epithelium (h-iNPCE) and primary trabecular meshwork cells, which are intimately linked to BAB and aqueous humor outflow respectively, affected actin cytoskeleton organization. PLEKHA7 specifically interacts with GTP-bound Rac1 and Cdc42, but not RhoA, and the activation status of the two small GTPases is linked to PLEKHA7 expression levels. PLEKHA7 stimulates Rac1 and Cdc42 GTP hydrolysis, without affecting nucleotide exchange, identifying PLEKHA7 as a novel Rac1/Cdc42 GAP. Consistent with the regulatory role of Rac1 and Cdc42 in maintaining the tight junction permeability, silencing of PLEKHA7 compromises the paracellular barrier between h-iNPCE cells. Thus, downregulation of PLEKHA7 in PACG may affect BAB integrity and aqueous humor outflow via its Rac1/Cdc42 GAP activity, thereby contributing to disease etiology. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Pilot study of lithium to restore intestinal barrier function in severe graft-versus-host disease.

    Directory of Open Access Journals (Sweden)

    Gideon Steinbach

    Full Text Available Severe intestinal graft-vs-host disease (GVHD after allogeneic hematopoietic cell transplantation (HCT causes mucosal ulceration and induces innate and adaptive immune responses that amplify and perpetuate GVHD and the associated barrier dysfunction. Pharmacological agents to target mucosal barrier dysfunction in GVHD are needed. We hypothesized that induction of Wnt signaling by lithium, an inhibitor of glycogen synthase kinase (GSK3, would potentiate intestinal crypt proliferation and mucosal repair and that inhibition of GSK3 in inflammatory cells would attenuate the deregulated inflammatory response to mucosal injury. We conducted an observational pilot study to provide data for the potential design of a randomized study of lithium. Twenty patients with steroid refractory intestinal GVHD meeting enrollment criteria were given oral lithium carbonate. GVHD was otherwise treated per current practice, including 2 mg/kg per day of prednisone equivalent. Seventeen patients had extensive mucosal denudation (extreme endoscopic grade 3 in the duodenum or colon. We observed that 8 of 12 patients (67% had a complete remission (CR of GVHD and survived more than 1 year (median 5 years when lithium administration was started promptly within 3 days of endoscopic diagnosis of denuded mucosa. When lithium was started promptly and less than 7 days from salvage therapy for refractory GVHD, 8 of 10 patients (80% had a CR and survived more than 1 year. In perspective, a review of 1447 consecutive adult HCT patients in the preceding 6 years at our cancer center showed 0% one-year survival in 27 patients with stage 3-4 intestinal GVHD and grade 3 endoscopic appearance in the duodenum or colon. Toxicities included fatigue, somnolence, confusion or blunted affect in 50% of the patients. The favorable outcomes in patients who received prompt lithium therapy appear to support the future conduct of a randomized study of lithium for management of severe GVHD with

  4. Myosin light chain kinase knockout improves gut barrier function and confers a survival advantage in polymicrobial sepsis.

    Science.gov (United States)

    Lorentz, C Adam; Liang, Zhe; Meng, Mei; Chen, Ching-Wen; Yoseph, Benyam P; Breed, Elise R; Mittal, Rohit; Klingensmith, Nathan J; Farris, Alton B; Burd, Eileen M; Koval, Michael; Ford, Mandy L; Coopersmith, Craig M

    2017-06-07

    Sepsis-induced intestinal hyperpermeability is mediated by disruption of the epithelial tight junction, which is closely associated with the peri-junctional actin-myosin ring. Myosin light chain kinase (MLCK) phosphorylates the myosin regulatory light chain, resulting in increased permeability. The purpose of this study was to determine whether genetic deletion of MLCK would alter gut barrier function and survival from sepsis. MLCK -/- and wild type (WT) mice were subjected to cecal ligation and puncture and assayed for both survival and mechanistic studies. Survival was significantly increased in MLCK -/- mice (95% vs. 24%, p<0.0001). Intestinal permeability increased in septic WT mice compared to unmanipulated mice. In contrast, permeability in septic MLCK -/- mice was similar to that seen in unmanipulated animals. Improved gut barrier function in MLCK -/- mice was associated with increases in the tight junction mediators ZO-1 and claudin 15 without alterations in claudin 1, 2, 3, 4, 5, 7, 8, 13, occludin or JAM-A. Other components of intestinal integrity (apoptosis, proliferation and villus length) were unaffected by MLCK deletion as were local peritoneal inflammation and distant lung injury. Systemic IL-10 was decreased greater than 10-fold in MLCK -/- mice; however, survival was similar between septic MLCK -/- mice given exogenous IL-10 or vehicle. These data demonstrate that deletion of MLCK improves survival following sepsis, associated with normalization of intestinal permeability and selected tight junction proteins.

  5. Performance of Density Functional Theory Procedures for the Calculation of Proton-Exchange Barriers: Unusual Behavior of M06-Type Functionals.

    Science.gov (United States)

    Chan, Bun; Gilbert, Andrew T B; Gill, Peter M W; Radom, Leo

    2014-09-09

    We have examined the performance of a variety of density functional theory procedures for the calculation of complexation energies and proton-exchange barriers, with a focus on the Minnesota-class of functionals that are generally highly robust and generally show good accuracy. A curious observation is that M05-type and M06-type methods show an atypical decrease in calculated barriers with increasing proportion of Hartree-Fock exchange. To obtain a clearer picture of the performance of the underlying components of M05-type and M06-type functionals, we have investigated the combination of MPW-type and PBE-type exchange and B95-type and PBE-type correlation procedures. We find that, for the extensive E3 test set, the general performance of the various hybrid-DFT procedures improves in the following order: PBE1-B95 → PBE1-PBE → MPW1-PBE → PW6-B95. As M05-type and M06-type procedures are related to PBE1-B95, it would be of interest to formulate and examine the general performance of an alternative Minnesota DFT method related to PW6-B95.

  6. Interactions between bacteria and the gut mucosa: Do enteric neurotransmitters acting on the mucosal epithelium influence intestinal colonization or infection?

    Science.gov (United States)

    The intestinal epithelium is a critical barrier between the internal and external milieux of the mammalian host. Epithelial interactions between these two host environments have been shown to be modulated by several different, cross-communicating cell types residing in the gut mucosa. These include ...

  7. Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

    Science.gov (United States)

    Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

    2018-01-21

    Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Characterisation and functional properties of antimicrobial bio-barriers formed by natural fibres.

    Science.gov (United States)

    Tomšič, Brigita; Ilec, Eva; Žerjav, Metka; Hladnik, Aleš; Simončič, Andrej; Simončič, Barbara

    2014-10-01

    Antimicrobial bio-barriers formed on cotton (CO), silk (SE), and woollen (WO) fabrics were prepared by the application of 3-(trimethoxysilyl)-propyldimethyloctadecyl ammonium chloride (Si-QAC) at 11 concentrations ranging from 0.5% to 20% using an exhaustion method. The presence of the Si-QAC coating on the treated fabric samples was detected by X-ray photoelectron spectroscopy. The bromophenol blue reagent was used to determine the concentration of quaternary ammonium groups in the coating. The antimicrobial activity of the coated fibres against Gram-negative and Gram-positive bacteria (Escherichia coli and Staphylococcus aureus), fungi (Aspergillus niger and Chaetomium globosum), and soil microflora was assessed using standard microbiological methods. The antimicrobial protection of the fibres increased with increases in the applied concentration of Si-QAC. The fibre type strongly influenced the antimicrobial activity of Si-QAC. Si-QAC was most effective for CO fibres, less effective for WO fibres, and least effective for SE fibres, suggesting that Si-QAC is less accessible for interactions with microorganisms when applied to protein fibres than to cellulose. Although Si-QAC reduced the microbial growth, it did not significantly hinder the biodegradability or sustainability of the coated fibres when exposed to soil microflora. The extent of rotting was more influenced by the morphological and chemical properties of the fibres than by the presence of Si-QAC. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Early effects of gliadin on enterocyte intracellular signalling involved in intestinal barrier function.

    Science.gov (United States)

    Clemente, M G; De Virgiliis, S; Kang, J S; Macatagney, R; Musu, M P; Di Pierro, M R; Drago, S; Congia, M; Fasano, A

    2003-02-01

    Despite the progress made in understanding the immunological aspects of the pathogenesis of coeliac disease (CD), the early steps that allow gliadin to cross the intestinal barrier are still largely unknown. The aim of this study was to establish whether gliadin activates a zonulin dependent enterocyte intracellular signalling pathway(s) leading to increased intestinal permeability. The effect of gliadin on the enterocyte actin cytoskeleton was studied on rat intestinal epithelial (IEC-6) cell cultures by fluorescence microscopy and spectrofluorimetry. Zonulin concentration was measured on cell culture supernatants by enzyme linked immunosorbent assay. Transepithelial intestinal resistance (Rt) was measured on ex vivo intestinal tissues mounted in Ussing chambers. Incubation of cells with gliadin led to a reversible protein kinase C (PKC) mediated actin polymerisation temporarily coincident with zonulin release. A significant reduction in Rt was observed after gliadin addition on rabbit intestinal mucosa mounted in Ussing chambers. Pretreatment with the zonulin inhibitor FZI/0 abolished the gliadin induced actin polymerisation and Rt reduction but not zonulin release. Gliadin induces zonulin release in intestinal epithelial cells in vitro. Activation of the zonulin pathway by PKC mediated cytoskeleton reorganisation and tight junction opening leads to a rapid increase in intestinal permeability.

  10. Dengue Virus Infection Differentially Regulates Endothelial Barrier Function over Time through Type I Interferon Effects

    Science.gov (United States)

    Liu, Ping; Woda, Marcia; Ennis, Francis A.; Libraty, Daniel H.

    2013-01-01

    Background The morbidity and mortality resulting from dengue hemorrhagic fever (DHF) are largely caused by endothelial barrier dysfunction and a unique vascular leakage syndrome. The mechanisms that lead to the location and timing of vascular leakage in DHF are poorly understood. We hypothesized that direct viral effects on endothelial responsiveness to inflammatory and angiogenesis mediators can explain the DHF vascular leakage syndrome. Methods We used an in vitro model of human endothelium to study the combined effects of dengue virus (DENV) type 2 (DENV2) infection and inflammatory mediators on paracellular macromolecule permeability over time. Results Over the initial 72 h after infection, DENV2 suppressed tumor necrosis factor (TNF)–α–mediated hyperpermeability in human umbilical vein endothelial cell (HUVEC) monolayers. This suppressive effect was mediated by type I interferon (IFN). By 1 week, TNF-α stimulation of DENV2-infected HUVECs synergistically increased cell cycling, angiogenic changes, and macromolecule permeability. This late effect could be prevented by the addition of exogenous type I IFN. Conclusions DENV infection of primary human endothelial cells differentially modulates TNF-α–driven angiogenesis and hyperpermeability over time. Type I IFN plays a central role in this process. Our findings suggest a rational model for the DHF vascular leakage syndrome. PMID:19530939

  11. Phenotypic and physiologic variability in nasal epithelium cultured from smokers and non-smokers exposed to secondhand tobacco smoke

    Science.gov (United States)

    The emergence of air-liquid interface (ALI) culturing of mammalian airway epithelium is a recent innovation for experimental modeling of airway epithelial development, function, and pathogenic mechanisms associated with infectious agent and irritant exposure. This construct provi...

  12. Neoplasia versus hyperplasia of the retinal pigment epithelium

    DEFF Research Database (Denmark)

    Heegaard, Steffen; Larsen, J.N.B.; Fledelius, Hans C.

    2001-01-01

    ophthalmology, retinal pigment epithelium, adenoma, tumor-like hyperplasia, histology, immunohistochemistry, tumor, neoplasm, ultrasonography......ophthalmology, retinal pigment epithelium, adenoma, tumor-like hyperplasia, histology, immunohistochemistry, tumor, neoplasm, ultrasonography...

  13. The Structure of Urethral Epithelium in Merinos Lambs

    Directory of Open Access Journals (Sweden)

    Vasile RUS

    2018-05-01

    Full Text Available The aim of this study was to investigate by histological techniques the structure of urethral epithelium in lambs. In this study, we harvested several fragments (prostatic, membranous and cavernous from urethra from 5 merino’s lambs of 3 months old. The first anatomical segment, the prostatic urethra, is lined by a urinary epithelium. The intermediary layer of this epithelium is formed of 5-6 rows of oval cells. The second segment of urethra has the same type of epithelium but the intermediary layer is formed of 6-7 rows of oval cells. In the last anatomical segment, the penile urethra, the epithelium is the same, but the intermediary layer has 3-4 rows of oval cells. In lambs, the urethra is lined by urinary epithelium. The urethral epithelium does not have the same thickness in all segments. The thinner epithelium it is in the cavernous urethra, the ticker is the membranous urethra.

  14. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

    Science.gov (United States)

    Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

    2014-01-01

    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

  15. Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress.

    Science.gov (United States)

    Yu, Leilei; Zhai, Qixiao; Tian, Fengwei; Liu, Xiaoming; Wang, Gang; Zhao, Jianxin; Zhang, Hao; Narbad, Arjan; Chen, Wei

    2016-12-02

    Aluminum (Al) is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy) were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

  16. Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Leilei Yu

    2016-12-01

    Full Text Available Aluminum (Al is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

  17. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

    Science.gov (United States)

    Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

    2005-10-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

  18. Application of stem cell-derived retinal pigmented epithelium in retinal degenerative diseases: present and future

    Directory of Open Access Journals (Sweden)

    Mingyue Luo

    2018-01-01

    Full Text Available As a constituent of blood-retinal barrier and retinal outer segment (ROS scavenger, retinal pigmented epithelium (RPE is fundamental to normal function of retina. Malfunctioning of RPE contributes to the onset and advance of retinal degenerative diseases. Up to date, RPE replacement therapy is the only possible method to completely reverse retinal degeneration. Transplantation of human RPE stem cell-derived RPE (hRPESC-RPE has shown some good results in animal models. With promising results in terms of safety and visual improvement, human embryonic stem cell-derived RPE (hESC-RPE can be expected in clinical settings in the near future. Despite twists and turns, induced pluripotent stem cell-derived RPE (iPSC-RPE is now being intensely investigated to overcome genetic and epigenetic instability. By far, only one patient has received iPSC-RPE transplant, which is a hallmark of iPSC technology development. During follow-up, no major complications such as immunogenicity or tumorigenesis have been observed. Future trials should keep focusing on the safety of stem cell-derived RPE (SC-RPE especially in long period, and better understanding of the nature of stem cell and the molecular events in the process to generate SC-RPE is necessary to the prosperity of SC-RPE clinical application.

  19. Application of stem cell-derived retinal pigmented epithelium in retinal degenerative diseases: present and future.

    Science.gov (United States)

    Luo, Mingyue; Chen, Youxin

    2018-01-01

    As a constituent of blood-retinal barrier and retinal outer segment (ROS) scavenger, retinal pigmented epithelium (RPE) is fundamental to normal function of retina. Malfunctioning of RPE contributes to the onset and advance of retinal degenerative diseases. Up to date, RPE replacement therapy is the only possible method to completely reverse retinal degeneration. Transplantation of human RPE stem cell-derived RPE (hRPESC-RPE) has shown some good results in animal models. With promising results in terms of safety and visual improvement, human embryonic stem cell-derived RPE (hESC-RPE) can be expected in clinical settings in the near future. Despite twists and turns, induced pluripotent stem cell-derived RPE (iPSC-RPE) is now being intensely investigated to overcome genetic and epigenetic instability. By far, only one patient has received iPSC-RPE transplant, which is a hallmark of iPSC technology development. During follow-up, no major complications such as immunogenicity or tumorigenesis have been observed. Future trials should keep focusing on the safety of stem cell-derived RPE (SC-RPE) especially in long period, and better understanding of the nature of stem cell and the molecular events in the process to generate SC-RPE is necessary to the prosperity of SC-RPE clinical application.

  20. Muscarinic cholinergic and alpha 2-adrenergic receptors in the epithelium and muscularis of the human ileum

    International Nuclear Information System (INIS)

    Lepor, H.; Rigaud, G.; Shapiro, E.; Baumann, M.; Kodner, I.J.; Fleshman, J.W.

    1990-01-01

    The aim of this study was to characterize the binding and functional properties of muscarinic cholinergic (MCh) and alpha 2-adrenergic receptors in the human ileum to provide insight into pharmacologic strategies for managing urinary and fecal incontinence after bladder and rectal replacement with intestinal segments. MCh and alpha 2-adrenergic binding sites were characterized in the epithelium and muscularis of eight human ileal segments with 3H-N-methylscopolamine and 3H-rauwolscine, respectively. The dissociation constant for 3H-N-methylscopolamine in the epithelium and muscularis was 0.32 +/- 0.07 nmol/L and 0.45 +/- 0.10 nmol/L, respectively (p = 0.32). The MCh receptor content was approximately eightfold greater in the muscularis compared with the epithelium (p = 0.008). The dissociation constant for 3H-rauwolscine in the muscularis and epithelium was 2.55 +/- 0.42 nmol/L and 2.03 +/- 0.19 nmol/L, respectively (p = 0.29). The alpha 2-adrenoceptor density was twofold greater in the epithelium compared with the muscularis (p = 0.05). Noncumulative concentration-response experiments were performed with carbachol, an MCh agonist, and UK-14304, a selective alpha 2-adrenergic agonist. The epithelium did not contract in the presence of high concentrations of carbachol and UK-14304. The muscularis preparations were responsive only to carbachol. The muscularis contains primarily MCh receptors mediating smooth muscle contraction. The alpha 2-adrenoceptors are localized primarily to the epithelium and may regulate water secretion in the intestine. The distribution and functional properties of ileal MCh and alpha 2-adrenergic receptors provide a theoretic basis for the treatment of incontinence after bladder and rectal replacement with intestinal segments

  1. Fabrication of High Gas Barrier Epoxy Nanocomposites: An Approach Based on Layered Silicate Functionalized by a Compatible and Reactive Modifier of Epoxy-Diamine Adduct

    Directory of Open Access Journals (Sweden)

    Ran Wei

    2018-05-01

    Full Text Available To solve the drawbacks of poor dispersion and weak interface in gas barrier nanocomposites, a novel epoxy-diamine adduct (DDA was synthesized by reacting epoxy monomer DGEBA with curing agent D400 to functionalize montmorillonite (MMT, which could provide complete compatibility and reactivity with a DGEBA/D400 epoxy matrix. Thereafter, sodium type montmorillonite (Na-MMT and organic-MMTs functionalized by DDA and polyether amines were incorporated with epoxy to manufacture nanocomposites. The effects of MMT functionalization on the morphology and gas barrier property of nanocomposites were evaluated. The results showed that DDA was successfully synthesized, terminating with epoxy and amine groups. By simulating the small-angle neutron scattering data with a sandwich structure model, the optimal dispersion/exfoliation of MMT was observed in a DDA-MMT/DGEBA nanocomposite with a mean radius of 751 Å, a layer thickness of 30.8 Å, and only two layers in each tactoid. Moreover, the DDA-MMT/DGEBA nanocomposite exhibited the best N2 barrier properties, which were about five times those of neat epoxy. Based on a modified Nielsen model, it was clarified that this excellent gas barrier property was due to the homogeneously dispersed lamellas with almost exfoliated structures. The improved morphology and barrier property confirmed the superiority of the adduct, which provides a general method for developing gas barrier nanocomposites.

  2. 1,4-Bis(5-(naphthalen-1-yl)thiophen-2-yl)naphthalene, a small molecule, functions as a novel anti-HIV-1 inhibitor targeting the interaction between integrase and cellular Lens epithelium-derived growth factor.

    Science.gov (United States)

    Gu, Wan-gang; Ip, Denis Tsz-Ming; Liu, Si-jie; Chan, Joseph H; Wang, Yan; Zhang, Xuan; Zheng, Yong-tang; Wan, David Chi-Cheong

    2014-04-25

    Translocation of viral integrase (IN) into the nucleus is a critical precondition of integration during the life cycle of HIV, a causative agent of Acquired Immunodeficiency Syndromes (AIDS). As the first discovered cellular factor to interact with IN, Lens epithelium-derived growth factor (LEDGF/p75) plays an important role in the process of integration. Disruption of the LEDGF/p75-IN interaction has provided a great interest for anti-HIV agent discovery. In this work, we reported that one small molecular compound, 1,4-bis(5-(naphthalen-1-yl)thiophen-2-yl)naphthalene(Compound 15), potently inhibit the IN-LEDGF/p75 interaction and affect the HIV-1 IN nuclear distribution at 1 μM. The putative binding mode of Compound 15 was constructed by a molecular docking simulation to provide structural insights into the ligand-binding mechanism. Compound 15 suppressed viral replication by measuring p24 antigen production in HIV-1IIIB acute infected C8166 cells with EC50 value of 11.19 μM. Compound 15 might supply useful structural information for further anti-HIV agent discovery. Copyright © 2014. Published by Elsevier Ireland Ltd.

  3. Permeating disciplines: Overcoming barriers between molecular simulations and classical structure-function approaches in biological ion transport.

    Science.gov (United States)

    Howard, Rebecca J; Carnevale, Vincenzo; Delemotte, Lucie; Hellmich, Ute A; Rothberg, Brad S

    2018-04-01

    Ion translocation across biological barriers is a fundamental requirement for life. In many cases, controlling this process-for example with neuroactive drugs-demands an understanding of rapid and reversible structural changes in membrane-embedded proteins, including ion channels and transporters. Classical approaches to electrophysiology and structural biology have provided valuable insights into several such proteins over macroscopic, often discontinuous scales of space and time. Integrating these observations into meaningful mechanistic models now relies increasingly on computational methods, particularly molecular dynamics simulations, while surfacing important challenges in data management and conceptual alignment. Here, we seek to provide contemporary context, concrete examples, and a look to the future for bridging disciplinary gaps in biological ion transport. This article is part of a Special Issue entitled: Beyond the Structure-Function Horizon of Membrane Proteins edited by Ute Hellmich, Rupak Doshi and Benjamin McIlwain. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Host Epithelial Interactions with Helicobacter Pylori: A Role for Disrupted Gastric Barrier Function in the Clinical Outcome of Infection?

    Directory of Open Access Journals (Sweden)

    Andre G Buret

    2005-01-01

    Full Text Available Infection of the human stomach with Helicobacter pylori may develop into gastritis, ulceration, adenocarcinoma and mucosal lymphomas. The pathogenic mechanisms that determine the clinical outcome from this microbial-epithelial interaction remain poorly understood. An increasing number of reports suggests that disruptions of epithelial barrier function may contribute to pathology and postinfectious complications in a variety of gastrointestinal infections. The aim of this review is to critically discuss the implications of H pylori persistence on gastric disease, with emphasis on the role of myosin light chain kinase, claudins and matrix metalloproteinases in gastric permeability defects, and their contribution to the development of cancer. These mechanisms and the associated signalling events may represent novel therapeutic targets to control disease processes induced by H pylori, a microbial pathogen that colonizes the stomach of over 50% of the human population.

  5. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

    Science.gov (United States)

    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

    2017-02-08

    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  6. Clinical effectiveness of low-power laser radiation and functioning of hemosalivatory barrier in patients with rheumatic diseases

    Science.gov (United States)

    Gladkova, Natalia D.; Karachistov, Alexander B.; Komarova, Lia G.; Alekseeva, Olga P.; Grunina, Elena A.

    1996-11-01

    We have estimated the clinical effectiveness of several regimes and ways of low power laser therapy (LT) on the basis of a double 'blind', placebo-controlling randomizing comparative test in 454 patients with rheumatic diseases (RD). LT for RD has a well-expressed placebo effect. The level of clinical effect of LT for RD is not so high. We couldn't achieve 'a considerable improvement' in any cases, 'an improvement' was secured in only 18 percent. LT should be viewed as a symptomatic means, with a primary anesthetic and feebly expressed anti-inflammatory effect, which can not influence the course of the rheumatoid process. Only in 15 percent of patients with RD, a sufficient functioning of hemo-salivary barrier was observed, the latter providing a reserve for adaption mechanism, which leads under the influence of stressor agents of medium strength not only to anesthetic, but also to moderately expressed anti- inflammatory effect.

  7. Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

    NARCIS (Netherlands)

    Rißmann, Robert

    2009-01-01

    Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

  8. Excitation functions for deuterium-induced reactions on 194Pt near the coulomb barrier

    Czech Academy of Sciences Publication Activity Database

    Kulko, A. A.; Skobelev, N. K.; Kroha, Václav; Penionzhkevich, Y. E.; Mrázek, Jaromír; Burjan, Václav; Hons, Zdeněk; Šimečková, Eva; Piskoř, Štěpán; Kugler, Andrej; Demekhina, N. A.; Sobolev, Yu. G.; Chuvilskaya, T. V.; Shirokova, K.; Kuterbekov, K.

    2012-01-01

    Roč. 9, 6-7 (2012), s. 502-507 ISSN 1547-4771 R&D Projects: GA MŠk LA08002 Institutional support: RVO:61389005 Keywords : nucelar reactions * excitation functions * charged particle activation Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders

  9. Does the disruption of horizontal anterior ciliary vessels affect the blood-aqueous barrier function?

    Science.gov (United States)

    Pan, Meihua; Yang, Mei; Xie, Renyi; Zhao, Zhimin; Huang, Xingxing

    2017-12-01

    To investigate the significance of the anterior ciliary vessels (ACVs) preservation during the conventional horizontal strabismus surgery. Patients (≥ 8 years) with horizontal strabismus were randomly allocated into group 1 (with ACV preservation) and group 2 (without ACV preservation). The surgical eyes in group 1 were further divided into group A (one rectus muscle operated) and group B (two rectus muscles operated). Similarly, eyes in group 2 were divided into group C (one rectus muscle operated) and group D (two rectus muscles operated). The success rate of ACV preservation was calculated. The anterior chamber flare measurements of each eye by laser flare photometry were recorded on the day prior to and after operation. The flare values between groups and between pre- and post-operation in each group were compared by one-way analysis of variance and a paired t-test respectively. In groups A and B, the success rate of ACV preservation was 82% (27/33) and 70% (28/40)respectively, and the flare values between pre- and post-operation showed no significant differences(4.378 ± 1.527, 4.544 ± 1.452, P = 0.526; 4.625 ± 1.090, 4.989 ± 1.468, P = 0.101 respectively). However, the postoperative values were significantly increased in group C and group D(4.661 ± 1.031, 5.039 ± 1.310, P = 0.025; 4.933 ± 1.691, 5.502 ± 1.430, P = 0.000 respectively). The postoperative flare readings of group D were significantly higher than group B, while group A and group C had no significant variation. ACV preservation probably has clinical significance in reducing the undesirable influence on the blood-aqueous barrier.

  10. Evolution of cement based materials in a repository for radioactive waste and their chemical barrier function

    International Nuclear Information System (INIS)

    Kienzler, Bernhard; Metz, Volker; Schlieker, Martina; Bohnert, Elke

    2015-01-01

    The use of cementitious materials in nuclear waste management is quite widespread. It covers the solidification of low/intermediate-level liquid as well as solid wastes (e.g. laboratory wastes) and serves as shielding. For both high-level and intermediate-low level activity repositories, cement/concrete likewise plays an important role. It is used as construction material for underground and surface disposals, but more importantly it serves as barrier or sealing material. For the requirements of waste conditioning, special cement mixtures have been developed. These include special mixtures for the solidification of evaporator concentrates, borate binding additives and for spilling solid wastes. In recent years, low-pH cements were strongly discussed especially for repository applications, e.g. (Celine CAU DIT COUMES 2008; Garcia-Sineriz, et al. 2008). Examples for relevant systems are Calcium Silicate Cements (ordinary Portland cement (OPC) based) or Calcium Aluminates Cements (CAC). Low-pH pore solutions are achieved by reduction of the portlandite content by partial substitution of OPC by mineral admixtures with high silica content. The blends follow the pozzolanic reaction consuming Ca(OH) 2 . Potential admixtures are silica fume (SF) and fly ashes (FA). In these mixtures, super plasticizers are required, consisting of polycarboxilate or naphthalene formaldehyde as well as various accelerating admixtures (Garcia-Sineriz, et al. 2008). The pH regime of concrete/cement materials may stabilize radionuclides in solution. Newly formed alteration products retain or release radionuclides. An important degradation product of celluloses in cement is iso-saccharin acid. According to Glaus 2004 (Glaus and van Loon 2004), it reacts with radionuclides forming dissolved complexes. Apart from potentially impacting radionuclide solubility limitations, concrete additives, radionuclides or other strong complexants compete for surface sites for sorbing onto cement phases. In

  11. Tranexamic Acid Attenuates The Loss of Lung Barrier Function in a Rat Model of Polytrauma And Hemorrhage With Resuscitation.

    Science.gov (United States)

    Wu, Xiaowu; Dubick, Michael A; Schwacha, Martin G; Cap, Andrew P; Darlington, Daniel N

    2017-04-01

    Severe trauma, hemorrhage, and resuscitation can lead to a trauma-related acute lung injury that involves rapid infiltration of immune cells and platelets. This infiltration involves exymatic degradation of matrix proteins, including plasmin, and causes loss of barrier function. Since tranexamic acid (TXA) inhibits plasminogen/ plasmin binding to target substrates, it may attenuate loss of barrier function after severe trauma, hemorrhage, and resuscitation. Sprague-Dawley rats were subjected to polytrauma (laparotomy, and trauma to intestines, liver, right leg skeletal muscle, and right femur fracture), then bled 40% of their blood volume. One hour after completion of polytrauma and hemorrhage, resuscitation was begun with fresh whole blood (FWB) or FWB with prior bolus administration of TXA (10 mg/kg in 0.2 mL). Polytrauma, hemorrhage, and resuscitation with FWB led to an elevation in lung water content that was significantly reduced with TXA administration. Polytrauma and hemorrhage led to rise in the number of neutrophils/monocytes and platelets in the lungs, and a rise in myeloperoxidase (MPO), neutrophil elastase and complement C5a content. While resuscitation with FWB significantly reduced the cellular infiltrate and MPO, FWB/TXA further reduced the levels of neutrophil/monocytes, neutrophil elastase, and complement C5a. Polytrauma and hemorrhage led to rise in lung plasmin activity that was significantly reduced with either FWB or FWB/TXA resuscitation. Severe trauma and hemorrhage leads to increases in lung water content, and immune cell, platelets, MPO, elastase, and C5a content in lung tissue, all markers of inflammation and acute lung injury. The addition of TXA to FWB resuscitation markedly attenuated the rise in these parameters suggesting its utility in treating acute lung injury.

  12. Effects of ambient air particulate exposure on blood-gas barrier permeability and lung function

    DEFF Research Database (Denmark)

    Bräuner, Elvira Vaclavik; Mortensen, Jann; Møller, Peter

    2009-01-01

    function and Clara cell 16 (CC16) protein release in healthy young subjects. Twenty-nine nonsmokers participated in a randomized, two-factor crossover study with or without biking exercise for 180 min and with 24-h exposure to particle-rich (6169-15,362 particles/cm(3); 7.0-11.6 microg/m(3) PM(2.5); 7...

  13. Breaking through barriers: using technology to address executive function weaknesses and improve student achievement.

    Science.gov (United States)

    Schwartz, David M

    2014-01-01

    Assistive technologies provide significant capabilities for improving student achievement. Improved accessibility, cost, and diversity of applications make integration of technology a powerful tool to compensate for executive function weaknesses and deficits and their impact on student performance, learning, and achievement. These tools can be used to compensate for decreased working memory, poor time management, poor planning and organization, poor initiation, and decreased memory. Assistive technology provides mechanisms to assist students with diverse strengths and weaknesses in mastering core curricular concepts.

  14. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  15. Dual functional MoS2/graphene interlayer as an efficient polysulfide barrier for advanced lithium-sulfur batteries

    International Nuclear Information System (INIS)

    Guo, Pengqian; Liu, Dequan; Liu, Zhengjiao; Shang, Xiaonan; Liu, Qiming; He, Deyan

    2017-01-01

    Highlights: •Dual functional MoS 2 /graphene interlayer was first used as an efficient polysulfide-trapping shield for lithium-sulfur batteries. •MoS 2 /graphene interlayer shows strong chemical interactions with LiPSs. •MoS 2 /graphene interlayer forms a 3D network to facilitate electron and ion transfer during the discharge-charge processes. •The resultant lithium-sulfur batteries exhibit a superior rate capacity and improved cycling capacity. -- Abstract: A dual functional interlayer consisted of composited two-dimensional MoS 2 and graphene has been developed as an efficient polysulfide barrier for lithium-sulfur batteries (LSBs). With such a configuration, LSBs show a superior rate capacity and improved cycling capacity. The excellent electrochemical performance can be attributed to the strong bonding interactions between the MoS 2 /graphene interlayer and the formed lithium polysulfides (LiPSs) as well as the good electrical conductivity of the MoS 2 /graphene composite. The MoS 2 /graphene interlayer can physically block LiPSs by the graphene nanosheets and chemically suppress the dissolution of LiPSs by the polar MoS 2 nanoflowers. Such a dual functional interlayer further provides a good contact with the surface of the sulfur cathode, acts as an upper current collector and greatly improves the sulfur utilization and the rate capability of LSBs.

  16. Prostaglandin E2 release from dermis regulates sodium permeability of frog skin epithelium

    DEFF Research Database (Denmark)

    Rytved, Klaus A.; Brodin, Birger; Nielsen, Robert

    1995-01-01

    Arachidonic acid, cAMP, epithelium, frog skin, intracellular calcium, prostaglandin E*U2, sodium transport, tight epithelium.......Arachidonic acid, cAMP, epithelium, frog skin, intracellular calcium, prostaglandin E*U2, sodium transport, tight epithelium....

  17. Non-Saccharomyces yeasts protect against epithelial cell barrier disruption induced by Salmonella enterica subsp. enterica serovar Typhimurium.

    Science.gov (United States)

    Smith, I M; Baker, A; Arneborg, N; Jespersen, L

    2015-11-01

    The human gastrointestinal epithelium makes up the largest barrier separating the body from the external environment. Whereas invasive pathogens cause epithelial barrier disruption, probiotic micro-organisms modulate tight junction regulation and improve epithelial barrier function. In addition, probiotic strains may be able to reduce epithelial barrier disruption caused by pathogenic species. The aim of this study was to explore non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Benchmarking against established probiotic strains, we evaluated the ability of four nonpathogenic yeast species to modulate transepithelial electrical resistance (TER) across a monolayer of differentiated human colonocytes (Caco-2 cells). Further, we assessed yeast modulation of a Salmonella Typhimurium-induced epithelial cell barrier function insult. Our findings demonstrate distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function. While the established probiotic yeast Saccharomyces boulardii increased TER across a Caco-2 monolayer by 30%, Kluyveromyces marxianus exhibited significantly stronger properties of TER enhancement (50% TER increase). In addition, our data demonstrate significant yeast-mediated modulation of Salmonella-induced epithelial cell barrier disruption and identify K. marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study demonstrates distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Further, our data demonstrate significant yeast-mediated modulation of Salmonella Typhimurium-induced epithelial cell barrier disruption and identify Kluyveromyces marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study is the first to demonstrate significant non-Saccharomyces yeast

  18. Intestinal subepithelial myofibroblasts support in vitro and in vivo growth of human small intestinal epithelium.

    Directory of Open Access Journals (Sweden)

    Nicholas Lahar

    Full Text Available The intestinal crypt-niche interaction is thought to be essential to the function, maintenance, and proliferation of progenitor stem cells found at the bases of intestinal crypts. These stem cells are constantly renewing the intestinal epithelium by sending differentiated cells from the base of the crypts of Lieberkühn to the villus tips where they slough off into the intestinal lumen. The intestinal niche consists of various cell types, extracellular matrix, and growth factors and surrounds the intestinal progenitor cells. There have recently been advances in the understanding of the interactions that regulate the behavior of the intestinal epithelium and there is great interest in methods for isolating and expanding viable intestinal epithelium. However, there is no method to maintain primary human small intestinal epithelium in culture over a prolonged period of time. Similarly no method has been published that describes isolation and support of human intestinal epithelium in an in vivo model. We describe a technique to isolate and maintain human small intestinal epithelium in vitro from surgical specimens. We also describe a novel method to maintain human intestinal epithelium subcutaneously in a mouse model for a prolonged period of time. Our methods require various growth factors and the intimate interaction between intestinal sub-epithelial myofibroblasts (ISEMFs and the intestinal epithelial cells to support the epithelial in vitro and in vivo growth. Absence of these myofibroblasts precluded successful maintenance of epithelial cell formation and proliferation beyond just a few days, even in the presence of supportive growth factors. We believe that the methods described here can be used to explore the molecular basis of human intestinal stem cell support, maintenance, and growth.

  19. Radiobiology of intestinal epithelium stem cells

    International Nuclear Information System (INIS)

    Konoplyannikova, O.A.

    1988-01-01

    After a single or three-fold whole body irradiation of mice with a dose of 4 Gy and the time interval for the proliferation to be restored (5 days or 3 weeks) the survival curve for stem cells of small intestine epithelium with regard to radiation dose was the same as that for non-preirradiated mice. This indicated that the proliferative potential of stem cells in these experimental conditions was not reduced

  20. Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

  1. Endothelial dysfunction and functional status of intestinal mucosal barrier in asphyxiated low birth weight infants

    Directory of Open Access Journals (Sweden)

    Huseynova S.A.

    2016-03-01

    Full Text Available Aim of study. The main prpose of present study was to determine the effect of endothelial dysfunction to the levels of markers of functional state of digestive system in infants with perinatal hypoxia. Materials and methods. The neuronal dysfunction was detected basing on the levels of NSE and NR2 antibodies. The functional state of gastrointestinal tract was estimated by IFABP, sLFABP, MUC-2, ITF, LBP. As the markers of endothelial dysfunction it was detected endotelin-1 and NO. The concentrations of markers were determined in peripheral blood of 66 preterm newborns exposure intrauterine hypoxia with 32–36 weeks of gestational age, which were classified as asphyxiated (1st group, n=30, non asphyxiated (2nd group, n=36 infants. Control group consisted of 22 healthy preterm babies. Results. It was not detected significant difference of NSE and NR2 antibodies levels between 1st and 2nd groups. The endothelin-1 concentrations significantly decreased in asphyxiated group in the background of high NO levels. The elevated level of IFABP in asphyxiated infants associated with compensative increasing of ITF and low anti endotoxine immunity. Conclusion. Endothelial dysfunction is one of the main factor resulting in hypoxic-ischemic injury of gastrointestinal tract in asphyxiated low birth weight infants.

  2. Development of the ovarian follicular epithelium.

    Science.gov (United States)

    Rodgers, R J; Lavranos, T C; van Wezel, I L; Irving-Rodgers, H F

    1999-05-25

    A lot is known about the endocrine control of the development of ovarian follicles, but a key question now facing researchers is which molecular and cellular processes take part in control of follicular growth and development. The growth and development of ovarian follicles occurs postnatally and throughout adult life. In this review, we focus on the follicular epithelium (membrana granulosa) and its basal lamina. We discuss a model of how granulosa cells arise from a population of stem cells and then enter different lineages before differentiation. The structure of the epithelium at the antral stage of development is presented, and the effects that follicle growth has on the behavior of the granulosa cells are discussed. Finally, we discuss the evidence that during follicle development the follicular basal lamina changes in composition. This would be expected if the behavior of the granulosa cells changes, or if the permeability of the basal lamina changes. It will be evident that the follicular epithelium has similarities to other epithelia in the body, but that it is more dynamic, as gross changes occur during the course of follicle development. This basic information will be important for the development of future reproductive technologies in both humans and animals, and possibly for understanding polycystic ovarian syndrome in women.

  3. Oral and fecal Campylobacter concisus strains perturb barrier function by apoptosis induction in HT-29/B6 intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Hans Linde Nielsen

    Full Text Available Campylobacter concisus infections of the gastrointestinal tract can be accompanied by diarrhea and inflammation, whereas colonization of the human oral cavity might have a commensal nature. We focus on the pathophysiology of C. concisus and the effects of different clinical oral and fecal C. concisus strains on human HT-29/B6 colon cells. Six oral and eight fecal strains of C. concisus were isolated. Mucus-producing HT-29/B6 epithelial monolayers were infected with the C. concisus strains. Transepithelial electrical resistance (R(t and tracer fluxes of different molecule size were measured in Ussing chambers. Tight junction (TJ protein expression was determined by Western blotting, and subcellular TJ distribution was analyzed by confocal laser-scanning microscopy. Apoptosis induction was examined by TUNEL-staining and Western blot of caspase-3 activation. All strains invaded confluent HT-29/B6 cells and impaired epithelial barrier function, characterized by a time- and dose-dependent decrease in R(t either after infection from the apical side but even more from the basolateral compartment. TJ protein expression changes were sparse, only in apoptotic areas of infected monolayers TJ proteins were redistributed. Solely the barrier-forming TJ protein claudin-5 showed a reduced expression level to 66±8% (P<0.05, by expression regulation from the gene. Concomitantly, Lactate dehydrogenase release was elevated to 3.1±0.3% versus 0.7±0.1% in control (P<0.001, suggesting cytotoxic effects. Furthermore, oral and fecal C. concisus strains elevated apoptotic events to 5-fold. C. concisus-infected monolayers revealed an increased permeability for 332 Da fluorescein (1.74±0.13 vs. 0.56±0.17 10(-6 cm/s in control, P<0.05 but showed no difference in permeability for 4 kDa FITC-dextran (FD-4. The same was true in camptothecin-exposed monolayers, where camptothecin was used for apoptosis induction.In conclusion, epithelial barrier dysfunction by oral and

  4. [Implementation of functional autonomy measurement system: barriers and facilitators in PISE-Dordogne project].

    Science.gov (United States)

    Gervais, Pauline; Hébert, Réjean; Lamontagne, Julie; Tousignant, Michel

    2011-12-01

    The objectives of the study were to identify the adjustments made during the implantation and the conditions favouring or limiting the SMAF utilisation. A multiqualitative quote was developed. The Functional autonomy measurement system (SMAF) was implanted in 11 French medico-social establishments. Analyses were made with the mixed type thematic method from Miles and Huberman. Principal adjustments that have been made during implantation concern the informatics assistance and clinical support. Strategic, organizational and individual factors explained adhesion level of actors and the subsequent flow of implantation. Establishment of SMAF and of the software eSMAF® in the medico-social establishments rests on a certain number of conditions which could be identified during the study. These conditions made it possible to work out structured recommendations for future implementations.

  5. Impaired barrier function by dietary fructo-oligosaccharides (FOS in rats is accompanied by increased colonic mitochondrial gene expression

    Directory of Open Access Journals (Sweden)

    Kramer Evelien

    2008-03-01

    well as three other peptide hormone genes; peptide YY, pancreatic polypeptide and cholecystokinin. Conclusion We conclude that altered energy metabolism may underly colonic barrier function disruption due to FOS feeding in rats.

  6. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Enrrico Bloise

    2017-02-01

    Full Text Available Background/Aims: Viral infection during pregnancy is known to affect the fetal brain. The toll-like receptor (TLR-3 is a pattern recognition receptor activated by viruses known to elicit adverse fetal neurological outcomes. The P-glycoprotein (P-gp efflux transporter protects the developing fetus by limiting the transfer of substrates across both the placenta and the fetal blood-brain barrier (BBB. As such, inhibition of P-gp at these blood-barrier sites may result in increased exposure of the developing fetus to environmental toxins and xenobiotics present in the maternal circulation. We hypothesized that viral exposure during pregnancy would impair P-gp function in the placenta and in the developing BBB. Here we investigated whether the TLR-3 ligand, polyinosinic:polycytidylic acid (PolyI:C, increased accumulation of one P-gp substrate in the fetus and in the developing fetal brain. Methods: Pregnant C57BL/6 mice (GD15.5 were injected (i.p. with PolyI:C (5 mg/kg or 10 mg/kg or vehicle (saline. [3H]digoxin (P-gp substrate was injected (i.v. 3 or 23h post-treatment and animals were euthanized 1h later. Maternal plasma, ‘fetal-units’ (fetal membranes, amniotic fluid and whole fetus, and fetal brains were collected. Results: PolyI:C exposure (4h significantly elevated maternal plasma IL-6 (P<0.001 and increased [3H]digoxin accumulation in the fetal brain (P<0.05. In contrast, 24h after PolyI:C exposure, no effect on IL-6 or fetal brain accumulation of P-gp substrate was observed. Conclusion: Viral infection modeled by PolyI:C causes acute increases in fetal brain accumulation of P-gp substrates and by doing so, may increase fetal brain exposure to xenobiotics and environmental toxins present in the maternal circulation.

  7. SH2 domain-containing protein tyrosine phosphatase 2 and focal adhesion kinase protein interactions regulate pulmonary endothelium barrier function.

    Science.gov (United States)

    Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O

    2015-06-01

    Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients

  8. The food contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin expression

    International Nuclear Information System (INIS)

    Pinton, Philippe; Nougayrede, Jean-Philippe; Del Rio, Juan-Carlos; Moreno, Carolina; Marin, Daniela E.; Ferrier, Laurent; Bracarense, Ana-Paula; Kolf-Clauw, Martine; Oswald, Isabelle P.

    2009-01-01

    'The gastrointestinal tract represents the first barrier against food contaminants as well as the first target for these toxicants. Deoxynivalenol (DON) is a mycotoxin that commonly contaminates cereals and causes various toxicological effects. Through consumption of contaminated cereals and cereal products, human and pigs are exposed to this mycotoxin. Using in vitro, ex vivo and in vivo approaches, we investigated the effects of DON on the intestinal epithelium. We demonstrated that, in intestinal epithelial cell lines from porcine (IPEC-1) or human (Caco-2) origin, DON decreases trans-epithelial electrical resistance (TEER) and increases in a time and dose-dependent manner the paracellular permeability to 4 kDa dextran and to pathogenic Escherichia coli across intestinal cell monolayers. In pig explants treated with DON, we also observed an increased permeability of intestinal tissue. These alterations of barrier function were associated with a specific reduction in the expression of claudins, which was also seen in vivo in the jejunum of piglets exposed to DON-contaminated feed. In conclusion, DON alters claudin expression and decreases the barrier function of the intestinal epithelium. Considering that high levels of DON may be present in food or feed, consumption of DON-contaminated food/feed may induce intestinal damage and has consequences for human and animal health.

  9. Effect of ruminal acidosis and short-term low feed intake on indicators of gastrointestinal barrier function in Holstein steers.

    Science.gov (United States)

    Pederzolli, Rae-Leigh A; Van Kessel, Andrew G; Campbell, John; Hendrick, Steve; Wood, Katie M; Penner, Gregory B

    2018-02-15

    The objective of this study was to determine effect of ruminal acidosis (RA) and low feed intake [LFI] on the regional barrier function of the gastrointestinal tract. Twenty-one Holstein steers were fed for ad libitum intake for 5 d (control [CON]), fed at 25% of ad libitum intake for 5 d (LFI), or provided 2 d of ad libitum intake followed by 1-d of feed restriction (25% of ad libitum intake), 1 d where 30% of ad libitum dry matter intake (DMI) was provided as pelleted barley followed by the full allocation (RA) and fed for ad libitum intake the following day. Tissues and digesta from the rumen, omasum, duodenum, jejunum, ileum, cecum, proximal, and distal colon were collected. Permeability was assessed using the mucosal-to-serosal flux of inulin (JMS-inulin) and mannitol (JMS-mannitol). Digesta pH was 0.81, 0.63, and 0.42 pH units less for RA than CON in the rumen, cecum, and proximal colon; while, LFI had pH that was 0.47 and 0.36 pH units greater in the rumen and proximal colon compared to CON. Total ruminal short-chain fatty acid (SCFA) concentration were less for LFI (92 mM; P = 0.010) and RA (87 mM; P = 0.007) than CON (172 mM) steers. In the proximal colon, the proportion of butyrate (P = 0.025 and P = 0.022) and isobutyrate (P = 0.019 and P = 0.019) were greater, and acetate (P = 0.028 and P = 0.028) was less for LFI and RA, respectively, when compared to CON steers. Ruminal papillae length, width, perimeter, and surface area were 1.21 mm, 0.78 mm, 3.84 mm, and 11.15 mm2 less for LFI than CON; while, RA decreased papillae width by 0.52 mm relative to CON. The JMS-mannitol was less for LFI steers than CON in the proximal colon (P = 0.041) and in the distal colon (P = 0.015). Increased gene expression for claudin 1, occludin, tight-cell junction protein 1 and 2, and toll-like receptor 4 were detected for LFI relative to CON in the rumen, jejunum, and proximal colon. For RA steers, expression of toll-like receptor 4 in the rumen, and occludin and tight

  10. Rapid and clean amine functionalization of carbon nanotubes in a dielectric barrier discharge reactor for biosensor development

    International Nuclear Information System (INIS)

    Khodadadei, Fatemeh; Ghourchian, Hedayatollah; Soltanieh, Mansour; Hosseinalipour, Mohammad; Mortazavi, Yadollah

    2014-01-01

    Multiwalled carbon nanotubes (MWCNTs) were amine-functionalized using the process of dielectric barrier discharge (DBD) plasma treatment. The scanning electron microscope micrographs and Fourier transform infra-red spectroscopy clearly demonstrated that the carbon skeleton structure of the plasma-treated MWCNTs was preserved and amine groups were coupled to MWCNTs during this process. The amine-functionalized MWCNTs were then fixed on glassy carbon (GC) electrode and glucose oxidase (GO X ) as a model enzyme was immobilized on the modified GC electrode. Direct electron transfer between the redox active center of the immobilized GO X and the plasma-treated MWCNTs was investigated through cyclic voltammetry. The well-defined, quasi-reversible redox peaks of the immobilized GO X revealed that GO X retained its activity such that it could specifically catalyze the oxidation of glucose with great efficiency. The obtained enzyme electrode was used for glucose biosensing with the linear range from 17 to 646 μM and sensitivity of 12.3 μA/mM cm 2 . Based on the signal to noise ratio of 3, the detection limit was estimated to be 9 μM. The Michaelis–Menten constant for immobilized GO X was as low as 480 μM

  11. Barrier Function-Based Neural Adaptive Control With Locally Weighted Learning and Finite Neuron Self-Growing Strategy.

    Science.gov (United States)

    Jia, Zi-Jun; Song, Yong-Duan

    2017-06-01

    This paper presents a new approach to construct neural adaptive control for uncertain nonaffine systems. By integrating locally weighted learning with barrier Lyapunov function (BLF), a novel control design method is presented to systematically address the two critical issues in neural network (NN) control field: one is how to fulfill the compact set precondition for NN approximation, and the other is how to use varying rather than a fixed NN structure to improve the functionality of NN control. A BLF is exploited to ensure the NN inputs to remain bounded during the entire system operation. To account for system nonlinearities, a neuron self-growing strategy is proposed to guide the process for adding new neurons to the system, resulting in a self-adjustable NN structure for better learning capabilities. It is shown that the number of neurons needed to accomplish the control task is finite, and better performance can be obtained with less number of neurons as compared with traditional methods. The salient feature of the proposed method also lies in the continuity of the control action everywhere. Furthermore, the resulting control action is smooth almost everywhere except for a few time instants at which new neurons are added. Numerical example illustrates the effectiveness of the proposed approach.

  12. Asymmetric Barrier Lyapunov Function-Based Wheel Slip Control for Antilock Braking System

    Directory of Open Access Journals (Sweden)

    Xiaolei Chen

    2015-01-01

    Full Text Available As an important device of the aircraft landing system, the antilock braking system (ABS has a function to avoid aircraft wheels self-locking. To deal with the strong nonlinear characteristics, complex nonlinear control schemes are applied in ABS. However, none of existing control schemes focus on the braking operating status, which directly reflects wheels self-locking degree. In this paper, the braking operating status region is divided into three regions: the healthy region, the light slip region, and the deep slip region. An ABLF-based wheel slip controller is proposed for ABS to constrain the braking system operating status in the healthy region and the light slip region. Therefore the ABS will be prevented from operating in the deep slip region. Under the proposed control scheme, self-locking is avoided completely and zero steady state error tracking of the wheel optimal slip ratio is implemented. The Hardware-In-Loop (HIL experiments have validated the effectiveness of the proposed controller.

  13. Defects in small intestinal epithelial barrier function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine.

    Science.gov (United States)

    Moeser, Adam J; Borst, Luke B; Overman, Beth L; Pittman, Jeremy S

    2012-10-01

    The objective of this study was to investigate intestinal function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Jejunum and distal ileum from control and pigs exhibiting PFTS was harvested at weaning, 4 and 11 days post-weaning (PW) for intestinal barrier function studies and histological analyses (n=6 pigs per group). Marked disturbances in intestinal barrier function was observed in PFTS pigs, compared with controls, indicated by lower (p<0.05) TER and increased (p<0.01) permeability to FITC dextran (4 kDa). Intestines from weaned pigs, subjected to a 4-day fast, exhibited minor disturbances in intestinal barrier function. Villus atrophy and crypt hyperplasia were observed in the PFTS intestine compared with control and fasted pigs. These data demonstrate that PFTS is associated with profound disturbances in intestinal epithelial barrier function and alterations in mucosal and epithelial morphology in which anorexia is not the sole factor. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Sensing of EGTA Mediated Barrier Tissue Disruption with an Organic Transistor

    Directory of Open Access Journals (Sweden)

    Scherrine Tria

    2013-01-01

    Full Text Available Barrier tissue protects the body against external factors by restricting the passage of molecules. The gastrointestinal epithelium is an example of barrier tissue with the primary purpose of allowing the passage of ions and nutrients, while restricting the passage of pathogens and toxins. It is well known that the loss of barrier function can be instigated by a decrease in extracellular calcium levels, leading to changes in protein conformation and an increase in paracellular transport. In this study, ethylene glycol-bis(beta-aminoethyl ether-N,N,N',N'-tetra acetic acid (EGTA, a calcium chelator, was used to disrupt the gastrointestinal epithelial barrier. The effect of EGTA on barrier tissue was monitored by a novel label-free method based on an organic electrochemical transistor (OECT integrated with living cells and validated against conventional methods for measuring barrier tissue integrity. We demonstrate that the OECT can detect breaches in barrier tissue upon exposure to EGTA with the same sensitivity as existing methods but with increased temporal resolution. Due to the potential of low cost processing techniques and the flexibility in design associated with organic electronics, the OECT has great potential for high-throughput, disposable sensing and diagnostics.

  15. Ion Transport in Human Pancreatic Duct Epithelium, Capan-1 Cells, Is Regulated by Secretin, VIP, Acetylcholine, and Purinergic Receptors

    DEFF Research Database (Denmark)

    Wang, Jing; Novak, Ivana

    2013-01-01

    OBJECTIVES: The objective of the study was to establish a solid model of polarized epithelium for human pancreatic ducts, where electrical parameters could be measured as indicators of ion transport. Further, we aimed to determine functional expression of several receptors, in particular, puriner...... transport in human pancreatic duct epithelium, Capan-1 cells, is regulated by secretin, VIP, acetylcholine, adenosine, and purinergic P2 receptors; and this human model has a good potential for studies of physiology and pathophysiology of pancreatic duct ion transport....

  16. Nanotopography follows force in TGF-β1 stimulated epithelium

    International Nuclear Information System (INIS)

    Thoelking, Gerold; Oberleithner, Hans; Riethmuller, Christoph; Reiss, Bjoern; Wegener, Joachim; Pavenstaedt, Hermann

    2010-01-01

    Inflammation and cellular fibrosis often imply an involvement of the cytokine TGF-β1. TGF-β1 induces epithelial-to-mesenchymal transdifferentiation (EMT), a term describing the loss of epithelium-specific function. Indicative for this process are an elongated cell shape parallel to stress fibre formation. Many signalling pathways of TGF-β1 have been discovered, but mechanical aspects have not yet been investigated. In this study, atomic force microscopy (AFM) was used to analyse surface topography and mechanical properties of EMT in proximal kidney tubule epithelium (NRK52E). Elongated cells, an increase of stress fibre formation and a loss of microvillus compatible structures were observed as characteristic signs of EMT. Furthermore, AFM could identify an increase in stiffness by 71% after six days of stimulation with TGF-β1. As a novel topographical phenomenon, nodular protrusions emerged at the cell-cell junctions. They occurred preferentially at sites where stress fibres cross the border. Since these nodular protrusions were sensitive to inhibitors of force generation, they can indicate intracellular tension. The results demonstrate a manifest impact of elevated tension on the cellular topography.

  17. Radio-iodination of plasma membranes of toad bladder epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, H J; Edelman, I S [California Univ., San Francisco (USA). Cardiovascular Research Inst.; California Univ., San Francisco (USA). Dept. of Medicine; California Univ., San Francisco (USA). Dept. of Biochemistry and Biophysics)

    1979-01-01

    The present report describes high yield enzymatic radio-iodination of the apical and basal-lateral plasma membranes of toad bladder epithelium with /sup 125/I-Na, by a procedure that does not breach the functional integrity of the epithelium, as assessed by the basal and vasopressin-sensitive short-circuit current (SCC). Iodination of basal-lateral plasma membranes, at a yield comparable to that obtained with apical labelling, was attained after about 30 min of exposure of the intact bladder to the labelling solutions. Approximately 25% of the basal-lateral labeling was lost when the epithelial cells were harvested after collagenase treatment, implying that some iodination of the basement membrane had taken place. Less than 10% of iodination of the apical or basal-lateral surfaces was accounted for by lipid-labeling. Analysis of the labeled apical and basal-lateral species by enzymatic digestion and thin layer chromatography disclosed that virtually all the radioactivity was present as mono-iodotyrosine (MIT). (orig./AJ).

  18. DHT deficiency perturbs the integrity of the rat seminiferous epithelium by disrupting tight and adherens junctions.

    Science.gov (United States)

    Kolasa, Agnieszka; Marchlewicz, Mariola; Wenda-Różewicka, Lidia; Wiszniewska, Barbara

    2011-01-01

    In rats with a DHT deficiency induced by finasteride, morphological changes in the seminiferous epithelium were observed. The structural alterations were manifested by the premature germ cells sloughing into the lumen of seminiferous tubules. The etiology of this disorder could be connected with intercellular junctions disintegration. We showed in the immunohistochemical study the changes in expression of some proteins building tight and adherens junctions. The depression of N-cadherin, β-catenin and occludin immunoexpressions could be the reason for the release of immature germ cells from the seminiferous epithelium. However, the observed increase of the immunohistochemical reaction intensity of vinculin, one of the cadherin/catenin complex regulators, could be insufficient to maintain the proper function of adherens junctions. The hormonal imbalance appears to influence the pattern of expression of junctional proteins in the seminiferous epithelium. It could lead to untimely germ cells sloughing, and ultimately could impair fertility.

  19. Dietary Lactobacillus rhamnosus GG Supplementation Improves the Mucosal Barrier Function in the Intestine of Weaned Piglets Challenged by Porcine Rotavirus.

    Directory of Open Access Journals (Sweden)

    Xiangbing Mao

    Full Text Available Lactobacillus rhamnosus GG (LGG has been regarded as a safe probiotic strain. The aim of this study was to investigate whether dietary LGG supplementation could alleviate diarrhea via improving jejunal mucosal barrier function in the weaned piglets challenged by RV, and further analyze the potential roles for apoptosis of jejunal mucosal cells and intestinal microbiota. A total of 24 crossbred barrows weaned at 21 d of age were assigned randomly to 1 of 2 diets: the basal diet and LGG supplementing diet. On day 11, all pigs were orally infused RV or the sterile essential medium. RV infusion increased the diarrhea rate, increased the RV-Ab, NSP4 and IL-2 concentrations and the Bax mRNA levels of jejunal mucosa (P<0.05, decreased the villus height, villus height: crypt depth, the sIgA, IL-4 and mucin 1 concentrations and the ZO-1, occludin and Bcl-2 mRNA levels of jejunal mucosa (P<0.05, and affected the microbiota of ileum and cecum (P<0.05 in the weaned pigs. Dietary LGG supplementation increased the villus height and villus height: crypt depth, the sIgA, IL-4, mucin 1 and mucin 2 concentrations, and the ZO-1, occludin and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05 reduced the Bax mRNA levels of the jejunal mucosa (P<0.05 in weaned pigs. Furthermore, dietary LGG supplementation alleviated the increase of diarrhea rate in the weaned pigs challenged by RV (P<0.05, and relieve the effect of RV infection on the villus height, crypt depth and the villus height: crypt depth of the jejunal mucosa (P<0.05, the NSP4, sIgA, IL-2, IL-4, mucin 1 and mucin 2 concentrations of jejunal mucosa (P<0.05, the ZO-1, occludin, Bax and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05, and the microbiota of ileum and cecum (P<0.05 in the weaned pigs challenged by RV. These results suggest that supplementing LGG in diets alleviated the diarrhea of weaned piglets challenged by RV via inhibiting the virus multiplication and improving the jejunal mucosal barrier

  20. Fluoxetine and vitamin C synergistically inhibits blood-spinal cord barrier disruption and improves functional recovery after spinal cord injury.

    Science.gov (United States)

    Lee, Jee Y; Choi, Hae Y; Yune, Tae Y

    2016-10-01

    Recently we reported that fluoxetine (10 mg/kg) improves functional recovery by attenuating blood spinal cord barrier (BSCB) disruption after spinal cord injury (SCI). Here we investigated whether a low-dose of fluoxetine (1 mg/kg) and vitamin C (100 mg/kg), separately not possessing any protective effect, prevents BSCB disruption and improves functional recovery when combined. After a moderate contusion injury at T9 in rat, a low-dose of fluoxetine and vitamin C, or the combination of both was administered intraperitoneally immediately after SCI and further treated once a day for 14 d. Co-treatment with fluoxetine and vitamin C significantly attenuated BSCB permeability at 1 d after SCI. When only fluoxetine or vitamin C was treated after injury, however, there was no effect on BSCB disruption. Co-treatment with fluoxetine and vitamin C also significantly inhibited the expression and activation of MMP-9 at 8 h and 1 d after injury, respectively, and the infiltration of neutrophils (at 1 d) and macrophages (at 5 d) and the expression of inflammatory mediators (at 2 h, 6 h, 8 h or 24 h after injury) were significantly inhibited by co-treatment with fluoxetine and vitamin C. Furthermore, the combination of fluoxetine and vitamin C attenuated apoptotic cell death at 1 d and 5 d and improved locomotor function at 5 weeks after SCI. These results demonstrate the synergistic effect combination of low-dose fluoxetine and vitamin C on BSCB disruption after SCI and furthermore support the effectiveness of the combination treatment regimen for the management of acute SCI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Jacob Barbara A

    2009-02-01

    Full Text Available Abstract Background HIV-infected individuals are at increased risk for acute and chronic airway disease even though there is no evidence that the virus can infect the lung epithelium. Although HIV-related proteins including gp120 and Tat can directly cause oxidant stress and cellular dysfunction, their effects in the lung are unknown. The goal of this study was to determine the effects of HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayer permeability in vitro. Oxidant stress in the alveolar space was determined by measuring the glutathione redox couple by high performance liquid chromatography, and the expression and membrane localization of key tight junction proteins were assessed. Finally, the direct effects of the HIV-related proteins gp120 and Tat on alveolar epithelial barrier formation and tight junction protein expression were determined. Results HIV-1 transgene expression caused oxidant stress within the alveolar space and impaired epithelial barrier function even though there was no evidence of overt inflammation within the airways. The expression and membrane localization of the tight junction proteins zonula occludens-1 and occludin were decreased in alveolar epithelial cells from HIV-1 transgenic rats. Further, treating alveolar epithelial monolayers from wild type rats in vitro with recombinant gp120 or Tat for 24 hours reproduced many of the effects on zonula occludens-1 and occludin expression and membrane localization. Conclusion Taken together, these data indicate that HIV-related proteins cause oxidant stress and alter the expression of critical tight junction proteins in the alveolar epithelium, resulting in barrier dysfunction.

  2. Posttranslational regulation of glucose-6-phosphate dehydrogenase activity in tongue epithelium

    NARCIS (Netherlands)

    Biagiotti, E.; Bosch, K. S.; Ninfali, P.; Frederiks, W. M.; van Noorden, C. J.

    2000-01-01

    Expression of glucose-6-phosphate dehydrogenase (G6PD) activity is high in tongue epithelium, but its exact function is still unknown, it may be related;either to the high proliferation rate of this tissue or to protection against oxidative stress. To elucidate its exact role, we localized

  3. Histology, Immunohistochemistry and Ultrastructure of the Bovine Palatine Tonsil with Special Emphasis on Reticular Epithelium

    Science.gov (United States)

    The paired palatine tonsils are located at the junction of the nasopharynx and oropharynx; ideally positioned to sample antigens entering through either the nasal cavity or oral cavity. Entering antigens will first contact tonsilar epithelium. To better understand the cellular and functional composi...

  4. Toll-Like Receptor 2 Activation by beta 2 -> 1-Fructans Protects Barrier Function of T84 Human Intestinal Epithelial Cells in a Chain Length-Dependent Manner

    NARCIS (Netherlands)

    Vogt, Leonie M.; Meyer, Diederick; Pullens, Gerdie; Faas, Marijke M.; Venema, Koen; Ramasamy, Uttara; Schols, Henk A.; de Vos, Paul

    Dietary fiber intake is associated with lower incidence and mortality from disease, but the underlying mechanisms of these protective effects are unclear. We hypothesized that beta 2 -> 1-fructan dietary fibers confer protection on intestinal epithelial cell barrier function via Toll-like receptor 2

  5. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; A randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, De Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm J.H.M.; Wit, De Nicole J.W.; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  6. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

  7. South African Teachers' Attitudes toward Learners with Barriers to Learning: Attention-Deficit and Hyperactivity Disorder and Little or No Functional Speech

    Science.gov (United States)

    Bornman, Juan; Donohue, Dana K.

    2013-01-01

    This study examined teachers' attitudes toward learners with two types of barriers to learning: a learner with attention-deficit and hyperactivity disorder (ADHD), and a learner with little or no functional speech (LNFS). The results indicated that although teachers reported that the learner with ADHD would be more disruptive in class and have a…

  8. Analysis of complete fusion excitation functions for 7Li+152Sm, 197Au and 209Bi reactions at around barrier energies

    International Nuclear Information System (INIS)

    Kharab, Rajesh; Chahal, Rajiv; Kumar, Rajiv

    2017-01-01

    In the present work we have analyzed the fusion excitation function for CF process using the simple Wong’s formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in near barrier energy region for 7 Li+ 152 Sm, 197 Au and 209 Bi reactions

  9. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, de Paul; Boekschoten, Mark; Govers, Coen; Pieters, Harm J.H.M.; Wit, de Nicole; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein rearrangement,

  10. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; de Vos, Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm-Jan H M; de Wit, Nicole J. W.; Bron, Peter A.; Masclee, Ad A M; Troost, Freddy J

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  11. Information barriers

    International Nuclear Information System (INIS)

    Fuller, J.L.; Wolford, J.

    2001-01-01

    Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense

  12. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  13. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    International Nuclear Information System (INIS)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  14. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  15. Chlorinated pool attendance, airway epithelium defects and the risks of allergic diseases in adolescents: Interrelationships revealed by circulating biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Alfred, E-mail: Alfred.bernard@uclouvain.be; Nickmilder, Marc; Dumont, Xavier

    2015-07-15

    It has been suggested that allergic diseases might be epithelial disorders driven by various environmental stressors but the epidemiological evidence supporting this concept is limited. In a cross-sectional study of 835 school adolescents (365 boys; mean age, 15.5 yr), we measured the serum concentrations of Club cell protein (CC16), surfactant-associated protein D (SP-D) and of total and aeroallergen-specific IgE. We used the serum CC16/SP-D concentration ratio as an index integrating changes in the permeability (SP-D) and secretory function (CC16) of the airway epithelium. In both sexes, early swimming in chlorinated pools emerged as the most consistent and strongest predictor of low CC16 and CC16/SP-D ratio in serum. Among girls, a low CC16/SP-D ratio was associated with increased odds (lowest vs. highest tertile) for pet sensitization (OR 2.97, 95% CI 1.19–8.22) and for hay fever in subjects sensitized to pollen (OR 4.12, 95% CI 1.28–14.4). Among boys, a low CC16/SP-D ratio was associated with increased odds for house-dust mite (HDM) sensitization (OR 2.01, 95% CI 1.11–3.73), for allergic rhinitis in subjects sensitized to HDM (OR 3.52, 95% CI 1.22–11.1) and for asthma in subjects sensitized to any aeroallergen (OR 3.38, 95% CI 1.17–11.0), HDM (OR 5.20, 95% CI 1.40–24.2) or pollen (OR 5.82, 95% CI 1.51–27.4). Odds for allergic sensitization or rhinitis also increased with increasing SP-D or decreasing CC16 in serum. Our findings support the hypothesis linking the development of allergic diseases to epithelial barrier defects due to host factors or environmental stressors such as early swimming in chlorinated pools. - Highlights: • We conducted a cross-sectional study of 835 school adolescents. • The airway epithelium integrity was evaluated by measuring serum pneumoproteins. • The risk of allergic diseases was associated with a defective airway epithelium. • Childhood swimming in chlorinated pools can cause persistent epithelial

  16. Chlorinated pool attendance, airway epithelium defects and the risks of allergic diseases in adolescents: Interrelationships revealed by circulating biomarkers

    International Nuclear Information System (INIS)

    Bernard, Alfred; Nickmilder, Marc; Dumont, Xavier

    2015-01-01

    It has been suggested that allergic diseases might be epithelial disorders driven by various environmental stressors but the epidemiological evidence supporting this concept is limited. In a cross-sectional study of 835 school adolescents (365 boys; mean age, 15.5 yr), we measured the serum concentrations of Club cell protein (CC16), surfactant-associated protein D (SP-D) and of total and aeroallergen-specific IgE. We used the serum CC16/SP-D concentration ratio as an index integrating changes in the permeability (SP-D) and secretory function (CC16) of the airway epithelium. In both sexes, early swimming in chlorinated pools emerged as the most consistent and strongest predictor of low CC16 and CC16/SP-D ratio in serum. Among girls, a low CC16/SP-D ratio was associated with increased odds (lowest vs. highest tertile) for pet sensitization (OR 2.97, 95% CI 1.19–8.22) and for hay fever in subjects sensitized to pollen (OR 4.12, 95% CI 1.28–14.4). Among boys, a low CC16/SP-D ratio was associated with increased odds for house-dust mite (HDM) sensitization (OR 2.01, 95% CI 1.11–3.73), for allergic rhinitis in subjects sensitized to HDM (OR 3.52, 95% CI 1.22–11.1) and for asthma in subjects sensitized to any aeroallergen (OR 3.38, 95% CI 1.17–11.0), HDM (OR 5.20, 95% CI 1.40–24.2) or pollen (OR 5.82, 95% CI 1.51–27.4). Odds for allergic sensitization or rhinitis also increased with increasing SP-D or decreasing CC16 in serum. Our findings support the hypothesis linking the development of allergic diseases to epithelial barrier defects due to host factors or environmental stressors such as early swimming in chlorinated pools. - Highlights: • We conducted a cross-sectional study of 835 school adolescents. • The airway epithelium integrity was evaluated by measuring serum pneumoproteins. • The risk of allergic diseases was associated with a defective airway epithelium. • Childhood swimming in chlorinated pools can cause persistent epithelial

  17. Genotoxic differences by sex in nasal epithelium and blood leukocytes in subjects residing in a highly polluted area

    International Nuclear Information System (INIS)

    Fortoul, T.I.; Valverde, M.; Lopez, M.C.; Avila-Costa, M.R.; Avila-Casado, M.C.; Mussali-Galante, P.; Gonzalez-Villalva, A.; Rojas, E.; Ostrosky-Shejet, P.

    2004-01-01

    We describe differences by sex in genotoxic damage found in a population of medical students exposed to a highly oxidative atmosphere, compared with a control group, measured by the single-cell gel electrophoresis assay and histological changes in nasal epithelium smears. Cells were obtained from the nasal epithelium and blood leukocytes. Higher DNA damage in nasal cells and leukocytes was found in males compared to females and control subjects. The percentage of squamous metaplastic changes in the nasal epithelium was also higher in males compared with females and controls. The commutation of normal nasal epithelium by squamous cells might modify its protective function in the nose, increasing the risk of damage to the lower respiratory tract. Although, as medical students, males and females were exposed to the same environment and activity patterns, male genotoxicity damage was higher in control and exposed subjects. More research should be done in order to identify direct or indirect sexual hormone intervention

  18. Alterations in blood-brain barrier function following acute hypertension: comparison of the blood-to-brain transfer of horseradish peroxidase with that of alpha-aminisobutyric acid

    International Nuclear Information System (INIS)

    Ellison, M.D.B.

    1985-01-01

    The blood-brain barrier (BBB) selectively restricts the blood-to-brain passage of many solutes owing to unique properties of cerebrovascular endothelial cell membranes. To date, experimental study of the BBB has been accomplished primarily through the use of two different methodological approaches. Morphological studies have mostly employed large molecular weight (MW) tracers to detect morphological alterations underlying increased permeability. Physiological studies, employing smaller, more physiologic tracers have successfully described, quantitatively, certain functional aspects of blood-to-brain transfer. The current work attempts to merge these two approaches and to consider barrier function/dysfunction from both a morphological and a functional perspective. Specifically, the study compares in rats, following acute hypertension, the cerebrovascular passage of 14 C-alpha-aminoisobutyric acid (AIB) and that of horseradish peroxidase (HRP). The blood-to-brain passage of AIB and HRP were compared following acute hypertension, with regard to both the distributions of the tracer extravasation patterns and the magnitude of tracer extravasation. The results of this study suggest that traditional morphological barrier studies alone do not reveal all aspects of altered barrier status and that multiple mechanisms underlying increased BBB permeability may operate simultaneously during BBB dysfunction

  19. Tracheal epithelium cell volume responses to hyperosmolar, isosmolar and hypoosmolar solutions: relation to epithelium-derived relaxing factor (EpDRF effects

    Directory of Open Access Journals (Sweden)

    Jeffrey S. Fedan

    2013-10-01

    Full Text Available In asthmatic patients, inhalation of hyperosmolar saline or D-mannitol (D-M elicits bronchoconstriction, but in healthy subjects exercise causes bronchodilation. Hyperventilation causes drying of airway surface liquid (ASL and increases its osmolarity. Hyperosmolar challenge of airway epithelium releases epithelium-derived relaxing factor (EpDRF, which relaxes the airway smooth muscle. This pathway could be involved in exercise-induced bronchodilation. Little is known of ASL hyperosmolarity effects on epithelial function. We investigated the effects of osmolar challenge maneuvers on dispersed and adherent guinea-pig tracheal epithelial cells to examine the hypothesis that EpDRF-mediated relaxation is associated with epithelial cell shrinkage. Enzymatically-dispersed cells shrank when challenged with ≥10 mOsM added D M, urea or NaCl with a concentration-dependence that mimics relaxation of the of isolated, perfused tracheas (IPT. Cells shrank when incubated in isosmolar N-methyl-D-glucamine (NMDG chloride, Na gluconate (Glu, NMDG-Glu, K-Glu and K2SO4, and swelled in isosmolar KBr and KCl. However, isosmolar challenge is not a strong stimulus of relaxation in IPTs. In previous studies amiloride and 4,4' diisothiocyano 2,2' stilbenedisulfonic acid (DIDS inhibited relaxation of IPT to hyperosmolar challenge, but had little effect on shrinkage of dispersed cells. Confocal microscopy in tracheal segments showed that adherent epithelium is refractory to low hyperosmolar concentrations that induce dispersed cell shrinkage and relaxation of IPT. Except for gadolinium and erythro 9 (2 hydroxy 3 nonyladenine (EHNA, actin and microtubule inhibitors and membrane permeabilizing agents did not affect on ion transport by adherent epithelium or shrinkage responses of dispersed cells. Our studies dissociate relaxation of IPT from cell shrinkage after hyperosmolar challenge of airway epithelium .

  20. Effects of x-irradiation on cell kinetics of oral epithelium in mice

    International Nuclear Information System (INIS)

    Jinnouchi, Kenichi

    1982-01-01

    The acute radiation effects on the tongue and lip mucosa epithelium were cytokinetically investigated after the local irradiation at the head part of C 3 Hf/He mice with single dose of 516 mC/kg(2000R) of X rays. The microautoradiographic study was performed for these two kinds of oral epithelium at various times after the pulse-labeling with 3 H-thymidine, which followed immediately after the irradiation. The cell kinetics of irradiated as well as unirradiated basal cells were investigated by observing the changes in frequencies of the labeled cells and the labeled mitoses in the epithelium along the time course after irradiation. The results of the analysis of the percent frequencies of mitotic cells as a function of time after the labeling and the irradiation showed that the movement of the labeled cells were blocked at G 2 phase for about 6 hr and that the cell cycle time after the 1st post irradiation mitoses became shorter than that of the unirradiated cells. However, no change was found in the migration rate of the tongue epithelium, i.e., the time required for labeled cells to migrate from basal cell layer to prickle-granular cell layer. On the other hand, only 25% of labeled cells in the lip mucosa epithelium migrated into prickle-granular cell layer until 40 hr after irradiation, and it was hardly observed that the labeled cells moved into mitotic phase. These results suggest that basal cell of the lip mucosa is more radiosensitive than that of the tongue epithelium. (author)

  1. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  2. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat.

    Science.gov (United States)

    Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J

    2010-12-01

    Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.

  3. Acid phosphatase and lipid peroxidation in human cataractous lens epithelium

    Directory of Open Access Journals (Sweden)

    Vasavada Abhay

    1993-01-01

    Full Text Available The anterior lens epithelial cells undergo a variety of degenerative and proliferative changes during cataract formation. Acid phosphatase is primarily responsible for tissue regeneration and tissue repair. The lipid hydroperoxides that are obtained by lipid peroxidation of polysaturated or unsaturated fatty acids bring about deterioration of biological membranes at cellular and tissue levels. Acid phosphatase and lipid peroxidation activities were studied on the lens epithelial cells of nuclear cataract, posterior subcapsular cataract, mature cataract, and mixed cataract. Of these, mature cataractous lens epithelium showed maximum activity for acid phosphatase (516.83 moles of p-nitrophenol released/g lens epithelium and maximum levels of lipid peroxidation (86.29 O.D./min/g lens epithelium. In contrast, mixed cataractous lens epithelium showed minimum activity of acid phosphatase (222.61 moles of p-nitrophenol released/g lens epithelium and minimum levels of lipid peroxidation (54.23 O.D./min/g lens epithelium. From our study, we correlated the maximum activity of acid phosphatase in mature cataractous lens epithelium with the increased areas of superimposed cells associated with the formation of mature cataract. Likewise, the maximum levels of lipid peroxidation in mature cataractous lens epithelium was correlated with increased permeability of the plasma membrane. Conversely, the minimum levels of lipid peroxidation in mixed cataractous lens epithelium makes us presume that factors other than lipid peroxidation may also account for the formation of mixed type of cataract.

  4. Breakdown of mucin as barrier to digestive enzymes in the ischemic rat small intestine.

    Directory of Open Access Journals (Sweden)

    Marisol Chang

    Full Text Available Loss of integrity of the epithelial/mucosal barrier in the small intestine has been associated with different pathologies that originate and/or develop in the gastrointestinal tract. We showed recently that mucin, the main protein in the mucus layer, is disrupted during early periods of intestinal ischemia. This event is accompanied by entry of pancreatic digestive enzymes into the intestinal wall. We hypothesize that the mucin-containing mucus layer is the main barrier preventing digestive enzymes from contacting the epithelium. Mucin breakdown may render the epithelium accessible to pancreatic enzymes, causing its disruption and increased permeability. The objective of this study was to investigate the role of mucin as a protection for epithelial integrity and function. A rat model of 30 min splanchnic arterial occlusion (SAO was used to study the degradation of two mucin isoforms (mucin 2 and 13 and two epithelial membrane proteins (E-cadherin and toll-like receptor 4, TLR4. In addition, the role of digestive enzymes in mucin breakdown was assessed in this model by luminal inhibition with acarbose, tranexamic acid, or nafamostat mesilate. Furthermore, the protective effect of the mucin layer against trypsin-mediated disruption of the intestinal epithelium was studied in vitro. Rats after SAO showed degradation of mucin 2 and fragmentation of mucin 13, which was not prevented by protease inhibition. Mucin breakdown was accompanied by increased intestinal permeability to FITC-dextran as well as degradation of E-cadherin and TLR4. Addition of mucin to intestinal epithelial cells in vitro protected against trypsin-mediated degradation of E-cadherin and TLR4 and reduced permeability of FITC-dextran across the monolayer. These results indicate that mucin plays an important role in the preservation of the mucosal barrier and that ischemia but not digestive enzymes disturbs mucin integrity, while digestive enzymes actively mediate epithelial cell

  5. The function of waste immobilization as a barrier against radionuclide release in the frame of an overall risk assessment

    International Nuclear Information System (INIS)

    Girardi, F.

    1983-01-01

    The general approach to safety assurance in disposal of radioactive waste is the 'multibarrier' or 'defence-in-depth' approach. Research has been mostly directed to characterize individual barriers in order to learn what performance may be expected from the barrier when utilized in a hypothetical safety system. The knowledge available is briefly reviewed, with special reference to ongoing activities carried out within the framework of the waste management programme of the European Communities. The interaction between different barriers in a geological disposal environment is not sufficiently well known to permit a full appreciation of the long-term behaviour of a barrier system. Examples of studies under way within the programme mentioned above are outlined briefly. On the basis of the information available, immobilization of high-level waste in borosilicate glass appears an acceptable barrier, well-integrated in the various barrier systems. Studies on the long-term properties of conditioned alpha-contaminated waste deserve a high priority in order to make a balanced evaluation of the long-term risks of the various waste types. (author)

  6. Impaired function of the blood-testis barrier during aging is preceded by a decline in cell adhesion proteins and GTPases.

    Directory of Open Access Journals (Sweden)

    Catriona Paul

    Full Text Available With increasing age comes many changes in the testis, including germ cell loss. Cell junctions in the testis tether both seminiferous epithelial and germ cells together and assist in the formation of the blood-testis barrier (BTB, which limits transport of biomolecules, ions and electrolytes from the basal to the adluminal compartment and protects post-meiotic germ cells. We hypothesize that as male rats age the proteins involved in forming the junctions decrease and that this alters the ability of the BTB to protect the germ cells. Pachytene spermatocytes were isolated from Brown Norway rat testes at 4 (young and 18 (aged months of age using STA-PUT velocity sedimentation technique. RNA was extracted and gene expression was assessed using Affymetrix rat 230 2.0 whole rat genome microarrays. Microarray data were confirmed by q-RT-PCR and protein expression by Western blotting. Of the genes that were significantly decreased by at least 1.5 fold, 70 were involved in cell adhesion; of these, at least 20 are known to be specifically involved in junction dynamics within the seminiferous epithelium. The mRNA and protein levels of Jam2, Ocln, cdh2 (N-cadherin, ctnna (α-catenin, and cldn11 (involved in adherens junctions, among others, were decreased by approximately 50% in aged spermatocytes. In addition, the GTPases Rac1 and cdc42, involved in the recruitment of cadherins to the adherens junctions, were similarly decreased. It is therefore not surprising that with lower expression of these proteins that the BTB becomes diminished with age. We saw, using a FITC tracer, a gradual collapse of the BTB between 18 and 24 months. This provides the opportunity for harmful substances and immune cells to cross the BTB and cause the disruption of spermatogenesis that is observed with increasing age.

  7. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  8. The SETD8/PR-Set7 Methyltransferase Functions as a Barrier to Prevent Senescence-Associated Metabolic Remodeling

    Directory of Open Access Journals (Sweden)

    Hiroshi Tanaka

    2017-02-01

    Full Text Available Summary: Cellular senescence is an irreversible growth arrest that contributes to development, tumor suppression, and age-related conditions. Senescent cells show active metabolism compared with proliferating cells, but the underlying mechanisms remain unclear. Here we show that the SETD8/PR-Set7 methyltransferase, which catalyzes mono-methylation of histone H4 at lysine 20 (H4K20me1, suppresses nucleolar and mitochondrial activities to prevent cellular senescence. SETD8 protein was selectively downregulated in both oncogene-induced and replicative senescence. Inhibition of SETD8 alone was sufficient to trigger senescence. Under these states, the expression of genes encoding ribosomal proteins (RPs and ribosomal RNAs as well as the cyclin-dependent kinase (CDK inhibitor p16INK4A was increased, with a corresponding reduction of H4K20me1 at each locus. As a result, the loss of SETD8 concurrently stimulated nucleolar function and retinoblastoma protein-mediated mitochondrial metabolism. In conclusion, our data demonstrate that SETD8 acts as a barrier to prevent cellular senescence through chromatin-mediated regulation of senescence-associated metabolic remodeling. : Tanaka et al. show that SETD8/PR-Set7 methyltransferase represses senescence-associated genes including ribosomal proteins, ribosomal RNAs, and p16INK4A by catalyzing mono-methylation of histone H4 at lysine 20. Depletion of SETD8 derepresses these genes, resulting in nucleolar and mitochondrial coactivation characteristic of senescence-associated metabolic remodeling. Keywords: SETD8/PR-Set7, H4K20 methylation, senescence-associated metabolic remodeling, nucleolus, mitochondria

  9. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  10. Vocal Fold Epithelial Barrier in Health and Injury A Research Review

    Science.gov (United States)

    Levendoski, Elizabeth Erickson; Leydon, Ciara; Thibeault, Susan L.

    2015-01-01

    Purpose Vocal fold epithelium is composed of layers of individual epithelial cells joined by junctional complexes constituting a unique interface with the external environment. This barrier provides structural stability to the vocal folds and protects underlying connective tissue from injury while being nearly continuously exposed to potentially hazardous insults including environmental or systemic-based irritants such as pollutants and reflux, surgical procedures, and vibratory trauma. Small disruptions in the epithelial barrier may have a large impact on susceptibility to injury and overall vocal health. The purpose of this article is to provide a broad-based review of our current knowledge of the vocal fold epithelial barrier. Methods A comprehensive review of the literature was conducted. Details of the structure of the vocal fold epithelial barrier are presented and evaluated in the context of function in injury and pathology. The importance of the epithelial-associated vocal fold mucus barrier is also introduced. Results/Conclusions Information presented in this review is valuable for clinicians and researchers as it highlights the importance of this understudied portion of the vocal folds to overall vocal health and disease. Prevention and treatment of injury to the epithelial barrier is a significant area awaiting further investigation. PMID:24686981

  11. Functional characterization and localization of a gill-specific claudin isoform in Atlantic salmon

    DEFF Research Database (Denmark)

    Engelund, Morten Buch; Yu, Alan S L; Li, Jiahua

    2012-01-01

    Claudins are the major determinants of paracellular epithelial permeability in multicellular organisms. In Atlantic salmon (Salmo salar L.), we previously found that mRNA expression of the abundant gill-specific claudin 30 decreases during seawater (SW) acclimation, suggesting that this claudin i...... that claudin 30 functions as a cation barrier between pavement cells in the gill and also has a general role in cell-cell adhesion in deeper layers of the epithelium....

  12. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  13. Loss of the Wnt receptor frizzled 7 in the mouse gastric epithelium is deleterious and triggers rapid repopulation in vivo

    Directory of Open Access Journals (Sweden)

    Dustin J. Flanagan

    2017-08-01

    Full Text Available The gastric epithelium consists of tubular glandular units, each containing several differentiated cell types, and populations of stem cells, which enable the stomach to secrete the acid, mucus and various digestive enzymes required for its function. Very little is known about which cell signalling pathways are required for homeostasis of the gastric epithelium. Many diseases, such as cancer, arise as a result of deregulation of signalling pathways that regulate homeostasis of the diseased organ. Therefore, it is important to understand the biology of how normal conditions are maintained in a tissue to help inform the mechanisms driving disease in that same tissue, and to identify potential points of therapeutic intervention. Wnt signalling regulates several cell functions, including proliferation, differentiation and migration, and plays a crucial role during homeostasis of several tissues, including the intestinal epithelium. Wnt3a is required in the culture medium of gastric organoids, suggesting it is also important for the homeostasis of the gastric epithelium, but this has not been investigated in vivo. Here, we show that the Wnt receptor frizzled 7 (Fzd7, which is required for the homeostasis of the intestine, is expressed in the gastric epithelium and is required for gastric organoid growth. Gastric-specific loss of Fzd7 in the adult gastric epithelium of mice is deleterious and triggers rapid epithelial repopulation, which we believe is the first observation of this novel function for this tissue. Taken together, these data provide functional evidence of a crucial role for Wnt signalling, via the Fzd7 receptor, during homeostasis of the gastric epithelium.

  14. Loss of the Wnt receptor frizzled 7 in the mouse gastric epithelium is deleterious and triggers rapid repopulation in vivo.

    Science.gov (United States)

    Flanagan, Dustin J; Barker, Nick; Nowell, Cameron; Clevers, Hans; Ernst, Matthias; Phesse, Toby J; Vincan, Elizabeth

    2017-08-01

    The gastric epithelium consists of tubular glandular units, each containing several differentiated cell types, and populations of stem cells, which enable the stomach to secrete the acid, mucus and various digestive enzymes required for its function. Very little is known about which cell signalling pathways are required for homeostasis of the gastric epithelium. Many diseases, such as cancer, arise as a result of deregulation of signalling pathways that regulate homeostasis of the diseased organ. Therefore, it is important to understand the biology of how normal conditions are maintained in a tissue to help inform the mechanisms driving disease in that same tissue, and to identify potential points of therapeutic intervention. Wnt signalling regulates several cell functions, including proliferation, differentiation and migration, and plays a crucial role during homeostasis of several tissues, including the intestinal epithelium. Wnt3a is required in the culture medium of gastric organoids, suggesting it is also important for the homeostasis of the gastric epithelium, but this has not been investigated in vivo Here, we show that the Wnt receptor frizzled 7 (Fzd7), which is required for the homeostasis of the intestine, is expressed in the gastric epithelium and is required for gastric organoid growth. Gastric-specific loss of Fzd7 in the adult gastric epithelium of mice is deleterious and triggers rapid epithelial repopulation, which we believe is the first observation of this novel function for this tissue. Taken together, these data provide functional evidence of a crucial role for Wnt signalling, via the Fzd7 receptor, during homeostasis of the gastric epithelium. © 2017. Published by The Company of Biologists Ltd.

  15. Fusion barrier distributions from capture and quasi-elastic excitation functions measured in reaction 36S, 48Ca, 64Ni+238U

    International Nuclear Information System (INIS)

    Kozulin, E. M.

    2009-01-01

    The subbarrier fusion enhancement in reactions with heavy ions were explained by taking into account coupling between relative motion and intrinsic degrees of freedom of interacting nuclei. The coupling of reaction channels manifests itself in the potential barrier between interacting nuclei giving rise to a distribution of fusion barrier instead of single barrier.Capture and quasi-elastic scattering excitation functions at backward angles were measured for 3 6S , 4 8C a, 6 4N i+2 38U reactions systems at energies close and below the Coulomb barrier (i.e. when the influence of the shell effects on the fusion and characteristics of the decay of the composite system is considerable). Representations of the barrier distributions were extracted from both capture and quasi-elastic data. The experimental representations of barrier distributions were compared with coupled-channel calculations using CCFULL code. The major part of these experiments has been performed at the U-400 accelerator of the Flerov Laboratory of Nuclear Reactions (JINR, Dubna); at the TANDEM-ALPI accelerator of the LNL (INFN, Legnaro, Italy) and at the Accelerator Laboratory of University of Jyvaeskylae (JYFL, Finland) using a time-of-flight spectrometer of fission fragments CORSET (CORrelation SET-up.) The extraction of the masses and Total Kinetic Energy (TKE) of the binary reaction products is based upon the analysis of the two-body velocity In the case of the fusion-fission and quasi-fission processes, the observed peculiarities of mass and energy distributions of the fragments, the ratio between the fusion-fission and quasi-fission cross sections are determined deformations of interaction nuclei and angular momentum carried in the di-nuclear system and the shell structure of the formed fragments. In this work, the high-precision capture and quasi-elastic scattering excitation function data are presented.The influence of projectile and target excitations and nucleon transfer on fusion barrier

  16. The tumor suppressor adenomatous polyposis coli controls the direction in which a cell extrudes from an epithelium

    OpenAIRE

    Marshall, Thomas W.; Lloyd, Isaac E.; Delalande, Jean Marie; N?thke, Inke; Rosenblatt, Jody

    2011-01-01

    Despite high rates of cell death, epithelia maintain intact barriers by squeezing dying cells out using a process termed cell extrusion. Cells can extrude apically into the lumen or basally into the tissue the epithelium encases, depending on whether actin and myosin contract at the cell base or apex, respectively. We previously found that microtubules in cells surrounding a dying cell target p115 RhoGEF to the actin cortex to control where contraction occurs. However, what controls microtubu...

  17. Mucosal prevalence and interactions with the epithelium indicate commensalism of Sutterella spp.

    Directory of Open Access Journals (Sweden)

    Kaisa Hiippala

    2016-10-01

    Full Text Available Sutterella species have been frequently associated with human diseases, such as autism, Down syndrome and inflammatory bowel disease (IBD, but the impact of these bacteria on health still remains unclear. Especially the interactions of Sutterella spp. with the host are largely unknown, despite of the species being highly prevalent. In this study, we addressed the interaction of three known species of Sutterella with the intestinal epithelium and examined their adhesion properties, the effect on intestinal barrier function and the pro-inflammatory capacity in vitro. We also studied the relative abundance and prevalence of the genus Sutterella and S. wadsworthensis in intestinal biopsies of healthy individuals and patients with celiac disease (CeD or IBD. Our results show that Sutterella spp. are abundant in the duodenum of healthy adults with a decreasing gradient towards the colon. No difference was detected in the prevalence of Sutterella between the pediatric IBD or CeD patients and the healthy controls. Sutterella parvirubra adhered better than the two other Sutterella spp. to differentiated Caco-2 cells and was capable of decreasing the adherence of S. wadsworthensis, which preferably bound to mucus and human extracellular matrix (ECM proteins. Furthermore, only S. wadsworthensis induced an interleukin-8 (IL-8 production in enterocytes, which could be due to different lipopolysaccharide (LPS structures between the species. However, its pro-inflammatory activity was modest as compared to non-pathogenic Escherichia coli. Sutterella spp. had no effect on the enterocyte monolayer integrity in vitro. Our findings indicate that the members of genus Sutterella are widely prevalent commensals with mild pro-inflammatory capacity in the human gastrointestinal tract and do not contribute significantly to the disrupted epithelial homeostasis associated with microbiota dysbiosis and increase of Proteobacteria. The ability of Sutterella spp. to adhere to

  18. Antioxidant effect of minocycline in gingival epithelium induced by Actinobacillus actinomycetemcomitans serotype B toxin

    Directory of Open Access Journals (Sweden)

    Ernie Maduratna Setiawati

    2009-03-01

    Full Text Available Background: Actinobacillus actinomycetemcomitans (Aa serotype B has been associated with aggressive periodontitis. Gingival epithelial cell is exquisitely sensitive to the toxin and may lead to the epithel protective barrier disruption. Experimental models show that minocycline is not related to it’s antimicrobial effect and protection against neuron cell apoptosis of a number experimental models of brain injury and Parkinson’s disease. Purpose: This study, examined antioxidant effect of minocycline to inhibit apoptosis of gingival epithelium induced crude toxin bacteria Aa serotype B in mice. Methods: Thirty adult mice strain Swiss Webster (balb C were divided randomly into three groups: control group (group A, toxin group (group B and toxin and minocycline group (group C. The mice were taken at 24 hours after application, and then the tissue sections of gingival epithelium were stained with tunnel assay and immunohistochemistry. Result: Treatment with these toxin induced apoptosis of gingival epithelium and was associated with DNA fragmentation and reduced gluthatione (GSH. Minocycline 100 nM significantly increased GSH and reduced apoptosis (p < 0.05. Minocycline provides antioxidant effect against citotoxicity of bacteria Aa serotipe B. Conclusion: Nanomolar concentration of minocycline potential as new therapeutic agent to prevent progressivity of aggressiveness of periodontitis.

  19. Histological, Topographical and Ultrastructural Organization of Different Cells Lining the Olfactory Epithelium of Red Piranha, Pygocentrus nattereri (Characiformes, Serrasalmidae

    Directory of Open Access Journals (Sweden)

    Ghosh S. K.

    2016-10-01

    Full Text Available The structural characterization of the olfactory epithelium in Pygocentrus nattereri Kner, 1858 was studied with the help of light as well as scanning and transmission electron microscope. The oval shaped olfactory rosette consisted of 26–28 primary lamellae radiated from midline raphe. The olfactory epithelium of each lamella was well distributed by sensory and non-sensory epithelium. The sensory epithelium contained morphologically distinct ciliated and microvillous receptor cells, supporting cells and basal cells. The non-sensory epithelium was made up of labyrinth cells, mucous cells and stratified epithelial cells. According to TEM investigation elongated rod emerging out from dendrite end of the receptor cells in the free space. The dendrite process of microvillous receptor cells contained microvilli. The supporting cells had lobular nucleus with clearly seen electron dense nucleolus. The apex of the ciliated non-sensory cells was broad and provided with plenty of kinocilia. Basal cells provided with oval nucleus and contained small number of secretory granules. The mucous cells were restricted to the non-sensory areas and the nuclei situated basally and filled with about two-third of the vesicles. The functional significance of various cells lining the olfactory epithelium was discussed with mode of life and living of fish concerned.

  20. Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

    Science.gov (United States)

    Egawa, Gyohei; Kabashima, Kenji

    2016-08-01

    Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  1. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

    Science.gov (United States)

    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

    2013-11-01

    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  3. Change of the work function and potential barrier transparency of W(100) and GaAs(110) single crystals during removing the inherent surface oxide layer

    International Nuclear Information System (INIS)

    Asalkhanov, Yu.I.; Saneev, Eh.L.

    2002-01-01

    Changes of current voltage characteristics of slow monoenergetic electron beam through the surfaces of W(100) and GaAs(100) single crystals have been measured in the process of surface oxide layers elimination. It is shown that work function is decreased and transparency coefficient of surface potential barrier is increased under increasing the temperature of vacuum annealing. Peculiarities of surface potential change under oxide layer elimination in metals and semiconductors are discussed [ru

  4. Impact of thymectomy and antilymphocytic serum on stem cells of the intestinal epithelium

    International Nuclear Information System (INIS)

    Aparovich, G.G.; Trufakin, V.A.

    1982-01-01

    The population of stem cells of the intestinal epithelium was studied under conditions of the disturbed balance in the immune system on F 1 (CBAxC57B1) mice. It has been shown that thymectomy in adult mice does not influence the stem region of the intestinal epithelium at early time of observation but causes a tendency to the changed number of epithelial stem cells in 4-6 months. Administration of specific sera against T-, B- and mixed lymphoid populations on the 1st day of observation produces an ambi us effect on the stem region and results in an increase of the number of epithelial stem cells on the 5th day. After administration of the antilymphocytic serum there have been determined morphological changes in the population of mature erythrocytes and undulatory fluctuations in the number of mitotic cells of the intestinal epithelium. These data suggest functional correlation of the intestinal epithelium and the state of the immunocompetent tissue [ru

  5. Repair of tracheal epithelium by basal cells after chlorine-induced injury

    Directory of Open Access Journals (Sweden)

    Musah Sadiatu

    2012-11-01

    Full Text Available Abstract Background Chlorine is a widely used toxic compound that is considered a chemical threat agent. Chlorine inhalation injures airway epithelial cells, leading to pulmonary abnormalities. Efficient repair of injured epithelium is necessary to restore normal lung structure and function. The objective of the current study was to characterize repair of the tracheal epithelium after acute chlorine injury. Methods C57BL/6 mice were exposed to chlorine and injected with 5-ethynyl-2′-deoxyuridine (EdU to label proliferating cells prior to sacrifice and collection of tracheas on days 2, 4, 7, and 10 after exposure. Airway repair and restoration of a differentiated epithelium were examined by co-localization of EdU labeling with markers for the three major tracheal epithelial cell types [keratin 5 (K5 and keratin 14 (K14 for basal cells, Clara cell secretory protein (CCSP for Clara cells, and acetylated tubulin (AcTub for ciliated cells]. Morphometric analysis was used to measure proliferation and restoration of a pseudostratified epithelium. Results Epithelial repair was fastest and most extensive in proximal trachea compared with middle and distal trachea. In unexposed mice, cell proliferation was minimal, all basal cells expressed K5, and K14-expressing basal cells were absent from most sections. Chlorine exposure resulted in the sloughing of Clara and ciliated cells from the tracheal epithelium. Two to four days after chlorine exposure, cell proliferation occurred in K5- and K14-expressing basal cells, and the number of K14 cells was dramatically increased. In the period of peak cell proliferation, few if any ciliated or Clara cells were detected in repairing trachea. Expression of ciliated and Clara cell markers was detected at later times (days 7–10, but cell proliferation was not detected in areas in which these differentiated markers were re-expressed. Fibrotic lesions were observed at days 7–10 primarily in distal trachea. Conclusion

  6. Regional increase in P-glycoprotein function in the blood-brain barrier of patients with chronic schizophrenia : A PET study with [C-11]verapamil as a probe for P-glycoprotein function

    NARCIS (Netherlands)

    de Klerk, Onno L.; Willemsen, Antoon T. M.; Bosker, Fokko J.; Bartels, Anna L.; Hendrikse, N. Harry; den Boer, Johan A.; Dierckx, Rudy A.

    2010-01-01

    P-glycoprotein (P-gp), a major efflux pump in the blood-brain barrier (BBB) has a profound effect on entry of drugs, peptides and other substances into the central nervous system (CNS). The brain's permeability can be negatively influenced by modulation of the transport function of P-gp.

  7. Contacting co-culture of human retinal microvascular endothelial cells alters barrier function of human embryonic stem cell derived retinal pigment epithelial cells.

    Science.gov (United States)

    Skottman, H; Muranen, J; Lähdekorpi, H; Pajula, E; Mäkelä, K; Koivusalo, L; Koistinen, A; Uusitalo, H; Kaarniranta, K; Juuti-Uusitalo, K

    2017-10-01

    Here we evaluated the effects of human retinal microvascular endothelial cells (hREC) on mature human embryonic stem cell (hESC) derived retinal pigment epithelial (RPE) cells. The hESC-RPE cells (Regea08/017, Regea08/023 or Regea11/013) and hREC (ACBRI 181) were co-cultured on opposite sides of transparent membranes for up to six weeks. Thereafter barrier function, small molecule permeability, localization of RPE and endothelial cell marker proteins, cellular fine structure, and growth factor secretion of were evaluated. After co-culture, the RPE specific CRALBP and endothelial cell specific von Willebrand factor were appropriately localized. In addition, the general morphology, pigmentation, and fine structure of hESC-RPE cells were unaffected. Co-culture increased the barrier function of hESC-RPE cells, detected both with TEER measurements and cumulative permeability of FD4 - although the differences varied among the cell lines. Co-culturing significantly altered VEGF and PEDF secretion, but again the differences were cell line specific. The results of this study showed that co-culture with hREC affects hESC-RPE functionality. In addition, co-culture revealed drastic cell line specific differences, most notably in growth factor secretion. This model has the potential to be used as an in vitro outer blood-retinal barrier model for drug permeability testing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Creating Live Interactions to Mitigate Barriers (CLIMB): A Mobile Intervention to Improve Social Functioning in People With Chronic Psychotic Disorders

    Science.gov (United States)

    Schlosser, Danielle; Nahum, Mor

    2016-01-01

    Background Numerous psychosocial interventions for individuals with chronic psychotic disorders (CPD) have shown positive effects on social cognitive and functional outcome measures. However, access to and engagement with these interventions remains limited. This is partly because these interventions require specially trained therapists, are not available in all clinical settings, and have a high scheduling burden for participants, usually requiring a commitment of several weeks. Delivering interventions remotely via mobile devices may facilitate access, improve scheduling flexibility, and decrease participant burden, thus improving adherence to intervention requirements. To address these needs, we designed the Creating Live Interactions to Mitigate Barriers (CLIMB) digital intervention, which aims to enhance social functioning in people with CPD. CLIMB consists of two treatment components: a computerized social cognition training (SCT) program and optimized remote group therapy (ORGT). ORGT is an innovative treatment that combines remote group therapy with group texting (short message service, SMS). Objectives The objectives of this single-arm study were to investigate the feasibility of delivering 6 weeks of CLIMB to people with CPD and explore the initial effects on outcomes. Methods Participants were recruited, screened and enrolled via the Internet, and delivered assessments and interventions remotely using provided tablets (iPads). Participants were asked to complete 18 hours of SCT and to attend 6 remote group therapy sessions. To assess feasibility, adherence to study procedures, attrition rates, engagement metrics, and acceptability of the intervention were evaluated. Changes on measures of social cognition, quality of life, and symptoms were also explored. Results In total, 27 participants were enrolled over 12 months. Remote assessments were completed successfully on 96% (26/27) of the enrolled participants. Retention in the 6-week trial was 78% (21

  9. Protein kinase C-dependent signaling controls the midgut epithelial barrier to malaria parasite infection in anopheline mosquitoes.

    Directory of Open Access Journals (Sweden)

    Nazzy Pakpour

    Full Text Available Anopheline mosquitoes are the primary vectors of parasites in the genus Plasmodium, the causative agents of malaria. Malaria parasites undergo a series of complex transformations upon ingestion by the mosquito host. During this process, the physical barrier of the midgut epithelium, along with innate immune defenses, functionally restrict parasite development. Although these defenses have been studied for some time, the regulatory factors that control them are poorly understood. The protein kinase C (PKC gene family consists of serine/threonine kinases that serve as central signaling molecules and regulators of a broad spectrum of cellular processes including epithelial barrier function and immunity. Indeed, PKCs are highly conserved, ranging from 7 isoforms in Drosophila to 16 isoforms in mammals, yet none have been identified in mosquitoes. Despite conservation of the PKC gene family and their potential as targets for transmission-blocking strategies for malaria, no direct connections between PKCs, the mosquito immune response or epithelial barrier integrity are known. Here, we identify and characterize six PKC gene family members--PKCδ, PKCε, PKCζ, PKD, PKN, and an indeterminate conventional PKC--in Anopheles gambiae and Anopheles stephensi. Sequence and phylogenetic analyses of the anopheline PKCs support most subfamily assignments. All six PKCs are expressed in the midgut epithelia of A. gambiae and A. stephensi post-blood feeding, indicating availability for signaling in a tissue that is critical for malaria parasite development. Although inhibition of PKC enzymatic activity decreased NF-κB-regulated anti-microbial peptide expression in mosquito cells in vitro, PKC inhibition had no effect on expression of a panel of immune genes in the midgut epithelium in vivo. PKC inhibition did, however, significantly increase midgut barrier integrity and decrease development of P. falciparum oocysts in A. stephensi, suggesting that PKC

  10. Effect of Glucagon-like Peptide 2 on Tight Junction in Jejunal Epithelium of Weaned Pigs though MAPK Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Changsong Yu

    2014-05-01

    Full Text Available The glucagon-like peptide 2 (GLP-2 that is expressed in intestine epithelial cells of mammals, is important for intestinal barrier function and regulation of tight junction (TJ proteins. However, there is little known about the intracellular mechanisms of GLP-2 in the regulation of TJ proteins in piglets’ intestinal epithelial cells. The purpose of this study is to test the hypothesis that GLP-2 regulates the expressions of TJ proteins in the mitogen-activated protein kinase (MAPK signaling pathway in piglets’ intestinal epithelial cells. The jejunal tissues were cultured in a Dulbecco’s modified Eagle’s medium/high glucose medium containing supplemental 0 to 100 nmol/L GLP-2. At 72 h after the treatment with the appropriate concentrations of GLP-2, the mRNA and protein expressions of zonula occludens-1 (ZO-1, occludin and claudin-1 were increased (p<0.05. U0126, an MAPK kinase inhibitor, prevented the mRNA and protein expressions of ZO-1, occludin, claudin-1 increase induced by GLP-2 (p<0.05. In conclusion, these results indicated that GLP-2 could improve the expression of TJ proteins in weaned pigs’ jejunal epithelium, and the underlying mechanism may due to the MAPK signaling pathway.

  11. File list: Unc.Oth.10.AllAg.Olfactory_epithelium [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Oth.10.AllAg.Olfactory_epithelium mm9 Unclassified Others Olfactory epithelium ...SRX112960 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Oth.10.AllAg.Olfactory_epithelium.bed ...

  12. File list: Unc.Oth.20.AllAg.Olfactory_epithelium [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Oth.20.AllAg.Olfactory_epithelium mm9 Unclassified Others Olfactory epithelium ...SRX112960 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Oth.20.AllAg.Olfactory_epithelium.bed ...

  13. File list: Unc.Oth.05.AllAg.Olfactory_epithelium [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Oth.05.AllAg.Olfactory_epithelium mm9 Unclassified Others Olfactory epithelium ...SRX112960 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Oth.05.AllAg.Olfactory_epithelium.bed ...

  14. Enhanced cerebral uptake of receptor ligands by modulation of P-glycoprotein function in the blood-brain barrier

    NARCIS (Netherlands)

    Doze, P; Van Waarde, A; Elsinga, P H; Hendrikse, N H; Vaalburg, W

    Low cerebral uptake of some therapeutic drugs can be enhanced by modulation of P-glycoprotein (P-gp), an ATP-driven drug efflux pump at the blood-brain barrier (BBB). We investigated the possibility of increasing cerebral uptake of the beta-adrenergic ligands S-1'-[(18)F]-fluorocarazolol (FCAR) and

  15. Monitoring functionality and durability of the New York State Highway 30 turtle barrier and adjacent nesting substrate.

    Science.gov (United States)

    2012-08-01

    In 2008, the NYS Department of Transportation installed a wildlife barrier along NYS Route 30 in Tupper Lake, Franklin County, NY. The major objectives of the study that is the subject of this report were to: evaluate the effectiveness of the Route 3...

  16. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis

    NARCIS (Netherlands)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    Scope: Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on

  17. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-05-01

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  18. Regeneration of stem-cells in intestinal epithelium after irradiation

    International Nuclear Information System (INIS)

    Hendry, J.H.

    1979-01-01

    Stem-cells can be defined as pluripotent progenitor cells, capable of both self-renewal and differentitation into all the functional end-cells typical of that cell family. Intestinal crypts contain population of cells which is capable of a) self-renewal following the severe depletion after radiation injury, b) replacing all other cypt cell types, and c) regeneration following repeated depletion (in colon). These are the properties of stem cells. Most measurements of the rate of regeneration of these cells following the severe depletion by radiation have been made by employing large test dose at increasing times. Such measurements have produced widely differing rates of increase in the survival under the test dose, from 4 hours (macrocolonies in jejunum) to 43 hours (microcolonies in stomach). In other tissues, large single test doses have been used to derive the time of doubling survival ratio e.g. for epidermal clones. Although cryptogenic cell number per crypt can be virtually restored by day 4 after a single dose and probably after many such doses, the status quo cannot be reached until the number of crypts is restored to normal. Stem cell numbers form a necessary part of the integrity of epitheliums. The quality of the stem cell function of survivors as expressed in the differentiated progeny, and the maintenance of function of the supportive environment are equally important for late radiation damage. (Yamashita, S.)

  19. Potential in vitro model for testing the effect of exposure to nanoparticles on the lung alveolar epithelial barrier

    Directory of Open Access Journals (Sweden)

    Raymond Derk

    2015-03-01

    Full Text Available Pulmonary barrier function plays a pivotal role in protection from inhaled particles. However, some nano-scaled particles, such as carbon nanotubes (CNT, have demonstrated the ability to penetrate this barrier in animal models, resulting in an unusual, rapid interstitial fibrosis. To delineate the underlying mechanism and specific bio-effect of inhaled nanoparticles in respiratory toxicity, models of lung epithelial barriers are required that allow accurate representation of in vivo systems; however, there is currently a lack of consistent methods to do so. Thus, this work demonstrates a well-characterized in vitro model of pulmonary barrier function using Calu-3 cells, and provides the experimental conditions required for achieving tight junction complexes in cell culture, with trans-epithelial electrical resistance measurement used as a biosensor for proper barrier formation and integrity. The effects of cell number and serum constituents have been examined and we found that changes in each of these parameters can greatly affect barrier formation. Our data demonstrate that use of 5.0 × 104 Calu-3 cells/well in the Transwell cell culture system, with 10% serum concentrations in culture media is optimal for assessing epithelial barrier function. In addition, we have utilized CNT exposure to analyze the dose-, time-, and nanoparticle property-dependent alterations of epithelial barrier permeability as a means to validate this model. Such high throughput in vitro cell models of the epithelium could be used to predict the interaction of other nanoparticles with lung epithelial barriers to mimic respiratory behavior in vivo, thus providing essential tools and bio-sensing techniques that can be uniformly employed.

  20. Chaotic correlations in barrier billiards with arbitrary barriers

    International Nuclear Information System (INIS)

    Osbaldestin, A H; Adamson, L N C

    2013-01-01

    We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)

  1. EP3 receptors inhibit antidiuretic-hormone-dependent sodium transport across frog skin epithelium

    DEFF Research Database (Denmark)

    Rytved, Klaus A.; Nielsen, Robert

    1999-01-01

    Antidiuretic hormone; tight epithelium; prostaglandin receptors; sulprostone; misoprostol; cAMP; cellular Ca2+......Antidiuretic hormone; tight epithelium; prostaglandin receptors; sulprostone; misoprostol; cAMP; cellular Ca2+...

  2. Impact of lactic Acid bacteria on dendritic cells from allergic patients in an experimental model of intestinal epithelium.

    Science.gov (United States)

    Ratajczak, Céline; Duez, Catherine; Grangette, Corinne; Pochard, Pierre; Tonnel, André-Bernard; Pestel, Joël

    2007-01-01

    Lactic acid bacteria (LAB) are Gram positive nonpathogenic commensal organisms present in human gastrointestinal tract. In vivo, LAB are separated from antigen-presenting cells such as dendritic cells (DC) by the intestinal epithelial barrier. In this study, the impact of one LAB strain (Lactobacillus casei ATCC393) on human monocyte-derived DC from allergic and healthy donors was assessed by using a polarized epithelium model. Confocal and flow cytometer analyses showed that immature DC efficiently captured FITC-labelled L. casei through the epithelial layer. After interaction with L. casei, DC acquired a partial maturation status (i.e., CD86 and CD54 increase) and increased their interleukin (IL)-10 and IL-12 production. Interestingly, after activation by L. casei in the presence of experimental epithelium, DC from allergic patients instructed autologous naïve CD4(+) T cells to produce more interferon-gamma than without the epithelium. Thus by modulating human DC reactivity, LAB and intestinal epithelium might modify T cell immune response and regulate the development of allergic reaction.

  3. Impact of Lactic Acid Bacteria on Dendritic Cells from Allergic Patients in an Experimental Model of Intestinal Epithelium

    Directory of Open Access Journals (Sweden)

    Céline Ratajczak

    2007-01-01

    Full Text Available Lactic acid bacteria (LAB are Gram positive nonpathogenic commensal organisms present in human gastrointestinal tract. In vivo, LAB are separated from antigen-presenting cells such as dendritic cells (DC by the intestinal epithelial barrier. In this study, the impact of one LAB strain (Lactobacillus casei ATCC393 on human monocyte-derived DC from allergic and healthy donors was assessed by using a polarized epithelium model. Confocal and flow cytometer analyses showed that immature DC efficiently captured FITC-labelled L. casei through the epithelial layer. After interaction with L. casei, DC acquired a partial maturation status (i.e., CD86 and CD54 increase and increased their interleukin (IL-10 and IL-12 production. Interestingly, after activation by L. casei in the presence of experimental epithelium, DC from allergic patients instructed autologous naïve CD4+ T cells to produce more interferon-γ than without the epithelium. Thus by modulating human DC reactivity, LAB and intestinal epithelium might modify T cell immune response and regulate the development of allergic reaction.

  4. Ultraviolet induced lysosome activity in corneal epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Cullen, A.P.

    1980-01-01

    A 5.000 W Xe-Hg high pressure lamp and a double monochromator were used to produce a 3.3 nm half-bandpass ultraviolet radiation at 295 nm. Pigmented rabbit eyes were irradiated with radiant exposures from 140 Jm/sup -2/ to 10.000 Jm/sup -2/ and evaluated by slit-lamp biomicroscopy, light and electron microscopy. Corneal threshold (Hsub(c) was 200 Jm/sup -2/ and lens threshold (Hsub(L)) was 7.500 Jm/sup -2/. The most repeatable and reliable corneal response to these levels of UV was the development of corneal epithelial granules. Histological changes included a loss of superficial epithelial cells and selective UV induced autolysis of the wing cells. It is suggested that the biomicroscopically observed granules are the clinical manifestation of the secondary lysosomes revealed by light and electron microscopy. It is proposed that UV breaks down the primary lysosome membranes to release hydrolytic enzymes which in turn form the secondary lysosomes during autolysis. Extreme levels of radiant exposure at 295 nm result in indiscriminate destruction of all layers of the corneal epithelium, but the posterior cornea was spared.

  5. Ultraviolet induced lysosome activity in corneal epithelium

    International Nuclear Information System (INIS)

    Cullen, A.P.

    1980-01-01

    A 5.000 W Xe-Hg high pressure lamp and a double monochromator were used to produce a 3.3 nm half-bandpass ultraviolet radiation at 295 nm. Pigmented rabbit eyes were irradiated with radiant exposures from 140 Jm -2 to 10.000 Jm -2 and evaluated by slit-lamp biomicroscopy, light and electron microscopy. Corneal threshold (Hsub(c) was 200 Jm -2 and lens threshold (Hsub(L)) was 7.500 Jm -2 . The most repeatable and reliable corneal response to these levels of UV was the development of corneal epithelial granules. Histological changes included a loss of superficial epithelial cells and selective UV induced autolysis of the wing cells. It is suggested that the biomicroscopically observed granules are the clinical manifestation of the secondary lysosomes revealed by light and electron microscopy. It is proposed that UV breaks down the primary lysosome membranes to release hydrolytic enzymes which in turn form the secondary lysosomes during autolysis. Extreme levels of radiant exposure at 295 nm result in indiscriminate destruction of all layers of the corneal epithelium, but the posterior cornea was spared. (orig.) [de

  6. Xyloglucan, a Plant Polymer with Barrier Protective Properties over the Mucous Membranes: An Overview

    Directory of Open Access Journals (Sweden)

    Núria Piqué

    2018-02-01

    Full Text Available Disruption of the epithelial barrier function has been recently associated with a variety of diseases, mainly at intestinal level, but also affecting the respiratory epithelium and other mucosal barriers. Non-pharmacological approaches such as xyloglucan, with demonstrated protective barrier properties, are proposed as new alternatives for the management of a wide range of diseases, for which mucosal disruption and, particularly, tight junction alterations, is a common characteristic. Xyloglucan, a natural polysaccharide derived from tamarind seeds, possesses a “mucin-like” molecular structure that confers mucoadhesive properties, allowing xyloglucan formulations to act as a barrier capable of reducing bacterial adherence and invasion and to preserve tight junctions and paracellular flux, as observed in different in vitro and in vivo studies. In clinical trials, xyloglucan has been seen to reduce symptoms of gastroenteritis in adults and children, nasal disorders and dry eye syndrome. Similar mucosal protectors containing reticulated proteins have also been useful for the treatment of irritable bowel syndrome and urinary tract infections. The role of xyloglucan in other disorders with mucosal disruption, such as dermatological or other infectious diseases, deserves further research. In conclusion, xyloglucan, endowed with film-forming protective barrier properties, is a safe non-pharmacological alternative for the management of different diseases, such as gastrointestinal and nasal disorders.

  7. Single blinded, randomized, placebo-controlled study on the effects of ciclosporin on cutaneous barrier function and immunological response in atopic beagles.

    Science.gov (United States)

    White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna

    2018-03-01

    Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. A breakdown in communication? Understanding the effects of aging on the human small intestine epithelium

    OpenAIRE

    Mabbott, Neil A.

    2015-01-01

    In the intestine, a single layer of epithelial cells sealed together at their apical surfaces by tight junctions helps to prevent the luminal commensal and pathogenic micro-organisms and their toxins from entering host tissues. The intestinal epithelium also helps to maintain homoeostasis in the mucosal immune system by expressing anti-inflammatory cytokines in the steady state and inflammatory cytokines in response to pathogens. Although the function of the mucosal immune system is impaired ...

  9. The pH-sensing receptor OGR1 improves barrier function of epithelial cells and inhibits migration in an acidic environment.

    Science.gov (United States)

    de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus

    2015-09-15

    The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.

  10. Maintenance of sweat glands by stem cells located in the acral epithelium.

    Science.gov (United States)

    Ohe, Shuichi; Tanaka, Toshihiro; Yanai, Hirotsugu; Komai, Yoshihiro; Omachi, Taichi; Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho; Nakamura, Naohiro; Ohsugi, Haruyuki; Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki; Yamazaki, Fumikazu; Okamoto, Hiroyuki; Ueno, Hiroo

    2015-10-23

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Maintenance of sweat glands by stem cells located in the acral epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Ohe, Shuichi [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Dermatology, Kansai Medical University, Osaka 573-1010 (Japan); Tanaka, Toshihiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Third Department of Internal Medicine, Kansai Medical University, Osaka 573-1010 (Japan); Yanai, Hirotsugu [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Surgery, Kansai Medical University, Osaka 573-1010 (Japan); Komai, Yoshihiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Urology and Andrology, Kansai Medical University, Osaka 573-1010 (Japan); Omachi, Taichi [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Pediatrics, Kansai Medical University, Osaka 573-1010 (Japan); Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Nakamura, Naohiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Third Department of Internal Medicine, Kansai Medical University, Osaka 573-1010 (Japan); Ohsugi, Haruyuki [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Urology and Andrology, Kansai Medical University, Osaka 573-1010 (Japan); Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Yamazaki, Fumikazu; Okamoto, Hiroyuki [Department of Dermatology, Kansai Medical University, Osaka 573-1010 (Japan); Ueno, Hiroo, E-mail: hueno@hirakata.kmu.ac.jp [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan)

    2015-10-23

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. - Highlights: • The acral epithelium have two types of stem cells. • Lgr6-positive cells are rapid-cycling, short-term stem cells. • Bmi1-positive cells are slow-cycling stem cells that act as reserver stem cells. • Lgr5 may be a useful sweat gland marker in mice.

  12. Maintenance of sweat glands by stem cells located in the acral epithelium

    International Nuclear Information System (INIS)

    Ohe, Shuichi; Tanaka, Toshihiro; Yanai, Hirotsugu; Komai, Yoshihiro; Omachi, Taichi; Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho; Nakamura, Naohiro; Ohsugi, Haruyuki; Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki; Yamazaki, Fumikazu; Okamoto, Hiroyuki; Ueno, Hiroo

    2015-01-01

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. - Highlights: • The acral epithelium have two types of stem cells. • Lgr6-positive cells are rapid-cycling, short-term stem cells. • Bmi1-positive cells are slow-cycling stem cells that act as reserver stem cells. • Lgr5 may be a useful sweat gland marker in mice.

  13. Buccal Epithelium in treating Ocular Surface Disorders

    Directory of Open Access Journals (Sweden)

    Srinivas KR

    2008-11-01

    Full Text Available Background - Ocular surface disorders due to limbal stem cell deficiency are an important cause of ocular morbidity and visual loss. Although autologous limbal stem cell transplants have helped in the management of unilateral disease, allografts in those with bilateral disease often fail due to immunological reasons. The use of autologous buccal epithelium cultivated on amniotic membrane has been described as a useful approach in the management of this condition. It is the purpose of this study to explore the feasibility of using a novel thermo-gelatin polymer (TGP as a substrate to culture these cells, and to characterize them using RNA extraction and RT-PCR. Methods - Oral cheek mucosal biopsies were obtained from 5 adult patients undergoing Modified Osteo-Odonto Keratoprosthesis surgery. The specimens were transported to the laboratory in transport medium. The cells were released using enzymatic digestion and seeded in both convention culture medium and TGP. The resulting cellular growth was characterized using RNA extraction and RT-PCR. Results - Cells could be cultured from 4 of the 5 specimens. In one specimen, contamination occurred and this was discarded. In the other specimens, the cheek epithelial cells could be cultured in both the conventional culture medium and TGP, with equal ease. RT-PCR revealed the presence of K3, a marker for epithelial cells, and GAPDH indicating the presence of some adipose tissue as well. Conclusions - It is possible to culture autologous cheek mucosal epithelial cells using TGP, a synthetic scaffold, without the need for other biological substrates. Since the specimens are obtained from the oral cavity, stringent asepsis is required. Further studies are required for histopathological characterization of the cultured cells and to create a model for delivery onto the ocular surface of eyes with bilateral surface disease due to limbal stem cell deficiency.

  14. Mechanical Barriers Restrict Invasion of Herpes Simplex Virus 1 into Human Oral Mucosa.

    Science.gov (United States)

    Thier, Katharina; Petermann, Philipp; Rahn, Elena; Rothamel, Daniel; Bloch, Wilhelm; Knebel-Mörsdorf, Dagmar

    2017-11-15

    Oral mucosa is one of the main target tissues of the human pathogen herpes simplex virus 1 (HSV-1). How the virus overcomes the protective epithelial barriers and penetrates the tissue to reach its receptors and initiate infection is still unclear. Here, we established an ex vivo infection assay with human oral mucosa that allows viral entry studies in a natural target tissue. The focus was on the susceptibility of keratinocytes in the epithelium and the characterization of cellular receptors that mediate viral entry. Upon ex vivo infection of gingiva or vestibular mucosa, we observed that intact human mucosa samples were protected from viral invasion. In contrast, the basal layer of the oral epithelium was efficiently invaded once the connective tissue and the basement membrane were removed. Later during infection, HSV-1 spread from basal keratinocytes to upper layers, demonstrating the susceptibility of the stratified squamous epithelium to HSV-1. The analysis of potential receptors revealed nectin-1 on most mucosal keratinocytes, whereas herpesvirus entry mediator (HVEM) was found only on a subpopulation of cells, suggesting that nectin-1 acts as primary receptor for HSV-1 in human oral mucosa. To mimic the supposed entry route of HSV-1 via microlesions in vivo , we mechanically wounded the mucosa prior to infection. While we observed a limited number of infected keratinocytes in some wounded mucosa samples, other samples showed no infected cells. Thus, we conclude that mechanical wounding of mucosa is insufficient for the virus to efficiently overcome epithelial barriers and to make entry-mediating receptors accessible. IMPORTANCE To invade the target tissue of its human host during primary infection, herpes simplex virus (HSV) must overcome the epithelial barriers of mucosa, skin, or cornea. For most viruses, the mechanisms underlying the invasion into the target tissues of their host organism are still open. Here, we established an ex vivo infection model of

  15. Cyclosporine a inhibits apoptosis of rat gingival epithelium.

    Science.gov (United States)

    Ma, Su; Liu, Peihong; Li, Yanwu; Hou, Lin; Chen, Li; Qin, Chunlin

    2014-08-01

    The use of cyclosporine A (CsA) induces hyperplasia of the gingival epithelium in a site-specific response manner, but the molecular mechanism via which the lesion occurs is unclear. The present research aims to investigate the site-specific effect of CsA on the apoptosis of gingival epithelium associated with gingival hyperplasia. Forty Wistar rats were divided into CsA-treated and non-treated groups. Paraffin-embedded sections of mandibular first molars were selected for hematoxylin and eosin staining, immunohistochemistry analyses of bcl-2 and caspase-3, and the staining of terminal deoxynucleotidyl transfer-mediated dUTP nick-end labeling (TUNEL). The area of the whole gingival epithelium and the length of rete pegs were measured, and the number of bcl-2- and caspase-3-positive cells in the longest rete peg were counted. The analysis of variance for factorial designs and Fisher least significant difference test for post hoc analysis were used to determine the significance levels. In CsA-treated rats, bcl-2 expression was significantly upregulated, whereas caspase-3 expression was downregulated, along with a reduced number of TUNEL-positive cells. The site-specific distribution of bcl-2 was consistent with the site-specific hyperplasia of the gingival epithelium in CsA-treated rats. CsA inhibited gingival epithelial apoptosis via the mitochondrial pathway and common pathway. The antiapoptotic protein bcl-2 might play a critical role in the pathogenesis of the site-specific hyperplasia of gingival epithelium induced by CsA. There were mechanistic differences in the regulation of apoptosis for cells in the attached gingival epithelium, free gingival epithelium, and junctional epithelium.

  16. Extracorporeal membrane oxygenation causes loss of intestinal epithelial barrier in the newborn piglet.

    Science.gov (United States)

    Kurundkar, Ashish R; Killingsworth, Cheryl R; McIlwain, R Britt; Timpa, Joseph G; Hartman, Yolanda E; He, Dongning; Karnatak, Rajendra K; Neel, Mary L; Clancy, John P; Anantharamaiah, G M; Maheshwari, Akhil

    2010-08-01

    Extracorporeal membrane oxygenation (ECMO) is an important life-support system used in neonates and young children with intractable cardiorespiratory failure. In this study, we used our porcine neonatal model of venoarterial ECMO to investigate whether ECMO causes gut barrier dysfunction. We subjected 3-wk-old previously healthy piglets to venoarterial ECMO for up to 8 h and evaluated gut mucosal permeability, bacterial translocation, plasma levels of bacterial products, and ultrastructural changes in gut epithelium. We also measured plasma lipopolysaccharide (LPS) levels in a small cohort of human neonates receiving ECMO. In our porcine model, ECMO caused a rapid increase in gut mucosal permeability within the first 2 h of treatment, leading to a 6- to 10-fold rise in circulating bacterial products. These changes in barrier function were associated with cytoskeletal condensation in epithelial cells, which was explained by phosphorylation of a myosin II regulatory light chain. In support of these findings, we also detected elevated plasma LPS levels in human neonates receiving ECMO, indicating a similar loss of gut barrier function in these infants. On the basis of these data, we conclude that ECMO is an independent cause of gut barrier dysfunction and bacterial translocation may be an important contributor to ECMO-related inflammation.

  17. Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

    Directory of Open Access Journals (Sweden)

    Johan Agren

    2010-01-01

    Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

  18. Sodium coupled bicarbonate influx regulates intracellular and apical pH in cultured rat caput epididymal epithelium.

    Science.gov (United States)

    Zuo, Wu-Lin; Li, Sheng; Huang, Jie-Hong; Yang, Deng-Liang; Zhang, Geng; Chen, Si-Liang; Ruan, Ye-Chun; Ye, Ke-Nan; Cheng, Christopher H K; Zhou, Wen-Liang

    2011-01-01

    The epithelium lining the epididymis provides an optimal acidic fluid microenvironment in the epididymal tract that enable spermatozoa to complete the maturation process. The present study aims to investigate the functional role of Na(+)/HCO(3)(-) cotransporter in the pH regulation in rat epididymis. Immunofluorescence staining of pan cytokeratin in the primary culture of rat caput epididymal epithelium showed that the system was a suitable model for investigating the function of epididymal epithelium. Intracellular and apical pH were measured using the fluorescent pH sensitive probe carboxy-seminaphthorhodafluor-4F acetoxymethyl ester (SNARF-4F) and sparklet pH electrode respectively to explore the functional role of rat epididymal epithelium. In the HEPES buffered Krebs-Henseleit (KH) solution, the intracellular pH (pHi) recovery from NH(4)Cl induced acidification in the cultured caput epididymal epithelium was completely inhibited by amiloride, the inhibitor of Na(+)/H(+) exchanger (NHE). Immediately changing of the KH solution from HEPES buffered to HCO(3)(-) buffered would cause another pHi recovery. The pHi recovery in HCO(3)(-) buffered KH solution was inhibited by 4, 4diisothiocyanatostilbene-2,2-disulfonic acid (DIDS), the inhibitor of HCO(3)(-) transporter or by removal of extracellular Na(+). The extracellular pH measurement showed that the apical pH would increase when adding DIDS to the apical side of epididymal epithelial monolayer, however adding DIDS to the basolateral side had no effect on apical pH. The present study shows that sodium coupled bicarbonate influx regulates intracellular and apical pH in cultured caput epididymal epithelium.

  19. Sodium coupled bicarbonate influx regulates intracellular and apical pH in cultured rat caput epididymal epithelium.

    Directory of Open Access Journals (Sweden)

    Wu-Lin Zuo

    Full Text Available The epithelium lining the epididymis provides an optimal acidic fluid microenvironment in the epididymal tract that enable spermatozoa to complete the maturation process. The present study aims to investigate the functional role of Na(+/HCO(3(- cotransporter in the pH regulation in rat epididymis.Immunofluorescence staining of pan cytokeratin in the primary culture of rat caput epididymal epithelium showed that the system was a suitable model for investigating the function of epididymal epithelium. Intracellular and apical pH were measured using the fluorescent pH sensitive probe carboxy-seminaphthorhodafluor-4F acetoxymethyl ester (SNARF-4F and sparklet pH electrode respectively to explore the functional role of rat epididymal epithelium. In the HEPES buffered Krebs-Henseleit (KH solution, the intracellular pH (pHi recovery from NH(4Cl induced acidification in the cultured caput epididymal epithelium was completely inhibited by amiloride, the inhibitor of Na(+/H(+ exchanger (NHE. Immediately changing of the KH solution from HEPES buffered to HCO(3(- buffered would cause another pHi recovery. The pHi recovery in HCO(3(- buffered KH solution was inhibited by 4, 4diisothiocyanatostilbene-2,2-disulfonic acid (DIDS, the inhibitor of HCO(3(- transporter or by removal of extracellular Na(+. The extracellular pH measurement showed that the apical pH would increase when adding DIDS to the apical side of epididymal epithelial monolayer, however adding DIDS to the basolateral side had no effect on apical pH.The present study shows that sodium coupled bicarbonate influx regulates intracellular and apical pH in cultured caput epididymal epithelium.

  20. Cytotoxicity and genotoxicity of bacterial magnetosomes against human retinal pigment epithelium cells

    Science.gov (United States)

    Qi, Lei; Lv, Xiujuan; Zhang, Tongwei; Jia, Peina; Yan, Ruiying; Li, Shuli; Zou, Ruitao; Xue, Yuhua; Dai, Liming

    2016-06-01

    A variety of nanomaterials have been developed for ocular diseases. The ability of these nanomaterials to pass through the blood-ocular barrier and their biocompatibility are essential characteristics that must be considered. Bacterial magnetosomes (BMs) are a type of biogenic magnetic nanomaterials synthesized by magnetotactic bacteria. Due to their unique biomolecular membrane shell and narrow size distribution of approximately 30 nm, BMs can pass through the blood-brain barrier. The similarity of the blood-ocular barrier to the blood-brain barrier suggests that BMs have great potential as treatments for ocular diseases. In this work, BMs were isolated from magnetotactic bacteria and evaluated in various cytotoxicity and genotoxicity studies in human retinal pigment epithelium (ARPE-19) cells. The BMs entered ARPE-19 cells by endocytosis after a 6-h incubation and displayed much lower cytotoxicity than chemically synthesized magnetic nanoparticles (MNPs). MNPs exhibited significantly higher genotoxicity than BMs and promoted the expression of Bax (the programmed cell death acceleration protein) and the induction of greater cell necrosis. In BM-treated cells, apoptosis tended to be suppressed via increased expression of the Bcl-2 protein. In conclusion, BMs display excellent biocompatibility and potential for use in the treatment of ocular diseases.

  1. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  2. Fine structure of the midgut epithelium in the millipede Telodeinopus aoutii (Myriapoda, Diplopoda) with special emphasis on epithelial regeneration.

    Science.gov (United States)

    Rost-Roszkowska, M M; Kszuk-Jendrysik, M; Marchewka, A; Poprawa, I

    2018-01-01

    The midgut of millipedes is composed of a simple epithelium that rests on a basal lamina, which is surrounded by visceral muscles and hepatic cells. As the material for our studies, we chose Telodeinopus aoutii (Demange, 1971) (Kenyan millipede) (Diplopoda, Spirostreptida), which lives in the rain forests of Central Africa. This commonly reared species is easy to obtain from local breeders and easy to culture in the laboratory. During our studies, we used transmission and scanning electron microscopes and light and fluorescent microscopes. The midgut epithelium of the species examined here shares similarities to the structure of the millipedes analyzed to date. The midgut epithelium is composed of three types of cells-digestive, secretory, and regenerative cells. Evidence of three types of secretion have been observed in the midgut epithelium: merocrine, apocrine, and microapocrine secretion. The regenerative cells of the midgut epithelium in millipedes fulfill the role of midgut stem cells because of their main functions: self-renewal (the ability to divide mitotically and to maintain in an undifferentiated state) and potency (ability to differentiate into digestive cells). We also confirmed that spot desmosomes are common intercellular junctions between the regenerative and digestive cells in millipedes.

  3. Ultrastructure and Glycoconjugate Pattern of the Foot Epithelium of the Abalone Haliotis tuberculata (Linnaeus, 1758 (Gastropoda, Haliotidae

    Directory of Open Access Journals (Sweden)

    I. Bravo Portela

    2012-01-01

    Full Text Available The foot epithelium of the gastropod Haliotis tuberculata is studied by light and electron microscopy in order to contribute to the understanding of the anatomy and functional morphology of the mollusks integument. Study of the external surface by scanning electron microscopy reveals that the side foot epithelium is characterized by a microvillus border with a very scant presence of small ciliary tufts, but the sole foot epithelium bears a dense field of long cilia. Ultrastructural examination by transmission electron microscopy of the side epithelial cells shows deeply pigmented cells with high electron-dense granular content which are not observed in the epithelial sole cells. Along the pedal epithelium, seven types of secretory cells are present; furthermore, two types of subepithelial glands are located just in the sole foot. The presence and composition of glycoconjugates in the secretory cells and subepithelial glands are analyzed by conventional and lectin histochemistry. Subepithelial glands contain mainly N-glycoproteins rich in fucose and mannose whereas secretory cells present mostly acidic sulphated glycoconjugates such as glycosaminoglycans and mucins, which are rich in galactose, N-acetyl-galactosamine, and N-acetyl-glucosamine. No sialic acid is present in the foot epithelium.

  4. Perinatal supplementation of 4-phenylbutyrate and glutamine attenuates endoplasmic reticulum stress and improves colonic epithelial barrier function in rats born with intrauterine growth restriction.

    Science.gov (United States)

    Désir-Vigné, Axel; Haure-Mirande, Vianney; de Coppet, Pierre; Darmaun, Dominique; Le Dréan, Gwenola; Segain, Jean-Pierre

    2018-05-01

    Intrauterine growth restriction (IUGR) can affect the structure and function of the intestinal barrier and increase digestive disease risk in adulthood. Using the rat model of maternal dietary protein restriction (8% vs. 20%), we found that the colon of IUGR offspring displayed decreased mRNA expression of epithelial barrier proteins MUC2 and occludin during development. This was associated with increased mRNA expression of endoplasmic reticulum (ER) stress marker XBP1s and increased colonic permeability measured in Ussing chambers. We hypothesized that ER stress contributes to colonic barrier alterations and that perinatal supplementation of dams with ER stress modulators, phenylbutyrate and glutamine (PG) could prevent these defects in IUGR offspring. We first demonstrated that ER stress induction by tunicamycin or thapsigargin increased the permeability of rat colonic tissues mounted in Ussing chamber and that PG treatment prevented this effect. Therefore, we supplemented the diet of control and IUGR dams with PG during gestation and lactation. Real-time polymerase chain reaction and histological analysis of colons from 120-day-old offspring revealed that perinatal PG treatment partially prevented the increased expression of ER stress markers but reversed the reduction of crypt depth and goblet cell number in IUGR rats. In dextran sodium sulfate-induced injury and recovery experiments, the colon of IUGR rats without perinatal PG treatment showed higher XBP1s mRNA levels and histological scores of inflammation than IUGR rats with perinatal PG treatment. In conclusion, these data suggest that perinatal supplementation with PG could alleviate ER stress and prevent epithelial barrier dysfunction in IUGR offspring. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Additive impairment of the barrier function and irritation by biogenic amines and sodium lauryl sulphate: a controlled in vivo tandem irritation study.

    Science.gov (United States)

    Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P

    2005-01-01

    Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.

  6. Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

    Science.gov (United States)

    Kubota, Takahiro

    2012-06-01

    Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

  7. Spontaneous and cytokine induced expression and activity of matrix metalloproteinases in human colonic epithelium

    DEFF Research Database (Denmark)

    Pedersen, G; Saermark, T; Kirkegaard, T

    2009-01-01

    levels in cells from inflamed IBD mucosa. MMP-2 and -8 mRNA were expressed inconsistently and MMP-11, -13 and -14 mRNA undetectable. Proteolytic MMP activity was detected in CEC supernatants and the level was increased significantly in inflamed IBD epithelium. The enzyme activity was inhibited strongly......Matrix metalloproteinases (MMPs) have been implicated in tissue damage associated with inflammatory bowel disease (IBD).As the role of the intestinal epithelium in this process is unknown, we determined MMP expression and enzyme activity in human colonic epithelial cells (CEC). MMP mRNA expression...... was assessed by reverse transcription-polymerase chain reaction in HT-29 and DLD-1 cells and in CEC isolated from biopsies from IBD and control patients. Total MMP activity in the cells was measured by a functional assay, based on degradation of a fluorescent synthetic peptide containing the specific bond...

  8. Species variation in biology and physiology of the ciliary epithelium: similarities and differences.

    Science.gov (United States)

    Do, Chi Wai; Civan, Mortimer M

    2009-04-01

    Glaucoma is a leading cause of irreversible blindness worldwide. Lowering intraocular pressure (IOP) is the only strategy documented to delay the appearance and retard the progression of vision loss. One major approach for lowering IOP is to slow the rate of aqueous humor formation by the ciliary epithelium. As discussed in the present review, the transport basis for this secretion is largely understood. However, several substantive issues are yet to be resolved, including the integrated regulation of secretion, the functional topography of the ciliary epithelium, and the degree and significance of species variation in aqueous humor inflow. This review discusses species differences in net secretion, particularly of Cl(-) and HCO(3)(-) secretion. Identifying animal models most accurately mimicking aqueous humor formation in the human will facilitate development of future novel initiatives to lower IOP.

  9. Scanning electron microscopical study of the lingual epithelium of green iguana (Iguana iguana).

    Science.gov (United States)

    Abbate, F; Latella, G; Montalbano, G; Guerrera, M C; Levanti, M B; Ciriaco, E

    2008-08-01

    During the last few years, green iguanas (Iguana iguana) have turned out to be one of the most popular pets. They are omnivorous. In their way of feeding, this crucial function is performed by capturing of the preys and mostly, this is carried out by the tongue. The role of the tongue is also fundamental during the intra-oral transport and during the swallowing of food. This has been reported in several studies about chameleons, agamids and iguanids, nevertheless published data about the mechanisms of capturing and swallowing the prey, and the morphological descriptions about the tongue epithelium, are scarce. Therefore, the aim of this present study was to analyse the morphology of the lingual epithelium in green iguanas by scanning electron microscopy. Three different areas were demonstrated on the tongue surface: the tongue tip, characterized by a smooth epithelium without papillae, a foretongue, completely covered by numerous closely packed cylindriform papillae, and a hindtongue with conical-like papillae. Some taste buds were recognized on the middle and the posterior parts of the tongue. Different functional roles could be hypothesized for the three tongue areas: the tongue tip could have a role related to the movements of the prey immediately after the capturing, while the middle papillae and the hindtongue could have an important role concerning the swallowing phase.

  10. Histochemical localization of cholinesterase activity in the dental epithelium of guinea pig teeth.

    Science.gov (United States)

    Jayawardena, C K; Takano, Y

    2004-07-01

    Cholinesterase is known for its remarkable diversity in distribution and function. An association of this enzyme with proliferative and morpho-differentiating tissues has been reported in several species. Here we report on the first evidence of the presence of cholinesterase in the enamel organ of continuously erupting incisors and molars of the guinea pig. Frozen sections of the incisors and molars of the guinea pig were incubated for histochemical demonstration of cholinesterase activity by means of the thiocholine method as described by Karnovsky and Root. The cholinesterase activity was observed in several types of cells of the dental epithelium; cells forming the basal portion of the enamel organ, outer enamel epithelium and maturation stage ameloblasts of both the incisors and molars. In the crown analogue side, the outer enamel epithelial cells gained strong reactions for cholinesterase and maintained the reaction throughout the secretory and maturation stages of amelogenesis. In contrast, cholinesterase reactions were lacking in the inner enamel epithelium, pre-ameloblasts, and secretory ameloblasts. In the early stage of enamel maturation, ameloblasts began to show positive reactions for cholinesterase, which was upregulated in the incisal direction. Although both tooth types showed similar reactive patterns for cholinesterase at the growing ends, maturation ameloblasts depicted a different pattern of staining displaying the reactions only sporadically in molars. These data indicate the role of cholinesterase in the enamel organ in tooth morphogenesis and function of guinea pig teeth. Copyright 2004 Springer-Verlag

  11. Chronic Alcohol Ingestion Changes the Landscape of the Alveolar Epithelium

    Directory of Open Access Journals (Sweden)

    Charles A. Downs

    2013-01-01

    Full Text Available Similar to effects of alcohol on the heart, liver, and brain, the effects of ethanol (EtOH on lung injury are preventable. Unlike other vital organ systems, however, the lethal effects of alcohol on the lung are underappreciated, perhaps because there are no signs of overt pulmonary disorder until a secondary insult, such as a bacterial infection or injury, occurs in the lung. This paper provides overview of the complex changes in the alveolar environment known to occur following both chronic and acute alcohol exposures. Contemporary animal and cell culture models for alcohol-induced lung dysfunction are discussed, with emphasis on the effect of alcohol on transepithelial transport processes, namely, epithelial sodium channel activity (ENaC. The cascading effect of tissue and phagocytic Nadph oxidase (Nox may be triggered by ethanol exposure, and as such, alcohol ingestion and exposure lead to a prooxidative environment; thus impacting alveolar macrophage (AM function and oxidative stress. A better understanding of how alcohol changes the landscape of the alveolar epithelium can lead to improvements in treating acute respiratory distress syndrome (ARDS for which hospitalized alcoholics are at an increased risk.

  12. Damage to lens fiber cells causes TRPV4-dependent Src family kinase activation in the epithelium.

    Science.gov (United States)

    Shahidullah, M; Mandal, A; Delamere, N A

    2015-11-01

    The bulk of the lens consists of tightly packed fiber cells. Because mature lens fibers lack mitochondria and other organelles, lens homeostasis relies on a monolayer of epithelial cells at the anterior surface. The detection of various signaling pathways in lens epithelial cells suggests they respond to stimuli that influence lens function. Focusing on Src Family Kinases (SFKs) and Transient Receptor Potential Vanilloid 4 (TRPV4), we tested whether the epithelium can sense and respond to an event that occurs in fiber mass. The pig lens was subjected to localized freeze-thaw (FT) damage to fibers at posterior pole then the lens was incubated for 1-10 min in Krebs solution at 37 °C. Transient SFK activation in the epithelium was detectable at 1 min. Using a western blot approach, the ion channel TRPV4 was detected in the epithelium but was sparse or absent in fiber cells. Even though TRPV4 expression appears low at the actual site of FT damage to the fibers, SFK activation in the epithelium was suppressed in lenses subjected to FT damage then incubated with the TRPV4 antagonist HC067047 (10 μM). Na,K-ATPase activity was examined because previous studies report changes of Na,K-ATPase activity associated with SFK activation. Na,K-ATPase activity doubled in the epithelium removed from FT-damaged lenses and the response was prevented by HC067047 or the SFK inhibitor PP2 (10 μM). Similar changes were observed in response to fiber damage caused by injection of 5 μl hyperosmotic NaCl or mannitol solution beneath the surface of the posterior pole. The findings point to a TRPV4-dependent mechanism that enables the epithelial cells to detect remote damage in the fiber mass and respond within minutes by activating SFK and increasing Na,K-ATPase activity. Because TRPV4 channels are mechanosensitive, we speculate they may be stimulated by swelling of the lens structure caused by damage to the fibers. Increased Na,K-ATPase activity gives the lens greater capacity to

  13. Intestinal Barrier Function and the Gut Microbiome Are Differentially Affected in Mice Fed a Western-Style Diet or Drinking Water Supplemented with Fructose.

    Science.gov (United States)

    Volynets, Valentina; Louis, Sandrine; Pretz, Dominik; Lang, Lisa; Ostaff, Maureen J; Wehkamp, Jan; Bischoff, Stephan C

    2017-05-01

    Background: The consumption of a Western-style diet (WSD) and high fructose intake are risk factors for metabolic diseases. The underlying mechanisms are largely unclear. Objective: To unravel the mechanisms by which a WSD and fructose promote metabolic disease, we investigated their effects on the gut microbiome and barrier function. Methods: Adult female C57BL/6J mice were fed a sugar- and fat-rich WSD or control diet (CD) for 12 wk and given access to tap water or fructose-supplemented water. The microbiota was analyzed with the use of 16S rRNA gene sequencing. Barrier function was studied with the use of permeability tests, and endotoxin, mucus thickness, and gene expressions were measured. Results: The WSD increased body weight gain but not endotoxin translocation compared with the CD. In contrast, high fructose intake increased endotoxin translocation 2.6- and 3.8-fold in the groups fed the CD + fructose and WSD + fructose, respectively, compared with the CD group. The WSD + fructose treatment also induced a loss of mucus thickness in the colon (-46%) and reduced defensin expression in the ileum and colon. The lactulose:mannitol ratio in the WSD + fructose mice was 1.8-fold higher than in the CD mice. Microbiota analysis revealed that fructose, but not the WSD, increased the Firmicutes:Bacteroidetes ratio by 88% for CD + fructose and 63% for WSD + fructose compared with the CD group. Bifidobacterium abundance was greater in the WSD mice than in the CD mice (63-fold) and in the WSD + fructose mice than in the CD + fructose mice (330-fold). Conclusions: The consumption of a WSD or high fructose intake differentially affects gut permeability and the microbiome. Whether these differences are related to the distinct clinical outcomes, whereby the WSD primarily promotes weight gain and high fructose intake causes barrier dysfunction, needs to be investigated in future studies. © 2017 American Society for Nutrition.

  14. Prevalence of ciliated epithelium in apical periodontitis lesions.

    Science.gov (United States)

    Ricucci, Domenico; Loghin, Simona; Siqueira, José F; Abdelsayed, Rafik A

    2014-04-01

    This article reports on the morphologic features and the frequency of ciliated epithelium in apical cysts and discusses its origin. The study material consisted of 167 human apical periodontitis lesions obtained consecutively from patients presenting for treatment during a period of 12 years in a dental practice operated by one of the authors. All of the lesions were obtained still attached to the root apices of teeth with untreated (93 lesions) or treated canals (74 lesions). The former were obtained by extraction and the latter by extraction or apical surgery. Specimens were processed for histopathologic and histobacteriologic analyses. Lesions were classified, and the type of epithelium, if present, was recorded. Of the lesions analyzed, 49 (29%) were diagnosed as cysts. Of these, 26 (53%) were found in untreated teeth, and 23 (47%) related to root canal-treated teeth. Ciliated columnar epithelium was observed partially or completely lining the cyst wall in 4 cysts, and all of them occurred in untreated maxillary molars. Three of these lesions were categorized as pocket cysts, and the other was a true cyst. Ciliated columnar epithelium-lined cysts corresponded to approximately 2% of the apical periodontitis lesions and 8% of the cysts of endodontic origin in the population studied. This epithelium is highly likely to have a sinus origin in the majority of cases. However, the possibility of prosoplasia or upgraded differentiation into ciliated epithelium from the typical cystic lining squamous epithelium may also be considered. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. Comparison of transepithelial corneal crosslinking with epithelium-off crosslinking (epithelium-off CXL in adult Pakistani population with progressive keratoconus

    Directory of Open Access Journals (Sweden)

    Bushra Akbar

    2017-01-01

    CONCLUSION: Transepithelial CXL is not recommended to be replaced completely by standard epithelium-off CXL due to continued ectatic progression in 25% of cases. However, thin corneas, unfit for standard epithelium-off CXL, can benefit from transepithelial CXL.

  16. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  17. Vehicle barrier systems

    International Nuclear Information System (INIS)

    Sena, P.A.

    1986-01-01

    The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper

  18. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal

    2015-09-15

    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

  19. Six1 is essential for differentiation and patterning of the mammalian auditory sensory epithelium.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    2017-09-01

    Full Text Available The organ of Corti in the cochlea is a two-cell layered epithelium: one cell layer of mechanosensory hair cells that align into one row of inner and three rows of outer hair cells interdigitated with one cell layer of underlying supporting cells along the entire length of the cochlear spiral. These two types of epithelial cells are derived from common precursors in the four- to five-cell layered primordium and acquire functionally important shapes during terminal differentiation through the thinning process and convergent extension. Here, we have examined the role of Six1 in the establishment of the auditory sensory epithelium. Our data show that prior to terminal differentiation of the precursor cells, deletion of Six1 leads to formation of only a few hair cells and defective patterning of the sensory epithelium. Previous studies have suggested that downregulation of Sox2 expression in differentiating hair cells must occur after Atoh1 mRNA activation in order to allow Atoh1 protein accumulation due to antagonistic effects between Atoh1 and Sox2. Our analysis indicates that downregulation of Sox2 in the differentiating hair cells depends on Six1 activity. Furthermore, we found that Six1 is required for the maintenance of Fgf8 expression and dynamic distribution of N-cadherin and E-cadherin in the organ of Corti during differentiation. Together, our analyses uncover essential roles of Six1 in hair cell differentiation and formation of the organ of Corti in the mammalian cochlea.

  20. Hyperspectral Image Enhancement and Mixture Deep-Learning Classification of Corneal Epithelium Injuries.

    Science.gov (United States)

    Noor, Siti Salwa Md; Michael, Kaleena; Marshall, Stephen; Ren, Jinchang

    2017-11-16

    In our preliminary study, the reflectance signatures obtained from hyperspectral imaging (HSI) of normal and abnormal corneal epithelium tissues of porcine show similar morphology with subtle differences. Here we present image enhancement algorithms that can be used to improve the interpretability of data into clinically relevant information to facilitate diagnostics. A total of 25 corneal epithelium images without the application of eye staining were used. Three image feature extraction approaches were applied for image classification: (i) image feature classification from histogram using a support vector machine with a Gaussian radial basis function (SVM-GRBF); (ii) physical image feature classification using deep-learning Convolutional Neural Networks (CNNs) only; and (iii) the combined classification of CNNs and SVM-Linear. The performance results indicate that our chosen image features from the histogram and length-scale parameter were able to classify with up to 100% accuracy; particularly, at CNNs and CNNs-SVM, by employing 80% of the data sample for training and 20% for testing. Thus, in the assessment of corneal epithelium injuries, HSI has high potential as a method that could surpass current technologies regarding speed, objectivity, and reliability.

  1. Macrophage/epithelium cross-talk regulates cell cycle progression and migration in pancreatic progenitors.

    Directory of Open Access Journals (Sweden)

    Kristin Mussar

    Full Text Available Macrophages populate the mesenchymal compartment of all organs during embryogenesis and have been shown to support tissue organogenesis and regeneration by regulating remodeling of the extracellular microenvironment. Whether this mesenchymal component can also dictate select developmental decisions in epithelia is unknown. Here, using the embryonic pancreatic epithelium as model system, we show that macrophages drive the epithelium to execute two developmentally important choices, i.e. the exit from cell cycle and the acquisition of a migratory phenotype. We demonstrate that these developmental decisions are effectively imparted by macrophages activated toward an M2 fetal-like functional state, and involve modulation of the adhesion receptor NCAM and an uncommon "paired-less" isoform of the transcription factor PAX6 in the epithelium. Over-expression of this PAX6 variant in pancreatic epithelia controls both cell motility and cell cycle progression in a gene-dosage dependent fashion. Importantly, induction of these phenotypes in embryonic pancreatic transplants by M2 macrophages in vivo is associated with an increased frequency of endocrine-committed cells emerging from ductal progenitor pools. These results identify M2 macrophages as key effectors capable of coordinating epithelial cell cycle withdrawal and cell migration, two events critical to pancreatic progenitors' delamination and progression toward their differentiated fates.

  2. Macrophage/epithelium cross-talk regulates cell cycle progression and migration in pancreatic progenitors.

    Science.gov (United States)

    Mussar, Kristin; Tucker, Andrew; McLennan, Linsey; Gearhart, Addie; Jimenez-Caliani, Antonio J; Cirulli, Vincenzo; Crisa, Laura

    2014-01-01

    Macrophages populate the mesenchymal compartment of all organs during embryogenesis and have been shown to support tissue organogenesis and regeneration by regulating remodeling of the extracellular microenvironment. Whether this mesenchymal component can also dictate select developmental decisions in epithelia is unknown. Here, using the embryonic pancreatic epithelium as model system, we show that macrophages drive the epithelium to execute two developmentally important choices, i.e. the exit from cell cycle and the acquisition of a migratory phenotype. We demonstrate that these developmental decisions are effectively imparted by macrophages activated toward an M2 fetal-like functional state, and involve modulation of the adhesion receptor NCAM and an uncommon "paired-less" isoform of the transcription factor PAX6 in the epithelium. Over-expression of this PAX6 variant in pancreatic epithelia controls both cell motility and cell cycle progression in a gene-dosage dependent fashion. Importantly, induction of these phenotypes in embryonic pancreatic transplants by M2 macrophages in vivo is associated with an increased frequency of endocrine-committed cells emerging from ductal progenitor pools. These results identify M2 macrophages as key effectors capable of coordinating epithelial cell cycle withdrawal and cell migration, two events critical to pancreatic progenitors' delamination and progression toward their differentiated fates.

  3. Barrier mechanisms in the Drosophila blood-brain barrier

    Directory of Open Access Journals (Sweden)

    Samantha Jane Hindle

    2014-12-01

    Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

  4. Increase of corneal epithelium cell radioresistance during regeneration

    International Nuclear Information System (INIS)

    Popova, M.F.; Bulyakova, N.V.; Azarova, V.S.

    1985-01-01

    A comparative study of the radiosensitivity of the normal and regenerating cornea epithelium of C 57 Bl mice was performed on the cellular level, the duration of the cell cycle being taken into account. Criteria of radiation injuries were the number of chromosome aberrations, mitotic index and duration of mitotic block. The anterior part of the head was irradiated singly with 1.75, 3.5 or 7.0 Gy and also repeatedly 3.5 + 3.5 at a 24-hours interval. The corneas were fixed 2, 4, 6, 12, 24, 48, 72 and 96 hours after irradiation. In all cases of irradiated mice the regenerating epithelium showed a shorter mitotic block and significantly lower cytogenetic injury as compared with the controls. Effects of fractionated irradiation were only shown in the regenerating epithelium. The results obtained indicate that regenerating epithelium cells of the cornea are significantly more radioresistant than normal epithelium due to activation of post-radiation recovery, and also, possibly, due to an increase in the content of endogenous radioprotectors. (author)

  5. Developmental origin of the posterior pigmented epithelium of iris.

    Science.gov (United States)

    Wang, Xiaobing; Xiong, Kai; Lu, Lei; Gu, Dandan; Wang, Songtao; Chen, Jing; Xiao, Honglei; Zhou, Guomin

    2015-03-01

    Iris epithelium is a double-layered pigmented cuboidal epithelium. According to the current model, the neural retina and the posterior iris pigment epithelium (IPE) are derived from the inner wall of the optic cup, while the retinal pigment epithelium (RPE) and the anterior IPE are derived from the outer wall of the optic cup during development. Our current study shows evidence, contradicting this model of fetal iris development. We demonstrate that human fetal iris expression patterns of Otx2 and Mitf transcription factors are similar, while the expressions of Otx2 and Sox2 are complementary. Furthermore, IPE and RPE exhibit identical morphologic development during the early embryonic period. Our results suggest that the outer layer of the optic cup forms two layers of the iris epithelium, and the posterior IPE is the inward-curling anterior rim of the outer layer of the optic cup. These findings provide a reasonable explanation of how IPE cells can be used as an appropriate substitute for RPE cells.

  6. Respiratory Epithelium Lined Cyst of the Maxilla: Differential Diagnosis

    Directory of Open Access Journals (Sweden)

    C. P. Martinelli-Kläy

    2017-01-01

    Full Text Available Maxillary cysts, including the cysts lined by respiratory epithelium, can present a diagnostic challenge. We report an unusual case of a maxillary cyst on an endodontically treated tooth #16, in which the cavity was totally lined by a respiratory epithelium. The patient, a 35-year-old male, presented with a generalized chronic periodontitis and complained of a pain in the tooth #16 region. A periodontal pocket extending to the root apices with pus coming out from the gingival was found. A combined endodontic periodontal was observed on a panoramic radiography. CBCT-scan revealed a well-circumscribed radiolucent lesion at the apices of the distobuccal root of the 16. A communication with the right maxillary sinus cavity and a maxillary and ethmoidal sinusitis were also observed. The lesion was removed and histological examination revealed a cyst lined exclusively by respiratory epithelium. Ciliated and rare mucous cells were also observed. The diagnosis could evoke a surgical ciliated cyst mimicking the radicular cyst but the patient has no previous history of trauma or surgery in the maxillofacial region. It could also be an unusual radicular cyst in which the stratified squamous epithelium was destroyed by inflammation and replaced by a respiratory epithelium of the maxillary sinus.

  7. Disruption of the epithelial barrier during intestinal inflammation: Quest for new molecules and mechanisms.

    Science.gov (United States)

    Lechuga, Susana; Ivanov, Andrei I

    2017-07-01

    The intestinal epithelium forms a key protective barrier that separates internal organs from the harmful environment of the gut lumen. Increased permeability of the gut barrier is a common manifestation of different inflammatory disorders contributing to the severity of disease. Barrier permeability is controlled by epithelial adherens junctions and tight junctions. Junctional assembly and integrity depend on fundamental homeostatic processes such as cell differentiation, rearrangements of the cytoskeleton, and vesicle trafficking. Alterations of intestinal epithelial homeostasis during mucosal inflammation may impair structure and remodeling of apical junctions, resulting in increased permeability of the gut barrier. In this review, we summarize recent advances in our understanding of how altered epithelial homeostasis affects the structure and function of adherens junctions and tight junctions in the inflamed gut. Specifically, we focus on the transcription reprogramming of the cell, alterations in the actin cytoskeleton, and junctional endocytosis and exocytosis. We pay special attention to knockout mouse model studies and discuss the relevance of these mechanisms to human gastrointestinal disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. LM and TEM study of the orthokeratinized and parakeratinized epithelium of the tongue in the domestic duck (Anas platyrhynchos f. domestica).

    Science.gov (United States)

    Skieresz-Szewczyk, Kinga; Jackowiak, Hanna; Ratajczak, Marlena

    2014-12-01

    The previous histological studies of the lingual mucosa in birds characterized two types of keratinized epithelium, i.e. orthokeratinized and parakeratinized. These epithelia are composed of three layers: basal, intermediate and keratinized. The present study showed detailed ultrastructural features of cells in particular layers of two types of keratinized epithelia on the tongue in the domestic duck and defined structural differences. TEM observations showed a gradual reduction in cell organelles in the following layers, at increasing amounts of keratin fibers. The characteristic feature of the ortho- and parakeratinized epithelium is the presence of sub-layers in the intermediate layer, i.e. the upper and lower part, which results from the different shape of cell nuclei and dye affinity of the cytoplasm. The keratinized layer of ortho- and parakeratinized epithelium is built of two types of cells such as electron dark and light cells, which undergo exfoliation. The basic difference between the keratinized epithelia is the presence of flattened cell nuclei in the keratinized layer of the parakeratinized epithelium. The differentiating feature is also an arrangement of keratin fibers in the cell cytoplasm of the keratinized layer. The analysis of the thickness of the epithelium and the keratinized layer, indicated differences between keratinized epithelia, which result from two variants of performing protective functions, either through a thick keratinized layer or by a higher epithelium. Differences in the ultrastructure of the ortho- and parakeratinized epithelium are associated with mechanical functions of the epithelium resulting from different forces acting on the tongue during feeding activities. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Protective barrier development: Overview

    International Nuclear Information System (INIS)

    Wing, N.R.; Gee, G.W.

    1990-01-01

    Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed

  10. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS): A Pilot Study.

    Science.gov (United States)

    Lindheim, Lisa; Bashir, Mina; Münzker, Julia; Trummer, Christian; Zachhuber, Verena; Leber, Bettina; Horvath, Angela; Pieber, Thomas R; Gorkiewicz, Gregor; Stadlbauer, Vanessa; Obermayer-Pietsch, Barbara

    2017-01-01

    Polycystic ovary syndrome (PCOS) is a common female endocrinopathy of unclear origin characterized by hyperandrogenism, oligo-/anovulation, and ovarian cysts. Women with PCOS frequently display overweight, insulin resistance, and systemic low-grade inflammation. We hypothesized that endotoxemia resulting from a leaky gut is associated with inflammation, insulin resistance, fat accumulation, and hyperandrogenemia in PCOS. In this pilot study, we compared the stool microbiome, gut permeability, and inflammatory status of women with PCOS and healthy controls. 16S rRNA gene amplicon sequencing was performed on stool samples from 24 PCOS patients and 19 healthy controls. Data processing and microbiome analysis were conducted in mothur and QIIME using different relative abundance cut-offs. Gut barrier integrity, endotoxemia, and inflammatory status were evaluated using serum and stool markers and associations with reproductive, metabolic, and anthropometric parameters were investigated. The stool microbiome of PCOS patients showed a lower diversity and an altered phylogenetic composition compared to controls. We did not observe significant differences in any taxa with a relative abundance>1%. When looking at rare taxa, the relative abundance of bacteria from the phylum Tenericutes, the order ML615J-28 (phylum Tenericutes) and the family S24-7 (phylum Bacteroidetes) was significantly lower and associated with reproductive parameters in PCOS patients. Patients showed alterations in some, but not all markers of gut barrier function and endotoxemia. Patients with PCOS have a lower diversity and an altered phylogenetic profile in their stool microbiome, which is associated with clinical parameters. Gut barrier dysfunction and endotoxemia were not driving factors in this patient cohort, but may contribute to the clinical phenotype in certain PCOS patients.

  11. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS: A Pilot Study.

    Directory of Open Access Journals (Sweden)

    Lisa Lindheim

    Full Text Available Polycystic ovary syndrome (PCOS is a common female endocrinopathy of unclear origin characterized by hyperandrogenism, oligo-/anovulation, and ovarian cysts. Women with PCOS frequently display overweight, insulin resistance, and systemic low-grade inflammation. We hypothesized that endotoxemia resulting from a leaky gut is associated with inflammation, insulin resistance, fat accumulation, and hyperandrogenemia in PCOS. In this pilot study, we compared the stool microbiome, gut permeability, and inflammatory status of women with PCOS and healthy controls.16S rRNA gene amplicon sequencing was performed on stool samples from 24 PCOS patients and 19 healthy controls. Data processing and microbiome analysis were conducted in mothur and QIIME using different relative abundance cut-offs. Gut barrier integrity, endotoxemia, and inflammatory status were evaluated using serum and stool markers and associations with reproductive, metabolic, and anthropometric parameters were investigated.The stool microbiome of PCOS patients showed a lower diversity and an altered phylogenetic composition compared to controls. We did not observe significant differences in any taxa with a relative abundance>1%. When looking at rare taxa, the relative abundance of bacteria from the phylum Tenericutes, the order ML615J-28 (phylum Tenericutes and the family S24-7 (phylum Bacteroidetes was significantly lower and associated with reproductive parameters in PCOS patients. Patients showed alterations in some, but not all markers of gut barrier function and endotoxemia.Patients with PCOS have a lower diversity and an altered phylogenetic profile in their stool microbiome, which is associated with clinical parameters. Gut barrier dysfunction and endotoxemia were not driving factors in this patient cohort, but may contribute to the clinical phenotype in certain PCOS patients.

  12. Development of a novel multi-functional active membrane capping barrier for the remediation of nitrobenzene-contaminated sediment.

    Science.gov (United States)

    Wang, Qing; Li, Yi; Wang, Chao; Wu, Yue; Wang, Peifang

    2014-07-15

    A novel bio-reactive capping barrier composed of polysulfone/granular activated carbon (PS/GAC) hybrid membranes immobilized with microorganism was developed for the remediation of nitrobenzene in sediments. The SEM observation demonstrated that all the membranes had a dense top layer and a porous sublayer, this structure can block the transfer of nitrobenzene from sediment to the water and enhance nitrobenzene degradation. Adsorption behaviors of nitrobenzene on membranes showed that the membrane impregnated with GAC had better performance than the pure PS membrane. The values of Kads increased from 4.64 (without GAC) to 6.19 (1:2 GAC). 20mg/L nitrobenzene can be completely degraded by Pseudomonas putida immobilized on membranes. The biodegradation rate of activated carbon-filled membrane system was little higher than that of pure PS membrane system. For remediation experiments, only about 21.7, 28.3 and 43.9% of nitrobenzene in the sediment was removed by the end of the experiments for PS/GAC membrane, sand-alone and sand amended with activated carbon capping systems, respectively. While for PS/GAC+microorganisms capping system, more than 70% of nitrobenzene loss was observed. This demonstrated that nitrobenzene can be effectively removed from contaminated sediments by microbial degradation in the bio-reactive capping system. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Gut barrier function and systemic endotoxemia after laparotomy or laparoscopic resection for colon cancer: A prospective randomized study

    Directory of Open Access Journals (Sweden)

    Mario Schietroma

    2016-01-01

    Full Text Available Purpose: The gut barrier is altered in certain pathologic conditions (shock, trauma, or surgical stress, resulting in bacterial and/or endotoxin translocation from the gut lumen into the systemic circulation. In this prospective randomized study, we investigated the effect of surgery on intestinal permeability (IP and endotoxemia in patients undergoing elective colectomy for colon cancer by comparing the laparoscopic with the open approach. Patients and Methods: A hundred twenty-three consecutive patients underwent colectomy for colon cancer: 61 cases were open resection (OR and 62 cases were laparoscopic resection (LR. IP was measured preoperatively and at days 1 and 3 after surgery. Serial venous blood sample were taken at 0, 30, 60, 90, 120, and 180 min, and at 12, 24, and 48 h after surgery for endotoxin measurement. Results: IP was significantly increased in the open and closed group at day 1 compared with the preoperative level (P < 0.05, but no difference was found between laparoscopic and open surgery group. The concentration endotoxin systemic increased significantly in the both groups during the course of surgery and returned to baseline levels at the second day. No difference was found between laparoscopic and open surgery. A significant correlation was observed between the maximum systemic endotoxin concentration and IP measured at day 1 in the open group and in the laparoscopic group. Conclusion: An increase in IP, and systemic endotoxemia were observed during the open and laparoscopic resection for colon cancer, without significant statistically difference between the two groups.

  14. Host-dependent zonulin secretion causes the impairment of the small intestine barrier function after bacterial exposure.

    Science.gov (United States)

    El Asmar, Ramzi; Panigrahi, Pinaki; Bamford, Penelope; Berti, Irene; Not, Tarcisio; Coppa, Giovanni V; Catassi, Carlo; Fasano, Alessio; El Asmar, Rahzi

    2002-11-01

    Enteric infections have been implicated in the pathogenesis of both food intolerance and autoimmune diseases secondary to the impairment of the intestinal barrier. On the basis of our recent discovery of zonulin, a modulator of small-intestinal tight junctions, we asked whether microorganisms might induce zonulin secretion and increased small-intestinal permeability. Both ex vivo mammalian small intestines and intestinal cell monolayers were exposed to either pathogenic or nonpathogenic enterobacteria. Zonulin production and changes in paracellular permeability were monitored in Ussing chambers and micro-snapwells. Zonula occludens 1 protein redistribution after bacteria colonization was evaluated on cell monolayers. Small intestines exposed to enteric bacteria secreted zonulin. This secretion was independent of either the species of the small intestines or the virulence of the microorganisms tested, occurred only on the luminal aspect of the bacteria-exposed small-intestinal mucosa, and was followed by a decrease in small-intestinal tissue resistance (transepithelial electrical resistance). The transepithelial electrical resistance decrement was secondary to the zonulin-induced tight junction disassembly, as also shown by the disengagement of the protein zonula occludens 1 protein from the tight junctional complex. This zonulin-driven opening of the paracellular pathway may represent a defensive mechanism, which flushes out microorganisms and contributes to the host response against bacterial colonization of the small intestine.

  15. A Method for Quantification of Epithelium Colonization Capacity by Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Micha Pedersen, Rune; Grønnemose, Rasmus Birkholm; Stærk, Kristian

    2018-01-01

    a method in which epithelia/endothelia are simulated by flow chamber-grown human cell layers, and infection is induced by seeding of pathogenic bacteria on these surfaces under conditions that simulate the physiological microenvironment. Quantification of bacterial adhesion and colonization of the cell......Most bacterial infections initiate at the mucosal epithelium lining the gastrointestinal, respiratory, and urogenital tracts. At these sites, bacterial pathogens must adhere and increase in numbers to effectively breach the outer barrier and invade the host. If the bacterium succeeds in reaching...... the bloodstream, effective dissemination again requires that bacteria in the blood, reestablish contact to distant endothelium sites and form secondary site foci. The infectious potential of bacteria is therefore closely linked to their ability to adhere to, colonize, and invade epithelial and endothelial...

  16. Host Defense and the Airway Epithelium: Frontline Responses That Protect against Bacterial Invasion and Pneumonia

    Directory of Open Access Journals (Sweden)

    Nicholas A. Eisele

    2011-01-01

    Full Text Available Airway epithelial cells are the first line of defense against invading microbes, and they protect themselves through the production of carbohydrate and protein matrices concentrated with antimicrobial products. In addition, they act as sentinels, expressing pattern recognition receptors that become activated upon sensing bacterial products and stimulate downstream recruitment and activation of immune cells which clear invading microbes. Bacterial pathogens that successfully colonize the lungs must resist these mechanisms or inhibit their production, penetrate the epithelial barrier, and be prepared to resist a barrage of inflammation. Despite the enormous task at hand, relatively few virulence factors coordinate the battle with the epithelium while simultaneously providing resistance to inflammatory cells and causing injury to the lung. Here we review mechanisms whereby airway epithelial cells recognize pathogens and activate a program of antibacterial pathways to prevent colonization of the lung, along with a few examples of how bacteria disrupt these responses to cause pneumonia.

  17. Erlotinib promotes endoplasmic reticulum stress-mediated injury in the intestinal epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Lu; Hu, Lingna; Yang, Baofang; Fang, Xianying; Gao, Zhe; Li, Wanshuai; Sun, Yang; Shen, Yan; Wu, Xuefeng [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093 (China); Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, 140 Hanzhong Road, Nanjing 210029 (China); Gu, Yanhong, E-mail: guluer@163.com [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, 140 Hanzhong Road, Nanjing 210029 (China); Wu, Xudong, E-mail: xudongwu@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093 (China)

    2014-07-01

    Erlotinib, a popular drug for treating non-small cell lung cancer (NSCLC), causes diarrhea in approximately 55% of patients receiving this drug. In the present study, we found that erlotinib induced barrier dysfunction in rat small intestine epithelial cells (IEC-6) by increasing epithelial permeability and down-regulating E-cadherin. The mRNA levels of various pro-inflammatory cytokines (Il-6, Il-25 and Il-17f) were increased after erlotinib treatment in IEC-6 cells. Erlotinib concentration- and time-dependently induced apoptosis and endoplasmic reticulum (ER) stress in both IEC-6 and human colon epithelial cells (CCD 841 CoN). Intestinal epithelial injury was also observed in male C57BL/6J mice administrated with erlotinib. Knockdown of C/EBP homologous protein (CHOP) with small interference RNA partially reversed erlotinib-induced apoptosis, production of IL-6 and down-regulation of E-cadherin in cultured intestinal epithelial cells. In conclusion, erlotinib caused ER stress-mediated injury in the intestinal epithelium, contributing to its side effects of diarrhea in patients. - Highlights: • Erlotinib destroyed barrier integrity both in vitro and in vivo. • Erlotinib induced inflammation both in vitro and in vivo. • Erlotinib induced apoptosis both in vitro and in vivo. • ER stress contributed to erlotinib-induced barrier dysfunction.

  18. Erlotinib promotes endoplasmic reticulum stress-mediated injury in the intestinal epithelium

    International Nuclear Information System (INIS)

    Fan, Lu; Hu, Lingna; Yang, Baofang; Fang, Xianying; Gao, Zhe; Li, Wanshuai; Sun, Yang; Shen, Yan; Wu, Xuefeng; Shu, Yongqian; Gu, Yanhong; Wu, Xudong; Xu, Qiang

    2014-01-01

    Erlotinib, a popular drug for treating non-small cell lung cancer (NSCLC), causes diarrhea in approximately 55% of patients receiving this drug. In the present study, we found that erlotinib induced barrier dysfunction in rat small intestine epithelial cells (IEC-6) by increasing epithelial permeability and down-regulating E-cadherin. The mRNA levels of various pro-inflammatory cytokines (Il-6, Il-25 and Il-17f) were increased after erlotinib treatment in IEC-6 cells. Erlotinib concentration- and time-dependently induced apoptosis and endoplasmic reticulum (ER) stress in both IEC-6 and human colon epithelial cells (CCD 841 CoN). Intestinal epithelial injury was also observed in male C57BL/6J mice administrated with erlotinib. Knockdown of C/EBP homologous protein (CHOP) with small interference RNA partially reversed erlotinib-induced apoptosis, production of IL-6 and down-regulation of E-cadherin in cultured intestinal epithelial cells. In conclusion, erlotinib caused ER stress-mediated injury in the intestinal epithelium, contributing to its side effects of diarrhea in patients. - Highlights: • Erlotinib destroyed barrier integrity both in vitro and in vivo. • Erlotinib induced inflammation both in vitro and in vivo. • Erlotinib induced apoptosis both in vitro and in vivo. • ER stress contributed to erlotinib-induced barrier dysfunction

  19. Hypothermia-induced loss of endothelial barrier function is restored after dopamine pretreatment : Role of p42/p44 activation

    NARCIS (Netherlands)

    Brinkkoetter, Paul-Thomas; Beck, Grietje C.; Gottmann, Uwe; Loesel, Ralf; Schnetzke, Ulf; Rudic, Boris; Hanusch, Christine; Rafat, Neysan; Liu, Zhenzi; Weiss, Christel; Leuvinik, Henri G. D.; Ploeg, Rutger; Braun, Claude; Schnuelle, Peter; van der Woude, Fokko J.; Yard, Benito A.

    2006-01-01

    Background. Donor dopamine usage is associated with improved immediate graft function after renal transplantation. Although prolonged cold preservation results in an increased vascular permeability, the present study was conducted to examine in vitro and in vivo if dopamine Pretreatment influences

  20. Potential Pathways for CNS Drug Delivery Across the Blood-Cerebrospinal Fluid Barrier

    OpenAIRE

    Strazielle, Nathalie; Ghersi-Egea, Jean-Fran?ois

    2016-01-01

    The blood-brain interfaces restrict the cerebral bioavailability of pharmacological compounds. Various drug delivery strategies have been developed to improve drug penetration into the brain. Most strategies target the microvascular endothelium forming the blood-brain barrier proper. Targeting the blood-cerebrospinal fluid (CSF) barrier formed by the epithelium of the choroid plexuses in addition to the blood-brain barrier may offer added-value for the treatment of central nervous system dise...

  1. Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-08-01

    This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.

  2. Transplantation of in vitro cultured endothelial progenitor cells repairs the blood-brain barrier and improves cognitive function of APP/PS1 transgenic AD mice.

    Science.gov (United States)

    Zhang, Shishuang; Zhi, Yongle; Li, Fei; Huang, Shan; Gao, Huabin; Han, Zhaoli; Ge, Xintong; Li, Dai; Chen, Fanglian; Kong, Xiaodong; Lei, Ping

    2018-04-15

    To date, the pathogenesis of Alzheimer's disease (AD) remains unclear. It is well-known that excessive deposition of Aβ in the brain is a crucial part of the pathogenesis of AD. In recent years, the AD neurovascular unit hypothesis has attracted much attention. Impairment of the blood-brain barrier (BBB) leads to abnormal amyloid-β (Aβ) transport, and chronic cerebral hypoperfusion causes Aβ deposition throughout the onset and progression of AD. Endothelial progenitor cells (EPCs) are the universal cells for repairing blood vessels. Our previous studies have shown that a reduced number of EPCs in the peripheral blood results in cerebral vascular repair disorder, cerebral hypoperfusion and neurodegeneration, which might be related to the cognitive dysfunction of AD patients. This study was designed to confirm whether EPCs transplantation could repair the blood-brain barrier, stimulate angiogenesis and reduce Aβ deposition in AD. The expression of ZO-1, Occludin and Claudin-5 was up-regulated in APP/PS1 transgenic mice after hippocampal transplantation of EPCs. Consistent with previous studies, EPC transplants also increased the microvessel density. We observed that Aβ senile plaque deposition was decreased and hippocampal cell apoptosis was reduced after EPCs transplantation. The Morris water maze test showed that spatial learning and memory functions were significantly improved in mice transplanted with EPCs. Consequently, EPCs could up-regulate the expression of tight junction proteins, repair BBB tight junction function, stimulate angiogenesis, promote Aβ clearance, and decrease neuronal loss, ultimately improve cognitive function. Taken together, these data demonstrate EPCs may play an important role in the therapeutic implications for vascular dysfunction in AD. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Three-dimensional culture conditions differentially affect astrocyte modulation of brain endothelial barrier function in response to transforming growth factor β1.

    Science.gov (United States)

    Hawkins, Brian T; Grego, Sonia; Sellgren, Katelyn L

    2015-05-22

    Blood-brain barrier (BBB) function is regulated by dynamic interactions among cell types within the neurovascular unit, including astrocytes and endothelial cells. Co-culture models of the BBB typically involve astrocytes seeded on two-dimensional (2D) surfaces, which recent studies indicate cause astrocytes to express a phenotype similar to that of reactive astrocytes in situ. We hypothesized that the culture conditions of astrocytes would differentially affect their ability to modulate BBB function in vitro. Brain endothelial cells were grown alone or in co-culture with astrocytes. Astrocytes were grown either as conventional (2D) monolayers, or in a collagen-based gel which allows them to grow in a three-dimensional (3D) construct. Astrocytes were viable in 3D conditions, and displayed a marked reduction in their expression of glial fibrillary acidic protein (GFAP), suggesting reduced activation. Stimulation of astrocytes with transforming growth factor (TGF)β1 decreased transendothelial electrical resistance (TEER) and reduced expression of claudin-5 in co-cultures, whereas treatment of endothelial cells in the absence of astrocytes was without effect. The effect of TGFβ1 on TEER was significantly more pronounced in endothelial cells cultured with 3D astrocytes compared to 2D astrocytes. These results demonstrate that astrocyte culture conditions differentially affect their ability to modulate brain endothelial barrier function, and suggest a direct relationship between reactive gliosis and BBB permeability. Moreover, these studies demonstrate the potential importance of physiologically relevant culture conditions to in vitro modeling of disease processes that affect the neurovascular unit. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. An autocrine ATP release mechanism regulates basal ciliary activity in airway epithelium.

    Science.gov (United States)

    Droguett, Karla; Rios, Mariana; Carreño, Daniela V; Navarrete, Camilo; Fuentes, Christian; Villalón, Manuel; Barrera, Nelson P

    2017-07-15

    Extracellular ATP, in association with [Ca 2+ ] i regulation, is required to maintain basal ciliary beat frequency. Increasing extracellular ATP levels increases ciliary beating in airway epithelial cells, maintaining a sustained response by inducing the release of additional ATP. Extracellular ATP levels in the millimolar range, previously associated with pathophysiological conditions of the airway epithelium, produce a transient arrest of ciliary activity. The regulation of ciliary beat frequency is dependent on ATP release by hemichannels (connexin/pannexin) and P2X receptor activation, the blockage of which may even stop ciliary movement. The force exerted by cilia, measured by atomic force microscopy, is reduced following extracellular ATP hydrolysis. This result complements the current understanding of the ciliary beating regulatory mechanism, with special relevance to inflammatory diseases of the airway epithelium that affect mucociliary clearance. Extracellular nucleotides, including ATP, are locally released by the airway epithelium and stimulate ciliary activity in a [Ca 2+ ] i -dependent manner after mechanical stimulation of ciliated cells. However, it is unclear whether the ATP released is involved in regulating basal ciliary activity and mediating changes in ciliary activity in response to chemical stimulation. In the present study, we evaluated ciliary beat frequency (CBF) and ciliary beating forces in primary cultures from mouse tracheal epithelium, using videomicroscopy and atomic force microscopy (AFM), respectively. Extracellular ATP levels and [Ca 2+ ] i were measured by luminometric and fluorimetric assays, respectively. Uptake of ethidium bromide was measured to evaluate hemichannel functionality. We show that hydrolysis of constitutive extracellular ATP levels with apyrase (50 U ml -1 ) reduced basal CBF by 45% and ciliary force by 67%. The apyrase effect on CBF was potentiated by carbenoxolone, a hemichannel inhibitor, and oxidized ATP, an